The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP049101	Escherichia coli strain EC28 chromosome, complete genome	5012525	76643	95484	5012525	integrase	Morganella_phage(30.77%)	23	80805:80821	100951:100967
WP_000230718.1|76643_77087_+	hypothetical protein	NA	A0A1W6JPI4	Morganella_phage	66.4	4.8e-45
WP_000204054.1|77103_77481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072645.1|77484_77967_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A142KB62	Gordonia_phage	43.9	1.5e-28
WP_000594596.1|78939_79638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016231879.1|79788_82509_-	lytic transglycosylase domain-containing protein	NA	A5VW64	Enterobacteria_phage	60.9	7.5e-149
80805:80821	attL	TCATCTCCGGGCTGAGT	NA	NA	NA	NA
WP_072643837.1|82505_83825_-	phage DNA ejection protein	NA	B6SCW4	Bacteriophage	43.2	1.6e-35
WP_000909176.1|83824_84502_-	hypothetical protein	NA	Q2A0B2	Sodalis_phage	71.6	7.0e-56
WP_000420674.1|84495_84957_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	72.2	2.9e-61
WP_001018524.1|84973_85135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001555747.1|85719_88476_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	57.0	3.4e-298
WP_001208878.1|88462_88834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000628967.1|88826_89168_-	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	61.5	2.5e-33
WP_042196814.1|89178_89781_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	36.8	8.8e-26
WP_164699319.1|89773_89995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024675.1|89991_90255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001065738.1|90251_90446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001399727.1|90438_91506_-	ash family protein	NA	A0A1C9IHV9	Salmonella_phage	36.8	8.9e-13
WP_033554327.1|91499_91682_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_072643836.1|91674_92508_-	antA/AntB antirepressor family protein	NA	G9L6G1	Escherichia_phage	46.7	9.0e-21
WP_000412532.1|92520_92952_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	50.3	1.8e-28
WP_001018038.1|92951_93155_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_063101851.1|93261_94212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_028120363.1|94230_95484_-|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	78.1	3.9e-193
100951:100967	attR	ACTCAGCCCGGAGATGA	NA	NA	NA	NA
>prophage 2
NZ_CP049101	Escherichia coli strain EC28 chromosome, complete genome	5012525	1171624	1180374	5012525		Escherichia_phage(71.43%)	7	NA	NA
WP_001279001.1|1171624_1172263_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	2.8e-83
WP_000590411.1|1172259_1173522_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_000847997.1|1173518_1174427_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.5e-117
WP_001296319.1|1174622_1175390_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	9.7e-70
WP_001141293.1|1175440_1176097_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.1	3.3e-50
WP_164699436.1|1176202_1178770_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.7	3.5e-31
WP_001525479.1|1178916_1180374_+	hypothetical protein	NA	A0A0R6PGY7	Moraxella_phage	28.1	5.8e-23
>prophage 3
NZ_CP049101	Escherichia coli strain EC28 chromosome, complete genome	5012525	1520197	1574874	5012525	lysis,terminase,capsid,integrase,portal,holin,tail,head	Enterobacteria_phage(54.69%)	65	1532026:1532047	1573785:1573806
WP_001224626.1|1520197_1520767_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	52.2	7.0e-49
WP_001181153.1|1521516_1522146_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	99.5	2.4e-119
WP_001525246.1|1522464_1523085_+	LuxR family transcriptional regulator	NA	A0A2L1IV08	Escherichia_phage	99.0	1.6e-118
WP_001525245.1|1523109_1531017_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV38	Escherichia_phage	94.3	0.0e+00
WP_001525244.1|1531064_1531595_+	OmpH family outer membrane protein	NA	A0A2L1IV11	Escherichia_phage	97.7	3.3e-85
1532026:1532047	attL	TGATAAATGGTGTCCCCTGCAG	NA	NA	NA	NA
WP_001163428.1|1532120_1532321_-	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_000545733.1|1532378_1532546_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	100.0	1.3e-27
WP_001525242.1|1532618_1532903_-	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	98.9	1.2e-49
WP_000253289.1|1532895_1533180_-	DUF4752 family protein	NA	A5VWB4	Enterobacteria_phage	100.0	3.8e-48
WP_164699343.1|1534825_1534993_-	DUF2737 family protein	NA	K7PJY9	Enterobacterial_phage	96.4	6.6e-24
WP_000753555.1|1535009_1535324_-	hypothetical protein	NA	K7PLT4	Enterobacteria_phage	100.0	1.2e-50
WP_000041326.1|1535335_1535818_-	siphovirus Gp157 family protein	NA	K7P6T5	Enterobacteria_phage	96.9	3.5e-78
WP_032174196.1|1535801_1536713_-	DNA recombinase	NA	K7PKG9	Enterobacteria_phage	99.7	1.7e-169
WP_000604110.1|1536709_1537018_-	hypothetical protein	NA	K7PJM4	Enterobacteria_phage	99.0	3.3e-53
WP_001243355.1|1537102_1537255_-	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000972063.1|1537239_1537374_-	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	100.0	3.1e-16
WP_164699438.1|1537457_1537874_-	hypothetical protein	NA	A0A0U2DAF7	Escherichia_phage	66.4	3.4e-53
WP_164699440.1|1538007_1538208_-	hypothetical protein	NA	A0A088CQ77	Enterobacteria_phage	98.5	4.0e-28
WP_164699316.1|1538207_1538459_-	hypothetical protein	NA	A0A088CPT8	Enterobacteria_phage	92.8	3.8e-39
WP_001525230.1|1538548_1538812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096106239.1|1538820_1539207_-	antitermination protein	NA	A4KWR0	Enterobacteria_phage	100.0	2.4e-53
WP_024220799.1|1539653_1540526_-	hypothetical protein	NA	I6NRL3	Burkholderia_virus	28.4	7.7e-23
WP_001274760.1|1540557_1541271_-	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	100.0	1.8e-131
WP_164699344.1|1541371_1541572_+	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	98.5	1.3e-29
WP_000251073.1|1541690_1541984_+	hypothetical protein	NA	K7P6Y2	Enterobacteria_phage	100.0	2.8e-46
WP_000166961.1|1542016_1542178_+	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_001608293.1|1542164_1542986_+	replication protein	NA	K7PJZ3	Enterobacterial_phage	99.6	2.0e-153
WP_001525220.1|1542982_1544359_+	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	99.3	8.2e-253
WP_000736904.1|1544432_1544873_+	recombination protein NinB	NA	A5VW91	Enterobacteria_phage	100.0	7.0e-81
WP_024186921.1|1544869_1545052_+	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	98.3	2.2e-28
WP_000566998.1|1545048_1545219_+	protein ninF	NA	A0A2I6PIG4	Escherichia_phage	100.0	7.2e-26
WP_001003984.1|1545211_1545934_+	DNA-binding protein	NA	K7P7L0	Enterobacteria_phage	99.6	7.1e-131
WP_000002243.1|1545933_1546224_+	DUF1364 domain-containing protein	NA	K7PKV0	Enterobacteria_phage	100.0	3.4e-52
