The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP049088	Glaesserella parasuis strain sHPS7 chromosome, complete genome	2276207	561	50055	2276207	integrase,plate,tail,protease,transposase	Haemophilus_phage(38.71%)	56	17579:17602	33563:33586
WP_035520377.1|561_930_-	hypothetical protein	NA	F6MIJ4	Haemophilus_phage	96.7	4.6e-62
WP_005711955.1|1493_1805_-	hypothetical protein	NA	F6MIJ3	Haemophilus_phage	92.2	1.6e-47
WP_164681528.1|1819_1996_-	hypothetical protein	NA	F6MIJ2	Haemophilus_phage	94.8	2.0e-23
WP_005711957.1|2099_2621_-	host-nuclease inhibitor protein Gam	NA	F6MIJ0	Haemophilus_phage	98.8	4.4e-90
WP_021118241.1|2632_2926_-	hypothetical protein	NA	F6MII9	Haemophilus_phage	95.9	2.3e-48
WP_005711959.1|2927_3119_-	hypothetical protein	NA	F6MII8	Haemophilus_phage	100.0	3.9e-28
WP_021118242.1|3126_4008_-	AAA family ATPase	NA	F6MII7	Haemophilus_phage	99.7	1.4e-160
WP_021118243.1|4091_4514_-	hypothetical protein	NA	F6MII6	Haemophilus_phage	99.3	2.6e-69
WP_021118244.1|4523_6500_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	F6MII5	Haemophilus_phage	94.8	0.0e+00
WP_021115413.1|6544_6823_-	DNA-binding Ner domain protein	NA	F6MII4	Haemophilus_phage	58.8	1.5e-17
WP_021118245.1|6999_7710_+	helix-turn-helix transcriptional regulator	NA	F6MII3	Haemophilus_phage	62.4	5.4e-67
WP_164681529.1|8103_8949_+	hypothetical protein	NA	Q19UR0	Mannheimia_phage	46.7	8.2e-54
WP_021118247.1|9043_9241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021118248.1|9221_9596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021118249.1|9709_9907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021118250.1|10032_10608_+|plate	phage baseplate assembly protein V	plate	A0A0M3LPY9	Mannheimia_phage	60.6	3.2e-41
WP_021110844.1|10604_10946_+	lysozyme family protein	NA	A0A0M3LQ08	Mannheimia_phage	66.7	8.2e-29
WP_021118251.1|10942_11857_+|plate	baseplate assembly protein	plate	Q19UQ5	Mannheimia_phage	67.1	1.8e-110
WP_021118252.1|11846_12386_+|tail	phage tail protein I	tail	Q19UQ4	Mannheimia_phage	55.2	1.4e-51
WP_164681530.1|14905_15469_+	DUF4376 domain-containing protein	NA	F6MIL9	Haemophilus_phage	92.9	9.8e-96
WP_021113064.1|15455_15725_+	hypothetical protein	NA	A0A0M3LNN9	Mannheimia_phage	83.5	9.9e-38
WP_164681531.1|15828_16998_+|tail	phage tail sheath protein	tail	E5E3Q3	Burkholderia_phage	56.7	1.2e-127
WP_021113117.1|17053_17563_+|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	53.5	1.0e-43
17579:17602	attL	CGGACACACGCAGTGTGTCCCTAC	NA	NA	NA	NA
WP_042905885.1|17614_17950_+|tail	phage tail assembly protein	tail	A4PE51	Ralstonia_virus	51.2	1.1e-12
WP_071610269.1|17958_18078_+|tail	GpE family phage tail protein	tail	E5E3Q0	Burkholderia_phage	61.5	1.3e-05
WP_164681532.1|18154_18592_+|tail	phage tail protein	tail	A0A0M3LQ18	Mannheimia_phage	61.4	1.1e-46
WP_164681533.1|18588_19737_+	phage late control D family protein	NA	R9QBT3	Mannheimia_phage	66.7	1.7e-142
WP_043894459.1|21043_21700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164681534.1|21757_22093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164681535.1|23272_23695_-	helix-turn-helix domain-containing protein	NA	Q6QID2	Burkholderia_phage	37.8	2.0e-08
WP_021110860.1|23820_24015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164681536.1|24011_24554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035524138.1|24749_25142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164681537.1|25336_25609_+	hypothetical protein	NA	Q19UN6	Mannheimia_phage	70.7	9.4e-28
WP_075604531.1|25687_26008_+	hypothetical protein	NA	Q19UT2	Mannheimia_phage	40.4	7.7e-05
WP_075606055.1|26017_26332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164681538.1|26457_26673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164681539.1|26647_29071_+	replication endonuclease	NA	Q1I108	Pasteurella_virus	49.4	4.3e-164
WP_164681540.1|29057_29447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051611646.1|29455_29944_+	ash family protein	NA	NA	NA	NA	NA
WP_035524154.1|29936_30263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021110872.1|30349_30607_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_164681541.1|30644_31862_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	34.7	1.0e-57
