The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	0	62485	2752113	protease,portal,head,capsid,tail,holin,plate	Staphylococcus_phage(69.7%)	60	NA	NA
WP_031773897.1|1366_2605_+|portal	phage portal protein	portal	A0A2I6PF26	Staphylococcus_phage	99.5	1.7e-233
WP_031883906.1|2588_3362_+|protease	Clp protease ClpP	protease	A0A2I6PEQ7	Staphylococcus_phage	97.7	1.9e-134
WP_031883907.1|3373_4537_+|capsid	phage major capsid protein	capsid	Q4ZCT8	Staphylococcus_virus	99.5	2.7e-217
WP_000050977.1|4605_4884_+|head,tail	phage gp6-like head-tail connector protein	head,tail	R4WAL3	Staphylococcus_phage	100.0	3.5e-46
WP_000395499.1|4895_5228_+	hypothetical protein	NA	A0A2I6PEH8	Staphylococcus_phage	100.0	3.1e-57
WP_164025726.1|5224_5626_+	hypothetical protein	NA	R4WAN5	Staphylococcus_phage	99.2	1.8e-67
WP_001636966.1|5626_6022_+	DUF3168 domain-containing protein	NA	R4WAV1	Staphylococcus_phage	99.2	4.4e-66
WP_031865961.1|6056_6698_+|tail	tail protein	tail	A0A2I6PEP6	Staphylococcus_phage	99.5	1.7e-120
WP_031916056.1|6789_7245_+	Ig domain-containing protein	NA	A0A2I6PF45	Staphylococcus_phage	98.7	1.4e-76
WP_000589165.1|7302_7653_+	hypothetical protein	NA	A0A2I6PDE6	Staphylococcus_phage	100.0	1.1e-55
WP_000438833.1|7694_7853_+	hypothetical protein	NA	A0A2I6PES8	Staphylococcus_phage	100.0	1.2e-19
WP_164025728.1|7866_14043_+|tail	phage tail tape measure protein	tail	A0A2I6PDS2	Staphylococcus_phage	97.2	0.0e+00
WP_001190533.1|14042_14867_+|tail	phage tail family protein	tail	A0A2I6PER3	Staphylococcus_phage	100.0	4.1e-159
WP_098692151.1|14875_16456_+	peptidase	NA	Q4ZD01	Staphylococcus_virus	98.7	3.1e-304
WP_031786856.1|16455_16746_+	hypothetical protein	NA	U5U457	Staphylococcus_phage	99.0	6.0e-49
WP_031906531.1|16761_18672_+	hypothetical protein	NA	A0A2I6PF35	Staphylococcus_phage	99.8	0.0e+00
WP_164026468.1|18671_20138_+|plate	BppU family phage baseplate upper protein	plate	A0A2I6PES7	Staphylococcus_phage	99.8	1.3e-272
WP_001166599.1|20137_20527_+	DUF2977 domain-containing protein	NA	A0A2I6PER1	Staphylococcus_phage	100.0	2.2e-62
WP_000916020.1|20519_20684_+	XkdX family protein	NA	A0A2I6PES4	Staphylococcus_phage	100.0	4.9e-24
WP_000466784.1|20729_21029_+	DUF2951 domain-containing protein	NA	A0A2I6PER2	Staphylococcus_phage	100.0	2.0e-31
WP_164025730.1|21164_21467_+|holin	phage holin	holin	A0A2I6PET6	Staphylococcus_phage	97.0	4.5e-47
WP_164025732.1|21477_22932_+	CHAP domain-containing protein	NA	A0A0N6WMR3	Staphylococcus_phage	96.9	3.0e-282
WP_098692146.1|23766_24744_-	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	99.1	8.8e-185
WP_000669702.1|25581_27945_+	MAP domain-containing protein	NA	NA	NA	NA	NA
WP_001068523.1|28223_29510_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_000990056.1|29709_29808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000681968.1|30050_30227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000691584.1|30485_30866_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000991303.1|30862_31759_+	phenol-soluble modulin export ABC transporter ATP-binding protein PmtA	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	1.1e-16
WP_000645725.1|31759_32440_+	phenol-soluble modulin export ABC transporter permease subunit PmtB	NA	NA	NA	NA	NA
WP_000763048.1|32436_33309_+	phenol-soluble modulin export ABC transporter ATP-binding protein PmtC	NA	A0A2H4PQG7	Staphylococcus_phage	35.2	6.1e-28
WP_001221651.1|33308_34049_+	phenol-soluble modulin export ABC transporter permease subunit PmtD	NA	NA	NA	NA	NA
WP_000182842.1|34114_34678_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_000966288.1|34798_35323_+	membrane protein	NA	NA	NA	NA	NA
WP_001033971.1|35382_35940_+	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
WP_000713070.1|35936_36779_+	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_001188074.1|36835_37876_-	linear amide C-N hydrolase	NA	NA	NA	NA	NA
WP_000267034.1|38326_38500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000205106.1|39072_39474_-	YolD-like family protein	NA	U3PG23	Staphylococcus_phage	42.9	6.0e-23
WP_000181322.1|39743_40772_+	lactonase family protein	NA	NA	NA	NA	NA
WP_001021216.1|40891_42271_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001790680.1|42322_42496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001140871.1|42690_43620_-	manganese-dependent inorganic pyrophosphatase	NA	NA	NA	NA	NA
WP_164025735.1|43672_44233_-	isochorismatase family protein	NA	G3MA16	Bacillus_virus	41.2	2.0e-32
WP_000275706.1|44604_45702_+	pectate lyase	NA	U5PWM6	Bacillus_phage	34.9	2.5e-47
WP_000323164.1|45906_47469_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_001802312.1|47479_47587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164025737.1|47658_48453_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_000897635.1|48472_49549_-	nitric oxide synthase oxygenase	NA	NA	NA	NA	NA
WP_000284433.1|49732_51202_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	45.1	3.5e-108
WP_000040866.1|51194_52016_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.7	2.3e-69
WP_000011542.1|52286_52889_+	DUF2179 domain-containing protein	NA	NA	NA	NA	NA
WP_000669861.1|52869_53043_+	NETI motif-containing protein	NA	NA	NA	NA	NA
WP_000434934.1|53335_53662_-	staphostatin A	NA	NA	NA	NA	NA
WP_000827750.1|53692_54859_-|protease	cysteine protease staphopain A	protease	NA	NA	NA	NA
WP_000572878.1|55718_57014_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.9	1.6e-16
WP_164025739.1|57122_57425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000272070.1|57596_58289_+	heptaprenylglyceryl phosphate synthase	NA	NA	NA	NA	NA
WP_000992921.1|58285_60478_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	42.2	1.0e-135
WP_024273295.1|60481_62485_+	NAD-dependent DNA ligase LigA	NA	A0A0A8J9A9	Ralstonia_phage	36.2	2.3e-110
>prophage 2
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	69603	74631	2752113		Catovirus(33.33%)	5	NA	NA
WP_001231451.1|69603_70551_+	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	27.8	1.2e-16
WP_001147864.1|70631_71993_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A1X9I6F4	Streptococcus_phage	43.8	6.3e-104
WP_000548781.1|72162_72693_+	DUF3267 domain-containing protein	NA	NA	NA	NA	NA
WP_000140176.1|72939_74010_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000613865.1|74076_74631_-	3'-5' exonuclease	NA	B5WZL1	Staphylococcus_phage	35.7	1.2e-29
>prophage 3
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	78084	78498	2752113		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001549145.1|78084_78498_+	hypothetical protein	NA	A0A1Q1PVU5	Staphylococcus_phage	37.7	5.1e-17
>prophage 4
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	83552	84182	2752113		Bacillus_phage(100.0%)	1	NA	NA
WP_000153535.1|83552_84182_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	30.8	8.1e-06
>prophage 5
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	99661	101398	2752113		Bacillus_phage(100.0%)	1	NA	NA
WP_000597230.1|99661_101398_+	SAV1866 family putative multidrug efflux ABC transporter	NA	W8CYL7	Bacillus_phage	30.2	3.8e-53
>prophage 6
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	117843	118572	2752113		Planktothrix_phage(100.0%)	1	NA	NA
WP_001144055.1|117843_118572_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.7	1.0e-36
>prophage 7
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	129165	129510	2752113		Streptococcus_phage(100.0%)	1	NA	NA
WP_000290301.1|129165_129510_+	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	29.7	7.5e-06
>prophage 8
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	139248	139989	2752113		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000216874.1|139248_139989_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.8	1.2e-24
>prophage 9
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	151325	167372	2752113	protease	Staphylococcus_phage(90.91%)	15	NA	NA
WP_000711493.1|151325_152672_-	DUF4041 domain-containing protein	NA	M1NRY5	Streptococcus_phage	50.8	9.6e-65
WP_000595640.1|152838_153435_-	membrane protein	NA	NA	NA	NA	NA
WP_000878802.1|155056_155977_+	beta-channel forming cytolysin	NA	A0A2H4PQI5	Staphylococcus_phage	100.0	2.3e-174
WP_000782446.1|155978_156962_+	bi-component leukocidin LukED subunit D	NA	A0A2H4PQH7	Staphylococcus_phage	99.1	2.3e-185
WP_000543856.1|157331_158123_-	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_000550252.1|158127_158601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024273481.1|158856_159075_+	hypothetical protein	NA	A0A2H4PQH0	Staphylococcus_phage	77.8	1.5e-23
WP_001092776.1|159548_160118_-	DUF4888 domain-containing protein	NA	A0A2H4PQH6	Staphylococcus_phage	62.6	2.6e-51
WP_001039433.1|161080_161788_+|protease	serine protease SplA	protease	A0A2H4PQN3	Staphylococcus_phage	99.6	7.7e-130
WP_164025765.1|161912_162635_+|protease	trypsin-like serine protease	protease	A0A2H4PQN0	Staphylococcus_phage	99.6	3.2e-131
WP_001038872.1|162692_163412_+|protease	serine protease SplC	protease	A0A2H4PQP7	Staphylococcus_phage	98.7	1.3e-129
WP_017431874.1|163532_164252_+|protease	serine protease SplF	protease	A0A2H4PQP1	Staphylococcus_phage	97.9	1.7e-129
WP_001791797.1|164316_164451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072433588.1|164431_166171_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	98.3	3.8e-287
WP_000072589.1|166163_167372_+	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	31.5	9.3e-35
>prophage 10
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	176566	223311	2752113	tRNA,protease	Staphylococcus_phage(94.59%)	44	NA	NA
WP_000864143.1|176566_177124_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4PQN8	Staphylococcus_phage	96.2	2.7e-77
WP_000414214.1|177320_177893_-	hypothetical protein	NA	A0A2H4PQN4	Staphylococcus_phage	96.6	1.1e-25
WP_000627537.1|177993_178335_-	DUF3969 family protein	NA	A0A2H4PQN6	Staphylococcus_phage	95.6	3.0e-55
WP_000669027.1|178375_179002_-	hypothetical protein	NA	A0A2H4PQM7	Staphylococcus_phage	93.8	5.3e-90
WP_000070655.1|179077_180073_-	DUF4352 domain-containing protein	NA	A0A2H4PQN2	Staphylococcus_phage	98.8	6.2e-77
WP_001795535.1|180153_180804_-	calcium-binding protein	NA	A0A2H4PQM8	Staphylococcus_phage	88.4	2.7e-44
WP_072433592.1|181106_181562_+	DUF4909 domain-containing protein	NA	A0A2H4PQN7	Staphylococcus_phage	97.9	5.7e-78
WP_000348374.1|181720_183199_+	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	97.4	8.1e-283
WP_000778525.1|183203_184205_+	o-succinylbenzoate synthase	NA	A0A2H4PQM0	Staphylococcus_phage	97.9	2.2e-186
WP_000718107.1|184201_184459_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	100.0	7.2e-46
WP_000672014.1|184524_184998_+	nucleoside triphosphatase YtkD	NA	A0A2H4PQM4	Staphylococcus_phage	98.1	4.7e-83
WP_001834463.1|185002_185749_+	S9 family peptidase	NA	A0A2H4PQM6	Staphylococcus_phage	98.8	1.4e-142
WP_000109906.1|186126_187719_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	100.0	0.0e+00
WP_000933822.1|188090_189284_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	99.7	1.9e-218
WP_000366163.1|189408_190317_+	NERD domain-containing protein	NA	A0A2H4PQQ8	Staphylococcus_phage	100.0	3.4e-138
WP_000453314.1|190528_191362_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	100.0	5.4e-159
WP_000623478.1|191744_192098_-	CrcB family protein	NA	A0A2H4PQQ7	Staphylococcus_phage	100.0	2.6e-22
WP_001200542.1|192094_192460_-	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	100.0	3.6e-59
WP_000091445.1|192715_193018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001096494.1|193277_193991_+	transaldolase	NA	M1PR54	Cyanophage	35.3	5.5e-19
WP_001168901.1|194430_195066_-|protease	CPBP family intramembrane metalloprotease SdpA	protease	NA	NA	NA	NA
WP_001030469.1|195361_195805_+	hypothetical protein	NA	A0A2H4PQT8	Staphylococcus_phage	98.6	2.4e-57
WP_001153742.1|195791_196235_-	competence protein ComK	NA	NA	NA	NA	NA
WP_000671052.1|196347_196818_-	RNA polymerase sigma factor	NA	A0A2H4PQT5	Staphylococcus_phage	99.4	1.0e-82
WP_000384171.1|197016_197241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001032833.1|197516_198371_+	autolysin	NA	Q4ZCC7	Staphylococcus_virus	38.6	9.8e-39
WP_000989122.1|198457_199750_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4PQU3	Staphylococcus_phage	99.3	9.4e-227
WP_000221177.1|199749_200064_-	winged helix-turn-helix transcriptional regulator	NA	A0A2H4PQT4	Staphylococcus_phage	98.1	9.8e-53
WP_001261668.1|200586_202089_+	FAD-dependent oxidoreductase	NA	A0A2H4PQX2	Staphylococcus_phage	98.6	1.9e-29
WP_000384185.1|202581_203613_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	98.8	4.0e-196
WP_000493892.1|203619_204252_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	99.5	1.7e-112
WP_001159022.1|204262_205444_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	99.7	6.6e-227
WP_164025769.1|205456_205921_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	96.1	3.8e-69
WP_001196354.1|206042_207044_-	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	99.7	9.0e-185
WP_001790712.1|207155_207275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000266096.1|207277_208105_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000757543.1|208676_209078_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000764419.1|209197_209761_-	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	99.5	8.3e-103
WP_000526539.1|209757_210711_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	100.0	2.2e-79
WP_164025772.1|210820_212002_+	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	99.7	2.1e-217
WP_164025775.1|212292_214707_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	99.2	0.0e+00
WP_000836465.1|214728_215040_+	rhodanese-like domain-containing protein	NA	A0A2H4PQR9	Staphylococcus_phage	100.0	1.6e-52
WP_164025778.1|215365_221926_+	DUF1542 domain-containing protein	NA	A0A2H4PQU6	Staphylococcus_phage	98.9	1.0e-308
WP_000285020.1|222042_223311_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	99.1	9.1e-57
>prophage 11