WP_001008199.1|1546220_1546583_+	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	100.0	9.2e-63
WP_000994516.1|1546579_1546768_+	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_000027549.1|1546764_1547283_+	DUF1133 family protein	NA	A5VW83	Enterobacteria_phage	100.0	9.0e-96
WP_000783734.1|1547879_1548203_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_164699345.1|1548186_1548663_+	glycoside hydrolase family protein	NA	A5VW81	Enterobacteria_phage	99.4	6.4e-88
WP_164699346.1|1548659_1549097_+|lysis	lysis protein	lysis	K7P7F7	Enterobacteria_phage	94.5	5.1e-68
WP_001139680.1|1549084_1549237_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	100.0	1.2e-21
WP_001028468.1|1549438_1549960_+	DNA-binding protein	NA	H6WRZ8	Salmonella_phage	99.4	7.2e-101
WP_000807788.1|1550319_1550562_+	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_000179910.1|1550641_1551067_+	hypothetical protein	NA	Q716H4	Shigella_phage	87.9	1.8e-65
WP_112864989.1|1551063_1552476_+|terminase	PBSX family phage terminase large subunit	terminase	Q716H3	Shigella_phage	99.8	5.8e-278
WP_164699347.1|1552478_1554605_+|portal	portal protein	portal	Q9AYZ9	Salmonella_phage	99.4	0.0e+00
WP_164699348.1|1554618_1555503_+|capsid	phage capsid protein	capsid	Q716H1	Shigella_phage	99.3	2.0e-143
WP_164699349.1|1555514_1556786_+|head	head protein	head	Q716H0	Shigella_phage	99.3	1.6e-239
WP_137500155.1|1556828_1557014_+	hypothetical protein	NA	Q716G9	Shigella_phage	96.7	3.0e-25
WP_000246750.1|1556988_1557471_+	packaged DNA stabilization protein p27	NA	Q716G8	Shigella_phage	100.0	3.8e-88
WP_164699350.1|1557479_1558898_+	hypothetical protein	NA	A5VW69	Enterobacteria_phage	98.3	3.3e-273
WP_089659741.1|1558897_1559599_+|tail	phage tail protein	tail	A0A2D1GLK3	Escherichia_phage	97.9	1.1e-117
WP_164699351.1|1559598_1560054_+	DUF2824 family protein	NA	A5VW67	Enterobacteria_phage	97.4	3.1e-84
WP_164699352.1|1560056_1560752_+	DNA transfer protein	NA	A0A2H4FUQ9	Salmonella_phage	97.8	1.4e-115
WP_164699353.1|1560762_1562112_+	phage DNA ejection protein	NA	Q9AYZ0	Salmonella_phage	98.9	7.3e-246
WP_164699354.1|1562111_1564280_+	DNA transfer protein	NA	Q9AYY9	Salmonella_phage	92.8	0.0e+00
WP_000895335.1|1564280_1564610_-	hypothetical protein	NA	Q9AYY8	Salmonella_phage	99.1	1.7e-52
WP_000136767.1|1564766_1565735_+	hypothetical protein	NA	A9YX09	Burkholderia_phage	48.6	8.5e-71
WP_071653511.1|1566126_1566312_+	hypothetical protein	NA	I6RSG3	Salmonella_phage	96.7	4.3e-08
WP_001036008.1|1566286_1566496_-	hypothetical protein	NA	I6R975	Salmonella_phage	97.1	1.7e-29
WP_001283827.1|1566492_1566744_-	Arc family DNA-binding protein	NA	A5VW59	Enterobacteria_phage	95.1	1.2e-34
WP_000865491.1|1566849_1566990_+	Arc family DNA-binding protein	NA	A0A0M4S6R9	Salmonella_phage	59.1	5.7e-05
WP_097451082.1|1567088_1568012_+	phage antirepressor Ant	NA	A5VW58	Enterobacteria_phage	98.4	4.6e-175
WP_164699355.1|1568112_1571058_+	peptidase S74	NA	A5VW57	Enterobacteria_phage	99.0	0.0e+00
WP_000958692.1|1572472_1573630_-|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.5	1.4e-221
WP_001525186.1|1573941_1574874_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	1.0e-166
1573785:1573806	attR	TGATAAATGGTGTCCCCTGCAG	NA	NA	NA	NA
>prophage 4
NZ_CP049101	Escherichia coli strain EC28 chromosome, complete genome	5012525	1812886	1822329	5012525		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569347.1|1812886_1813813_+	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	2.6e-08
WP_000783109.1|1813817_1814549_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1814529_1814637_-	protein YohO	NA	NA	NA	NA	NA
WP_001240408.1|1814696_1815428_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.5	6.3e-111
WP_001295431.1|1815649_1817335_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1817331_1818051_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_045133108.1|1818097_1818568_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	98.7	1.5e-81
WP_001296231.1|1818608_1819070_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_045133107.1|1819189_1821196_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.2	0.0e+00
WP_001525033.1|1821192_1822329_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	1.9e-162
>prophage 5
NZ_CP049101	Escherichia coli strain EC28 chromosome, complete genome	5012525	2140210	2225622	5012525	tRNA,terminase,capsid,integrase,plate,holin,tail	Escherichia_phage(28.21%)	98	2137757:2137772	2210308:2210323
2137757:2137772	attL	CAGCAGGTCGAGTATG	NA	NA	NA	NA
WP_001531780.1|2140210_2141227_-|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	63.6	1.1e-126
WP_097478861.1|2141195_2141459_-	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	38.0	4.0e-07
WP_000916333.1|2141668_2141851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021560871.1|2141850_2142420_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	50.3	3.6e-37
WP_097478862.1|2142416_2144633_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.8	1.4e-100
WP_097478863.1|2144663_2144993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001296165.1|2145989_2146403_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	49.1	8.7e-09
WP_000360804.1|2146501_2146732_+	transcriptional regulator	NA	H6WRX5	Salmonella_phage	63.2	1.5e-21
WP_097478864.1|2146790_2147267_+	hypothetical protein	NA	H9C162	Pectobacterium_phage	48.6	1.9e-23
WP_097478865.1|2147306_2147531_+	hypothetical protein	NA	H9C163	Pectobacterium_phage	54.1	1.0e-16
WP_097478866.1|2147527_2148538_+	replication protein RepO	NA	A0A067ZIA1	Vibrio_phage	46.7	8.4e-29
WP_097478867.1|2148534_2149926_+	replicative DNA helicase	NA	I6R0N4	Salmonella_phage	45.9	2.4e-103
WP_097478868.1|2149964_2150375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064226336.1|2150376_2150613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033814619.1|2150609_2150921_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	66.7	4.1e-35
WP_059270170.1|2150917_2151142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000466605.1|2151329_2151551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097478869.1|2151823_2152618_+	ORF6N domain-containing protein	NA	A0A2R2Z302	Escherichia_phage	68.3	2.6e-41
WP_001559334.1|2152997_2153693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097755779.1|2153693_2154359_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_097478789.1|2154686_2155586_-	SMEK domain-containing protein	NA	NA	NA	NA	NA
WP_097478788.1|2156119_2157472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097478787.1|2158201_2158750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097478786.1|2159361_2160042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000536919.1|2160203_2160437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097478785.1|2160680_2161322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001025459.1|2161473_2161653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000057009.1|2161730_2162327_+	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	64.6	3.0e-71