WP_164681542.1|32307_33540_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_012621765.1|33675_34299_-	MarC family protein	NA	NA	NA	NA	NA
33563:33586	attR	GTAGGGACACACTGCGTGTGTCCG	NA	NA	NA	NA
WP_164681543.1|34378_36292_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	30.4	5.0e-67
WP_164681816.1|37307_39236_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G9E4U6	Ostreococcus_lucimarinus_virus	43.4	5.3e-117
WP_160421926.1|39309_39936_-	23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE	NA	NA	NA	NA	NA
WP_005714049.1|40248_41037_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_164681544.1|44645_45362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016527812.1|45640_46288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035519505.1|46304_47078_-	PD-(D/E)XK nuclease family protein	NA	NA	NA	NA	NA
WP_164681545.1|47153_48116_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_016527809.1|48172_48469_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005714197.1|48471_48816_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_164681546.1|48957_50055_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP049088	Glaesserella parasuis strain sHPS7 chromosome, complete genome	2276207	112564	122328	2276207	tRNA	Ostreococcus_lucimarinus_virus(12.5%)	9	NA	NA
WP_021118346.1|112564_113827_-	inorganic phosphate transporter	NA	E5ES24	Ostreococcus_lucimarinus_virus	36.0	3.0e-60
WP_005714552.1|113846_114527_-	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_012621869.1|114836_115820_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.0	7.1e-33
WP_021118347.1|115975_118363_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	29.9	1.4e-05
WP_005710633.1|118379_118676_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	7.9e-12
WP_005710634.1|118728_119241_+	endopeptidase	NA	A0A0K2SUC1	Clostridium_phage	39.1	7.0e-16
WP_010786629.1|119428_120082_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	37.0	1.1e-34
WP_005710639.1|120098_120683_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	40.5	2.2e-29
WP_021118348.1|120813_122328_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	39.2	1.8e-80
>prophage 3
NZ_CP049088	Glaesserella parasuis strain sHPS7 chromosome, complete genome	2276207	364342	459512	2276207	portal,integrase,tRNA,terminase,tail,plate,transposase,capsid,head	Haemophilus_phage(70.15%)	96	357222:357237	463727:463742
357222:357237	attL	AATCAAACCGCTTGAG	NA	NA	NA	NA
WP_021118245.1|364342_365053_-	helix-turn-helix transcriptional regulator	NA	F6MII3	Haemophilus_phage	62.4	5.4e-67
WP_021115413.1|365229_365508_+	DNA-binding Ner domain protein	NA	F6MII4	Haemophilus_phage	58.8	1.5e-17
WP_021118244.1|365552_367529_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	F6MII5	Haemophilus_phage	94.8	0.0e+00
WP_021118243.1|367538_367961_+	hypothetical protein	NA	F6MII6	Haemophilus_phage	99.3	2.6e-69
WP_021118242.1|368044_368926_+	AAA family ATPase	NA	F6MII7	Haemophilus_phage	99.7	1.4e-160
WP_005711959.1|368933_369125_+	hypothetical protein	NA	F6MII8	Haemophilus_phage	100.0	3.9e-28
WP_021118241.1|369126_369420_+	hypothetical protein	NA	F6MII9	Haemophilus_phage	95.9	2.3e-48
WP_005711957.1|369431_369953_+	host-nuclease inhibitor protein Gam	NA	F6MIJ0	Haemophilus_phage	98.8	4.4e-90
WP_164681528.1|370056_370233_+	hypothetical protein	NA	F6MIJ2	Haemophilus_phage	94.8	2.0e-23
WP_005711955.1|370247_370559_+	hypothetical protein	NA	F6MIJ3	Haemophilus_phage	92.2	1.6e-47
WP_021118240.1|370551_371112_+	DUF5420 family protein	NA	A0A0M3LP85	Mannheimia_phage	38.0	3.1e-25
WP_035520377.1|371122_371491_+	hypothetical protein	NA	F6MIJ4	Haemophilus_phage	96.7	4.6e-62
WP_021118239.1|371658_372222_+	hypothetical protein	NA	F6MIJ5	Haemophilus_phage	96.8	9.5e-99
WP_021118238.1|372202_372625_+	regulatory protein GemA	NA	F6MIJ6	Haemophilus_phage	98.6	3.0e-73
WP_016528529.1|372726_373170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005711943.1|373363_373789_+	hypothetical protein	NA	F6MIJ8	Haemophilus_phage	100.0	1.1e-75
WP_005711942.1|373867_374410_+	N-acetylmuramoyl-L-alanine amidase	NA	F6MIJ9	Haemophilus_phage	99.4	2.9e-105
WP_005711941.1|374465_374696_+	DUF2644 domain-containing protein	NA	F6MIK0	Haemophilus_phage	100.0	1.1e-34
