The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP047584	Lactobacillus fermentum strain AGR1485 chromosome, complete genome	2226862	14359	24534	2226862	transposase	Staphylococcus_phage(33.33%)	9	NA	NA
WP_070955304.1|14359_15535_+	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	28.7	2.8e-44
WP_003682310.1|15546_15879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163586672.1|16151_17177_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.6	2.2e-45
WP_003685635.1|17695_18403_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.8	7.9e-42
WP_015638411.1|18414_20274_+	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	35.6	1.7e-35
WP_163586673.1|20257_21556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003682314.1|21557_22358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003682315.1|22372_23188_+	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	33.2	4.1e-34
WP_163586674.1|23262_24534_+	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	28.9	1.3e-18
>prophage 2
NZ_CP047584	Lactobacillus fermentum strain AGR1485 chromosome, complete genome	2226862	37852	150524	2226862	protease,transposase,tRNA	Paenibacillus_phage(19.44%)	91	NA	NA
WP_070955311.1|37852_39946_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	40.3	6.6e-121
WP_012390672.1|40367_41828_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_070955312.1|42310_46048_+	ATP-dependent helicase	NA	NA	NA	NA	NA
WP_070955313.1|46054_50068_+	helicase-exonuclease AddAB subunit AddA	NA	S5MMD7	Bacillus_phage	22.4	3.3e-12
WP_070955314.1|50067_50931_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	46.4	1.2e-57
WP_070955315.1|51168_52794_+	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_003682345.1|53087_53444_-	arsenate reductase family protein	NA	NA	NA	NA	NA
WP_015638426.1|53482_54598_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_023465701.1|54590_55322_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.2	8.2e-26
WP_070955316.1|55460_56015_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003682354.1|56095_57070_-	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	69.0	4.9e-135
WP_070955317.1|57266_58556_+	adenylosuccinate synthase	NA	A0A285PX35	Cedratvirus	36.2	3.9e-71
WP_046025634.1|58882_60265_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003685686.1|60548_61088_+	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR	NA	NA	NA	NA	NA
WP_070955318.1|61206_61938_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_003682365.1|61937_62564_+	orotate phosphoribosyltransferase	NA	S4VS55	Pandoravirus	38.6	3.7e-35
WP_147342558.1|62663_62993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111523509.1|63067_63979_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	31.2	7.6e-21
WP_163586676.1|63915_64629_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_021350374.1|65145_65538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003685694.1|65680_67219_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_163586677.1|67218_68715_+	accessory Sec system glycosyltransferase Asp1	NA	NA	NA	NA	NA
WP_015638438.1|69124_69967_+	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_163586678.1|69992_71057_+	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.8	4.4e-28
WP_003682378.1|71049_71751_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_163587036.1|71964_73113_+	ArgE/DapE family deacylase	NA	NA	NA	NA	NA
WP_163586679.1|73463_74888_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	34.2	7.3e-71
WP_112296721.1|76215_77508_-	D-alanyl-lipoteichoic acid biosynthesis protein DltD	NA	NA	NA	NA	NA
WP_003682388.1|77521_77758_-	D-alanine--poly(phosphoribitol) ligase subunit DltC	NA	NA	NA	NA	NA
WP_069775913.1|77787_79014_-	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	31.2	3.4e-24
WP_135252280.1|79013_80543_-	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9KZV5	Tupanvirus	25.8	1.8e-35
WP_003682395.1|80557_80689_-	teichoic acid D-Ala incorporation-associated protein DltX	NA	NA	NA	NA	NA
WP_012390701.1|80925_81378_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	51.5	2.8e-32
WP_003684310.1|81456_82707_+|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	37.0	2.6e-56
WP_163586680.1|82919_84053_+	exonuclease SbcCD subunit D	NA	NA	NA	NA	NA
WP_163586681.1|84049_87154_+	SMC family ATPase	NA	NA	NA	NA	NA
WP_003682400.1|87442_88741_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.8	6.2e-93
WP_015638451.1|89243_90257_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_035436592.1|90514_91768_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A1L2CUL7	Pectobacterium_phage	42.0	3.9e-84
WP_118033844.1|92235_93690_+	ABC transporter substrate-binding protein/permease	NA	NA	NA	NA	NA
WP_012390698.1|93693_94437_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.1	5.4e-33
WP_111522950.1|94943_96317_+	amino acid permease	NA	NA	NA	NA	NA
WP_042513824.1|96640_97891_-|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	36.3	1.8e-57
WP_012390701.1|97969_98422_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	51.5	2.8e-32
WP_014562705.1|98806_99994_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.1	4.4e-37
WP_012390702.1|100569_101769_+	nucleoside transporter	NA	NA	NA	NA	NA
WP_003685735.1|102003_102924_+	ribonucleoside hydrolase RihC	NA	NA	NA	NA	NA
WP_163587037.1|103112_103850_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_163586682.1|103868_104804_+	nucleoid occlusion protein	NA	I3NLC2	Bifidobacterium_phage	33.6	8.0e-10
WP_163586683.1|104817_105651_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	32.9	2.3e-16
WP_024500621.1|105663_105864_+	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_163586684.1|105879_106977_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_163586685.1|107010_107781_+	DUF1129 domain-containing protein	NA	NA	NA	NA	NA
WP_163586686.1|108038_109181_+	guanosine monophosphate reductase	NA	A0A1V0SHK8	Klosneuvirus	32.6	2.5e-58
WP_163586687.1|109529_110534_+	LytR family transcriptional regulator	NA	NA	NA	NA	NA
WP_163586688.1|110533_111304_+	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_163586689.1|111320_112061_+	CpsD/CapB family tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_163586690.1|112087_112858_+	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_163586691.1|112888_113830_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SAI6	Catovirus	36.3	1.1e-43
WP_163587038.1|113807_114473_+	exopolysaccharide biosynthesis polyprenyl glycosylphosphotransferase	NA	NA	NA	NA	NA
WP_163586692.1|114509_115346_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_046949115.1|116467_117493_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.1	1.3e-42
WP_163586693.1|117676_118726_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_163586694.1|118730_119828_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_163586695.1|119853_120969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163586696.1|121542_121779_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_163586697.1|121884_123423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163586698.1|123595_124816_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	45.7	1.5e-93
WP_163586699.1|124854_125157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016370900.1|125275_126799_-|transposase	IS66 family transposase	transposase	S5VTP8	Leptospira_phage	27.7	6.1e-07
WP_003686704.1|126866_127223_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_003686706.1|127212_127407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041812692.1|128168_129047_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.8	5.2e-43
WP_163586700.1|129070_129358_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_163586701.1|130080_131268_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.1	2.0e-37
WP_163586702.1|132120_132315_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_163586703.1|132329_133550_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.2	2.4e-94
WP_163586704.1|134135_135152_+	sugar phosphotransferase	NA	NA	NA	NA	NA