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	234363	239691	2752113		Staphylococcus_phage(50.0%)	3	NA	NA
WP_001091387.1|234363_235221_+	DUF1444 domain-containing protein	NA	A0A2H4PQY3	Staphylococcus_phage	100.0	6.8e-72
WP_001048368.1|235249_235846_+	DUF4479 domain-containing protein	NA	NA	NA	NA	NA
WP_000118284.1|235866_239691_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	47.0	2.0e-83
>prophage 12
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	256429	259060	2752113	tRNA,protease	Cronobacter_phage(50.0%)	2	NA	NA
WP_000186029.1|256429_257692_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.1	2.7e-85
WP_001279338.1|257785_259060_-|protease	trypsin-like serine protease	protease	A0A1B1IRD3	uncultured_Mediterranean_phage	29.0	1.7e-10
>prophage 13
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	262829	266964	2752113		Staphylococcus_phage(50.0%)	4	NA	NA
WP_164025784.1|262829_264434_-	phosphoglycerate dehydrogenase	NA	A0A2H4PQU8	Staphylococcus_phage	100.0	1.2e-114
WP_164025786.1|264420_265581_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_000553927.1|265694_266141_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000174285.1|266220_266964_+	glycerophosphoryl diester phosphodiesterase	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	30.0	4.9e-18
>prophage 14
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	284695	287893	2752113		Streptomyces_phage(100.0%)	1	NA	NA
WP_001836688.1|284695_287893_+	DNA polymerase III subunit alpha	NA	A0A2L1IZ23	Streptomyces_phage	30.6	1.0e-136
>prophage 15
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	292826	294584	2752113		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001232648.1|292826_294584_+	pyruvate kinase	NA	A0A2H4PQU5	Staphylococcus_phage	100.0	2.6e-41
>prophage 16
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	301445	309609	2752113		Feldmannia_irregularis_virus(25.0%)	5	NA	NA
WP_000080028.1|301445_302150_+	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	28.7	1.6e-07
WP_015445861.1|302149_303811_+	PAS domain S-box protein	NA	W8CYF6	Bacillus_phage	39.4	5.8e-35
WP_164025807.1|304309_305797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001038308.1|306090_308721_+	DNA polymerase I	NA	A8E2B3	Enterococcus_phage	33.0	6.1e-47
WP_001114467.1|308736_309609_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	G3MA33	Bacillus_virus	38.2	2.0e-42
>prophage 17
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	313524	324677	2752113	tRNA,protease	Brevibacillus_phage(20.0%)	12	NA	NA
WP_001670575.1|313524_314445_+	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	29.4	4.8e-31
WP_001790562.1|314537_314660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024273554.1|314857_316795_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	35.8	1.7e-115
WP_000049145.1|317220_318714_+	amino acid permease	NA	NA	NA	NA	NA
WP_001791162.1|318942_319470_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.1	4.1e-11
WP_001125540.1|319498_319699_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001138360.1|319745_320102_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_000032657.1|320243_320852_+	NUDIX domain-containing protein	NA	A0A060AB76	Staphylococcus_phage	35.9	6.6e-21
WP_164025812.1|320870_321800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001790560.1|321804_321915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070047466.1|321962_323264_+	trigger factor	NA	NA	NA	NA	NA
WP_000472293.1|323414_324677_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	61.7	1.1e-139
>prophage 18
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	335765	338396	2752113	tRNA	Catovirus(100.0%)	1	NA	NA
WP_000425363.1|335765_338396_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	40.4	2.2e-153
>prophage 19
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	348591	384144	2752113	tRNA	uncultured_Mediterranean_phage(18.75%)	31	NA	NA
WP_001005768.1|348591_349596_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	29.1	1.7e-05
WP_070004486.1|349597_350623_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_001112045.1|350645_351785_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.7	5.4e-85
WP_001160682.1|351803_352064_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	35.3	8.2e-05
WP_000749795.1|352338_354618_+	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.8	1.8e-31
WP_000594991.1|354820_357094_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.8	5.2e-63
WP_000364542.1|357115_357634_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	46.5	5.6e-29
WP_001058583.1|358061_360251_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.7	6.9e-12
WP_000869983.1|360262_360715_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_000717800.1|360711_361587_+	SH3 domain-containing protein	NA	A0A0N9SGH1	Paenibacillus_phage	33.7	4.7e-12
WP_000590824.1|362047_363310_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000044799.1|363325_365092_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	27.3	1.3e-16
WP_001790559.1|365424_365553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000682646.1|365552_366326_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_000102740.1|366486_367761_-	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	50.7	1.8e-105
WP_000704122.1|367845_368268_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_000752909.1|368367_368550_+	CsbD family protein	NA	NA	NA	NA	NA
WP_000009238.1|368589_368736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985895.1|368972_369986_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000409158.1|370297_371440_+	cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	30.8	5.4e-32
WP_164025819.1|371440_372559_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000567017.1|373193_373862_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_164025822.1|373863_376341_+	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	28.9	1.9e-66
WP_000734081.1|376683_379314_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	34.4	3.2e-64
WP_000426912.1|379376_379637_+	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_000939059.1|379640_380069_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_000134779.1|380083_380392_+	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_000342266.1|380676_381315_+	O-methyltransferase	NA	A0A2P1JQT7	Mycobacterium_phage	28.8	1.6e-09
WP_000137775.1|381317_382241_+	U32 family peptidase	NA	NA	NA	NA	NA
WP_162646513.1|382252_383521_+	U32 family peptidase	NA	Q6DW11	Phage_TP	31.4	1.5e-35
WP_000648617.1|383520_384144_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.1	2.8e-35
>prophage 20
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	398216	405158	2752113		Indivirus(25.0%)	6	NA	NA
WP_072353822.1|398216_398903_+	ComEA family DNA-binding protein	NA	A0A1V0SDW0	Indivirus	30.4	7.5e-05
WP_000439693.1|398994_399456_+	ComE operon protein 2	NA	A7KUY9	Bacillus_phage	58.8	3.6e-35
WP_164026471.1|399514_401662_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q332C0	Clostridium_botulinum_C_phage	32.2	2.7e-32
WP_001282562.1|401718_402693_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_001274017.1|402737_402989_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_000368341.1|403334_405158_+	elongation factor 4	NA	A0A1S5SF82	Streptococcus_phage	25.1	6.1e-22
>prophage 21
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	408594	411702	2752113		Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_164025830.1|408594_410427_+	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	46.7	1.2e-137
WP_001119021.1|410562_411702_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	25.8	1.2e-26
>prophage 22
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	418170	419118	2752113		Rhizobium_phage(100.0%)	1	NA	NA
WP_001117767.1|418170_419118_+	PhoH family protein	NA	L7TP00	Rhizobium_phage	46.8	6.4e-47
>prophage 23
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	422172	435918	2752113	tRNA	Klosneuvirus(25.0%)	13	NA	NA
WP_001030080.1|422172_423564_-|tRNA	glycine--tRNA ligase	tRNA	A0A1V0SIF1	Klosneuvirus	27.4	4.7e-46
WP_001797828.1|423898_424522_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000411298.1|424532_425351_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_001217257.1|425411_427229_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	36.3	7.9e-54
WP_001283055.1|427452_428559_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	38.1	1.1e-37
WP_164025836.1|428689_429367_+|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_000683929.1|429369_430470_+	Nif3-like dinuclear metal center hexameric protein	NA	A0A1S5V250	Saudi_moumouvirus	29.6	5.2e-08
WP_001062187.1|430583_431930_+	DEAD/DEAH box helicase	NA	A0A1V0SIR5	Klosneuvirus	34.0	2.4e-55
WP_000924220.1|431939_432830_+	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	36.0	3.4e-26
WP_001213908.1|432955_433741_+	metal ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.3	8.0e-19
WP_000564316.1|433782_434646_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_001095260.1|434632_435043_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_000863556.1|435318_435918_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	54.7	9.2e-60
>prophage 24
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	442091	442715	2752113		Streptococcus_phage(100.0%)	1	NA	NA
WP_117223063.1|442091_442715_+	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	36.6	2.7e-30
>prophage 25
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	448259	451071	2752113		Prochlorococcus_phage(100.0%)	2	NA	NA
WP_000019691.1|448259_449606_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	39.2	1.7e-61
WP_000202188.1|449598_451071_+	glycine dehydrogenase subunit 2	NA	E3SN07	Prochlorococcus_phage	41.3	2.8e-81
>prophage 26
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	458570	465141	2752113		Indivirus(66.67%)	6	NA	NA
WP_001286928.1|458570_459908_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	37.7	1.6e-43
WP_000159865.1|459900_460131_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_000183381.1|460108_460990_+	polyprenyl synthetase family protein	NA	A0A1V0SE37	Indivirus	25.8	3.4e-10
WP_001124985.1|461421_461874_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_164025840.1|461889_463569_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001291538.1|463719_465141_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.3	8.7e-40
>prophage 27
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	471969	473376	2752113		Synechococcus_phage(100.0%)	1	NA	NA
WP_000193707.1|471969_473376_+	NADP-dependent phosphogluconate dehydrogenase	NA	A0A222YX62	Synechococcus_phage	31.1	4.3e-31
>prophage 28
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	479801	481286	2752113		Cyanophage(100.0%)	1	NA	NA
WP_164025845.1|479801_481286_-	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	37.6	1.2e-79
>prophage 29
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	486952	498009	2752113		Bacillus_phage(33.33%)	12	NA	NA
WP_000447732.1|486952_487840_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	31.4	4.3e-37
WP_001183439.1|487917_488424_-	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_000273371.1|488515_489247_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	21.8	7.9e-05
WP_000368656.1|489239_489782_+	SMC-Scp complex subunit ScpB	NA	NA	NA	NA	NA
WP_000159577.1|489774_490512_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_000064078.1|490644_491370_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	43.0	3.5e-45
WP_000987769.1|491350_493102_+	HAMP domain-containing protein	NA	A0A1V0SGX0	Hokovirus	33.6	1.7e-21
WP_164025848.1|493346_494291_+	DUF1672 family protein	NA	NA	NA	NA	NA
WP_164025849.1|494679_495225_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_001151997.1|495330_495579_-	ferredoxin	NA	A0A127AYY7	Bacillus_phage	48.0	8.3e-15
WP_001163801.1|495686_496640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902119.1|496629_498009_+	ATP-dependent DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	33.6	2.9e-56
>prophage 30
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	507419	512886	2752113		Bacillus_phage(25.0%)	7	NA	NA
WP_001043863.1|507419_507692_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	73.3	4.2e-28
WP_000450555.1|508122_508695_+	heptaprenyl diphosphate synthase component 1	NA	NA	NA	NA	NA
WP_000774685.1|508697_509423_+	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
WP_016169114.1|509439_510384_+	heptaprenyl diphosphate synthase component II	NA	A0A1V0SE37	Indivirus	24.4	1.3e-10
WP_000442480.1|510475_510925_+	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	43.8	2.4e-28
WP_000789522.1|511133_511334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001269930.1|511719_512886_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	32.1	7.6e-34
>prophage 31
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	516548	517124	2752113		Bacillus_virus(100.0%)	1	NA	NA
WP_000005212.1|516548_517124_+	IDEAL domain-containing protein	NA	G3MAV7	Bacillus_virus	27.2	2.1e-08
>prophage 32
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	520496	528002	2752113	tRNA	unidentified_phage(25.0%)	5	NA	NA
WP_000361549.1|520496_521699_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	43.3	1.9e-35
WP_164025859.1|521685_522657_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_164025861.1|522680_525374_+	ATP-dependent helicase	NA	A0A1X9I5C8	Streptococcus_phage	34.4	3.7e-47
WP_000858782.1|525695_526988_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.0	1.9e-54
WP_000362218.1|527315_528002_+	DnaD domain-containing protein	NA	Q938N2	Temperate_phage	32.6	1.2e-07
>prophage 33
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	531740	532418	2752113		Bacillus_phage(100.0%)	1	NA	NA
WP_164025863.1|531740_532418_-	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	35.5	1.9e-24
>prophage 34
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	542114	542993	2752113		Bacillus_phage(100.0%)	1	NA	NA