WP_021118237.1|374692_375046_+	DUF2681 domain-containing protein	NA	F6MIK1	Haemophilus_phage	90.6	2.5e-49
WP_016528482.1|375057_375216_+	hypothetical protein	NA	F6MIK3	Haemophilus_phage	86.5	3.0e-18
WP_005711935.1|375208_375469_+	hypothetical protein	NA	F6MIK4	Haemophilus_phage	92.7	2.4e-12
WP_016528480.1|375465_375720_+	hypothetical protein	NA	F6MIK5	Haemophilus_phage	97.6	4.7e-21
WP_021118236.1|375720_376230_+	DUF1804 family protein	NA	F6MIK6	Haemophilus_phage	98.2	3.4e-87
WP_021118235.1|376332_377949_+|terminase	phage terminase large subunit	terminase	B7SDN0	Haemophilus_phage	98.5	0.0e+00
WP_021118234.1|378039_379665_+	DUF935 domain-containing protein	NA	B7SDN1	Haemophilus_phage	96.6	2.7e-311
WP_021118233.1|379651_380920_+|capsid	minor capsid protein	capsid	B7SDN5	Haemophilus_phage	79.9	1.0e-193
WP_021118232.1|381071_381488_+	phage virion morphogenesis protein	NA	B7SDN8	Haemophilus_phage	98.6	9.5e-72
WP_035498568.1|381727_382804_+	hypothetical protein	NA	B7SDN9	Haemophilus_phage	98.6	1.1e-196
WP_016057771.1|382803_383727_+	hypothetical protein	NA	B7SDP1	Haemophilus_phage	100.0	3.5e-175
WP_021118231.1|383782_384136_+	hypothetical protein	NA	B7SDP3	Haemophilus_phage	94.9	4.9e-53
WP_021118230.1|384138_384615_+	DUF1320 domain-containing protein	NA	B7SDP4	Haemophilus_phage	99.4	1.8e-82
WP_021118229.1|384611_385259_+	DUF1834 family protein	NA	B7SDP5	Haemophilus_phage	92.0	1.0e-104
WP_164681818.1|385254_385428_+	DUF2635 domain-containing protein	NA	B7SDP7	Haemophilus_phage	93.0	2.6e-23
WP_021118227.1|385439_386849_+|tail	phage tail sheath family protein	tail	B7SDP8	Haemophilus_phage	99.6	3.1e-255
WP_021118226.1|386858_387233_+|tail	phage tail tube family protein	tail	F6MIK8	Haemophilus_phage	97.6	1.1e-61
WP_021118225.1|387232_387592_+	hypothetical protein	NA	F6MIK9	Haemophilus_phage	79.8	3.8e-45
WP_043896409.1|387621_387816_+	hypothetical protein	NA	F6MIL0	Haemophilus_phage	93.8	2.5e-19
WP_021118223.1|387862_390178_+|tail	phage-related minor tail family protein	tail	F6MIL1	Haemophilus_phage	78.7	1.6e-301
WP_021118222.1|390178_391534_+	DNA circulation family protein	NA	F6MIL2	Haemophilus_phage	94.7	2.5e-246
WP_021118221.1|391538_392663_+|tail	phage tail protein	tail	F6MIL3	Haemophilus_phage	97.6	4.2e-199
WP_005711896.1|392659_393310_+|plate	phage baseplate assembly protein V	plate	F6MIL4	Haemophilus_phage	86.1	2.5e-95
WP_021115447.1|393415_393766_+	mu bacteriophage protein gp46	NA	F6MIL5	Haemophilus_phage	99.1	1.2e-59
WP_021118220.1|393777_394839_+|plate	baseplate J/gp47 family protein	plate	F6MIL6	Haemophilus_phage	96.6	7.6e-190
WP_043896408.1|394835_395414_+	DUF2313 domain-containing protein	NA	F6MIL7	Haemophilus_phage	95.8	2.4e-105
WP_021118217.1|397496_398054_+	DUF4376 domain-containing protein	NA	F6MIL9	Haemophilus_phage	92.4	4.4e-96
WP_043896411.1|398355_398721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021118215.1|398713_399181_+	hypothetical protein	NA	F6MIM0	Haemophilus_phage	97.4	5.7e-89
WP_016057790.1|399330_399444_+	Com family DNA-binding transcriptional regulator	NA	F6MIM1	Haemophilus_phage	100.0	9.2e-14
WP_021118214.1|399547_400333_+	hypothetical protein	NA	F6MIM2	Haemophilus_phage	98.9	1.8e-151
WP_021115457.1|400373_400634_-	hypothetical protein	NA	F6MIM3	Haemophilus_phage	98.8	2.4e-41
WP_021118212.1|402677_402932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021118209.1|403419_403896_-|tail	phage tail protein	tail	Q19UR3	Mannheimia_phage	52.3	7.1e-39
WP_021118208.1|403892_404111_-	TraR/DksA family transcriptional regulator	NA	A0A0M3LS11	Mannheimia_phage	72.6	1.1e-21
WP_021110837.1|404226_404679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021110836.1|404656_404824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021110835.1|405032_405500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021118207.1|405484_406009_-	lysozyme	NA	A0A0M3LQY4	Mannheimia_phage	57.9	6.9e-51
WP_043896158.1|405992_406214_-	hypothetical protein	NA	Q19UR7	Mannheimia_phage	45.6	1.3e-06
WP_021115823.1|406219_406426_-	phage Tail protein X family protein	NA	A0A0M3LPY0	Mannheimia_phage	59.7	8.4e-13
WP_021113125.1|406425_406902_-|head	head completion/stabilization protein	head	A0A0M3LNL8	Mannheimia_phage	53.9	7.1e-39