WP_163586705.1|135578_136649_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_163587039.1|136740_137619_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.1	5.7e-42
WP_163586706.1|137642_137858_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_086031824.1|139546_140833_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_086031761.1|140911_142132_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.2	8.1e-95
WP_163586707.1|142311_142977_-|transposase	transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.4	3.2e-13
WP_163586708.1|142999_144187_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.1	3.4e-37
WP_035437552.1|144607_145297_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.6	1.8e-35
WP_151130128.1|145494_146637_+	GHKL domain-containing protein	NA	W8CYF6	Bacillus_phage	29.8	6.5e-30
WP_163586709.1|146636_147932_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_163586710.1|148266_149142_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_021350344.1|149141_149561_+	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_163586711.1|149660_150524_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP047584	Lactobacillus fermentum strain AGR1485 chromosome, complete genome	2226862	173352	234214	2226862	transposase	Streptococcus_phage(38.89%)	53	NA	NA
WP_012391038.1|173352_174603_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	37.3	1.4e-57
WP_003686549.1|174891_176070_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_070955351.1|176183_177188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023466503.1|177673_178045_+	cupredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_070955352.1|178058_178367_+	copper-binding protein	NA	NA	NA	NA	NA
WP_070955353.1|178366_180298_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	37.7	3.5e-92
WP_163586718.1|180409_180841_+	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_003682515.1|180888_181365_-	nucleoside deoxyribosyltransferase	NA	A0A2P0ZL88	Lactobacillus_phage	35.2	7.7e-17
WP_163586719.1|187647_188283_-	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_100184979.1|188408_188798_+	tautomerase family protein	NA	NA	NA	NA	NA
WP_163586720.1|188792_189008_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_163586721.1|189031_189355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070955355.1|189418_190075_+	nitroreductase	NA	M1I6Q5	Acanthocystis_turfacea_Chlorella_virus	25.1	2.4e-13
WP_163586722.1|190760_191741_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_070955358.1|192710_192905_+	CsbD family protein	NA	NA	NA	NA	NA
WP_081339007.1|193110_193302_-	oxidoreductase	NA	NA	NA	NA	NA
WP_070955360.1|193469_194054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163586723.1|194151_194604_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	50.8	6.1e-32
WP_003684310.1|194682_195933_+|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	37.0	2.6e-56
WP_070955887.1|196108_196447_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_163586724.1|197122_198673_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_163586725.1|198868_200716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070955363.1|200705_201497_+	cell surface protein	NA	NA	NA	NA	NA
WP_070955364.1|201511_202390_+	heme ABC transporter substrate-binding protein IsdE	NA	NA	NA	NA	NA
WP_003684282.1|202391_203318_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_163586726.1|203310_204072_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.0	1.4e-15
WP_070955366.1|204429_205734_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	27.2	1.1e-44
WP_118033816.1|206343_206634_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_163586727.1|208362_209556_+	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.5	5.2e-30
WP_127429197.1|209555_210398_+	proline/glycine betaine ABC transporter permease	NA	NA	NA	NA	NA
WP_063733432.1|210410_211319_+	glycine/betaine ABC transporter	NA	NA	NA	NA	NA
WP_127429196.1|211983_212292_-	hypothetical protein	NA	A0A1X9I6F6	Streptococcus_phage	51.0	2.5e-21
WP_118033911.1|212325_212736_-|transposase	transposase	transposase	A0A1X9I6F6	Streptococcus_phage	57.9	3.1e-38
WP_118033910.1|212914_213592_+	hypothetical protein	NA	A0A1X9I6F6	Streptococcus_phage	54.4	1.6e-47
WP_118033909.1|213536_213794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163587040.1|213790_215212_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_003686636.1|215342_216182_+	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	62.8	3.2e-98
WP_003683931.1|221988_222960_+	2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	30.3	4.1e-25
WP_163586728.1|223129_223468_+	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_163586729.1|223483_224341_+	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_003683937.1|224421_224718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003686402.1|224720_224951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003686404.1|224929_225241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003683943.1|225379_225520_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_003686406.1|225543_226479_+	carbamate kinase	NA	NA	NA	NA	NA
WP_014562119.1|226596_227535_+	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_003683955.1|227611_228259_+	nitroreductase	NA	NA	NA	NA	NA
WP_003683956.1|228268_229000_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_003683957.1|229010_229325_+	DNA-binding protein	NA	A0A2R3ZXQ3	Staphylococcus_phage	40.4	6.6e-17
WP_163586730.1|229404_229860_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	53.5	9.5e-33
WP_163586731.1|229933_231184_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	37.5	4.8e-58
WP_003683959.1|231427_232468_+	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_016370900.1|232690_234214_-|transposase	IS66 family transposase	transposase	S5VTP8	Leptospira_phage	27.7	6.1e-07
>prophage 4
NZ_CP047584	Lactobacillus fermentum strain AGR1485 chromosome, complete genome	2226862	237664	310346	2226862	protease,transposase,tRNA	Lactobacillus_phage(15.0%)	58	NA	NA
WP_163586733.1|237664_238120_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	49.3	6.2e-32
WP_012391038.1|238193_239444_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	37.3	1.4e-57
WP_163586734.1|240018_240564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101889237.1|240631_241396_+	NADPH-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_012391038.1|241893_243144_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	37.3	1.4e-57
WP_046025888.1|243334_244183_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_163586735.1|244324_245488_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_163586736.1|245530_247852_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_003683970.1|248051_248990_+	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
WP_003686425.1|248982_250260_+	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
WP_003686427.1|250240_251224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003683973.1|251226_251925_+	NAD-dependent protein deacylase	NA	A0A068EPD4	Bacillus_phage	31.7	1.4e-19
WP_163586737.1|252140_253316_+	MFS transporter	NA	NA	NA	NA	NA
WP_003686431.1|253370_254213_+	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_163586738.1|254313_256314_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	36.4	2.4e-88
WP_003683977.1|256317_257106_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_003683978.1|257092_257662_+	ribonuclease M5	NA	NA	NA	NA	NA
WP_163586739.1|257654_258542_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_163586740.1|258821_259673_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_015638552.1|259850_260756_+	zinc ABC transporter solute-binding protein	NA	NA	NA	NA	NA
WP_163587041.1|260812_261424_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.8	2.1e-14
WP_003683987.1|261423_262218_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_003683990.1|262442_263279_+	pur operon repressor	NA	NA	NA	NA	NA
WP_023465687.1|263294_264662_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7P8	Chrysochromulina_ericina_virus	34.4	3.4e-33