WP_021560852.1|2162323_2162617_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	71.6	6.6e-35
WP_097478784.1|2162616_2163288_+	antitermination protein	NA	Q7Y3X2	Yersinia_phage	31.9	3.5e-15
WP_001294589.1|2163400_2163784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000172496.1|2163783_2164056_+|holin	phage holin family protein	holin	A0A0A0YPY6	Escherichia_phage	42.9	9.8e-09
WP_000131873.1|2164055_2164535_+	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	68.8	4.6e-62
WP_000734931.1|2164542_2164737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001531775.1|2164796_2165042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021560849.1|2165410_2165977_+	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	44.0	3.5e-32
WP_021560848.1|2165963_2167826_+|terminase	phage terminase large subunit family protein	terminase	A0A1I9KF19	Aeromonas_phage	53.4	3.7e-192
WP_000203897.1|2167825_2168059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033548729.1|2169629_2170937_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.4	1.4e-105
WP_000206292.1|2170936_2171266_+	hypothetical protein	NA	A0A2R9YJN3	Escherichia_phage	39.5	2.0e-08
WP_001283997.1|2171324_2172359_+|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	56.5	6.6e-106
WP_097478783.1|2172393_2172813_+	DNA-packaging protein	NA	NA	NA	NA	NA
WP_001531773.1|2172809_2173190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000774516.1|2173221_2173902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000015612.1|2173898_2174435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021560844.1|2174415_2175318_+|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_024230605.1|2175320_2175662_+|plate	baseplate assembly protein	plate	D4HTV2	Vibrio_phage	50.5	1.2e-19
WP_021560842.1|2175658_2176579_+	hypothetical protein	NA	D5LGZ3	Escherichia_phage	48.1	4.9e-68
WP_021560841.1|2176581_2177208_+|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	43.0	3.5e-25
WP_164699368.1|2177200_2178412_+|tail	phage tail protein	tail	J9QDX3	Clostridium_phage	35.5	4.8e-15
WP_000626358.1|2178411_2178801_+	hypothetical protein	NA	A0A2H4EXG4	Aeromonas_phage	30.8	9.4e-05
WP_097478780.1|2178797_2180300_+|tail	phage tail protein	tail	R9TMQ0	Vibrio_phage	34.5	2.7e-68
WP_021560838.1|2180317_2180830_+|tail	phage major tail tube protein	tail	NA	NA	NA	NA
WP_000444667.1|2180842_2181124_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_097478779.1|2181232_2182873_+	hypothetical protein	NA	A0A2I7R3J9	Vibrio_phage	29.3	1.2e-19
WP_001531768.1|2182908_2183298_+|tail	phage tail protein	tail	E5FFG4	Burkholderia_phage	37.9	1.0e-14
WP_001531767.1|2183458_2183683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097478778.1|2183686_2184730_+	late control protein	NA	R9TNM7	Vibrio_phage	28.5	1.5e-33
WP_001296152.1|2184896_2185316_+	hypothetical protein	NA	G8C7Q7	Escherichia_phage	68.8	1.8e-49
WP_000847877.1|2185787_2186453_+	UPF0149 family protein YecA	NA	NA	NA	NA	NA
WP_045133236.1|2186503_2187715_-	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000377224.1|2187905_2188145_+	YecH family protein	NA	NA	NA	NA	NA
WP_000917208.1|2188182_2188680_-	non-heme ferritin	NA	NA	NA	NA	NA
WP_001524855.1|2188851_2189175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010723106.1|2189438_2189525_+	stress response protein AzuC	NA	NA	NA	NA	NA
WP_000082125.1|2189639_2189891_+	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_000179469.1|2189968_2190472_-	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000548680.1|2191268_2192258_+	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_001187785.1|2192327_2193842_+	arabinose ABC transporter ATP binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.2	2.1e-12
WP_001527133.1|2193856_2194843_+	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001527131.1|2195009_2195810_+	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_001524853.1|2195784_2197209_+	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_000122412.1|2197215_2197644_-	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001295647.1|2198423_2198774_+	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_001291603.1|2198776_2199355_+	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_000906342.1|2199481_2200369_+	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_000795641.1|2200365_2201292_+	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_072254122.1|2201296_2203261_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000147302.1|2203281_2203785_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001524851.1|2203929_2205591_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_001524849.1|2205881_2206742_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000036385.1|2206744_2207794_+	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000763867.1|2207808_2208198_+	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000983609.1|2208208_2208853_+	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_001524846.1|2209041_2210190_+	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000066972.1|2210182_2212261_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
2210308:2210323	attR	CATACTCGACCTGCTG	NA	NA	NA	NA
WP_001202078.1|2212260_2212653_+	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_001025322.1|2212705_2214439_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.5	3.4e-86
WP_001304291.1|2214654_2215221_+	VOC family protein	NA	NA	NA	NA	NA
WP_001185734.1|2215234_2215981_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001524839.1|2216368_2217469_+	cytochrome c-type protein TorY	NA	NA	NA	NA	NA
WP_001527124.1|2217493_2219923_+	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_000564725.1|2219958_2220930_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_045133239.1|2220926_2221670_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	1.7e-23
WP_000252980.1|2221710_2222106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001524835.1|2222158_2222977_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
WP_000891625.1|2222973_2223540_-	hydrolase	NA	NA	NA	NA	NA
WP_001258676.1|2223849_2225622_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP049101	Escherichia coli strain EC28 chromosome, complete genome	5012525	2644490	2690314	5012525	lysis,capsid,terminase,integrase,tail,head	Enterobacteria_phage(55.26%)	53	2642414:2642429	2688342:2688357
2642414:2642429	attL	ATGATGTACGGTCATG	NA	NA	NA	NA