WP_021113131.1|407018_407672_-|terminase	phage small terminase subunit	terminase	A4JWP8	Burkholderia_virus	42.5	3.4e-39
WP_021118204.1|407671_408721_-|capsid	phage major capsid protein, P2 family	capsid	A4PE30	Ralstonia_virus	51.6	2.9e-93
WP_021118203.1|408733_409549_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0M3LSA0	Mannheimia_phage	44.5	3.7e-51
WP_043896407.1|409716_411495_+|terminase	terminase	terminase	A0A0M3LRV4	Mannheimia_phage	66.1	5.3e-220
WP_021113086.1|411502_412474_+|portal	phage portal protein	portal	Q19UT6	Mannheimia_phage	61.0	1.1e-115
WP_021118201.1|413044_413815_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_021118200.1|413941_415945_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_021118199.1|416461_417610_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.5	5.6e-130
WP_164681584.1|418144_422431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005711610.1|422763_423474_-	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_005711608.1|423541_424051_-	peptidyl-prolyl cis-trans isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	32.5	4.0e-11
WP_021118976.1|424144_425239_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_005711605.1|425345_426311_-	asparaginase	NA	NA	NA	NA	NA
WP_005711603.1|426311_426806_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_160413873.1|427187_429845_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_082259292.1|429994_431899_+	pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_005711597.1|432016_433441_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.5	2.4e-42
WP_164681585.1|433571_435881_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_164681819.1|436062_436602_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_021118971.1|436565_436925_-	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_021113580.1|437175_438069_+	DMT family transporter	NA	NA	NA	NA	NA
WP_164681586.1|438072_438780_+	DUF218 domain-containing protein	NA	NA	NA	NA	NA
WP_021113578.1|438877_439450_+	Der GTPase-activating protein YihI	NA	NA	NA	NA	NA
WP_021110807.1|439455_439905_+	DUF2489 domain-containing protein	NA	NA	NA	NA	NA
WP_164681587.1|439907_441275_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_035494752.1|441342_443676_+	LPS assembly protein LptD	NA	NA	NA	NA	NA
WP_160444212.1|443761_445996_+	response regulator	NA	A0A1V0SGX0	Hokovirus	30.0	1.9e-41
WP_005711576.1|446153_446516_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_160414602.1|446562_448209_+	bifunctional UDP-sugar hydrolase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_164681588.1|450782_452576_+	ABC transporter ATP-binding protein/permease	NA	A0A1V0SE00	Indivirus	25.7	9.4e-07
WP_021112352.1|452599_452917_-	XRE family transcriptional regulator	NA	A0A1S5R3V5	Pseudomonas_phage	44.7	2.3e-09
WP_043896398.1|452913_453255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021118188.1|453591_455721_+	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_021118187.1|455794_456721_+	lipoprotein NlpI	NA	NA	NA	NA	NA
WP_021118186.1|457045_458878_+	DEAD/DEAH box helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	34.0	1.9e-55
WP_043895712.1|458975_459512_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	A0A0B5J096	Pandoravirus	31.2	6.9e-06
463727:463742	attR	AATCAAACCGCTTGAG	NA	NA	NA	NA
>prophage 4
NZ_CP049088	Glaesserella parasuis strain sHPS7 chromosome, complete genome	2276207	540106	556639	2276207	tail	Mannheimia_phage(94.12%)	18	NA	NA
WP_035491741.1|540106_540403_-	hypothetical protein	NA	A0A0M3LR47	Mannheimia_phage	50.0	6.7e-19
WP_164681597.1|540480_545706_-	DUF1983 domain-containing protein	NA	A0A0M3LQ61	Mannheimia_phage	33.2	9.9e-166
WP_021113607.1|545764_545941_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	63.2	8.5e-14
WP_021113608.1|545987_546401_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0R6PH90	Moraxella_phage	53.7	7.1e-35
WP_164681598.1|546397_547135_-|tail	phage minor tail protein L	tail	A0A0M3LSQ5	Mannheimia_phage	54.5	7.9e-69
WP_021118485.1|547144_550408_-	tape measure protein	NA	A0A0M3LS69	Mannheimia_phage	36.8	2.6e-156
WP_021118484.1|550482_550743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021118483.1|550796_551123_-|tail	phage tail protein	tail	A0A0M3LQW6	Mannheimia_phage	66.4	1.3e-39