WP_003683994.1|264737_265724_+	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	33.6	8.4e-42
WP_003683996.1|265833_266562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070955380.1|266738_267560_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_003686449.1|267571_268927_-	HD domain-containing protein	NA	A0A291ATA1	Pandoravirus	32.1	1.4e-26
WP_070955381.1|269041_269467_+	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_100184739.1|269512_270088_+	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
WP_003686454.1|270254_271856_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.3	4.6e-146
WP_003684007.1|272066_273335_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_003684008.1|273429_273675_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_015638539.1|275138_275594_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	53.5	9.5e-33
WP_012391038.1|275667_276918_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	37.3	1.4e-57
WP_021349684.1|277108_277813_+	class A sortase	NA	NA	NA	NA	NA
WP_048340153.1|277895_278360_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_003684020.1|278496_279054_+	LemA family protein	NA	NA	NA	NA	NA
WP_070955382.1|279064_279964_+|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_003686468.1|280138_281518_+	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_046948384.1|281689_283168_+	DEAD/DEAH box helicase	NA	A0A1V0SBR7	Catovirus	38.3	1.5e-66
WP_003684028.1|283171_283531_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_070955383.1|283533_284655_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.6	4.2e-29
WP_021815621.1|284666_285020_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A2K9VCH5	Lactobacillus_phage	38.5	3.0e-10
WP_003686479.1|285152_285788_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_070955384.1|285975_286536_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_070955385.1|286553_290096_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_012390804.1|290092_290365_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_003686487.1|290453_290810_+	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_003684046.1|290938_291445_+	RNA-binding protein S1	NA	NA	NA	NA	NA
WP_046025875.1|291444_292794_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	A0A0N7G7K4	Chrysochromulina_ericina_virus	24.4	8.9e-10
WP_003684053.1|292810_293359_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	31.1	8.0e-10
WP_003684055.1|293442_295611_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	A0A0P0CCN8	Ostreococcus_mediterraneus_virus	48.8	5.6e-107
WP_012390806.1|295687_296569_+	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_070955386.1|296657_297659_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_070955387.1|297674_299168_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	41.4	1.6e-89
WP_163586741.1|305308_306595_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_163586742.1|309125_310346_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.0	1.8e-94
>prophage 5
NZ_CP047584	Lactobacillus fermentum strain AGR1485 chromosome, complete genome	2226862	316061	357729	2226862	transposase,tRNA	Bacillus_virus(20.0%)	33	NA	NA
WP_163586743.1|316061_317420_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_163586744.1|317548_318088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014562705.1|318259_319447_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.1	4.4e-37
WP_163586745.1|319735_321094_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_163586746.1|321305_322664_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_163586747.1|322848_323814_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_100184421.1|324124_325483_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_163586748.1|327001_328843_+	SEC10/PgrA surface exclusion domain-containing protein	NA	NA	NA	NA	NA
WP_070955388.1|329075_330572_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.7	6.1e-68
WP_070955389.1|330665_331511_+	phosphoesterase	NA	NA	NA	NA	NA
WP_015638577.1|331807_332449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004563349.1|332531_333245_+	amino acid racemase	NA	NA	NA	NA	NA
WP_004562719.1|333400_334102_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_070955390.1|334132_335593_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	45.6	4.8e-110
WP_069775996.1|335609_336440_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	56.2	2.3e-77
WP_070955391.1|336443_338621_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_015638580.1|338613_339069_+	SprT family protein	NA	NA	NA	NA	NA
WP_048340395.1|339355_341236_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	33.0	1.1e-95
WP_004562725.1|341219_342182_+	beta-galactosidase	NA	NA	NA	NA	NA
WP_046025866.1|342324_343281_+	AEC family transporter	NA	NA	NA	NA	NA
WP_070955392.1|343569_344247_+	2,3-bisphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_004562728.1|344250_345126_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_070955393.1|345442_346780_-	C1 family peptidase	NA	A0A2H4UU28	Bodo_saltans_virus	27.4	1.6e-48
WP_070955394.1|346843_347458_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_163587042.1|347485_348172_-	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_163586749.1|348204_348657_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	52.3	2.1e-32
WP_003684310.1|348735_349986_+|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	37.0	2.6e-56
WP_035437471.1|350140_350467_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_163586750.1|350666_351206_+	dUTP diphosphatase	NA	J9PV85	Bacillus_phage	47.8	6.9e-38
WP_096493406.1|351218_352592_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_163586751.1|352624_353758_+	PIN/TRAM domain-containing protein	NA	NA	NA	NA	NA
WP_004563336.1|353828_355325_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_004562738.1|356310_357729_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	31.1	2.7e-49
>prophage 6
NZ_CP047584	Lactobacillus fermentum strain AGR1485 chromosome, complete genome	2226862	445503	512883	2226862	transposase,tRNA	Streptococcus_phage(26.09%)	60	NA	NA
WP_100184440.1|445503_445881_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_163586758.1|445900_446437_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	30.8	1.9e-08
WP_004563284.1|446742_447771_-	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
WP_003682605.1|447796_448738_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_003682606.1|448840_449641_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_049184604.1|449703_451428_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	60.2	2.3e-196
WP_024500722.1|451642_452278_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_012390868.1|452283_452514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049184603.1|452613_454629_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_087907842.1|454638_457500_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	54.8	8.9e-302
WP_004563278.1|457589_458675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004563277.1|458893_459763_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	30.8	8.3e-09
WP_046025842.1|459784_460762_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	53.3	5.1e-92
WP_003682621.1|460779_461718_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	37.1	1.0e-49
WP_004563275.1|461838_462486_-	thiaminase II	NA	NA	NA	NA	NA
WP_003682627.1|462599_463190_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	56.8	3.6e-56
WP_163586759.1|465175_466420_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.4	1.7e-10
WP_003564909.1|466577_466724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004563273.1|466924_467407_+	tryptophan-rich sensory protein	NA	NA	NA	NA	NA
WP_163586760.1|468627_469767_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.3	3.9e-43