WP_001295593.1|2644490_2644925_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_120795384.1|2647851_2647965_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836772.1|2648033_2648267_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	4.1e-32
WP_000086519.1|2648583_2649174_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	2.8e-24
WP_000885599.1|2649271_2649847_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	96.9	9.1e-105
WP_071886609.1|2649846_2653377_-	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	37.3	2.5e-11
WP_001233133.1|2653441_2654041_-	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	95.0	1.6e-107
WP_032202219.1|2654108_2657588_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.5	0.0e+00
WP_000090943.1|2657648_2658251_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	84.7	4.0e-87
WP_164699377.1|2658187_2658931_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.3	6.1e-146
WP_001152660.1|2658936_2659635_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	4.0e-131
WP_000847405.1|2659634_2659964_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	94.5	5.4e-54
WP_000840269.1|2659960_2662522_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	94.5	0.0e+00
WP_000459474.1|2662514_2662949_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	90.0	9.0e-57
WP_000479129.1|2662930_2663353_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	91.4	2.7e-66
WP_001351266.1|2663368_2664109_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	3.7e-127
WP_000683145.1|2664116_2664512_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	100.0	1.3e-70
WP_000975062.1|2664508_2665087_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	2.9e-79
WP_001204540.1|2665098_2665452_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	65.0	3.4e-38
WP_000201530.1|2665444_2665819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522649.1|2665870_2666899_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.6	1.0e-114
WP_000256840.1|2666956_2667304_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_001253996.1|2667340_2668846_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.6e-100
WP_000140265.1|2670424_2670706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000835282.1|2670717_2671260_-|terminase	terminase	terminase	O64316	Escherichia_phage	48.8	3.4e-37
WP_001179424.1|2671461_2671845_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000190771.1|2671856_2672198_-|head	head decoration protein	head	NA	NA	NA	NA
WP_000228106.1|2672207_2673248_-|capsid	phage capsid protein	capsid	C6ZCY2	Enterobacteria_phage	42.2	3.0e-66
WP_000126640.1|2673465_2673888_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000161636.1|2673884_2674136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000761841.1|2674483_2676238_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	40.1	7.8e-91
WP_000425299.1|2676234_2676534_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001091146.1|2676551_2676773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001156310.1|2676773_2676965_-	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	59.3	1.1e-11
WP_000920679.1|2676964_2677150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001390072.1|2677142_2677340_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000179580.1|2677530_2677836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001038675.1|2678169_2678748_-	hypothetical protein	NA	A0A1W6JPH8	Morganella_phage	63.0	9.2e-57
WP_029488835.1|2678804_2679062_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000963723.1|2679063_2680305_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	42.9	9.1e-94
WP_000259002.1|2681322_2681529_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001304453.1|2681512_2683441_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.7	3.3e-260
WP_000867568.1|2683412_2683961_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_000881610.1|2684523_2684706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000830178.1|2684912_2685239_-	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_001298464.1|2685719_2686013_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_001228695.1|2686103_2686286_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001135310.1|2686502_2687000_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	96.4	9.3e-90
WP_000839565.1|2686999_2687215_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.3e-32
WP_001348108.1|2687466_2687841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000506936.1|2688012_2688441_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
2688342:2688357	attR	ATGATGTACGGTCATG	NA	NA	NA	NA
WP_000640162.1|2689484_2690027_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	75.7	4.9e-76
WP_000247763.1|2690023_2690314_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.7e-46
>prophage 7
NZ_CP049101	Escherichia coli strain EC28 chromosome, complete genome	5012525	2697041	2715338	5012525	tRNA,integrase	Escherichia_phage(64.71%)	21	2698378:2698391	2712761:2712774
WP_001676522.1|2697041_2699039_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	26.2	3.3e-21
2698378:2698391	attL	GCATTCACCTGCAA	NA	NA	NA	NA
WP_001151151.1|2699379_2699802_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	4.8e-63
WP_001262393.1|2699842_2700913_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.2	4.2e-63
WP_164699378.1|2700984_2701410_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001072337.1|2701406_2701661_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	60.3	2.8e-18
WP_000233320.1|2701740_2702160_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_001169151.1|2702591_2702747_+	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001312793.1|2702743_2703232_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_000560225.1|2703673_2703895_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001352098.1|2703894_2704065_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_164699379.1|2704515_2707116_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.4	2.6e-247
WP_000166319.1|2707108_2707918_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_001317028.1|2707974_2708169_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000276809.1|2708161_2708371_+	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_000079604.1|2708449_2708665_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040852.1|2708666_2709902_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_164699380.1|2709953_2710889_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.1	3.8e-145
WP_001524640.1|2711016_2712390_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	1.1e-52
WP_001296046.1|2712419_2712593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001524638.1|2712867_2713851_-	zinc transporter ZntB	NA	NA	NA	NA	NA