WP_021118482.1|551124_551460_-	hypothetical protein	NA	A0A0M3LQT0	Mannheimia_phage	65.4	5.9e-32
WP_021118481.1|551468_551873_-	hypothetical protein	NA	A0A0M3LPJ3	Mannheimia_phage	60.4	2.3e-38
WP_021118480.1|551888_552893_-	hypothetical protein	NA	A0A0M3LQ19	Mannheimia_phage	72.2	3.3e-134
WP_021118479.1|552895_553297_-	hypothetical protein	NA	A0A0M3LQB6	Mannheimia_phage	50.8	1.7e-33
WP_021118478.1|553296_553710_-	HK97 gp10 family phage protein	NA	A0A0M3LPJ5	Mannheimia_phage	61.0	3.5e-42
WP_021118477.1|553702_554083_-	hypothetical protein	NA	A0A0M3LT14	Mannheimia_phage	48.4	6.8e-24
WP_021118476.1|554085_554547_-	hypothetical protein	NA	A0A0M3LSP7	Mannheimia_phage	56.6	1.4e-34
WP_021118475.1|554521_554872_-	heH/LEM domain protein	NA	A0A0M3LS62	Mannheimia_phage	46.3	2.4e-20
WP_021118474.1|554925_555876_-	hypothetical protein	NA	A0A0M3LQL5	Mannheimia_phage	74.1	2.0e-133
WP_021118473.1|555904_556639_-	hypothetical protein	NA	A0A0M3LQV7	Mannheimia_phage	72.7	3.0e-84
>prophage 5
NZ_CP049088	Glaesserella parasuis strain sHPS7 chromosome, complete genome	2276207	559841	573063	2276207	terminase	Mannheimia_phage(68.42%)	24	NA	NA
WP_164681599.1|559841_561077_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0M3LTA2	Mannheimia_phage	79.5	1.2e-194
WP_021118468.1|561060_561576_-|terminase	terminase small subunit	terminase	A0A0M3LPC3	Mannheimia_phage	69.7	3.5e-55
WP_164681526.1|561591_561738_-	hypothetical protein	NA	A0A0M3LPX2	Mannheimia_phage	89.6	4.1e-14
WP_080651868.1|561962_562112_-	lytic transglycosylase	NA	A0A0M3LSZ0	Mannheimia_phage	80.9	4.5e-16
WP_021118467.1|562140_562485_-	DUF2570 domain-containing protein	NA	A0A0M3LSP1	Mannheimia_phage	59.8	6.4e-05
WP_021118466.1|562457_563003_-	lysozyme	NA	Q19UR6	Mannheimia_phage	49.7	4.2e-43
WP_043896445.1|562977_563265_-	hypothetical protein	NA	A0A0M3LR95	Mannheimia_phage	53.3	2.6e-12
WP_042905676.1|563388_563838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021110729.1|563800_563995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021118464.1|566030_566216_+	hypothetical protein	NA	A0A0R6PI59	Moraxella_phage	44.6	1.4e-06
WP_021118463.1|566224_566602_-	ECF sigma factor family protein	NA	Q7Y5V5	Haemophilus_phage	27.9	9.7e-07
WP_005714425.1|566598_567003_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M3LPZ2	Mannheimia_phage	43.5	1.1e-21
WP_164681820.1|566999_567281_-	DUF1364 domain-containing protein	NA	A0A0M3LQ97	Mannheimia_phage	89.1	7.4e-44
WP_005714427.1|567379_567562_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_005714429.1|567600_568008_+	type II toxin-antitoxin system HicB family antitoxin	NA	Q775F5	Haemophilus_virus	54.8	8.8e-38
WP_164681600.1|568041_568491_-	recombination protein NinB	NA	Q7Y5V7	Haemophilus_phage	60.7	5.3e-44
WP_164681601.1|568792_569344_-	adenine methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	49.2	9.4e-43
WP_164681602.1|569344_570700_-	AAA family ATPase	NA	A0A0M3LQC0	Mannheimia_phage	63.2	2.7e-155
WP_164681603.1|570699_571176_-	hypothetical protein	NA	Q7Y5W1	Haemophilus_phage	51.5	2.8e-27
WP_164681604.1|571207_571570_-	replication protein	NA	A0A0M3LSY4	Mannheimia_phage	44.3	9.6e-20
WP_164681605.1|571547_571730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021110741.1|571772_572048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012621794.1|572068_572275_-	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	45.3	2.8e-08
WP_164681606.1|572409_573063_+	helix-turn-helix domain-containing protein	NA	A0A0M3LSL8	Mannheimia_phage	68.4	5.3e-69
>prophage 6
NZ_CP049088	Glaesserella parasuis strain sHPS7 chromosome, complete genome	2276207	578848	590366	2276207	integrase	Mannheimia_phage(54.55%)	20	587838:587851	590448:590461
WP_005714998.1|578848_579037_-	hypothetical protein	NA	A0A0M3LS93	Mannheimia_phage	49.1	1.8e-06
WP_021118255.1|579563_580364_+	kilA-N domain protein	NA	A0A0P0ZCS0	Stx2-converting_phage	41.6	1.3e-11
WP_021118256.1|580444_580765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021118257.1|580761_580983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021118258.1|580969_581176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021110753.1|581255_581732_+	siphovirus Gp157 family protein	NA	A0A1W6JP90	Staphylococcus_phage	37.6	3.3e-12