WP_004563272.1|469950_471114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012390875.1|472047_473061_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_003682636.1|473142_474348_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_003682638.1|474453_475221_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_012390876.1|475337_476660_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	70.3	2.0e-171
WP_003682642.1|476853_478248_+	amino acid permease	NA	NA	NA	NA	NA
WP_004563268.1|478338_479889_+	ClC family H(+)/Cl(-) exchange transporter	NA	NA	NA	NA	NA
WP_003682647.1|479966_480191_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_070955427.1|480243_482637_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	39.1	2.2e-88
WP_003682651.1|482657_483131_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	56.8	4.0e-42
WP_070955428.1|483158_483743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004563264.1|483880_484570_+	uracil-DNA glycosylase	NA	A0A0B5IW78	Pandoravirus	45.6	2.3e-46
WP_003682658.1|484602_485577_+	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_003682659.1|485585_486038_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_070955429.1|486037_486553_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_070955430.1|486682_487222_-	3'-5' exonuclease	NA	M1PFD8	Streptococcus_phage	35.6	2.0e-21
WP_003682662.1|487349_488246_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_035423877.1|488260_489103_+	TIGR00159 family protein	NA	NA	NA	NA	NA
WP_070955431.1|489092_489971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070955432.1|490010_491369_+	phosphoglucosamine mutase	NA	A0A127AWJ1	Bacillus_phage	26.9	3.6e-19
WP_100184758.1|491582_493403_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1HVL7	Paramecium_bursaria_Chlorella_virus	35.5	2.6e-89
WP_004563258.1|493683_493995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087908286.1|494004_495855_+	acetyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	27.7	9.3e-26
WP_049184876.1|495885_496704_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_021815732.1|497023_497614_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A249XZV3	Enterococcus_phage	53.7	1.6e-27
WP_003682672.1|498011_499040_-	putative sulfate exporter family transporter	NA	NA	NA	NA	NA
WP_070955434.1|499160_500066_+	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	41.2	7.5e-05
WP_057194876.1|500162_501125_-	mannose-6-phosphate isomerase, class I	NA	NA	NA	NA	NA
WP_070955435.1|501211_502051_-	DegV family protein	NA	A0A1X9I5J4	Streptococcus_phage	40.5	2.7e-49
WP_003682679.1|502213_502729_+	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_003682680.1|502962_503904_-	Dyp-type peroxidase	NA	NA	NA	NA	NA
WP_070955436.1|504378_505362_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_003685815.1|505381_506185_+	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_003682688.1|506213_507134_+	PTS mannose/fructose/sorbose transporter family subunit IID	NA	NA	NA	NA	NA
WP_003682690.1|507134_507485_+	DUF956 family protein	NA	NA	NA	NA	NA
WP_003685809.1|508102_508825_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.4	8.6e-36
WP_023465572.1|508824_510327_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	34.6	5.2e-35
WP_023465571.1|510527_511388_+	sugar transporter	NA	NA	NA	NA	NA
WP_163586761.1|511462_511999_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_012390893.1|511995_512883_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	42.3	7.6e-34
>prophage 7
NZ_CP047584	Lactobacillus fermentum strain AGR1485 chromosome, complete genome	2226862	679671	799852	2226862	protease,transposase,integrase,tRNA	unidentified_phage(15.15%)	114	739293:739352	777291:777497
WP_003682110.1|679671_680805_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_012391006.1|682804_683737_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_003682107.1|683945_684602_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_003682106.1|684616_685306_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_003686358.1|685306_687853_+	AAA family ATPase	NA	A0A1P8DII4	Virus_Rctr197k	29.1	2.4e-32
WP_003686361.1|687923_688910_+	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	33.9	8.1e-37
WP_003686362.1|688942_689371_-	Spx/MgsR family RNA polymerase-binding regulatory protein	NA	NA	NA	NA	NA
WP_003682102.1|689610_690585_-	YegS/Rv2252/BmrU family lipid kinase	NA	NA	NA	NA	NA
WP_003682101.1|690844_691060_-	DNA-dependent RNA polymerase auxiliary subunit epsilon family protein	NA	NA	NA	NA	NA
WP_015638740.1|691186_691633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003686366.1|691738_692308_-	peptide deformylase	NA	A0A2I7S809	Vibrio_phage	41.3	5.8e-11
WP_003682094.1|692435_692723_+	UPF0223 family protein	NA	NA	NA	NA	NA
WP_003686368.1|692726_693491_+	inositol monophosphatase family protein	NA	NA	NA	NA	NA
WP_003682090.1|693568_695416_+	translational GTPase TypA	NA	NA	NA	NA	NA
WP_070955471.1|695518_696718_+	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_003686372.1|696704_697001_+	YlbG family protein	NA	NA	NA	NA	NA
WP_003682085.1|697003_697564_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_070955472.1|697568_698090_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	38.0	6.4e-25
WP_070955473.1|698073_699123_+	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_003686380.1|699188_699863_+	competence protein	NA	NA	NA	NA	NA
WP_003682078.1|699917_700397_+	ComE operon protein 2	NA	A7KUY9	Bacillus_phage	56.7	4.1e-34
WP_070955474.1|700397_702635_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q332C0	Clostridium_botulinum_C_phage	31.0	1.6e-27
WP_003682073.1|702652_703681_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_003682071.1|703920_704175_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_003682069.1|704437_704707_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_046026076.1|704863_706234_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_015638746.1|706404_708204_+	ribonuclease J	NA	NA	NA	NA	NA
WP_003682061.1|708294_709191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014562272.1|709371_710562_+	elongation factor Tu	NA	A0A1V0SGC3	Hokovirus	28.2	3.9e-33
WP_003682058.1|710732_712040_+	trigger factor	NA	NA	NA	NA	NA
WP_003682055.1|712190_713441_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.1	3.7e-135
WP_012391020.1|713454_714048_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_070955475.1|714047_714347_+	nucleoside triphosphate pyrophosphohydrolase family protein	NA	A0A1S7FYY8	Listeria_phage	51.5	9.1e-24
WP_012391021.1|714613_714760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003682049.1|714947_715694_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.8	1.4e-28
WP_070955476.1|715971_717783_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_003682046.1|717847_719155_+	GTPase ObgE	NA	NA	NA	NA	NA
WP_003682045.1|719181_720114_+	ribonuclease Z	NA	NA	NA	NA	NA
WP_003682044.1|720134_720974_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_023466447.1|721046_723344_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.3	2.6e-70
WP_003682042.1|723357_723885_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	44.0	2.3e-30
WP_003682041.1|724216_724594_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_003682040.1|724673_725672_-	D-2-hydroxyacid dehydrogenase	NA	M1H502	Paramecium_bursaria_Chlorella_virus	36.3	7.7e-51
WP_070955477.1|726174_726984_+	2-keto-4-pentenoate hydratase	NA	NA	NA	NA	NA
WP_012390701.1|727273_727726_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	51.5	2.8e-32
WP_003684310.1|727804_729055_+|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	37.0	2.6e-56
WP_070955478.1|729230_729767_+	NAD(P)H oxidoreductase	NA	NA	NA	NA	NA
WP_003682032.1|729777_730059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003682030.1|730058_730388_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_070955479.1|730735_731044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070955480.1|731745_732093_-	helix-turn-helix transcriptional regulator	NA	E9LUL4	Lactobacillus_phage	42.9	3.5e-11