2712761:2712774	attR	GCATTCACCTGCAA	NA	NA	NA	NA
WP_001524637.1|2714105_2715338_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 8
NZ_CP049101	Escherichia coli strain EC28 chromosome, complete genome	5012525	2908238	2953137	5012525	protease,tRNA,lysis,capsid,terminase,integrase,portal,plate,tail,head	Enterobacteria_phage(36.51%)	72	2906357:2906372	2960488:2960503
2906357:2906372	attL	CTGTTTTCCAAAGCTA	NA	NA	NA	NA
WP_095501568.1|2908238_2908430_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	4.4e-24
WP_001526918.1|2909221_2911111_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_032145339.1|2911144_2911372_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	81.2	1.9e-13
WP_001526916.1|2911365_2911752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001526915.1|2911753_2912191_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	66.9	7.2e-46
WP_000639074.1|2912162_2912558_-|tail	tail fiber assembly protein	tail	A0A0M4S6V4	Salmonella_phage	43.5	3.5e-15
WP_104209248.1|2912566_2912974_-|tail	phage tail protein	tail	M1FN94	Enterobacteria_phage	45.9	8.3e-20
WP_001526913.1|2913226_2913811_-	YmfQ family protein	NA	O22003	Shigella_phage	99.5	3.2e-113
WP_023351662.1|2913801_2914860_-|plate	baseplate J/gp47 family protein	plate	U5P424	Shigella_phage	98.9	6.2e-200
WP_000424732.1|2914846_2915272_-	hypothetical protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_001259088.1|2915271_2915820_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	98.4	3.3e-96
WP_045133318.1|2915819_2916899_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.4	2.2e-205
WP_001526910.1|2916895_2918224_-|tail	phage tail/DNA circulation protein	tail	Q8SBG8	Shigella_phage	99.1	2.5e-246
WP_045133317.1|2918284_2920120_-|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	98.9	1.2e-304
WP_001526907.1|2920261_2920531_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	98.9	3.9e-42
WP_001526906.1|2920530_2920887_-|tail	phage tail protein	tail	U5P076	Shigella_phage	99.2	9.0e-63
WP_001526905.1|2920886_2922383_-|tail	phage tail sheath protein	tail	M1FN90	Enterobacteria_phage	97.8	1.4e-269
WP_000497751.1|2922366_2922537_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_001526904.1|2922545_2923106_-	hypothetical protein	NA	Q8SBH4	Shigella_phage	98.4	2.0e-104
WP_001526903.1|2923102_2923609_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	99.4	6.5e-91
WP_000702388.1|2923583_2923994_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	97.8	5.9e-74
WP_000927711.1|2923990_2924314_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_000601363.1|2924316_2924517_-	hypothetical protein	NA	S5FNU1	Shigella_phage	98.5	1.7e-26
WP_001526902.1|2924566_2925772_-|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	99.3	1.2e-223
WP_001193631.1|2925786_2926437_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_001526901.1|2926414_2927656_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.5	7.6e-242
WP_000605606.1|2927655_2927838_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_072011717.1|2927849_2929346_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.8	7.4e-300
WP_000929172.1|2929579_2930074_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	99.4	8.6e-88
WP_001526899.1|2930199_2930550_-	HNH endonuclease	NA	Q8HA82	Salmonella_phage	94.0	7.5e-62
WP_001298464.1|2931074_2931368_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_001228695.1|2931458_2931641_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001135277.1|2931857_2932355_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
WP_000839596.1|2932354_2932570_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737271.1|2933158_2934241_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
WP_001204776.1|2934429_2934813_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	1.5e-55
WP_000971053.1|2934898_2935039_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	3.6e-07
WP_001099712.1|2935035_2935398_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000950951.1|2935417_2935612_-	protein ninF	NA	NA	NA	NA	NA
WP_000386643.1|2935604_2935946_-	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	96.5	1.6e-61
WP_024192700.1|2935948_2936125_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	94.8	6.3e-25
WP_000153286.1|2936121_2936649_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	99.4	4.7e-100
WP_000736913.1|2936645_2937086_-	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_000145927.1|2937159_2937450_-	protein ren	NA	O48423	Enterobacteria_phage	97.9	2.8e-46
WP_000788872.1|2937446_2938148_-	Replication protein 14	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	2.9e-129
WP_000185431.1|2938144_2939044_-	replication protein	NA	K7P7F0	Enterobacteria_phage	99.0	3.5e-172
WP_000442609.1|2939076_2939373_-	hypothetical protein	NA	G9L678	Escherichia_phage	94.9	2.2e-46
WP_000067727.1|2939514_2939730_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_001302016.1|2939806_2940502_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_001062368.1|2940541_2941099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000968518.1|2941095_2941848_+	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_000438342.1|2942124_2942307_+	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	98.3	1.1e-27
WP_000088199.1|2942284_2942557_+	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	98.9	2.8e-40
WP_001066170.1|2942573_2943155_-	superinfection exclusion protein B	NA	K7P6T7	Enterobacteria_phage	92.7	1.4e-92
WP_000213979.1|2943368_2943569_+	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	98.5	7.1e-33
WP_000065374.1|2943751_2944120_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_001198860.1|2944192_2944357_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	100.0	1.4e-26
WP_000372923.1|2944325_2944469_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	97.9	2.7e-18
WP_000995434.1|2944544_2944841_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	1.1e-48
WP_000100847.1|2944846_2945632_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186848.1|2945628_2946309_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000149537.1|2946305_2946488_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.3	1.8e-27
WP_000548516.1|2946460_2946652_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	93.7	1.8e-25
WP_000763374.1|2947038_2947260_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	93.2	2.3e-32
WP_000002139.1|2947259_2947586_+	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	95.7	9.8e-48
WP_000490213.1|2947569_2947809_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.2	4.7e-39
WP_000088653.1|2947948_2948185_+	excisionase	NA	NA	NA	NA	NA