WP_021118259.1|581753_582410_+	AAA family ATPase	NA	G9L667	Escherichia_phage	54.5	1.2e-65
WP_021118260.1|582411_583050_+	hypothetical protein	NA	A0A088C400	Shewanella_sp._phage	44.5	1.0e-32
WP_021118261.1|583162_583351_-	hypothetical protein	NA	Q19US2	Mannheimia_phage	72.4	2.6e-13
WP_164681609.1|583697_584270_+	hypothetical protein	NA	A0A0M3LPL3	Mannheimia_phage	75.4	5.4e-41
WP_164681610.1|584306_585089_+	riboflavin synthase subunit alpha	NA	NA	NA	NA	NA
WP_078208345.1|585090_585735_+	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_164681611.1|585703_585967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164681612.1|585980_586667_+	hypothetical protein	NA	A0A0M3LNU4	Mannheimia_phage	45.3	3.1e-27
WP_164681613.1|586973_587423_+	DUF551 domain-containing protein	NA	G4W933	Tetrasphaera_phage	42.4	6.4e-05
WP_021118921.1|587479_588343_+	SPFH domain / Band 7 family protein	NA	NA	NA	NA	NA
587838:587851	attL	AGTTAATTGAGCCT	NA	NA	NA	NA
WP_164681614.1|588561_588759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021118174.1|588755_589049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005712911.1|589080_589371_+	hypothetical protein	NA	A0A0M3LP12	Mannheimia_phage	34.8	6.8e-08
WP_005712908.1|589367_590366_-|integrase	site-specific integrase	integrase	Q19US1	Mannheimia_phage	57.4	2.3e-103
590448:590461	attR	AGGCTCAATTAACT	NA	NA	NA	NA
>prophage 7
NZ_CP049088	Glaesserella parasuis strain sHPS7 chromosome, complete genome	2276207	1186133	1230232	2276207	protease,transposase,tRNA	Bacillus_phage(27.27%)	40	NA	NA
WP_021118670.1|1186133_1187348_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_021111697.1|1187350_1188238_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_021114545.1|1188481_1189780_+	adenylosuccinate synthase	NA	A0A285PX35	Cedratvirus	37.0	6.4e-74
WP_021114544.1|1189944_1191162_+	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_021114543.1|1191238_1191613_+	cytochrome b562 family protein	NA	NA	NA	NA	NA
WP_043895984.1|1193249_1194689_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_164681650.1|1195912_1196251_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_005710405.1|1196254_1196563_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_160441069.1|1196763_1197924_+|tRNA	bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN	tRNA	NA	NA	NA	NA
WP_164681651.1|1198023_1198605_+	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_005710401.1|1198665_1199601_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	37.4	4.0e-41
WP_005710400.1|1199600_1200089_+	transcription elongation factor GreB	NA	NA	NA	NA	NA
WP_021118667.1|1200616_1201915_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_010786060.1|1202001_1202535_-	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	32.3	2.6e-21
WP_005710397.1|1202623_1203262_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_005710396.1|1203274_1204075_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.9	3.9e-13
WP_005710395.1|1204247_1205327_-	class II fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_005710394.1|1205432_1206608_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_164681652.1|1206846_1208235_-	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_010786065.1|1208399_1208594_-	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_021117800.1|1208602_1209343_-	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_021113229.1|1209389_1210052_-	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_164681653.1|1210061_1210688_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	NA	NA	NA	NA
WP_021113223.1|1210688_1211399_-	DnaA regulatory inactivator Hda	NA	NA	NA	NA	NA
WP_164681654.1|1211490_1212174_-	nicotinamide riboside transporter PnuC	NA	U5J9C5	Bacillus_phage	38.2	3.0e-38
WP_021113241.1|1212313_1214095_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	32.4	1.0e-66
WP_164681655.1|1214312_1216178_+	signal peptide peptidase SppA	NA	A0A2H4UUF9	Bodo_saltans_virus	21.8	8.5e-11
WP_164681656.1|1216318_1217395_+	DUF4115 domain-containing protein	NA	NA	NA	NA	NA