WP_163586776.1|732244_733336_-	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_015638760.1|733594_733774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163586777.1|733858_734782_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.7	4.0e-30
WP_118033897.1|735553_736684_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	6.0e-36
WP_118033896.1|736869_738081_-	chloride channel protein	NA	NA	NA	NA	NA
WP_021349406.1|738212_739433_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.2	6.2e-95
739293:739352	attL	AGCTTTAATCTGCTCAGTCGCTTCGGACTTAAGAATTTCGTCAAGGATCTTGGCCATAAT	NA	NA	NA	NA
WP_163586778.1|739790_740714_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.7	5.3e-30
WP_100184421.1|740949_742308_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_070955482.1|742470_742836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012391034.1|743106_743475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163586779.1|743601_744723_-	MFS transporter	NA	NA	NA	NA	NA
WP_003682012.1|745308_746898_-	asparagine synthase B	NA	L7RC73	Acanthamoeba_polyphaga_moumouvirus	40.3	3.1e-102
WP_070955892.1|747824_748055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111523127.1|750395_750836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035437289.1|750846_751836_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_003682001.1|751857_752304_-	nucleoside 2-deoxyribosyltransferase	NA	A0A1D3SPR3	Enterococcus_phage	36.7	2.4e-20
WP_015638775.1|752421_753042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163586780.1|753285_754371_-|integrase	site-specific integrase	integrase	A0A0M9JJ77	Lactobacillus_phage	54.0	1.1e-106
WP_163586781.1|754478_754991_-	hypothetical protein	NA	E9LUL0	Lactobacillus_phage	91.2	1.5e-63
WP_112296817.1|755270_755975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163586782.1|755974_756265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163586783.1|756520_757807_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_163586784.1|757885_758809_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	2.8e-31
WP_015474755.1|759016_760615_-	APC family permease	NA	NA	NA	NA	NA
WP_163586784.1|760924_761848_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	2.8e-31
WP_046948007.1|761970_762546_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041807739.1|763068_763431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008211256.1|763605_763926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070955495.1|764054_765278_+	DUF389 domain-containing protein	NA	NA	NA	NA	NA
WP_070955496.1|765299_766634_-	APC family permease	NA	NA	NA	NA	NA
WP_163587043.1|766726_767413_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	51.8	5.6e-61
WP_031274777.1|767787_769134_+	SLC45 family MFS transporter	NA	NA	NA	NA	NA
WP_023466491.1|769133_770900_+	alpha-glycosidase	NA	NA	NA	NA	NA
WP_083276546.1|771563_771998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163587044.1|772167_773097_-	hypothetical protein	NA	Q6NE04	Leptospira_phage	38.7	1.6e-55
WP_003688751.1|773629_773917_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_012391547.1|773940_774819_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.4	2.6e-42
WP_083276524.1|777278_777431_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_163586785.1|777632_778613_+	TIR domain-containing protein	NA	NA	NA	NA	NA
777291:777497	attR	AGCTTTAATCTGCTCAGTCGCTTCGGACTTAAGAATTTCGTCAAGGATCTTGGCCATAATTGATTGCATGGCCTTATCCCGATCACCTAGTAATAGTTCCTTTAATTCGTCATCTTCTAAATTTAATTCAACCTTTGGCATAATGAAGTTCCTTTCAGATTTCACAAAGTCCTATTTAGAATTTACACCAATTATACGGACATAACC	NA	NA	NA	NA
WP_016370900.1|778910_780434_-|transposase	IS66 family transposase	transposase	S5VTP8	Leptospira_phage	27.7	6.1e-07
WP_003686704.1|780501_780858_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_003686706.1|780847_781042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114806514.1|781162_781747_+	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	34.9	1.1e-20
WP_012391061.1|781900_782917_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.1	6.0e-35
WP_021815920.1|783129_783639_+	membrane protein	NA	NA	NA	NA	NA
WP_111523141.1|784572_784827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003685254.1|785051_785732_+	serine dehydratase	NA	NA	NA	NA	NA
WP_163586786.1|785732_786620_+	L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha	NA	NA	NA	NA	NA
WP_003685249.1|786616_786931_+	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_100184699.1|787404_788994_+	YSIRK-type signal peptide-containing protein	NA	NA	NA	NA	NA
WP_003685246.1|789077_789470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155114322.1|789433_789580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163586787.1|789610_790729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163586788.1|790764_791775_+	mucin-binding protein	NA	NA	NA	NA	NA
WP_163586789.1|792142_792877_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_163586790.1|792869_794387_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_163586791.1|794387_795194_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_123799397.1|795446_796616_+	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_070955499.1|796966_797593_-	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	51.4	1.5e-15
WP_070955500.1|797748_798000_+	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_003685231.1|798076_798304_+	YneF family protein	NA	NA	NA	NA	NA
WP_003685229.1|798371_799004_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_070955501.1|799099_799852_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
>prophage 8
NZ_CP047584	Lactobacillus fermentum strain AGR1485 chromosome, complete genome	2226862	805129	871215	2226862	protease,transposase,tRNA	Paenibacillus_phage(14.29%)	55	NA	NA
WP_023467494.1|805129_806401_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_070955503.1|806434_808156_+|tRNA	proline--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	25.3	1.8e-07
WP_070955504.1|808295_812639_+	PolC-type DNA polymerase III	NA	A0A0K2SUJ2	Clostridium_phage	35.3	1.7e-14
WP_070955505.1|812761_813913_-	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.0	5.6e-21
WP_070955506.1|813925_814672_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_163587045.1|814681_815809_-	bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ	NA	NA	NA	NA	NA
WP_163586792.1|815862_816888_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.3	1.9e-44
WP_070955507.1|817007_818033_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_003685204.1|818277_819348_+	carbamoyl phosphate synthase small subunit	NA	NA	NA	NA	NA
WP_070955508.1|819340_822430_+	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_003681934.1|822582_823062_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_003685200.1|823081_824308_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_003681930.1|824344_824647_+	YlxR family protein	NA	NA	NA	NA	NA
WP_003681928.1|824639_824963_+	YlxQ-related RNA-binding protein	NA	NA	NA	NA	NA
WP_118033624.1|824967_827292_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.6	4.3e-20
WP_003685195.1|827304_827667_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_015638815.1|827736_828633_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_003685190.1|828643_829609_+	riboflavin biosynthesis protein RibF	NA	NA	NA	NA	NA
WP_070955510.1|829723_831112_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_163586793.1|831230_831929_+|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	31.3	2.3e-22
WP_070955512.1|833160_834498_-	SLC45 family MFS transporter	NA	NA	NA	NA	NA
WP_070955513.1|834506_836201_-	alpha-glucosidase	NA	NA	NA	NA	NA
WP_015638823.1|836358_837345_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_035426273.1|837500_838793_+	Y-family DNA polymerase	NA	M1Q231	Streptococcus_phage	38.8	7.1e-81
WP_070955514.1|838773_839091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014562320.1|839243_840416_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_021349406.1|841200_842421_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.2	6.2e-95
WP_163586794.1|842636_843515_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.8	6.8e-43