WP_000741335.1|2948174_2949317_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	100.0	3.6e-206
WP_000444487.1|2949430_2950681_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248674.1|2950852_2951506_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|2951515_2951977_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001295972.1|2952030_2953137_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
2960488:2960503	attR	CTGTTTTCCAAAGCTA	NA	NA	NA	NA
>prophage 9
NZ_CP049101	Escherichia coli strain EC28 chromosome, complete genome	5012525	3520295	3572669	5012525	protease,tRNA,lysis,capsid,terminase,integrase,portal,holin,tail,head	Enterobacteria_phage(41.82%)	68	3548931:3548946	3577465:3577480
WP_001201838.1|3520295_3521249_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_000239877.1|3521480_3522149_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001311482.1|3522561_3522861_+|integrase	tyrosine-type recombinase/integrase	integrase	B9UDL9	Salmonella_phage	82.4	1.7e-30
WP_072254160.1|3522898_3523189_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A088CD23	Shigella_phage	83.1	3.8e-35
WP_001201822.1|3523663_3524617_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226381.1|3524803_3526288_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000937500.1|3526471_3526777_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_000742376.1|3526845_3527502_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_071586406.1|3527556_3527655_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	78.1	1.2e-06
WP_000355700.1|3527694_3527988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204581.1|3527997_3528276_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	50.5	6.0e-22
WP_021531100.1|3528272_3530333_-|tail	phage tail fiber protein	tail	A0A1X7QGG5	Escherichia_phage	65.7	4.2e-152
WP_021531099.1|3530397_3530997_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	95.5	1.3e-106
WP_062880614.1|3531064_3534544_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	90.0	0.0e+00
WP_089614625.1|3534604_3535237_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	97.1	8.5e-96
WP_068892106.1|3535173_3535917_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.3e-148
WP_001152612.1|3535922_3536621_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000847345.1|3536620_3536950_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_164699394.1|3536946_3539508_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	90.2	0.0e+00
WP_000459448.1|3539500_3539935_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	98.3	1.3e-63
WP_000479202.1|3539916_3540330_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	93.6	7.0e-67
WP_024210634.1|3540345_3541086_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	99.6	2.3e-132
WP_000683105.1|3541093_3541489_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975070.1|3541485_3542064_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	100.0	2.7e-80
WP_021546026.1|3542075_3542429_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	2.2e-61
WP_000158899.1|3542440_3542836_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	92.4	2.0e-55
WP_000063254.1|3542877_3543903_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.2	2.8e-189
WP_001299443.1|3543958_3544291_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_021546025.1|3544300_3545620_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	6.9e-233
WP_021546024.1|3545600_3547202_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	7.2e-309
WP_000198149.1|3547198_3547405_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_021514143.1|3547401_3549327_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
3548931:3548946	attL	CCAGCGCCAGCAGCGA	NA	NA	NA	NA
WP_061089094.1|3549301_3549847_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_000881608.1|3550411_3550594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000830178.1|3550800_3551127_-	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_000738425.1|3551607_3551901_+	increased serum survival lipoprotein Iss	NA	C6ZCX3	Enterobacteria_phage	91.8	1.6e-44
WP_077877966.1|3551991_3552174_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	96.7	6.5e-17
WP_000992182.1|3552390_3552924_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	94.4	2.6e-98
WP_000370548.1|3553029_3553302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000250557.1|3553267_3553612_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	90.5	3.5e-35
WP_000284486.1|3553616_3553832_-|holin	holin	holin	M1FN85	Enterobacteria_phage	95.8	1.0e-32
WP_000502162.1|3553854_3554046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021546022.1|3554925_3555987_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	97.4	1.3e-202
WP_001317671.1|3556136_3556331_-	hypothetical protein	NA	Q8SBE3	Shigella_phage	95.3	5.7e-27
WP_000966854.1|3556512_3557043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047122.1|3557197_3557950_-	antitermination protein	NA	Q8SBE4	Shigella_phage	97.6	8.4e-135
WP_001535863.1|3557963_3558953_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.8	1.4e-193
WP_001061427.1|3558960_3559803_-	KilA-N domain-containing protein	NA	S5MC03	Escherichia_phage	91.5	1.1e-138
WP_000767127.1|3559822_3560212_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	1.6e-68
WP_000210176.1|3560208_3560535_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	97.2	2.3e-52
WP_001573323.1|3560534_3561029_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	97.5	6.2e-86
WP_021546021.1|3561025_3561967_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	98.7	9.5e-152
WP_001250269.1|3561956_3562136_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515847.1|3562311_3562863_-	hypothetical protein	NA	S5FXP0	Shigella_phage	98.4	2.9e-100
WP_001191674.1|3562855_3563116_-	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
WP_001020634.1|3563213_3563906_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	100.0	1.0e-126
WP_000559922.1|3564225_3564741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000135680.1|3565211_3565574_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081287.1|3565639_3566464_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000008165.1|3566591_3567128_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	4.8e-100
WP_001242707.1|3567118_3567481_+	phage protein	NA	K7PH61	Enterobacteria_phage	98.3	4.4e-65
WP_000206812.1|3567480_3567786_+	hypothetical protein	NA	U5P0J0	Shigella_phage	95.0	9.2e-48
WP_000433951.1|3567785_3568157_+	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	80.2	1.0e-45
WP_001624790.1|3568012_3569176_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	5.2e-200