WP_001133022.1|542114_542993_+	5'-3' exonuclease	NA	S5M4P0	Bacillus_phage	29.5	1.4e-19
>prophage 35
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	581950	591340	2752113		Staphylococcus_phage(60.0%)	13	NA	NA
WP_000282171.1|581950_582655_-	queuosine precursor transporter	NA	A0A2H4J2N7	uncultured_Caudovirales_phage	23.8	8.4e-12
WP_001795441.1|582899_583094_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_000691943.1|583105_583357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000404641.1|583394_584519_+	virulence factor	NA	NA	NA	NA	NA
WP_000995287.1|584534_584972_+	BrxA/BrxB family bacilliredoxin	NA	NA	NA	NA	NA
WP_000934885.1|585395_586352_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	85.2	1.6e-167
WP_000175746.1|586551_587031_+	dihydrofolate reductase	NA	A0A0N9S8H6	Staphylococcus_phage	79.9	2.0e-73
WP_000166059.1|587045_587885_+	fatty acid kinase FakB2	NA	A0A0N9SI50	Staphylococcus_phage	77.3	2.3e-48
WP_000159902.1|587970_588504_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000913315.1|588496_588925_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_000473652.1|588936_589437_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000801007.1|589436_589658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000342125.1|589849_591340_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	30.5	2.3e-22
>prophage 36
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	594748	596760	2752113		Bacillus_phage(50.0%)	2	NA	NA
WP_000192137.1|594748_595408_+	response regulator transcription factor ArlR	NA	W8CYM9	Bacillus_phage	33.8	1.1e-34
WP_000166802.1|595404_596760_+	sensor histidine kinase ArlS	NA	A0A1V0SGX0	Hokovirus	27.8	3.5e-14
>prophage 37
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	602925	603717	2752113		Halovirus(100.0%)	1	NA	NA
WP_164025867.1|602925_603717_+	MoxR family ATPase	NA	R4TG24	Halovirus	34.2	3.3e-12
>prophage 38
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	607257	612288	2752113	lysis	Lactobacillus_phage(33.33%)	7	NA	NA
WP_000138420.1|607257_608394_-	toxic anion resistance protein	NA	A0A291I9K4	Lactobacillus_phage	28.0	3.7e-33
WP_001788788.1|608425_609055_-|lysis	5-bromo-4-chloroindolyl phosphate hydrolysis protein	lysis	NA	NA	NA	NA
WP_001215907.1|609073_609343_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000269923.1|609505_609814_+	DUF1033 family protein	NA	NA	NA	NA	NA
WP_000809131.1|609984_610185_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	66.2	8.4e-18
WP_000876201.1|610381_610783_+	sarA expression modulator protein Msa	NA	NA	NA	NA	NA
WP_164025869.1|611022_612288_-	diaminopimelate decarboxylase	NA	A0A0P0YM38	Yellowstone_lake_phycodnavirus	23.2	1.4e-12
>prophage 39
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	620133	621735	2752113		Klosneuvirus(100.0%)	1	NA	NA
WP_000942300.1|620133_621735_-	ATP-binding cassette domain-containing protein	NA	A0A1V0SKJ1	Klosneuvirus	25.7	5.5e-51
>prophage 40
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	626819	630273	2752113		Indivirus(50.0%)	3	NA	NA
WP_000079447.1|626819_627671_+	phosphate ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.7	8.9e-16
WP_000974848.1|627677_628319_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_000077571.1|628458_630273_-	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	47.1	5.1e-154
>prophage 41
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	633687	634389	2752113		Tupanvirus(100.0%)	1	NA	NA
WP_000571259.1|633687_634389_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	30.3	2.0e-13
>prophage 42
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	641900	644255	2752113		Acinetobacter_phage(100.0%)	3	NA	NA
WP_000153621.1|641900_642683_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	36.7	5.5e-28
WP_164025876.1|642684_643683_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	34.5	7.2e-33
WP_000604816.1|643688_644255_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	32.1	1.3e-23
>prophage 43
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	648573	649836	2752113		Bacillus_phage(100.0%)	1	NA	NA
WP_000283016.1|648573_649836_-	Y-family DNA polymerase	NA	O64031	Bacillus_phage	44.3	2.6e-96
>prophage 44
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	659495	663889	2752113		Bacillus_phage(50.0%)	2	NA	NA
WP_001289562.1|659495_661898_-	DNA topoisomerase IV subunit A	NA	A0A172JHV7	Bacillus_phage	32.4	7.9e-94
WP_001548666.1|661897_663889_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	40.5	8.0e-116
>prophage 45
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	669824	671471	2752113		Vibrio_phage(100.0%)	1	NA	NA
WP_001088978.1|669824_671471_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	24.4	2.5e-22
>prophage 46
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	675139	676261	2752113		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000691304.1|675139_676261_-	exonuclease SbcCD subunit D	NA	A0A1X9I9U0	Staphylococcus_phage	22.7	4.3e-10
>prophage 47
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	680410	686066	2752113		Phage_Wrath(25.0%)	7	NA	NA
WP_001208755.1|680410_681034_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	63.8	5.9e-17
WP_000380723.1|681413_682277_-	CAP domain-containing protein	NA	U5Q0C0	Bacillus_phage	41.5	4.1e-16
WP_001791425.1|682350_682455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000688122.1|682451_683429_-	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	99.7	8.0e-186
WP_001085655.1|683585_683855_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_001265708.1|684308_684458_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_164025891.1|684548_686066_-	catalase	NA	A0A2K9L0T1	Tupanvirus	43.2	2.3e-91
>prophage 48
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	696202	700478	2752113		Bacillus_phage(50.0%)	6	NA	NA
WP_000841351.1|696202_696736_-	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	43.5	3.4e-21
WP_001027143.1|696874_697063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000202390.1|697175_697778_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_164025893.1|697774_698866_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_000603969.1|698869_699601_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_164025895.1|699569_700478_-	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.2	6.2e-23
>prophage 49
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	709516	711124	2752113		Staphylococcus_phage(100.0%)	3	NA	NA
WP_001002340.1|709516_709723_-	hypothetical protein	NA	A0A2H4PQT0	Staphylococcus_phage	59.7	1.3e-13
WP_075111596.1|710019_710238_-	hypothetical protein	NA	A0A1W6JNK0	Staphylococcus_phage	73.1	6.4e-19
WP_001814546.1|710926_711124_-	hypothetical protein	NA	A0A1W6JNK0	Staphylococcus_phage	50.0	1.7e-10
>prophage 50
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	716199	716676	2752113		Fowlpox_virus(100.0%)	1	NA	NA
WP_000448079.1|716199_716676_+	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	37.3	7.9e-22
>prophage 51
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	722618	729100	2752113		Acanthocystis_turfacea_Chlorella_virus(33.33%)	4	NA	NA
WP_001103743.1|722618_723437_-	aquaporin family protein	NA	M1H4F4	Acanthocystis_turfacea_Chlorella_virus	35.1	2.4e-26
WP_001077635.1|723911_724454_-	glycerol-3-phosphate responsive antiterminator	NA	NA	NA	NA	NA
WP_000516264.1|724459_726469_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.7	2.8e-60
WP_164025900.1|726481_729100_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	23.8	6.5e-41
>prophage 52
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	738514	739558	2752113		Bacillus_phage(100.0%)	1	NA	NA
WP_000368166.1|738514_739558_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	69.2	9.3e-124
>prophage 53
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	743758	749302	2752113		Bacillus_virus(33.33%)	4	NA	NA
WP_000664778.1|743758_745045_-	insulinase family protein	NA	G3MBJ8	Bacillus_virus	27.9	6.7e-15
WP_000089942.1|745044_746310_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	26.8	9.1e-41
WP_001293307.1|746340_747054_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001806691.1|747058_749302_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	47.7	6.9e-84
>prophage 54
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	754442	766255	2752113	tRNA	Klosneuvirus(33.33%)	9	NA	NA
WP_000864186.1|754442_755414_-	riboflavin biosynthesis protein RibF	NA	A0A1V0SJE1	Klosneuvirus	31.3	6.6e-07
WP_000282298.1|755428_756346_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_000097322.1|756514_756865_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_000043635.1|757250_759368_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	25.1	2.4e-25
WP_000020853.1|759372_759690_-	YlxQ family RNA-binding protein	NA	NA	NA	NA	NA
WP_000727423.1|759686_759971_-	YlxR family protein	NA	NA	NA	NA	NA
WP_000097460.1|759991_761167_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000036633.1|761187_761655_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_001834826.1|761944_766255_-	PolC-type DNA polymerase III	NA	A0A0A8WJ41	Clostridium_phage	41.2	3.5e-23
>prophage 55
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	770503	771274	2752113		Flavobacterium_phage(100.0%)	1	NA	NA
WP_000473705.1|770503_771274_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	41.5	7.3e-25
>prophage 56
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	776048	787253	2752113	tRNA,protease	Erwinia_phage(20.0%)	9	NA	NA
WP_164025906.1|776048_777452_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A1B2IDZ7	Erwinia_phage	25.6	2.2e-27
WP_000072681.1|777517_778063_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001015597.1|778059_778956_-	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	31.5	3.6e-31
WP_000195254.1|779372_780680_-|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
WP_001557331.1|780835_782911_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	39.2	1.7e-105
WP_000931873.1|783084_783957_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_000110251.1|784280_785189_-	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	33.2	3.0e-17
WP_164025908.1|785210_786377_-	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_000176409.1|786485_787253_-	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	44.1	2.5e-25
>prophage 57
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	800863	803113	2752113		Acanthamoeba_polyphaga_mimivirus(33.33%)	3	NA	NA
WP_000043237.1|800863_801595_-	ribonuclease III	NA	A0A0G2Y7P9	Acanthamoeba_polyphaga_mimivirus	28.8	5.9e-24
WP_000426914.1|801710_801944_-	acyl carrier protein	NA	E3SSM9	Prochlorococcus_phage	63.3	1.6e-07
WP_164025911.1|802378_803113_-	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.3	2.4e-17
>prophage 58
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	813483	815478	2752113		Moumouvirus(100.0%)	1	NA	NA
WP_164025926.1|813483_815478_-	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	M1PCM5	Moumouvirus	34.8	5.5e-24
>prophage 59
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	818625	819561	2752113	tRNA	Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000161291.1|818625_819561_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	28.0	4.7e-10
>prophage 60
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	824574	826831	2752113		Methanothermobacter_phage(50.0%)	3	NA	NA
WP_000722165.1|824574_825774_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	32.9	1.2e-42
WP_000933956.1|825989_826208_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_164025928.1|826207_826831_-	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	34.7	1.6e-22
>prophage 61
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	830145	830757	2752113		Pandoravirus(100.0%)	1	NA	NA
WP_001040248.1|830145_830757_-	orotate phosphoribosyltransferase	NA	S4VS55	Pandoravirus	33.8	1.6e-27
>prophage 62
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	834724	839335	2752113		Halovirus(33.33%)	4	NA	NA
WP_164025937.1|834724_835825_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	36.8	7.4e-63
WP_000767028.1|835826_837101_-	dihydroorotase	NA	NA	NA	NA	NA
WP_001016166.1|837118_838000_-	aspartate carbamoyltransferase catalytic subunit	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	33.9	4.6e-31
WP_001178619.1|838027_839335_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	34.0	3.3e-54
>prophage 63
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	843872	846626	2752113	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_000384691.1|843872_846626_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	28.0	3.6e-90
>prophage 64
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	866210	866399	2752113		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001245802.1|866210_866399_-	hypothetical protein	NA	A0A0K1LL29	Staphylococcus_phage	86.9	3.8e-20
>prophage 65
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	875482	879961	2752113		Staphylococcus_phage(100.0%)	6	NA	NA
WP_001802045.1|875482_875707_-	hypothetical protein	NA	A0A2H4PQT0	Staphylococcus_phage	71.4	5.6e-18
WP_000765708.1|875663_875810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000857485.1|876482_877442_+	beta-channel forming cytolysin	NA	A0A2H4PQH7	Staphylococcus_phage	30.3	1.3e-34
WP_000231632.1|877918_878152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001032816.1|878773_878959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000669528.1|879610_879961_-	complement inhibitor SCIN family protein	NA	A7TWS0	Staphylococcus_phage	49.1	2.4e-20
>prophage 66
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	891446	896004	2752113		Staphylococcus_phage(33.33%)	3	NA	NA
WP_001018928.1|891446_891761_-	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	46.6	6.6e-25
WP_164025946.1|891933_894282_-	endonuclease MutS2	NA	F2QAF8	Phaeocystis_pouchetii_virus	25.7	3.8e-16
WP_000161941.1|894291_896004_-	DNA polymerase/3'-5' exonuclease PolX	NA	A0A2H4UV14	Bodo_saltans_virus	24.0	8.9e-15
>prophage 67