WP_070955895.1|843937_844900_+	ketopantoate reductase family protein	NA	NA	NA	NA	NA
WP_054194014.1|845582_846194_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_070955518.1|846368_847697_-	D-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_023466818.1|847986_849387_-	amino acid permease	NA	NA	NA	NA	NA
WP_003688751.1|849576_849864_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_041812692.1|849887_850766_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.8	5.2e-43
WP_015638832.1|851606_851972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031274283.1|852097_853144_+	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_070955521.1|853154_853742_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_070955522.1|853778_855635_+	molecular chaperone DnaK	NA	A0A2P1EIW2	Megavirus	45.5	3.2e-135
WP_003685152.1|855746_856907_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.2	2.1e-20
WP_070955523.1|857312_857861_+	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_003681896.1|857888_858056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054173459.1|858074_858641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163586795.1|858848_859688_+	histidinol-phosphatase HisJ	NA	NA	NA	NA	NA
WP_070955524.1|860009_861170_+	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_070955525.1|861162_861777_+	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_023465768.1|861778_863062_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_023465767.1|863063_863648_+	imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_012391116.1|863647_864256_+	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_070955526.1|864252_864978_+	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_069776140.1|864967_865753_+	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_021349426.1|865722_866040_+	phosphoribosyl-AMP cyclohydrolase	NA	NA	NA	NA	NA
WP_003681874.1|866041_866362_+	phosphoribosyl-ATP diphosphatase	NA	NA	NA	NA	NA
WP_070955527.1|866374_867460_+	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	23.7	7.6e-12
WP_003685127.1|867527_869360_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	26.1	2.5e-23
WP_003686724.1|869856_871215_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP047584	Lactobacillus fermentum strain AGR1485 chromosome, complete genome	2226862	878771	945756	2226862	protease,transposase,tRNA	Staphylococcus_phage(25.0%)	55	NA	NA
WP_021349417.1|878771_879242_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	42.9	6.8e-26
WP_046025761.1|879234_880428_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.4	1.9e-96
WP_070955532.1|880414_881023_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	38.5	2.3e-26
WP_081339015.1|881022_882081_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	33.9	4.5e-41
WP_163587046.1|882978_883887_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	28.7	2.2e-12
WP_163587047.1|883823_884399_-|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	33.7	1.3e-18
WP_163586796.1|884569_885709_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.3	5.1e-43
WP_163586797.1|887961_888987_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.3	8.4e-45
WP_070955536.1|889192_890365_+	cysteine desulfurase	NA	NA	NA	NA	NA
WP_012390701.1|890655_891108_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	51.5	2.8e-32
WP_163586798.1|891186_892437_+|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	36.7	2.2e-55
WP_003685096.1|892774_893386_-	cadmium transporter	NA	NA	NA	NA	NA
WP_003685094.1|893386_894067_-	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_003681833.1|894241_894781_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_003681831.1|895084_895246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003681830.1|895314_896163_+	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003681828.1|896175_896697_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_069776156.1|897519_897900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069776157.1|897889_898141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163586799.1|898267_899353_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	26.0	1.5e-23
WP_163586800.1|899485_900379_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_163586801.1|900618_901710_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2L2DIY2	Acanthamoeba_polyphaga_mimivirus	24.9	1.7e-14
WP_163586802.1|902142_906615_+	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_069776162.1|906631_908056_+	glutamate synthase subunit beta	NA	NA	NA	NA	NA
WP_012391148.1|908433_908691_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003685078.1|908779_909223_+	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_003681822.1|909237_910050_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_069776164.1|910111_910753_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_070955541.1|910917_911715_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_070955542.1|911716_912502_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_070955543.1|912947_914915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135251956.1|915223_915982_+	methylase	NA	A0A1D8KUI1	Synechococcus_phage	33.3	3.7e-05
WP_163586803.1|915968_916988_+	restriction endonuclease	NA	A0A1V0SII8	Klosneuvirus	26.4	6.3e-16
WP_163586804.1|916990_920332_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_163586805.1|920333_922307_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_163586806.1|923716_924415_+|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	31.3	6.8e-22
WP_012391154.1|925561_926515_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_070955544.1|927074_927401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070955545.1|927456_928419_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_070955546.1|928418_929168_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_070955547.1|929227_929569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070955548.1|929584_931819_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	35.2	3.0e-10
WP_070955549.1|931828_932266_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_021816005.1|932572_933061_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_070955550.1|933411_934608_+	PLP-dependent transferase	NA	NA	NA	NA	NA
WP_003681779.1|934582_935710_+	PLP-dependent transferase	NA	NA	NA	NA	NA
WP_070955551.1|936032_936692_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003685014.1|936672_937344_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_021816009.1|937354_938095_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.1	4.7e-37
WP_021816010.1|938110_938965_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_012390701.1|940258_940711_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	51.5	2.8e-32
WP_003684310.1|940789_942040_+|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	37.0	2.6e-56
WP_070955553.1|942334_943159_-	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_070955898.1|943492_944866_-	amino acid permease	NA	NA	NA	NA	NA
WP_163586807.1|944980_945756_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	54.1	7.1e-28
>prophage 10
NZ_CP047584	Lactobacillus fermentum strain AGR1485 chromosome, complete genome	2226862	966471	1022513	2226862	transposase,integrase,tRNA	Paenibacillus_phage(13.33%)	57	992597:992612	1009196:1009211
WP_014562705.1|966471_967659_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.1	4.4e-37
WP_003684975.1|968812_969373_+	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_003681705.1|969384_969570_+	DUF2273 domain-containing protein	NA	NA	NA	NA	NA
WP_003681703.1|969597_970140_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_003681701.1|970154_970406_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_003681696.1|970417_970558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163586809.1|970845_972132_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_118033733.1|972364_973276_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_015638908.1|973489_974497_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_015638909.1|974509_975868_-	aspartate kinase	NA	NA	NA	NA	NA