WP_021112005.1|1217396_1218506_+	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_021117792.1|1219611_1220439_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_035525394.1|1220641_1221283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021112000.1|1221282_1222266_-	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
WP_021113228.1|1222283_1222958_-	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_021113240.1|1222979_1223876_-	transcriptional regulator GcvA	NA	Q6JIH3	Burkholderia_virus	30.5	4.2e-24
WP_164681657.1|1224297_1225356_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_164681658.1|1225870_1226824_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_005713507.1|1226909_1227770_+	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_021118421.1|1229084_1229408_+|transposase	transposase	transposase	Q716C1	Shigella_phage	44.9	3.7e-15
WP_071610673.1|1229446_1229872_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	28.8	8.4e-07
WP_157834277.1|1229983_1230232_+|transposase	transposase	transposase	Q716C2	Shigella_phage	58.7	6.6e-20
>prophage 8
NZ_CP049088	Glaesserella parasuis strain sHPS7 chromosome, complete genome	2276207	1238649	1282792	2276207	transposase,tail,plate,head	Haemophilus_phage(22.86%)	59	NA	NA
WP_164681828.1|1238649_1239378_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_164681661.1|1240418_1240793_-	RidA family protein	NA	NA	NA	NA	NA
WP_035497241.1|1240861_1241881_-	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
WP_164681662.1|1242018_1243116_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_035497117.1|1243152_1243590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035522934.1|1244175_1244547_-	transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	43.9	9.5e-23
WP_035522937.1|1244548_1244947_-	regulatory protein GemA	NA	A0A219VHC6	Ochrobactrum_phage	31.0	2.3e-06
WP_035522939.1|1244936_1245299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035522942.1|1245280_1245757_-	hypothetical protein	NA	A0A0M3LPP6	Mannheimia_phage	28.3	7.2e-07
WP_035522945.1|1245806_1246220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164681663.1|1246216_1246375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035522948.1|1246367_1246583_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_035522951.1|1246579_1247104_-	host-nuclease inhibitor protein Gam	NA	F6MIJ0	Haemophilus_phage	51.7	8.1e-44
WP_164681664.1|1247193_1248366_-	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	54.7	5.6e-109
WP_164681665.1|1248443_1250267_-|transposase	transposase family protein	transposase	J9SGQ3	Pseudomonas_phage	41.7	2.6e-121
WP_164681666.1|1250277_1251186_-	DUF3102 domain-containing protein	NA	Q5ZR03	Pseudomonas_phage	39.5	5.3e-51
WP_041639451.1|1251243_1251546_-	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	54.5	1.2e-15
WP_164681667.1|1251542_1251713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160443989.1|1251824_1252016_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_051611621.1|1252125_1252593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164681668.1|1252620_1253280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051611622.1|1253294_1253519_+	excalibur calcium-binding domain-containing protein	NA	A0A0R6PHV6	Moraxella_phage	81.6	4.7e-09
WP_164681669.1|1253538_1254594_+	hypothetical protein	NA	A0A0R6PIZ6	Moraxella_phage	28.1	6.7e-29
WP_164681670.1|1254676_1255198_+	glycoside hydrolase family 108 protein	NA	A0A0M3LSH2	Mannheimia_phage	74.6	6.6e-70
WP_012621973.1|1255298_1255532_+	DUF2644 domain-containing protein	NA	F6MIK0	Haemophilus_phage	74.7	2.1e-23
WP_164681671.1|1255528_1255882_+	DUF2681 domain-containing protein	NA	F6MIK1	Haemophilus_phage	62.4	5.5e-28
WP_012621975.1|1255906_1256236_+	DUF2730 domain-containing protein	NA	M1Q558	Vibrio_phage	28.0	6.1e-05
WP_012621976.1|1256239_1256530_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	59.8	8.8e-24
WP_160441968.1|1256563_1257136_+	DUF3486 family protein	NA	A0A2I7S9D1	Vibrio_phage	46.1	2.1e-37
WP_164681829.1|1257201_1258692_+	hypothetical protein	NA	M1NVQ0	Vibrio_phage	62.2	6.5e-163
WP_164681672.1|1258791_1260207_+	DUF935 family protein	NA	A4JWJ5	Burkholderia_virus	47.2	1.3e-120
WP_164681673.1|1260203_1261475_+|head	phage head morphogenesis protein	head	J9STS2	Pseudomonas_phage	48.0	1.3e-58