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	901077	902136	2752113	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_000003566.1|901077_902136_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	35.5	1.9e-31
>prophage 68
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	914079	916987	2752113		uncultured_Mediterranean_phage(50.0%)	5	NA	NA
WP_000401377.1|914079_914562_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	46.2	2.6e-28
WP_001263796.1|914563_915106_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_000814565.1|915175_915565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001049150.1|915567_915822_-	YlbG family protein	NA	NA	NA	NA	NA
WP_164025948.1|916060_916987_+	glycerophosphodiester phosphodiesterase	NA	M1I1K8	Paramecium_bursaria_Chlorella_virus	26.2	1.7e-12
>prophage 69
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	928505	930353	2752113		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000182654.1|928505_930353_-	translational GTPase TypA	NA	A0A2K5B2A5	Erysipelothrix_phage	26.2	1.8e-21
>prophage 70
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	938488	947321	2752113		Mycoplasma_phage(25.0%)	9	NA	NA
WP_000433551.1|938488_939583_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	44.3	1.4e-37
WP_001020625.1|939595_940135_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000455597.1|940278_940554_-	UPF0223 family protein	NA	NA	NA	NA	NA
WP_000260117.1|940721_942128_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.2e-46
WP_000863439.1|942131_943424_-	2-oxo acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
WP_000068176.1|943514_944492_-	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_000035320.1|944495_945608_-	pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha	NA	A0A0K0KW14	Prochlorococcus_phage	27.8	1.4e-05
WP_000668339.1|945778_946405_-	cell-wall-binding lipoprotein	NA	NA	NA	NA	NA
WP_000957036.1|946769_947321_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	42.2	1.6e-13
>prophage 71
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	954787	959167	2752113		Bacillus_virus(50.0%)	5	NA	NA
WP_001289618.1|954787_955021_+	glutaredoxin family protein	NA	G3MBF0	Bacillus_virus	38.7	8.4e-09
WP_000040058.1|955257_956976_-	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_000437472.1|956978_957245_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_000505966.1|957398_957941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000685067.1|957994_959167_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	42.8	4.0e-75
>prophage 72
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	962535	977297	2752113		Prochlorococcus_phage(22.22%)	14	NA	NA
WP_000921973.1|962535_963936_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.3	1.1e-10
WP_000273253.1|963928_964735_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_164025951.1|965001_966249_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_000709277.1|966270_967749_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	51.8	3.2e-77
WP_164025952.1|967763_968330_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	39.6	1.8e-28
WP_164025953.1|968332_969361_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	41.7	1.0e-61
WP_000483720.1|969353_970838_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	31.7	1.9e-45
WP_000032740.1|970816_973006_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.8	3.5e-141
WP_000666806.1|972998_973670_-	phosphoribosylformylglycinamidine synthase I	NA	NA	NA	NA	NA
WP_000848350.1|973671_973935_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_000174053.1|973934_974639_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	42.1	7.3e-48
WP_164025954.1|974642_975767_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_000861572.1|975753_976236_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	44.7	6.2e-22
WP_000225837.1|976436_977297_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.2	5.3e-40
>prophage 73
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	987752	991523	2752113		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001074554.1|987752_991523_+	bifunctional autolysin	NA	A0A1J0MFB0	Staphylococcus_phage	37.6	1.1e-54
>prophage 74
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	995188	1011553	2752113	holin,bacteriocin,protease	Staphylococcus_phage(33.33%)	21	NA	NA
WP_164025959.1|995188_996199_+|protease	trypsin-like serine protease	protease	A0A2H4PQP7	Staphylococcus_phage	31.7	3.1e-15
WP_001089094.1|996280_997462_+|protease	cysteine protease staphopain B	protease	NA	NA	NA	NA
WP_164025963.1|997499_997829_+|protease	cysteine protease inhibitor staphostatin B	protease	NA	NA	NA	NA
WP_000184945.1|998066_998888_-	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_000150197.1|998880_999684_-	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
WP_164025965.1|999670_1001344_-	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylic-acid synthase	NA	NA	NA	NA	NA
WP_001816819.1|1001330_1002542_-	isochorismate synthase	NA	NA	NA	NA	NA
WP_001791731.1|1002618_1002723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164025967.1|1002873_1003812_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000620949.1|1003863_1004415_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001788574.1|1004504_1004795_+	TM2 domain-containing protein	NA	A0A060AN66	Enterococcus_phage	38.0	7.5e-07
WP_001790177.1|1004858_1004990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000766009.1|1006483_1006840_+	DoxX family protein	NA	NA	NA	NA	NA
WP_001792054.1|1006928_1007066_-	poly(glycerol-phosphate) alpha-glucosyltransferase	NA	NA	NA	NA	NA
WP_001795266.1|1007206_1007497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000571167.1|1007584_1008226_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.0	1.7e-19
WP_000668627.1|1008222_1008543_-	YxeA family protein	NA	NA	NA	NA	NA
WP_000870827.1|1008545_1010510_-|bacteriocin	bacteriocin-associated integral membrane family protein	bacteriocin	NA	NA	NA	NA
WP_001797239.1|1010553_1010826_-|bacteriocin	lactococcin 972 family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_031763719.1|1010835_1010937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164026481.1|1011475_1011553_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
>prophage 75
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1018420	1023631	2752113		Pithovirus(33.33%)	3	NA	NA
WP_164025971.1|1018420_1020745_-	PDZ domain-containing protein	NA	W5SAB9	Pithovirus	27.4	2.8e-11
WP_000928413.1|1020963_1021767_-	TerC family protein	NA	S5MAL1	Bacillus_phage	40.5	1.6e-30
WP_001049951.1|1022068_1023631_-	peptide chain release factor 3	NA	A0A1S5SF82	Streptococcus_phage	28.2	1.7e-36
>prophage 76
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1042562	1044371	2752113		Streptococcus_phage(100.0%)	1	NA	NA
WP_000082725.1|1042562_1044371_-	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	24.5	5.5e-47
>prophage 77
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1050184	1052154	2752113		Bacillus_virus(100.0%)	2	NA	NA
WP_000427769.1|1050184_1051165_-	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.1	2.7e-16
WP_001067040.1|1051167_1052154_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.0	1.8e-15
>prophage 78
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1055805	1057819	2752113		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_000786736.1|1055805_1056747_-	ABC transporter ATP-binding protein	NA	F2Y1V6	Organic_Lake_phycodnavirus	26.9	1.6e-05
WP_070047531.1|1056736_1057819_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	8.4e-19
>prophage 79
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1066413	1073223	2752113		Micromonas_sp._RCC1109_virus(33.33%)	4	NA	NA
WP_164025982.1|1066413_1067559_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	25.6	3.3e-05
WP_001047069.1|1067668_1068538_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000353954.1|1068596_1071206_-	ATP-dependent chaperone ClpB	NA	A0A223W0B1	Agrobacterium_phage	34.3	5.5e-117
WP_001044219.1|1071408_1073223_-	acetyltransferase	NA	B5WZU0	Pseudomonas_phage	34.2	3.0e-37
>prophage 80
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1080354	1084008	2752113		Bacillus_phage(100.0%)	1	NA	NA
WP_000154930.1|1080354_1084008_-	helicase-exonuclease AddAB subunit AddA	NA	A7KV33	Bacillus_phage	24.5	3.5e-24
>prophage 81
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1094162	1101339	2752113		Staphylococcus_phage(33.33%)	6	NA	NA
WP_000185319.1|1094162_1095092_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	37.9	3.7e-39
WP_000138487.1|1095613_1096858_-	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_000167314.1|1096966_1098157_-	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.7	1.3e-33
WP_000838034.1|1098464_1099592_-	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
WP_001067294.1|1099953_1100331_-	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000035058.1|1100745_1101339_-	peptidyl-prolyl cis-trans isomerase	NA	A0A076FI46	Aureococcus_anophage	41.3	1.1e-25
>prophage 82
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1111259	1114887	2752113		Mycoplasma_phage(50.0%)	3	NA	NA
WP_164025990.1|1111259_1112735_-	leucyl aminopeptidase family protein	NA	Q6GYZ8	Mycoplasma_phage	35.8	6.9e-48
WP_164025992.1|1112865_1114074_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001143495.1|1114527_1114887_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	38.6	2.7e-14
>prophage 83
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1118930	1121599	2752113		Pseudomonas_phage(50.0%)	2	NA	NA
WP_000613541.1|1118930_1120145_-	PG:teichoic acid D-alanyltransferase DltB	NA	A0A125RNP0	Pseudomonas_phage	26.1	8.5e-20
WP_164025994.1|1120141_1121599_-	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9L3I8	Tupanvirus	28.3	5.8e-39
>prophage 84
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1134721	1138245	2752113		environmental_halophage(50.0%)	3	NA	NA
WP_001006453.1|1134721_1135972_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	44.8	1.1e-110
WP_164026000.1|1136077_1137385_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000168845.1|1137483_1138245_-	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	23.3	4.4e-06
>prophage 85
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1141732	1142758	2752113		Planktothrix_phage(100.0%)	1	NA	NA
WP_000571218.1|1141732_1142758_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.8	1.2e-27
>prophage 86
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1146131	1151308	2752113		Streptococcus_phage(50.0%)	8	NA	NA
WP_000589549.1|1146131_1146488_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	46.6	4.7e-19
WP_001190695.1|1146631_1146952_+	thioredoxin family protein	NA	A0A1X9I9P5	Staphylococcus_phage	36.4	3.1e-06
WP_000422908.1|1147101_1147641_-	nitroreductase	NA	NA	NA	NA	NA
WP_000150013.1|1147723_1148440_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	30.6	2.3e-17
WP_000974460.1|1148587_1149010_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_000569884.1|1149408_1149903_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000255553.1|1150057_1150675_+	amino acid transporter	NA	NA	NA	NA	NA
WP_072353886.1|1150747_1151308_-	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	40.9	2.2e-31
>prophage 87
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1156232	1157476	2752113		Lactococcus_phage(50.0%)	2	NA	NA
WP_001059082.1|1156232_1156433_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	70.8	1.4e-20
WP_001548082.1|1156789_1157476_-	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	54.2	3.8e-33
>prophage 88
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1166392	1175281	2752113		Staphylococcus_phage(50.0%)	9	NA	NA
WP_000757406.1|1166392_1167121_+	DUF5067 domain-containing protein	NA	H9A0X8	Staphylococcus_phage	37.5	1.3e-18
WP_001057759.1|1167312_1167459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001058299.1|1167474_1167798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001085185.1|1169119_1169584_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	100.0	1.5e-81
WP_001050063.1|1169605_1171978_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	39.0	5.1e-93
WP_001165962.1|1172011_1172752_-	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_000556760.1|1172867_1173101_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_000785252.1|1173167_1173626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001121760.1|1173976_1175281_-	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	80.7	6.7e-196
>prophage 89
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1184399	1190219	2752113		Streptococcus_phage(40.0%)	5	NA	NA
WP_001049165.1|1184399_1184987_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.3	8.2e-53
WP_000006551.1|1185559_1186504_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	40.6	3.1e-54
WP_001248939.1|1186614_1187610_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	41.9	4.8e-53
WP_000369722.1|1187606_1188518_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	36.1	1.1e-08
WP_000134963.1|1189283_1190219_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	49.2	2.9e-84
>prophage 90
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1194622	1197469	2752113		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000662681.1|1194622_1197469_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.1	0.0e+00
>prophage 91
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1200787	1201627	2752113		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000749383.1|1200787_1201627_-	CHAP domain-containing protein	NA	A0A2H4J675	uncultured_Caudovirales_phage	42.2	3.5e-12
>prophage 92
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1207705	1213418	2752113		Streptococcus_phage(66.67%)	5	NA	NA
WP_164026013.1|1207705_1208788_-	DEAD/DEAH box helicase family protein	NA	A0A1X9I5S6	Streptococcus_phage	35.2	1.3e-43
WP_164026014.1|1209151_1210018_-	DegV family EDD domain-containing protein	NA	NA	NA	NA	NA