WP_046025722.1|976339_977659_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_070955565.1|977683_978397_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase	NA	NA	NA	NA	NA
WP_003683235.1|978396_979551_+	N-acetyldiaminopimelate deacetylase	NA	NA	NA	NA	NA
WP_003683233.1|979553_980489_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_024500891.1|980481_981261_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_070955566.1|981285_982470_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_003683228.1|982484_983537_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003683224.1|983672_985013_+	ATPase	NA	NA	NA	NA	NA
WP_046025720.1|985005_985680_+	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
WP_021816034.1|985688_986390_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_049183575.1|986382_987204_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_070955567.1|987223_988465_+	peptidase T	NA	NA	NA	NA	NA
WP_003683213.1|988536_988764_-	DUF2929 family protein	NA	NA	NA	NA	NA
WP_024500896.1|988854_992154_+	DNA polymerase III subunit alpha	NA	A0A0K1Y9G6	Streptomyces_phage	32.2	5.7e-143
WP_012391189.1|992291_993713_+	pyruvate kinase	NA	NA	NA	NA	NA
992597:992612	attL	GGAAAAGATCGCCGTT	NA	NA	NA	NA
WP_003683209.1|993868_994756_+	S1 RNA-binding protein	NA	NA	NA	NA	NA
WP_046025715.1|994748_995627_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A142K830	Mycobacterium_phage	29.1	4.9e-09
WP_003684947.1|995607_995991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046025714.1|995983_996772_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	27.1	3.6e-11
WP_003683201.1|996749_997337_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	30.7	7.5e-14
WP_003684943.1|997337_998063_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_003683198.1|998334_998913_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_031265319.1|999113_1000178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003683188.1|1000167_1001625_+	ATP-dependent DNA helicase RecQ	NA	F2NZ48	Diadromus_pulchellus_ascovirus	38.7	6.8e-56
WP_003683187.1|1001685_1002240_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003683185.1|1002263_1002944_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_003683184.1|1003020_1004253_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_046025711.1|1004330_1005644_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_003683180.1|1005867_1006143_+	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	68.5	3.4e-25
WP_003684932.1|1006221_1007484_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_003683175.1|1007597_1008455_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_163586810.1|1008620_1009823_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	48.6	3.4e-45
1009196:1009211	attR	GGAAAAGATCGCCGTT	NA	NA	NA	NA
WP_163586811.1|1009835_1011722_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.0	2.9e-51
WP_003683168.1|1011787_1012747_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	63.4	9.1e-118
WP_003683166.1|1012758_1013262_+	dihydrofolate reductase	NA	A0A223LJP4	Erwinia_phage	37.8	5.6e-18
WP_003684928.1|1013241_1013871_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_070955569.1|1014037_1014880_+	DegV family protein	NA	NA	NA	NA	NA
WP_070955570.1|1015013_1016192_-	3-phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	36.8	8.7e-62
WP_012391200.1|1016261_1016888_+	chloramphenicol acetyltransferase	NA	NA	NA	NA	NA
WP_003683158.1|1017018_1017936_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_003683157.1|1017939_1018533_+	YpmS family protein	NA	NA	NA	NA	NA
WP_003683156.1|1018542_1018767_+	YozE family protein	NA	NA	NA	NA	NA
WP_163586812.1|1019084_1019993_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.7	4.4e-29
WP_003678463.1|1020259_1020523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011222020.1|1020594_1020954_+	winged helix-turn-helix transcriptional regulator	NA	A0A2H4PQT4	Staphylococcus_phage	43.3	8.1e-19
WP_163586813.1|1020940_1021273_+	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_021349406.1|1021292_1022513_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.2	6.2e-95
>prophage 11
NZ_CP047584	Lactobacillus fermentum strain AGR1485 chromosome, complete genome	2226862	1026374	1085751	2226862	transposase,integrase	Streptococcus_phage(27.78%)	56	1054540:1054555	1067629:1067644
WP_014562705.1|1026374_1027562_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.1	4.4e-37
WP_163587048.1|1027650_1027845_+	arsenic metallochaperone ArsD family protein	NA	NA	NA	NA	NA
WP_003686724.1|1028004_1029363_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_163586815.1|1029438_1030839_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_021349406.1|1030990_1032211_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.2	6.2e-95
WP_003678450.1|1032528_1032897_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_021349960.1|1032898_1033513_+	CadD family cadmium resistance transporter	NA	NA	NA	NA	NA
WP_003684067.1|1033925_1035278_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_163586816.1|1035407_1035671_-	helix-turn-helix transcriptional regulator	NA	A0A1B1P888	Bacillus_phage	44.3	2.8e-05
WP_163586817.1|1036104_1036767_+	helix-turn-helix domain-containing protein	NA	A0A1S5SEX3	Streptococcus_phage	39.6	1.1e-32
WP_100184421.1|1036834_1038193_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_021349957.1|1039014_1039266_+	hypothetical protein	NA	W6LM55	Streptococcus_phage	43.3	4.5e-08
WP_003678442.1|1039354_1040614_+|integrase	site-specific integrase	integrase	A0A1S5S9U4	Streptococcus_phage	26.6	5.4e-25
WP_163586818.1|1041153_1041315_+	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_163586819.1|1041899_1042424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163586820.1|1042860_1045011_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_163586821.1|1045003_1046599_+	ATP-dependent helicase	NA	NA	NA	NA	NA
WP_163586822.1|1046831_1047758_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_163586823.1|1048357_1048756_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_163586824.1|1049007_1049625_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_163586825.1|1049602_1050418_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_163587049.1|1050710_1051355_-	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.7	3.3e-15
WP_163587050.1|1051488_1052541_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.2	1.0e-37
WP_163586826.1|1052593_1052860_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_163586827.1|1052933_1054049_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_163586828.1|1054036_1054717_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.1	1.5e-34
1054540:1054555	attL	TGTCCGGCAAGTTAAC	NA	NA	NA	NA
WP_163586829.1|1054921_1055455_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_163586830.1|1055839_1057084_+	helix-turn-helix domain-containing protein	NA	A0A1S5SEX3	Streptococcus_phage	43.3	2.3e-81
WP_054650508.1|1057165_1057414_+	hypothetical protein	NA	Q9AZF3	Lactococcus_phage	55.6	2.2e-15
WP_163586831.1|1057490_1058729_+|integrase	site-specific integrase	integrase	A0A1X9I6A9	Streptococcus_phage	26.6	4.3e-19
WP_163586832.1|1058842_1059715_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_024500903.1|1059707_1060478_+	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	35.2	1.4e-20
WP_024500904.1|1060530_1061406_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_046025708.1|1061489_1063622_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	36.0	5.8e-96
WP_049183051.1|1063696_1064593_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_003683143.1|1064608_1065487_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_023466131.1|1065554_1066166_-	glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_012391206.1|1066397_1068395_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	43.0	2.2e-121
1067629:1067644	attR	TGTCCGGCAAGTTAAC	NA	NA	NA	NA