WP_035522981.1|1261602_1262058_+	phage virion morphogenesis protein	NA	J9SNH3	Pseudomonas_phage	33.0	6.0e-19
WP_164681674.1|1262278_1263385_+	peptidase	NA	A4JWJ9	Burkholderia_virus	41.4	6.3e-70
WP_021118366.1|1263420_1264362_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	39.1	2.0e-53
WP_021118367.1|1264430_1264874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164681675.1|1264876_1265314_+	DUF1320 domain-containing protein	NA	NA	NA	NA	NA
WP_012621986.1|1265313_1265814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021118369.1|1265823_1267218_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	48.0	6.4e-112
WP_012621988.1|1267217_1267736_+|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	43.7	6.2e-36
WP_075630596.1|1268053_1268644_+	hypothetical protein	NA	G9L6G1	Escherichia_phage	53.9	1.1e-25
WP_012621990.1|1268648_1268909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012621991.1|1268988_1269276_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_106380187.1|1269277_1269406_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_012621993.1|1269390_1269675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164681676.1|1269718_1272397_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	22.7	3.2e-27
WP_164681677.1|1272396_1273338_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_021110043.1|1273330_1273549_+	phage Tail protein X family protein	NA	Q6QIA3	Burkholderia_phage	46.3	7.6e-12
WP_035523013.1|1273552_1274605_+	hypothetical protein	NA	Q6QIA2	Burkholderia_phage	38.6	1.1e-58
WP_035493220.1|1274619_1275204_+|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_021115058.1|1275261_1275630_+	lysozyme family protein	NA	NA	NA	NA	NA
WP_160427422.1|1275616_1276732_+|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	35.3	4.1e-53
WP_016528514.1|1276724_1277291_+|tail	putative bacteriophage tail fiber protein	tail	Q6QI98	Burkholderia_phage	44.0	2.6e-40
WP_021118217.1|1279654_1280212_+	DUF4376 domain-containing protein	NA	F6MIL9	Haemophilus_phage	92.4	4.4e-96
WP_043896411.1|1280513_1280879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021118215.1|1280871_1281339_+	hypothetical protein	NA	F6MIM0	Haemophilus_phage	97.4	5.7e-89
WP_016057790.1|1281488_1281602_+	Com family DNA-binding transcriptional regulator	NA	F6MIM1	Haemophilus_phage	100.0	9.2e-14
WP_164681678.1|1281705_1282491_+	hypothetical protein	NA	F6MIM2	Haemophilus_phage	100.0	3.2e-153
WP_164681679.1|1282531_1282792_-	hypothetical protein	NA	F6MIM3	Haemophilus_phage	97.7	7.1e-41
>prophage 9
NZ_CP049088	Glaesserella parasuis strain sHPS7 chromosome, complete genome	2276207	2262148	2274717	2276207	tail	Mannheimia_phage(86.67%)	16	NA	NA
WP_021118487.1|2262148_2262910_-	C40 family peptidase	NA	A0A0M3LQI5	Mannheimia_phage	48.8	1.6e-64
WP_016527932.1|2262980_2263259_+	plasmid maintenance protein ParE	NA	A0A0M3LQB1	Mannheimia_phage	50.0	4.0e-18
WP_021115320.1|2263276_2263552_+	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	36.2	6.4e-08
WP_021118486.1|2263548_2264286_-|tail	phage minor tail protein L	tail	A0A0M3LSQ5	Mannheimia_phage	54.5	7.9e-69
WP_021118485.1|2264295_2267559_-	tape measure protein	NA	A0A0M3LS69	Mannheimia_phage	36.8	2.6e-156
WP_021118484.1|2267633_2267894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021118483.1|2267947_2268274_-|tail	phage tail protein	tail	A0A0M3LQW6	Mannheimia_phage	66.4	1.3e-39
WP_021118482.1|2268275_2268611_-	hypothetical protein	NA	A0A0M3LQT0	Mannheimia_phage	65.4	5.9e-32
WP_021118481.1|2268619_2269024_-	hypothetical protein	NA	A0A0M3LPJ3	Mannheimia_phage	60.4	2.3e-38
WP_021118480.1|2269039_2270044_-	hypothetical protein	NA	A0A0M3LQ19	Mannheimia_phage	72.2	3.3e-134
WP_021118479.1|2270046_2270448_-	hypothetical protein	NA	A0A0M3LQB6	Mannheimia_phage	50.8	1.7e-33
WP_021118478.1|2270447_2270861_-	HK97 gp10 family phage protein	NA	A0A0M3LPJ5	Mannheimia_phage	61.0	3.5e-42
WP_021118477.1|2270853_2271234_-	hypothetical protein	NA	A0A0M3LT14	Mannheimia_phage	48.4	6.8e-24
WP_021118476.1|2271236_2271698_-	hypothetical protein	NA	A0A0M3LSP7	Mannheimia_phage	56.6	1.4e-34
WP_021118475.1|2271672_2272023_-	heH/LEM domain protein	NA	A0A0M3LS62	Mannheimia_phage	46.3	2.4e-20
WP_041603221.1|2274003_2274717_-	recombinase	NA	A0A0R6PHM5	Moraxella_phage	44.3	6.5e-44