WP_000192957.1|1210161_1210803_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	48.3	3.1e-37
WP_000258151.1|1210974_1212030_-	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_000460983.1|1212347_1213418_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.5	1.3e-16
>prophage 93
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1222697	1246259	2752113		uncultured_Caudovirales_phage(35.71%)	19	NA	NA
WP_000616842.1|1222697_1223459_-	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	31.6	8.5e-18
WP_001245577.1|1223455_1224412_-	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4J116	uncultured_Caudovirales_phage	57.8	1.2e-05
WP_164026017.1|1224398_1225370_-	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	78.6	1.6e-138
WP_000499195.1|1225408_1225564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000562498.1|1226077_1227049_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A2H4J4P3	uncultured_Caudovirales_phage	91.3	4.2e-171
WP_000855505.1|1227166_1229272_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4J2N6	uncultured_Caudovirales_phage	91.7	0.0e+00
WP_000692521.1|1229234_1229633_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A2H4J545	uncultured_Caudovirales_phage	72.0	1.2e-52
WP_001068497.1|1230433_1231300_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000930014.1|1231319_1231820_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	71.5	5.9e-52
WP_000193751.1|1232160_1233666_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.2	2.0e-58
WP_031797439.1|1233743_1233845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000429006.1|1233934_1234852_+	diacylglycerol kinase family lipid kinase	NA	A0A1V0SBJ0	Catovirus	22.0	2.1e-07
WP_000197275.1|1235531_1236074_-	5'-3'-deoxyribonucleotidase	NA	NA	NA	NA	NA
WP_164026020.1|1236368_1237427_-	histidinol-phosphate transaminase	NA	A0A0H3TLT9	Faustovirus	27.3	1.5e-20
WP_164026023.1|1237666_1239181_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_164026025.1|1239173_1240151_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	33.3	5.4e-25
WP_000983677.1|1240372_1242154_-	DNA helicase RecQ	NA	A0A2P1EM61	Moumouvirus	37.0	6.5e-77
WP_000525103.1|1242165_1244049_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.8	6.7e-56
WP_000098285.1|1244318_1246259_-	polyglycerol-phosphate lipoteichoic acid synthase LtaS	NA	W6LM83	Streptococcus_phage	39.5	1.3e-110
>prophage 94
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1249398	1259245	2752113		Pandoravirus(12.5%)	12	NA	NA
WP_001217794.1|1249398_1250550_-	anthranilate synthase component I family protein	NA	S4VNU7	Pandoravirus	36.1	3.5e-23
WP_000604515.1|1250533_1251127_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	43.5	1.2e-38
WP_000446724.1|1251477_1252146_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	57.5	9.6e-66
WP_000941336.1|1252147_1252567_+	6-carboxytetrahydropterin synthase QueD	NA	S4U060	uncultured_phage	28.7	6.3e-07
WP_164026027.1|1252570_1253284_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	43.5	1.1e-51
WP_000637687.1|1253382_1253967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001093556.1|1254246_1254687_+	DM13 domain-containing protein	NA	NA	NA	NA	NA
WP_001037807.1|1255029_1255503_+	DoxX family protein	NA	NA	NA	NA	NA
WP_000149344.1|1255477_1256164_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000244415.1|1256163_1257219_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	29.8	3.6e-14
WP_000702781.1|1257290_1258274_-	glycosyltransferase family 2 protein	NA	A0A192Y8W7	Salmonella_phage	43.3	1.5e-62
WP_000931237.1|1258405_1259245_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.3	5.1e-56
>prophage 95
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1270857	1272231	2752113		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000952032.1|1270857_1272231_-	deoxyribodipyrimidine photo-lyase	NA	A0A167RC11	Powai_lake_megavirus	34.1	1.6e-46
>prophage 96
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1277208	1283488	2752113		Bacillus_phage(33.33%)	6	NA	NA
WP_000857620.1|1277208_1278882_-	amino acid ABC transporter ATP-binding/permease protein	NA	W8CYL7	Bacillus_phage	23.4	3.4e-11
WP_000737159.1|1278878_1280510_-	ABC transporter ATP-binding protein/permease	NA	W5SAS9	Pithovirus	29.2	3.6e-13
WP_000469890.1|1280728_1281604_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_000358498.1|1281775_1282459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000148828.1|1282461_1282920_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_000820892.1|1282921_1283488_+	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	36.9	6.1e-21
>prophage 97
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1290686	1291160	2752113		Pandoravirus(100.0%)	1	NA	NA
WP_000833486.1|1290686_1291160_-	cupin	NA	A0A291AU44	Pandoravirus	39.4	1.6e-14
>prophage 98
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1296422	1297220	2752113		Bacillus_phage(100.0%)	1	NA	NA
WP_000731641.1|1296422_1297220_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A223LD43	Bacillus_phage	30.2	9.3e-07
>prophage 99
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1302052	1302814	2752113		Planktothrix_phage(100.0%)	1	NA	NA
WP_000985996.1|1302052_1302814_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.8	7.2e-33
>prophage 100
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1307188	1308232	2752113		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_001030771.1|1307188_1308232_-	alpha/beta hydrolase	NA	A0A0G2YDK2	Acanthamoeba_polyphaga_mimivirus	26.6	2.0e-17
>prophage 101
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1314755	1315553	2752113		Planktothrix_phage(100.0%)	1	NA	NA
WP_001080809.1|1314755_1315553_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.7	1.1e-18
>prophage 102
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1318778	1322737	2752113		Bacillus_phage(33.33%)	3	NA	NA
WP_000817956.1|1318778_1320506_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	43.3	9.7e-110
WP_000793075.1|1320926_1322222_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	26.6	5.7e-14
WP_000832260.1|1322338_1322737_-	glycerol-3-phosphate cytidylyltransferase	NA	A0A222YWT0	Streptomyces_phage	39.9	3.2e-16
>prophage 103
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1329671	1330415	2752113		Indivirus(100.0%)	1	NA	NA
WP_000894464.1|1329671_1330415_+	metal ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.7	1.2e-11
>prophage 104
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1341566	1342127	2752113	integrase	Streptococcus_phage(100.0%)	1	1335720:1335734	1345715:1345729
1335720:1335734	attL	TTTTGATACCATTTC	NA	NA	NA	NA
WP_164026048.1|1341566_1342127_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A141E172	Streptococcus_phage	35.1	1.3e-18
WP_164026048.1|1341566_1342127_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A141E172	Streptococcus_phage	35.1	1.3e-18
1345715:1345729	attR	TTTTGATACCATTTC	NA	NA	NA	NA
>prophage 105
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1355078	1358432	2752113		Tupanvirus(50.0%)	3	NA	NA
WP_001200748.1|1355078_1356089_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	27.3	5.6e-33
WP_001788287.1|1356587_1357109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000180230.1|1357136_1358432_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	27.9	2.1e-24
>prophage 106
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1371208	1372531	2752113		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000860587.1|1371208_1372531_+	FAD-containing oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.1	2.4e-108
>prophage 107
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1383835	1384492	2752113		Elephant_endotheliotropic_herpesvirus(100.0%)	1	NA	NA
WP_000455256.1|1383835_1384492_-	uracil-DNA glycosylase	NA	U5U4C1	Elephant_endotheliotropic_herpesvirus	46.4	1.1e-45
>prophage 108
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1388133	1391454	2752113		Staphylococcus_phage(50.0%)	2	NA	NA
WP_001100835.1|1388133_1389510_-	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	24.5	3.9e-21
WP_000347061.1|1390053_1391454_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	32.8	9.4e-55
>prophage 109
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1410815	1411478	2752113		Enterococcus_phage(100.0%)	1	NA	NA
WP_164026073.1|1410815_1411478_+	deoxynucleoside kinase	NA	A0A0M3UL55	Enterococcus_phage	36.9	4.1e-24
>prophage 110
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1418058	1419246	2752113		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000250823.1|1418058_1419246_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	30.6	4.4e-45
>prophage 111
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1422274	1433228	2752113		Streptococcus_phage(33.33%)	6	NA	NA
WP_000090315.1|1422274_1424356_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.3	2.7e-66
WP_001137495.1|1424478_1424949_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_001142337.1|1425014_1425428_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000031892.1|1425525_1425780_-	50S ribosomal protein L7ae-like protein	NA	NA	NA	NA	NA
WP_001788197.1|1425916_1429513_-	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	24.6	3.3e-67
WP_000918667.1|1429676_1433228_-	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	24.3	2.1e-50
>prophage 112
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1436912	1441695	2752113	tRNA	Bacillus_virus(50.0%)	8	NA	NA
WP_001288302.1|1436912_1437461_-	transcription termination/antitermination protein NusG	NA	G3MAW2	Bacillus_virus	33.5	8.6e-12
WP_001074473.1|1437473_1437656_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_001788193.1|1437711_1437855_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000872874.1|1437969_1438539_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_000664738.1|1438619_1439144_-	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_000390332.1|1439143_1439890_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000370182.1|1439897_1440302_-	Mini-ribonuclease 3	NA	NA	NA	NA	NA
WP_000631974.1|1440294_1441695_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	32.2	1.5e-55
>prophage 113
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1447705	1450162	2752113	protease	Escherichia_phage(100.0%)	1	NA	NA
WP_000897132.1|1447705_1450162_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A1C3S747	Escherichia_phage	41.2	1.4e-133
>prophage 114
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1469088	1479360	2752113	tRNA	Catovirus(16.67%)	10	NA	NA
WP_001288202.1|1469088_1470576_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	41.1	2.1e-92
WP_001790128.1|1470628_1470721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000613716.1|1471114_1471591_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_001154302.1|1471587_1471953_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_000167923.1|1471930_1472734_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	29.3	3.9e-21
WP_000057594.1|1472949_1473882_-	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	65.7	3.7e-108
WP_000148605.1|1474060_1474942_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_001167888.1|1475170_1477264_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5EQ50	Micromonas_sp._RCC1109_virus	42.7	4.0e-110
WP_000551283.1|1477520_1478060_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	29.8	6.5e-12
WP_001176700.1|1478064_1479360_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	A0A1V0SI91	Klosneuvirus	24.5	8.2e-13
>prophage 115
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1490137	1492602	2752113		Hokovirus(50.0%)	2	NA	NA
WP_000933774.1|1490137_1491103_-	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	35.4	6.1e-45
WP_001252529.1|1491249_1492602_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L821	Tupanvirus	30.4	8.3e-24
>prophage 116
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1498486	1501584	2752113	tRNA	Klosneuvirus(50.0%)	2	NA	NA
WP_001051129.1|1498486_1500460_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	36.2	1.5e-93
WP_000279926.1|1500744_1501584_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	45.8	2.7e-57
>prophage 117
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1505490	1506108	2752113		Streptococcus_phage(100.0%)	1	NA	NA
WP_001272126.1|1505490_1506108_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	48.3	9.2e-47
>prophage 118
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1515158	1516856	2752113		Streptococcus_virus(100.0%)	1	NA	NA
WP_001109057.1|1515158_1516856_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	42.3	2.5e-54
>prophage 119
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1533507	1539747	2752113		Lactobacillus_phage(33.33%)	6	NA	NA
WP_001170268.1|1533507_1534512_-	autolysin/adhesin Aaa	NA	A0A0A7NU10	Lactobacillus_phage	41.0	3.6e-24
WP_000825526.1|1534843_1535686_-	dipeptide ABC transporter glycylmethionine-binding lipoprotein	NA	NA	NA	NA	NA
WP_000468001.1|1535722_1536382_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569288.1|1536385_1537411_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.3	8.2e-32
WP_001036664.1|1537706_1538849_-	bifunctional cystathionine gamma-lyase/homocysteine desulfhydrase	NA	NA	NA	NA	NA
WP_000634094.1|1538832_1539747_-	cysteine synthase family protein	NA	A0A1W6JIM2	Lactococcus_phage	39.9	1.7e-49
>prophage 120
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1566718	1569506	2752113		Staphylococcus_phage(100.0%)	2	NA	NA
WP_000072586.1|1566718_1567957_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	63.4	2.1e-130
WP_000028648.1|1567949_1569506_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	99.0	2.6e-287
>prophage 121
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1583279	1589091	2752113	transposase	Paenibacillus_phage(25.0%)	5	NA	NA
WP_000159785.1|1583279_1583588_+|transposase	transposase	transposase	A0A0C5AJ30	Paenibacillus_phage	51.9	2.2e-12