WP_000729155.1|3569538_3570405_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000190282.1|3570406_3570619_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001143516.1|3570726_3571248_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000912352.1|3571283_3572669_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
3577465:3577480	attR	CCAGCGCCAGCAGCGA	NA	NA	NA	NA
>prophage 10
NZ_CP049101	Escherichia coli strain EC28 chromosome, complete genome	5012525	4133228	4212261	5012525	tRNA,capsid,terminase,integrase,portal,holin,tail,head	Enterobacteria_phage(36.67%)	92	4154084:4154099	4219556:4219571
WP_001223184.1|4133228_4133915_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001295754.1|4134314_4134455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001194358.1|4134550_4135267_+	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_000920358.1|4135326_4136679_-	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_001523910.1|4136736_4138161_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.9	4.2e-10
WP_001188689.1|4138160_4138850_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
WP_000875487.1|4138862_4139336_-	protein CreA	NA	NA	NA	NA	NA
WP_000371666.1|4139546_4140416_+	MDR efflux pump AcrAB transcriptional activator RobA	NA	NA	NA	NA	NA
WP_000942350.1|4140412_4141060_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_001339518.1|4141111_4141639_+	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_024193365.1|4141711_4142038_-	trp operon repressor	NA	NA	NA	NA	NA
WP_000409419.1|4142127_4144065_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000046754.1|4144271_4145939_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	27.7	1.0e-39
WP_000093834.1|4146059_4147292_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	2.1e-82
WP_001029698.1|4147312_4148695_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_001523907.1|4148743_4149712_-	phosphoserine phosphatase	NA	NA	NA	NA	NA
WP_000124608.1|4149817_4150462_+	YtjB family periplasmic protein	NA	NA	NA	NA	NA
WP_001523905.1|4150489_4151506_+	lipoate--protein ligase LplA	NA	NA	NA	NA	NA
WP_000566145.1|4151537_4151801_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000224879.1|4151961_4152681_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_000816460.1|4152737_4153961_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_000477822.1|4154012_4155335_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	4.0e-79
4154084:4154099	attL	TCACCGCTTTCGCCGC	NA	NA	NA	NA
WP_001295412.1|4155412_4156192_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_001143234.1|4156449_4158000_+	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
WP_024186950.1|4157971_4158835_+	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
WP_000563043.1|4159051_4159831_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_001298490.1|4159827_4160901_-	patatin family protein	NA	NA	NA	NA	NA
WP_000490275.1|4161022_4161184_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001385192.1|4161310_4161916_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000202563.1|4162308_4163895_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
WP_001217539.1|4164114_4164363_+	DinI family protein	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
WP_122990060.1|4164789_4164903_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	77.8	1.1e-06
WP_000839978.1|4164971_4165205_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	1.9e-32
WP_000086527.1|4165585_4166176_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_001306187.1|4166403_4166697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001306186.1|4166739_4167780_-|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	67.6	6.4e-125
WP_000654169.1|4167789_4168071_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	48.9	9.1e-18
WP_001560746.1|4168070_4170446_-|tail	phage tail fiber protein	tail	A0A1X7QGG5	Escherichia_phage	69.5	4.3e-169
WP_001228249.1|4170510_4171110_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	92.0	1.5e-102
WP_000515333.1|4171177_4174657_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	88.9	0.0e+00
WP_000090890.1|4174717_4175350_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	2.2e-96
WP_001306182.1|4175286_4176030_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.3	3.0e-145
WP_001152461.1|4176034_4176733_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.0	1.2e-130
WP_000847355.1|4176732_4177062_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	96.3	1.5e-56
WP_164699410.1|4177058_4179620_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	88.6	0.0e+00
WP_000459448.1|4179612_4180047_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	98.3	1.3e-63
WP_000479202.1|4180028_4180442_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	93.6	7.0e-67
WP_001306179.1|4180457_4181198_-|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	99.6	7.8e-133
WP_000683151.1|4181205_4181601_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	1.4e-69
WP_000975067.1|4181597_4182176_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	3.5e-80
WP_001204538.1|4182186_4182540_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	66.7	3.1e-39
WP_000201526.1|4182532_4182907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164699411.1|4182958_4183987_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	1.9e-113
WP_000256840.1|4184044_4184392_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_001253996.1|4184428_4185934_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.6e-100
WP_001306178.1|4185923_4187516_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	1.9e-184
WP_000259002.1|4187512_4187719_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001306177.1|4187702_4189631_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	3.3e-260
WP_001519435.1|4189602_4190109_-	hypothetical protein	NA	O64316	Escherichia_phage	48.5	3.3e-34
WP_001300120.1|4190536_4190731_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_000548592.1|4190981_4191188_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
WP_001019207.1|4191483_4191657_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001443523.1|4191829_4191985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071528545.1|4192132_4192321_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|4192331_4192544_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071778.1|4192908_4193406_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_001101173.1|4193402_4193936_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.8	1.4e-96
WP_001306174.1|4194049_4194310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000193256.1|4194257_4194809_-	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	50.6	1.1e-35
WP_000839580.1|4194813_4195029_-|holin	holin	holin	A5LH82	Enterobacteria_phage	93.0	1.9e-31