WP_000041883.1|1584312_1585017_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	U5U4R0	Staphylococcus_phage	37.6	2.6e-29
WP_000551776.1|1585409_1585946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000424963.1|1586058_1587600_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	32.6	1.2e-23
WP_000264071.1|1587624_1589091_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.5	5.2e-96
>prophage 122
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1597972	1599496	2752113		Enterococcus_phage(100.0%)	1	NA	NA
WP_164026126.1|1597972_1599496_+	alkyl hydroperoxide reductase subunit F	NA	A0A249XZT7	Enterococcus_phage	33.2	4.2e-40
>prophage 123
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1607068	1615485	2752113	integrase	Staphylococcus_phage(60.0%)	11	1601550:1601563	1610529:1610542
1601550:1601563	attL	AATATATTATGCAA	NA	NA	NA	NA
WP_000237576.1|1607068_1607227_+|integrase	integrase	integrase	Q4ZE80	Staphylococcus_phage	64.4	2.8e-08
WP_001817700.1|1607653_1608592_+	Abi family protein	NA	NA	NA	NA	NA
WP_000897044.1|1608857_1609100_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_106669570.1|1609151_1609655_-	single-stranded DNA-binding protein	NA	A0A1W6JPL9	Staphylococcus_phage	74.1	1.6e-60
WP_001261460.1|1609675_1609972_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001052483.1|1610215_1610407_+	hypothetical protein	NA	U3PCX8	Staphylococcus_phage	80.0	4.9e-23
WP_001218732.1|1610492_1611590_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
1610529:1610542	attR	TTGCATAATATATT	NA	NA	NA	NA
WP_000157345.1|1611601_1611805_-	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_001077602.1|1611834_1612716_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_001566903.1|1612872_1613718_-	ParB/RepB/Spo0J family partition protein	NA	A0A1C9EHW0	Gordonia_phage	34.4	1.6e-12
WP_000655707.1|1614381_1615485_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A0B5JD48	Pandoravirus	29.0	4.6e-12
>prophage 124
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1625420	1626263	2752113		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_000209549.1|1625420_1626263_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.2	2.9e-11
>prophage 125
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1647533	1650268	2752113		Bodo_saltans_virus(50.0%)	3	NA	NA
WP_000280804.1|1647533_1648556_-	lipoate--protein ligase	NA	A0A2H4UVX5	Bodo_saltans_virus	29.7	1.1e-09
WP_001191953.1|1648533_1649478_-	NAD-dependent deacetylase	NA	NA	NA	NA	NA
WP_000449077.1|1649467_1650268_-	protein-ADP-ribose hydrolase	NA	A0A2K9L8X2	Tupanvirus	43.9	5.2e-42
>prophage 126
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1668499	1669177	2752113		Planktothrix_phage(100.0%)	1	NA	NA
WP_000911017.1|1668499_1669177_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	1.6e-31
>prophage 127
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1691271	1695711	2752113		Mycobacterium_phage(100.0%)	1	NA	NA
WP_164026139.1|1691271_1695711_-	type VII secretion protein EssC	NA	V5UPA0	Mycobacterium_phage	24.3	8.2e-28
>prophage 128
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1708346	1710008	2752113		Amsacta_moorei_entomopoxvirus(50.0%)	2	NA	NA
WP_164026140.1|1708346_1709006_+	ATP-binding cassette domain-containing protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	36.7	9.9e-23
WP_000736795.1|1709057_1710008_-	glycine-glycine endopeptidase LytM	NA	V5R8R0	Arthrobacter_phage	42.7	1.5e-16
>prophage 129
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1718394	1719831	2752113		Pandoravirus(100.0%)	1	NA	NA
WP_000164001.1|1718394_1719831_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.2	3.7e-30
>prophage 130
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1723591	1728130	2752113		Enterobacteria_phage(50.0%)	3	NA	NA
WP_000925394.1|1723591_1725331_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	31.5	1.5e-62
WP_164026145.1|1725590_1726265_-	iron-sulfur cluster repair di-iron protein ScdA	NA	NA	NA	NA	NA
WP_164026147.1|1726408_1728130_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	37.4	2.1e-11
>prophage 131
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1737457	1738501	2752113		Synechococcus_phage(100.0%)	1	NA	NA
WP_000645604.1|1737457_1738501_-	galactitol-1-phosphate 5-dehydrogenase	NA	E3SJ82	Synechococcus_phage	24.6	4.6e-14
>prophage 132
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1745715	1747245	2752113		Vibrio_phage(100.0%)	1	NA	NA
WP_000838210.1|1745715_1747245_+	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	52.0	2.4e-11
>prophage 133
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1756120	1757626	2752113		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001008405.1|1756120_1757626_+	acyl--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.9	6.0e-39
>prophage 134
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1768907	1774266	2752113		Tetraselmis_virus(50.0%)	3	NA	NA
WP_000894660.1|1768907_1771157_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	45.1	1.7e-186
WP_164026151.1|1771744_1772713_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_000127990.1|1772709_1774266_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	27.2	5.8e-13
>prophage 135
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1784473	1786541	2752113		Planktothrix_phage(50.0%)	2	NA	NA
WP_000818913.1|1784473_1785571_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	35.6	1.4e-24
WP_001815512.1|1785953_1786541_-	M23 family metallopeptidase	NA	A0A2K9VGT1	Pontimonas_phage	40.1	1.3e-13
>prophage 136
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1795056	1798244	2752113		Planktothrix_phage(33.33%)	3	NA	NA
WP_000067358.1|1795056_1796649_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.2	3.5e-21
WP_000794565.1|1797158_1797356_-	helix-turn-helix transcriptional regulator	NA	A0A1V0E021	Clostridioides_phage	43.3	2.1e-05
WP_000960712.1|1797521_1798244_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	34.8	4.1e-22
>prophage 137
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1802115	1802796	2752113		Planktothrix_phage(100.0%)	1	NA	NA
WP_000571407.1|1802115_1802796_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.0	2.9e-33
>prophage 138
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1819604	1820789	2752113		Klosneuvirus(100.0%)	1	NA	NA
WP_001084434.1|1819604_1820789_+	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.2	7.0e-35
>prophage 139
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1825623	1835907	2752113		Tupanvirus(50.0%)	3	NA	NA
WP_076749343.1|1825623_1832799_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	29.4	2.6e-68
WP_000826862.1|1833245_1834496_-	MFS transporter	NA	NA	NA	NA	NA
WP_000706137.1|1834881_1835907_-	NAD-dependent formate dehydrogenase	NA	A0A1V0SBV6	Catovirus	33.9	2.9e-29
>prophage 140
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1839445	1842617	2752113		Bacillus_virus(50.0%)	4	NA	NA
WP_000590860.1|1839445_1840186_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	41.1	2.2e-39
WP_000171919.1|1840527_1841040_-	DUF4242 domain-containing protein	NA	NA	NA	NA	NA
WP_000356963.1|1841218_1841422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001013481.1|1841657_1842617_-	cation transporter	NA	A0A1V0SED0	Indivirus	34.2	1.2e-11
>prophage 141
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1845958	1848443	2752113		Catovirus(50.0%)	2	NA	NA
WP_164026163.1|1845958_1847104_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	26.1	1.6e-23
WP_000779494.1|1847180_1848443_-	nucleotide sugar dehydrogenase	NA	A0A127AXI2	Bacillus_phage	25.8	5.0e-23
>prophage 142
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1855278	1861843	2752113		Catovirus(50.0%)	6	NA	NA
WP_000413171.1|1855278_1856403_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SJE0	Klosneuvirus	59.6	6.7e-128
WP_001028282.1|1856406_1857516_-	capsular polysaccharide biosynthesis protein CapF	NA	NA	NA	NA	NA
WP_000459066.1|1857528_1858557_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	35.3	2.0e-41
WP_164026165.1|1858600_1860370_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	31.3	1.7e-29
WP_000565294.1|1860389_1861154_-	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_000037328.1|1861156_1861843_-	tyrosine-protein kinase	NA	A0A1X9I5D6	Streptococcus_phage	36.1	3.7e-28
>prophage 143
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1865865	1867041	2752113		Clostridium_phage(100.0%)	1	NA	NA
WP_000469831.1|1865865_1867041_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	27.6	1.1e-29
>prophage 144
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1872480	1873254	2752113		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078092.1|1872480_1873254_+	phosphonate ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.1	3.8e-13
>prophage 145
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1881288	1881888	2752113		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_000874681.1|1881288_1881888_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	50.2	7.6e-54
>prophage 146
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1886825	1887806	2752113		Catovirus(100.0%)	1	NA	NA
WP_001793242.1|1886825_1887806_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SAI6	Catovirus	37.0	1.0e-47
>prophage 147
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1891176	1892379	2752113		Tupanvirus(100.0%)	1	NA	NA
WP_001223704.1|1891176_1892379_-	staphyloferrin B biosynthesis decarboxylase SbnH	NA	A0A2K9L4I2	Tupanvirus	20.8	1.1e-08
>prophage 148
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1900645	1904855	2752113		Lactococcus_phage(50.0%)	4	NA	NA
WP_000570808.1|1900645_1901626_-	2,3-diaminopropionate biosynthesis protein SbnA	NA	A0A1W6JHY1	Lactococcus_phage	35.6	2.1e-40
WP_001045111.1|1901856_1902849_+	staphyloferrin B ABC transporter substrate-binding protein SirA	NA	NA	NA	NA	NA
WP_000924990.1|1902864_1903860_+	staphyloferrin B ABC transporter permease subunit SirB	NA	NA	NA	NA	NA
WP_000136636.1|1903856_1904855_+	staphyloferrin B ABC transporter permease subunit SirC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.5	1.2e-14
>prophage 149
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1936895	1937963	2752113		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000816128.1|1936895_1937963_-	persulfide response sulfurtransferase CstA	NA	A0A2H4PQR9	Staphylococcus_phage	41.5	3.5e-09
>prophage 150
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1941187	1947036	2752113		Liberibacter_phage(50.0%)	3	NA	NA
WP_024273384.1|1941187_1944316_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	30.9	2.7e-70
WP_000394003.1|1944299_1945532_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_000190898.1|1945521_1947036_-	SAM-dependent DNA methyltransferase	NA	A0A2H4PQP4	Staphylococcus_phage	29.8	2.3e-46
>prophage 151
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1952261	1962278	2752113		Bacillus_phage(40.0%)	7	NA	NA
WP_000088649.1|1952261_1953062_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	35.9	1.0e-37
WP_001104177.1|1953457_1954246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001060140.1|1954246_1955581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000871607.1|1955573_1957400_-	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	31.3	1.6e-30
WP_000101976.1|1957412_1958114_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.2	3.5e-42
WP_000095328.1|1959316_1960600_-	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	34.6	1.8e-68
WP_164026176.1|1960877_1962278_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	48.1	5.4e-111
>prophage 152
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1968969	1978008	2752113	tRNA	Bacillus_virus(50.0%)	5	NA	NA
WP_000884334.1|1968969_1970256_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.2	2.7e-88
WP_000177458.1|1970634_1972149_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	38.4	1.5e-90
WP_000449218.1|1972474_1973287_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_000819084.1|1973373_1976037_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	35.9	2.7e-119
WP_000255578.1|1976073_1978008_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	44.9	5.7e-143
>prophage 153
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	1988090	1994657	2752113		Faecalibacterium_phage(25.0%)	8	NA	NA
WP_000742837.1|1988090_1988930_+	nucleoid occlusion protein	NA	A0A2K9V477	Faecalibacterium_phage	23.8	2.2e-06
WP_000491382.1|1989380_1989734_+	DUF3147 family protein	NA	NA	NA	NA	NA
WP_000779136.1|1989801_1990197_+	DUF3147 family protein	NA	NA	NA	NA	NA
WP_001054118.1|1990456_1991026_+	helix-turn-helix domain-containing protein	NA	D2XQ11	Bacillus_virus	33.3	6.2e-05
WP_001059079.1|1991151_1991352_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	69.8	3.4e-19
WP_000672039.1|1991744_1991936_-	peptide resistance ABC transporter activity modulator VraH	NA	NA	NA	NA	NA
WP_000143652.1|1992028_1993909_-	peptide resistance ABC transporter permease subunit VraE	NA	NA	NA	NA	NA
WP_000154162.1|1993898_1994657_-	peptide resistance ABC transporter ATP-binding subunit VraD	NA	G9BWD6	Planktothrix_phage	39.5	9.0e-36
>prophage 154
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	2007962	2009675	2752113		Planktothrix_phage(100.0%)	1	NA	NA
WP_000138656.1|2007962_2009675_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	1.4e-20
>prophage 155
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	2015303	2016317	2752113		Faustovirus(100.0%)	1	NA	NA
WP_164026180.1|2015303_2016317_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A1X7QHI1	Faustovirus	22.2	2.1e-08
>prophage 156
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	2028815	2029508	2752113		Streptococcus_phage(100.0%)	1	NA	NA
WP_164026184.1|2028815_2029508_+	polysaccharide biosynthesis tyrosine autokinase	NA	A0A1X9I5D6	Streptococcus_phage	38.5	5.7e-29
>prophage 157
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	2055621	2057481	2752113		Enterococcus_phage(100.0%)	1	NA	NA