WP_000066486.1|4195781_4195997_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	75.0	5.9e-25
WP_000087755.1|4196296_4196509_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_122632654.1|4196563_4196653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023148371.1|4196931_4197684_-	antitermination protein	NA	Q8SBE4	Shigella_phage	98.0	1.7e-135
WP_001519432.1|4197697_4198687_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	4.3e-195
WP_001072669.1|4198694_4199510_-	KilA-N domain-containing protein	NA	U5P4K5	Shigella_phage	99.3	8.5e-149
WP_000767110.1|4199672_4200068_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	98.4	5.7e-66
WP_000210181.1|4200064_4200391_-	LexA family transcriptional regulator	NA	U5P451	Shigella_phage	100.0	9.2e-54
WP_001401088.1|4200387_4201041_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	3.3e-127
WP_001332382.1|4201040_4201535_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	99.4	1.9e-87
WP_164699412.1|4201531_4202350_-	helix-turn-helix domain-containing protein	NA	Q8SBF1	Shigella_phage	94.9	5.6e-116
WP_015364394.1|4202346_4202571_-	hypothetical protein	NA	A0A291AX25	Escherichia_phage	91.9	1.2e-33
WP_058905682.1|4202575_4203412_-	ash family protein	NA	Q8SBF3	Shigella_phage	98.9	2.3e-149
WP_000515860.1|4203408_4203960_-	hypothetical protein	NA	Q8SBF4	Shigella_phage	100.0	7.6e-101
WP_000649477.1|4204003_4204204_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000859460.1|4204294_4204969_+	LexA family transcriptional regulator	NA	Q8SBF6	Shigella_phage	99.1	1.7e-131
WP_000135680.1|4205637_4206000_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_063628492.1|4206065_4206890_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.3	6.6e-149
WP_164699413.1|4207017_4207554_+	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	97.2	1.2e-98
WP_041124190.1|4207907_4208528_+	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	91.3	2.2e-112
WP_088129574.1|4209262_4210870_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_061066749.1|4211022_4212261_-|integrase	site-specific integrase	integrase	A5LH57	Enterobacteria_phage	98.3	1.0e-233
4219556:4219571	attR	TCACCGCTTTCGCCGC	NA	NA	NA	NA
>prophage 1
NZ_CP049102	Escherichia coli strain EC28 plasmid p2, complete sequence	168051	1262	80455	168051	transposase,integrase,protease	Enterobacteria_phage(22.73%)	52	NA	NA
WP_001066954.1|1262_2003_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.2e-24
WP_001324033.1|2123_2312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000175738.1|2685_3594_-	antimicrobial resistance protein Mig-14	NA	NA	NA	NA	NA
WP_000771475.1|3656_4766_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_000280980.1|5198_6152_-|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_001324039.1|7424_7583_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000928804.1|10419_11607_+	efflux RND transporter periplasmic adaptor subunit	NA	A0A140XAI1	Dickeya_phage	55.7	1.0e-09
WP_000733250.1|11603_13544_+	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	39.0	1.8e-35
WP_001312828.1|13547_14918_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_000974762.1|15714_16656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450494.1|18916_20110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000169527.1|22141_22441_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_015918726.1|22437_23304_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	1.8e-51
WP_000738422.1|24465_24759_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_001318220.1|27904_29020_+	salmochelin biosynthesis C-glycosyltransferase IroB	NA	NA	NA	NA	NA
WP_001389363.1|29159_32819_+	salmochelin/enterobactin export ABC transporter IroC	NA	W8CYL7	Bacillus_phage	29.8	3.6e-45
WP_000933678.1|32922_34152_+	catecholate siderophore esterase IroD	NA	NA	NA	NA	NA
WP_000271274.1|34236_35193_+	catecholate siderophore esterase IroE	NA	NA	NA	NA	NA
WP_001222185.1|35237_37415_-	siderophore salmochelin receptor IroN	NA	A0A0P0I887	Acinetobacter_phage	31.8	9.6e-06
WP_001190234.1|38280_39315_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	44.0	1.9e-73
WP_000377483.1|39874_40183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000969988.1|40281_40464_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001324224.1|40460_40658_-	toxin-antitoxin system protein	NA	NA	NA	NA	NA
WP_001324221.1|41372_42614_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_001183604.1|42588_44703_+	microcin H47 export transporter peptidase/ATP-binding subunit MchF	NA	W8CYL7	Bacillus_phage	26.5	3.6e-34
WP_001259758.1|44872_45184_-	colicin V	NA	NA	NA	NA	NA
WP_001323890.1|45161_45398_-	colicin V immunity protein	NA	NA	NA	NA	NA
WP_000379710.1|46337_46607_+	membrane protein	NA	NA	NA	NA	NA
WP_001017346.1|46603_47584_+	NAD(P)-binding domain-containing protein	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	41.5	3.3e-06
WP_001171523.1|47659_48040_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|48036_48384_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001553770.1|50263_50716_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	39.4	9.2e-12
WP_079399109.1|50824_54958_-|protease	hemoglobin-binding protease autotransporter Hbp	protease	Q9LA54	Enterobacteria_phage	41.6	5.2e-295
WP_001442799.1|55923_57075_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000124098.1|57196_57562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001553768.1|58857_59202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001347516.1|59293_59434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001351729.1|61814_62207_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000058717.1|62344_63229_+	EamA family transporter	NA	NA	NA	NA	NA
WP_000804064.1|63260_64460_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000164043.1|64565_65216_+	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000844627.1|65247_65490_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001067855.1|67127_67832_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001138070.1|68202_71169_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.9	0.0e+00
WP_000427619.1|71247_72252_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_000954592.1|72433_72610_-	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_001043260.1|72939_73755_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_001082320.1|73815_74619_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000480972.1|74618_75455_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_000027057.1|75685_76546_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001235713.1|76728_77286_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_001143760.1|77449_80455_+|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