WP_001125609.1|2055621_2057481_-	amidase domain-containing protein	NA	A0A249Y0X5	Enterococcus_phage	37.3	9.7e-15
>prophage 158
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	2082915	2084666	2752113		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_000143426.1|2082915_2083803_+	sensor histidine kinase	NA	Q8QNA2	Ectocarpus_siliculosus_virus	22.5	3.3e-05
WP_164026217.1|2083910_2084666_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.4	1.9e-30
>prophage 159
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	2088086	2088584	2752113		Canarypox_virus(100.0%)	1	NA	NA
WP_001065268.1|2088086_2088584_+	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	33.1	1.8e-21
>prophage 160
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	2093635	2096019	2752113		Enterococcus_phage(100.0%)	2	NA	NA
WP_001071713.1|2093635_2095486_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	64.3	2.1e-235
WP_000173331.1|2095482_2096019_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	48.0	3.9e-41
>prophage 161
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	2101864	2111978	2752113	holin	Klosneuvirus(50.0%)	9	NA	NA
WP_000066516.1|2101864_2103574_+|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	32.3	2.2e-58
WP_000011688.1|2103851_2104064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001028786.1|2104343_2104787_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_001172348.1|2104980_2106579_+	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	36.8	6.9e-78
WP_001791980.1|2106638_2106968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164026223.1|2107263_2108760_+	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_001031400.1|2108953_2109844_-	fructose bisphosphate aldolase	NA	A0A0K0KVJ8	Prochlorococcus_phage	29.2	7.2e-08
WP_001237629.1|2109966_2110383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000030064.1|2110640_2111978_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.7	3.0e-18
>prophage 162
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	2141279	2145067	2752113		Staphylococcus_phage(50.0%)	3	NA	NA
WP_000751267.1|2141279_2141981_+	lytic transglycosylase IsaA	NA	Q4Z8Z7	Staphylococcus_phage	46.4	4.0e-38
WP_000996736.1|2142256_2142745_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000379821.1|2143255_2145067_+	acetyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	31.5	1.3e-35
>prophage 163
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	2153500	2157621	2752113		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
WP_000161366.1|2153500_2154499_+	D-lactate dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	30.2	2.6e-35
WP_000076661.1|2154588_2154795_-	copper chaperone CopZ	NA	NA	NA	NA	NA
WP_164026241.1|2155212_2157621_-	heavy metal translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	41.0	3.2e-127
>prophage 164
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	2166855	2169891	2752113	protease	Enterobacteria_phage(50.0%)	2	NA	NA
WP_001058988.1|2166855_2168961_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	38.5	3.1e-118
WP_000455994.1|2169369_2169891_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.3	9.0e-27
>prophage 165
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	2176314	2182684	2752113		Yellowstone_lake_phycodnavirus(33.33%)	5	NA	NA
WP_164026250.1|2176314_2178054_+	pyruvate oxidase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	1.0e-34
WP_000473680.1|2178354_2180421_+	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	43.3	8.3e-07
WP_000206033.1|2180786_2181197_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_000240662.1|2181238_2181583_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_001228169.1|2181715_2182684_+	alpha/beta hydrolase	NA	A0A167RJ59	Powai_lake_megavirus	26.5	5.2e-12
>prophage 166
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	2192399	2193392	2752113		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_000161536.1|2192399_2193392_-	D-lactate dehydrogenase	NA	M1HYB0	Acanthocystis_turfacea_Chlorella_virus	31.5	1.1e-36
>prophage 167
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	2202672	2203368	2752113		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000382899.1|2202672_2203368_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	38.9	4.7e-39
>prophage 168
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	2224261	2225128	2752113		Bacillus_phage(100.0%)	1	NA	NA
WP_164026268.1|2224261_2225128_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	52.6	3.7e-78
>prophage 169
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	2234080	2239276	2752113		Streptococcus_phage(50.0%)	3	NA	NA
WP_076079486.1|2234080_2235889_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	37.7	1.3e-93
WP_164026272.1|2236020_2236413_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_000088720.1|2236414_2239276_+	DUF3427 domain-containing protein	NA	Q5YA94	Bacillus_phage	27.9	2.4e-28
>prophage 170
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	2243868	2244564	2752113		Bacillus_phage(100.0%)	1	NA	NA
WP_000217471.1|2243868_2244564_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	37.5	2.3e-09
>prophage 171
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	2247992	2248811	2752113		Moumouvirus(100.0%)	1	NA	NA
WP_000824941.1|2247992_2248811_+	SDR family oxidoreductase	NA	A0A2P1ELN2	Moumouvirus	27.7	5.0e-08
>prophage 172
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	2256690	2258248	2752113		Planktothrix_phage(50.0%)	2	NA	NA
WP_000173875.1|2256690_2257506_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.8	4.7e-14
WP_000590512.1|2257498_2258248_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	3.1e-20
>prophage 173
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	2265366	2269795	2752113		Organic_Lake_phycodnavirus(50.0%)	4	NA	NA
WP_000923523.1|2265366_2266029_+	ATP-binding cassette domain-containing protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.8	4.2e-21
WP_000072147.1|2266021_2266798_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_164026282.1|2267193_2268381_+	MFS transporter	NA	NA	NA	NA	NA
WP_000700926.1|2268442_2269795_-	carboxylesterase/lipase family protein	NA	A0A0B5J865	Pandoravirus	33.3	2.8e-11
>prophage 174
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	2273482	2275341	2752113		Mycoplasma_phage(50.0%)	2	NA	NA
WP_000948979.1|2273482_2274709_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	50.5	6.6e-20
WP_000569120.1|2274705_2275341_+	ABC transporter permease	NA	G3M9Y4	Bacillus_virus	26.2	9.0e-05
>prophage 175
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	2293067	2299320	2752113		Bacillus_phage(66.67%)	5	NA	NA
WP_001176863.1|2293067_2294210_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	44.3	5.3e-56
WP_000779360.1|2294467_2294854_+	GtrA family protein	NA	NA	NA	NA	NA
WP_000482647.1|2294987_2295095_+	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_001064814.1|2295798_2297562_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.7	2.5e-36
WP_000486494.1|2297586_2299320_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.7	9.0e-31
>prophage 176
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	2302781	2308552	2752113		Staphylococcus_phage(75.0%)	6	NA	NA
WP_000971550.1|2302781_2303897_+	pyridoxal phosphate-dependent aminotransferase family protein	NA	V5LQ39	Emiliania_huxleyi_virus	24.7	1.6e-20
WP_000286877.1|2303907_2304600_+	6-carboxyhexanoate--CoA ligase	NA	NA	NA	NA	NA
WP_000200948.1|2304610_2305078_+	QueT transporter family protein	NA	NA	NA	NA	NA
WP_164026290.1|2305129_2306107_-	beta-channel forming cytolysin	NA	A0A2H4PQH7	Staphylococcus_phage	75.9	4.6e-141
WP_164026292.1|2306108_2307056_-	beta-channel forming cytolysin	NA	A0A2I6PER8	Staphylococcus_phage	77.1	2.1e-138
WP_000594519.1|2307622_2308552_-	bi-component gamma-hemolysin HlgAB subunit A	NA	A0A2H4PQI5	Staphylococcus_phage	71.1	3.2e-120
>prophage 177
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	2316498	2317230	2752113		Bacillus_virus(100.0%)	1	NA	NA
WP_000615461.1|2316498_2317230_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.7	4.1e-25
>prophage 178
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	2335415	2336975	2752113		Escherichia_phage(100.0%)	1	NA	NA
WP_000692645.1|2335415_2336975_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	46.8	4.4e-21
>prophage 179
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	2356365	2357400	2752113		Bacillus_virus(100.0%)	1	NA	NA
WP_000655972.1|2356365_2357400_+	NAD(P)/FAD-dependent oxidoreductase	NA	G3MA85	Bacillus_virus	26.6	5.8e-17
>prophage 180
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	2367260	2371157	2752113		Hokovirus(33.33%)	4	NA	NA
WP_000477328.1|2367260_2368634_-	heme sensor histidine kinase HssS	NA	A0A1V0SGX0	Hokovirus	29.8	1.3e-13
WP_000249497.1|2368626_2369301_-	DNA-binding heme response regulator HssR	NA	W8CYM9	Bacillus_phage	45.2	3.6e-52
WP_000761411.1|2369436_2370492_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001229911.1|2370491_2371157_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.8	1.2e-36
>prophage 181
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	2374896	2376105	2752113		Salmonella_phage(100.0%)	1	NA	NA
WP_000999168.1|2374896_2376105_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.4	4.6e-34
>prophage 182
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	2388226	2389126	2752113		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000524831.1|2388226_2389126_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.7	1.2e-15
>prophage 183
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	2401945	2402827	2752113		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000730034.1|2401945_2402827_+	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	45.9	3.8e-62
>prophage 184
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	2410705	2411341	2752113		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000285450.1|2410705_2411341_+	HAD family hydrolase	NA	A7J6N1	Paramecium_bursaria_Chlorella_virus	27.1	1.6e-09
>prophage 185
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	2424906	2429301	2752113		Staphylococcus_phage(50.0%)	4	NA	NA
WP_011447058.1|2424906_2425545_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6JQU5	Staphylococcus_phage	48.1	2.6e-36
WP_000684141.1|2426269_2427394_+	NAD(P)-binding protein	NA	A0A2K9L3K5	Tupanvirus	22.8	5.5e-13
WP_000417016.1|2427485_2428439_-	2-hydroxyacid dehydrogenase	NA	A0A1V0SBV6	Catovirus	28.9	2.9e-31
WP_000737705.1|2428800_2429301_-	CHAP domain-containing protein	NA	A0A2R3ZXQ4	Staphylococcus_phage	39.3	2.0e-07
>prophage 186
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	2433217	2434021	2752113		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000717381.1|2433217_2434021_-	CHAP domain-containing protein	NA	A0A2R3ZXQ4	Staphylococcus_phage	41.3	9.3e-07
>prophage 187
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	2452997	2453603	2752113		Pithovirus(100.0%)	1	NA	NA
WP_024273547.1|2452997_2453603_+	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	30.1	6.6e-13
>prophage 188
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	2465685	2468853	2752113		Leptospira_phage(100.0%)	1	NA	NA
WP_164026351.1|2465685_2468853_+	MMPL family transporter	NA	S5VTK5	Leptospira_phage	21.8	8.1e-62
>prophage 189
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	2494290	2495957	2752113		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
WP_000389652.1|2494290_2495100_+	energy-coupling factor transporter ATPase	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.5	3.3e-20
WP_000155385.1|2495096_2495957_+	energy-coupling factor transporter ATPase	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	9.7e-10
>prophage 190
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	2499557	2501222	2752113		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000130155.1|2499557_2501222_+	acetolactate synthase AlsS	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	25.6	1.6e-45
>prophage 191
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	2506304	2507153	2752113		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001015500.1|2506304_2507153_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.2	2.0e-44
>prophage 192
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	2510183	2510924	2752113		Orpheovirus(100.0%)	1	NA	NA
WP_024273263.1|2510183_2510924_-	NAD-dependent protein deacylase	NA	A0A2I2L319	Orpheovirus	30.8	1.5e-14
>prophage 193
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	2517245	2518658	2752113		Pandoravirus(100.0%)	1	NA	NA
WP_000169224.1|2517245_2518658_+	6-phospho-beta-galactosidase	NA	A0A0B5JD41	Pandoravirus	28.9	3.0e-48
>prophage 194
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	2522624	2524187	2752113		Vibrio_phage(100.0%)	1	NA	NA
WP_000792338.1|2522624_2524187_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	24.8	1.6e-18
>prophage 195
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	2534389	2535358	2752113		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_164026369.1|2534389_2535358_+	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	28.9	3.0e-15
>prophage 196
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	2551182	2552091	2752113		Klosneuvirus(100.0%)	1	NA	NA
WP_000167867.1|2551182_2552091_+	arginase	NA	A0A1V0SJM8	Klosneuvirus	32.0	3.2e-27
>prophage 197
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	2555682	2563104	2752113		Staphylococcus_phage(100.0%)	1	NA	NA
WP_164026373.1|2555682_2563104_+	DUF1542 domain-containing protein	NA	A0A2H4PQU6	Staphylococcus_phage	37.9	2.5e-21
>prophage 198
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	2569360	2572180	2752113		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_164026378.1|2569360_2571166_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1H1Z3	Paramecium_bursaria_Chlorella_virus	38.4	8.9e-98
WP_000908182.1|2571397_2572180_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.1	3.3e-09
>prophage 199
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	2585185	2589018	2752113		Clostridium_phage(50.0%)	4	NA	NA
WP_000070866.1|2585185_2585629_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	53.7	5.6e-38
WP_000160304.1|2585749_2586460_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_001083324.1|2586774_2587437_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_001242311.1|2587716_2589018_+	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	58.9	3.6e-133
>prophage 200
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	2596956	2598567	2752113		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_000159960.1|2596956_2598567_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.6	2.7e-146
>prophage 201
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	2606370	2614120	2752113		Bacillus_virus(25.0%)	9	NA	NA
WP_000273356.1|2606370_2606970_+	thymidine kinase	NA	G3MBK1	Bacillus_virus	42.9	6.2e-32
WP_000460242.1|2606970_2608047_+	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_000248733.1|2608033_2608870_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_072362259.1|2608902_2610000_+	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	35.6	3.6e-41
WP_000697334.1|2609996_2610416_+	low molecular weight protein arginine phosphatase	NA	NA	NA	NA	NA
WP_000654185.1|2610522_2611047_+	TIGR01440 family protein	NA	NA	NA	NA	NA
WP_000120494.1|2611073_2612312_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	8.2e-103
WP_000048712.1|2612339_2612969_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_164026384.1|2612992_2614120_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	29.9	6.0e-28
>prophage 202
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	2624523	2624919	2752113		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000932694.1|2624523_2624919_+	single-stranded DNA-binding protein	NA	A0A1J0MFK5	Staphylococcus_phage	38.5	1.3e-14
>prophage 203
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	2631020	2631668	2752113		Moumouvirus(100.0%)	1	NA	NA
WP_164026391.1|2631020_2631668_-	HD domain-containing protein	NA	H2ED17	Moumouvirus	26.6	1.0e-08
>prophage 204
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	2638868	2640389	2752113		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_164026393.1|2638868_2640389_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.9	2.0e-58
>prophage 205
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	2646073	2648101	2752113		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000546597.1|2646073_2648101_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.5	2.3e-25
>prophage 206
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	2653251	2656636	2752113		Clostridium_botulinum_C_phage(50.0%)	5	NA	NA
WP_000621175.1|2653251_2653614_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	Q332J9	Clostridium_botulinum_C_phage	32.8	4.2e-07
WP_000390829.1|2653963_2654965_+	PP2C family protein-serine/threonine phosphatase	NA	NA	NA	NA	NA
WP_001052491.1|2655083_2655410_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_164026401.1|2655381_2655891_+	anti-sigma B factor RsbW	NA	NA	NA	NA	NA
WP_001041102.1|2655865_2656636_+	RNA polymerase sigma factor SigB	NA	A0A0A0RNH9	Bacillus_phage	34.9	1.3e-21
>prophage 207
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	2665843	2717038	2752113	protease,integrase,coat,tRNA,terminase,transposase	Staphylococcus_phage(44.0%)	55	2704407:2704426	2720068:2720087
WP_001808146.1|2665843_2667163_-|transposase	ISL3-like element IS1181 family transposase	transposase	NA	NA	NA	NA
WP_000688533.1|2667564_2667981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000216855.1|2668057_2669326_-	threonine ammonia-lyase IlvA	NA	NA	NA	NA	NA
WP_164026405.1|2669340_2669913_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_000531820.1|2669913_2671284_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_000221946.1|2671297_2672344_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_000094576.1|2672346_2673876_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	28.1	5.5e-08
WP_072399972.1|2673905_2674925_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_000196911.1|2675046_2675301_-	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_000047820.1|2675300_2677070_-	biosynthetic-type acetolactate synthase large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	30.1	5.3e-63
WP_001255780.1|2677097_2678786_-	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_001789600.1|2679103_2679259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072433195.1|2679323_2679758_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_001086742.1|2679738_2680401_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000372758.1|2680373_2680838_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_000159053.1|2680830_2681856_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	40.6	5.8e-62
WP_000106329.1|2681957_2683568_-	MutS family DNA mismatch repair protein	NA	A0A0N9R0S5	Chrysochromulina_ericina_virus	26.9	3.3e-19
WP_001792272.1|2684248_2684377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164026407.1|2684521_2686450_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	30.4	2.4e-53
WP_001283612.1|2686702_2687338_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_164026505.1|2687692_2688721_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_000581077.1|2688780_2689005_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_001052257.1|2689211_2690462_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	31.2	3.4e-40
WP_000790324.1|2690644_2691595_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_000141426.1|2691743_2693228_+	sucrose-6-phosphate hydrolase	NA	S6ATV4	Bacillus_phage	25.6	4.0e-19
WP_001253302.1|2693224_2694184_+	carbohydrate kinase	NA	NA	NA	NA	NA
WP_000688498.1|2694552_2695269_-	response regulator transcription factor	NA	A0A2H4J4Z6	uncultured_Caudovirales_phage	32.6	3.0e-25
WP_164026507.1|2695287_2696532_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_001093929.1|2696604_2696745_-	cyclic lactone autoinducer peptide	NA	NA	NA	NA	NA
WP_164026409.1|2696741_2697311_-	accessory gene regulator AgrB	NA	NA	NA	NA	NA
WP_001549197.1|2697546_2697681_+	delta-lysin family phenol-soluble modulin	NA	NA	NA	NA	NA
WP_000867940.1|2698276_2699062_-	carbon-nitrogen family hydrolase	NA	NA	NA	NA	NA
WP_000522384.1|2699422_2700049_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_164026410.1|2700245_2701505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000197635.1|2701529_2702273_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_164026412.1|2702447_2702732_+	co-chaperone GroES	NA	A0A221S386	uncultured_virus	45.2	4.7e-14
WP_000240645.1|2702807_2704424_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	54.7	3.4e-157
2704407:2704426	attL	ATGCCAGGAATGATGTAAAA	NA	NA	NA	NA
WP_000179345.1|2704492_2705665_-|integrase	site-specific integrase	integrase	A0A1W6JQD3	Staphylococcus_phage	98.2	3.5e-220
WP_000620857.1|2705678_2706353_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JGT9	uncultured_Caudovirales_phage	45.8	1.6e-39
WP_000153640.1|2706525_2706744_+	helix-turn-helix transcriptional regulator	NA	A0A2H4JB11	uncultured_Caudovirales_phage	66.7	1.3e-19
WP_000481967.1|2706748_2707066_+	helix-turn-helix domain-containing protein	NA	A0A1W6JQE0	Staphylococcus_phage	98.1	9.2e-51
WP_000708433.1|2707062_2707218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001231376.1|2707202_2707406_+	hypothetical protein	NA	A0A1W6JQF4	Staphylococcus_phage	98.5	2.0e-30
WP_162675796.1|2707407_2707791_+	pathogenicity island protein	NA	A0A1W6JQI7	Staphylococcus_phage	95.3	3.1e-61
WP_164026414.1|2707791_2708106_+	DUF1474 family protein	NA	A0A1W6JQH0	Staphylococcus_phage	57.0	3.2e-19
WP_164026416.1|2708176_2710429_+	DNA primase	NA	A0A2H4JCU9	uncultured_Caudovirales_phage	72.7	0.0e+00
WP_000567972.1|2710699_2711044_+	hypothetical protein	NA	A0A2H4JHE6	uncultured_Caudovirales_phage	73.5	5.2e-39
WP_164026418.1|2711045_2711687_+	pathogenicity island protein	NA	Q4ZE67	Staphylococcus_phage	91.5	5.7e-108
WP_164026420.1|2711985_2712327_+	pathogenicity island protein	NA	Q4ZE66	Staphylococcus_phage	98.2	4.2e-57
WP_162675849.1|2712357_2713011_+	hypothetical protein	NA	Q4ZE82	Staphylococcus_phage	98.6	2.9e-115
WP_164026422.1|2713063_2713591_+|coat	spore coat protein	coat	Q4ZE87	Staphylococcus_phage	95.4	5.4e-88
WP_162675847.1|2713722_2713935_+	pathogenicity island family protein	NA	Q4ZE86	Staphylococcus_phage	85.7	2.1e-27
WP_024273585.1|2713931_2714501_+|terminase	terminase small subunit	terminase	Q4ZE85	Staphylococcus_phage	97.4	3.9e-100
WP_164026425.1|2714684_2716154_+	MFS transporter	NA	NA	NA	NA	NA
WP_000879843.1|2716354_2717038_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
2720068:2720087	attR	ATGCCAGGAATGATGTAAAA	NA	NA	NA	NA
>prophage 208
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	2720794	2721421	2752113		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000216894.1|2720794_2721421_+	hypothetical protein	NA	C8CH40	Staphylococcus_phage	44.5	7.0e-42
>prophage 209
NZ_CP048431	Staphylococcus aureus strain SA1428 chromosome, complete genome	2752113	2727308	2751794	2752113	integrase,terminase	Staphylococcus_phage(73.81%)	44	2716338:2716354	2752090:2752106
2716338:2716354	attL	AGGTTTAAAGAAGCTTT	NA	NA	NA	NA
WP_164026427.1|2727308_2728361_+	bi-component leukocidin LukGH subunit H	NA	A0A1X9IGW5	Staphylococcus_phage	34.6	2.5e-36
WP_000595401.1|2728382_2729399_+	bi-component leukocidin LukGH subunit G	NA	A0A2I6PER8	Staphylococcus_phage	29.3	2.3e-26
WP_164026429.1|2730517_2731555_-|integrase	tyrosine-type recombinase/integrase	integrase	Q4ZCY6	Staphylococcus_virus	97.4	8.8e-175
WP_098692184.1|2731621_2731975_-	DUF1640 domain-containing protein	NA	Q4ZCY5	Staphylococcus_virus	96.6	2.7e-11
WP_098692171.1|2732075_2732555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164026451.1|2732586_2733051_-	toxin	NA	A0A2I6PEK4	Staphylococcus_phage	97.4	2.1e-83
WP_000429766.1|2733063_2733393_-	helix-turn-helix transcriptional regulator	NA	A0A2I6PEN2	Staphylococcus_phage	100.0	3.2e-54
WP_001115060.1|2733553_2733745_+	helix-turn-helix transcriptional regulator	NA	A0A2I6PEL6	Staphylococcus_phage	100.0	2.3e-28
WP_001001356.1|2733828_2734005_+	hypothetical protein	NA	A0A2I6PEL1	Staphylococcus_phage	100.0	8.8e-27
WP_000549549.1|2734001_2734232_-	hypothetical protein	NA	A0A2I6PE22	Staphylococcus_phage	97.4	1.8e-35
WP_095316866.1|2734288_2734486_+	hypothetical protein	NA	A7TWF5	Staphylococcus_phage	95.4	6.6e-23
WP_095321183.1|2734472_2734853_-	DUF2513 domain-containing protein	NA	Q4ZCQ5	Staphylococcus_virus	98.4	2.9e-67
WP_098692166.1|2734908_2735127_+	DUF2829 domain-containing protein	NA	A0A0H3U4C7	Staphylococcus_phage	55.6	2.8e-14
WP_098692165.1|2735115_2735445_-	hypothetical protein	NA	M9NS98	Staphylococcus_phage	60.6	1.4e-30
WP_098692183.1|2735504_2735825_+	DUF771 domain-containing protein	NA	A0A2I6PDH6	Staphylococcus_phage	97.2	2.1e-55
WP_001285948.1|2735821_2735983_+	DUF1270 domain-containing protein	NA	A9CR58	Staphylococcus_phage	98.1	1.1e-20
WP_000174994.1|2736061_2736385_+	hypothetical protein	NA	A0A2I6PF12	Staphylococcus_phage	100.0	5.9e-53
WP_000985976.1|2736399_2736762_+	hypothetical protein	NA	A0A2I6PF03	Staphylococcus_phage	100.0	4.9e-56
WP_107378073.1|2736758_2737925_+	DUF2800 domain-containing protein	NA	A7TWG4	Staphylococcus_phage	99.2	7.7e-220
WP_164026454.1|2737951_2738506_+	DUF2815 family protein	NA	M9QRS1	Staphylococcus_phage	99.5	7.2e-99
WP_164026456.1|2738574_2740527_+	DNA polymerase	NA	B7T0G8	Staphylococcus_virus	98.6	0.0e+00
WP_001164628.1|2740539_2740725_+	DUF3113 family protein	NA	A0A2I6PEM8	Staphylococcus_phage	98.4	2.1e-26
WP_042909074.1|2740724_2741126_+	phage DNA polymerase	NA	A0A2I6PEL5	Staphylococcus_phage	99.2	4.7e-68
WP_164026458.1|2741125_2741383_+	DUF3310 domain-containing protein	NA	A0A1X9H067	Staphylococcus_phage	98.8	1.7e-42
WP_015994746.1|2741385_2741586_+	hypothetical protein	NA	B7T0H2	Staphylococcus_virus	100.0	3.7e-29
WP_015994747.1|2741582_2742272_+	N-6 DNA methylase	NA	B7T0H3	Staphylococcus_virus	100.0	6.1e-132
WP_103213508.1|2742285_2742492_+	hypothetical protein	NA	B7T0H4	Staphylococcus_virus	98.5	5.1e-34
WP_000983952.1|2742920_2743115_+	hypothetical protein	NA	B7T0H6	Staphylococcus_virus	92.2	2.4e-25
WP_164026460.1|2743111_2743549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164026462.1|2743545_2743830_+	hypothetical protein	NA	Q9MBR2	Staphylococcus_prophage	91.5	7.0e-42
WP_162637865.1|2743822_2744077_+	DUF1024 family protein	NA	A0A0H4IP74	Staphylococcus_phage	97.6	4.6e-37
WP_162637864.1|2744063_2744306_+	hypothetical protein	NA	A0A2H4JHI8	uncultured_Caudovirales_phage	85.0	5.2e-30
WP_164026464.1|2744298_2744835_+	dUTPase	NA	A0A1P8L6E0	Staphylococcus_phage	99.4	1.0e-94
WP_164026466.1|2745110_2745329_+	DUF1381 domain-containing protein	NA	A0A2I6PDB6	Staphylococcus_phage	95.3	2.0e-25
WP_117219955.1|2745312_2745549_+	hypothetical protein	NA	Q4ZA37	Staphylococcus_virus	97.4	9.6e-37
WP_000595260.1|2745541_2745694_+	transcriptional activator RinB	NA	A7TWI2	Staphylococcus_phage	100.0	2.6e-19
WP_000265258.1|2745761_2745962_+	DUF1514 family protein	NA	A0A2I6PF41	Staphylococcus_phage	100.0	2.9e-26
WP_094978771.1|2747405_2748461_+	hypothetical protein	NA	A0A0K1LKN1	Staphylococcus_phage	100.0	3.6e-208
WP_001801650.1|2748569_2748668_-	hypothetical protein	NA	A0A2I6PDP6	Staphylococcus_phage	100.0	3.7e-11
WP_000665203.1|2748801_2749092_+	VRR-NUC domain-containing protein	NA	A0A2I6PEN7	Staphylococcus_phage	100.0	6.5e-51
WP_001793488.1|2749072_2750440_+	DEAD/DEAH box helicase	NA	A0A2I6PE95	Staphylococcus_phage	100.0	1.7e-263
WP_000528512.1|2750452_2750890_+	transcriptional regulator	NA	A0A2I6PEN3	Staphylococcus_phage	100.0	7.9e-77
WP_031867793.1|2751046_2751361_+	HNH endonuclease	NA	A0A2I6PF37	Staphylococcus_phage	99.0	3.2e-56
WP_000778933.1|2751488_2751794_+|terminase	terminase	terminase	A0A2I6PEQ6	Staphylococcus_phage	100.0	2.9e-49
2752090:2752106	attR	AGGTTTAAAGAAGCTTT	NA	NA	NA	NA