WP_070955572.1|1068411_1070880_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	31.9	3.2e-98
WP_070955573.1|1070945_1071461_+	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_070955574.1|1071571_1072504_+	manganese-dependent inorganic pyrophosphatase	NA	NA	NA	NA	NA
WP_015638938.1|1072697_1073090_+	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_003683130.1|1073099_1073525_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_003684903.1|1073677_1074187_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_046025706.1|1074176_1074635_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_012391210.1|1074791_1076150_+	cytosine permease	NA	NA	NA	NA	NA
WP_012391211.1|1076152_1077391_+	cytosine deaminase	NA	NA	NA	NA	NA
WP_014562388.1|1077553_1079263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012391213.1|1079358_1079730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003684892.1|1079744_1081091_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	42.8	9.0e-87
WP_070955575.1|1081087_1081768_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_014562392.1|1082354_1083704_+	MFS transporter	NA	NA	NA	NA	NA
WP_012391217.1|1083830_1084034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003683109.1|1084048_1084204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003684884.1|1084190_1084481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014562705.1|1084563_1085751_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.1	4.4e-37
>prophage 12
NZ_CP047584	Lactobacillus fermentum strain AGR1485 chromosome, complete genome	2226862	1184545	1204712	2226862	transposase	Paenibacillus_phage(37.5%)	16	NA	NA
WP_012390701.1|1184545_1184998_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	51.5	2.8e-32
WP_163586844.1|1185076_1186327_+|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	37.2	2.4e-57
WP_070955614.1|1187547_1188315_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_003682911.1|1188307_1188949_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	30.6	5.5e-18
WP_070955615.1|1189343_1191026_-	acetolactate synthase AlsS	NA	NA	NA	NA	NA
WP_163587052.1|1191483_1191747_-	DUF4256 domain-containing protein	NA	NA	NA	NA	NA
WP_163586845.1|1191844_1192222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163587053.1|1192248_1193133_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_163587054.1|1193120_1193687_-|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	39.4	1.1e-25
WP_163586846.1|1193985_1194519_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_021349406.1|1194855_1196076_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.2	6.2e-95
WP_163586847.1|1196739_1197447_-	DNA methyltransferase	NA	Q58MW7	Prochlorococcus_phage	32.0	5.3e-06
WP_163586848.1|1197446_1201862_-	DEAD/DEAH box helicase family protein	NA	A0A1X7C005	Faustovirus	19.8	5.9e-10
WP_070955616.1|1201926_1202679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070955617.1|1202861_1203422_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_021349406.1|1203491_1204712_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.2	6.2e-95
>prophage 13
NZ_CP047584	Lactobacillus fermentum strain AGR1485 chromosome, complete genome	2226862	1225806	1253417	2226862	transposase	Lactobacillus_phage(28.57%)	30	NA	NA
WP_163587055.1|1225806_1226838_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.1	3.3e-41
WP_163586850.1|1226977_1227418_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_123472257.1|1227444_1227756_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_123472256.1|1228491_1228761_-	replication protein	NA	NA	NA	NA	NA
WP_070955618.1|1229016_1229349_-	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	40.9	3.0e-12
WP_012391303.1|1229345_1229711_-	CrcB family protein	NA	NA	NA	NA	NA
WP_070955902.1|1229834_1230227_+	VOC family virulence protein	NA	NA	NA	NA	NA
WP_003683563.1|1230301_1230859_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_070955619.1|1231133_1232849_+	AarF/ABC1/UbiB kinase family protein	NA	M4QMK7	Micromonas_pusilla_virus	29.7	1.4e-28
WP_003683557.1|1232910_1233609_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_111523282.1|1233952_1234408_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	48.6	1.4e-31
WP_163586851.1|1234481_1235732_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	37.3	1.1e-57
WP_103205604.1|1235892_1236798_-	ROK family protein	NA	NA	NA	NA	NA
WP_046025972.1|1236869_1237145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012391310.1|1237171_1237630_-	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
WP_003683545.1|1238185_1238707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163586852.1|1238850_1239798_+	Rgg/GadR/MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_070955623.1|1239999_1241520_+	gluconokinase	NA	NA	NA	NA	NA
WP_003683541.1|1241541_1242888_+	gluconate permease	NA	NA	NA	NA	NA
WP_070955624.1|1243014_1244019_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003683537.1|1244031_1244373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070955625.1|1244625_1245813_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_003683533.1|1246014_1246548_-	VanZ family protein	NA	NA	NA	NA	NA
WP_081339021.1|1246848_1248357_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_003683527.1|1248467_1249121_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_118033636.1|1249239_1249665_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_012391325.1|1249893_1250322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070955628.1|1250331_1251297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012391038.1|1251637_1252888_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	37.3	1.4e-57
WP_046025595.1|1252961_1253417_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	47.8	2.0e-30
>prophage 14
NZ_CP047584	Lactobacillus fermentum strain AGR1485 chromosome, complete genome	2226862	1313699	1473442	2226862	plate,portal,tail,protease,head,integrase,tRNA,capsid,transposase,terminase	Lactobacillus_phage(50.85%)	156	1361889:1361906	1408927:1408944
WP_163586857.1|1313699_1315709_+|portal	portal protein	portal	M1IBC2	Acanthocystis_turfacea_Chlorella_virus	35.9	2.0e-66
WP_003683387.1|1315927_1316374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004563180.1|1316370_1317882_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_003683382.1|1317949_1318174_-	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_023465879.1|1318199_1320071_-	potassium transporter	NA	NA	NA	NA	NA
WP_003683380.1|1320179_1321592_-	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_070955648.1|1321612_1322512_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_012391366.1|1322504_1323815_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003683374.1|1323983_1324253_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_003683372.1|1324355_1325219_-	metallophosphoesterase family protein	NA	NA	NA	NA	NA
WP_163586858.1|1325475_1326867_+	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_003683366.1|1326882_1328124_+	MFS transporter	NA	NA	NA	NA	NA
WP_003683364.1|1328288_1329677_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_163587056.1|1330063_1331278_-	DEAD/DEAH box helicase	NA	L0P6E9	Lactobacillus_phage	52.8	1.0e-110
WP_163586670.1|1331213_1331567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163586859.1|1331553_1332066_-	ParB-like nuclease domain-containing protein	NA	L0P6I1	Lactobacillus_phage	80.8	3.8e-78
WP_163586860.1|1332049_1333348_-	DUF3440 domain-containing protein	NA	L0P6Z6	Lactobacillus_phage	75.2	1.0e-196
WP_163586861.1|1333344_1333677_-	hypothetical protein	NA	L0P8P1	Lactobacillus_phage	31.2	8.6e-07
WP_163586862.1|1333686_1333962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163586863.1|1334179_1334509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163586864.1|1334645_1335767_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A172JIA8	Bacillus_phage	34.1	8.7e-27
WP_163586865.1|1335766_1336207_-	hypothetical protein	NA	A0A0A1ELI5	Lactobacillus_phage	45.5	1.7e-23
WP_163586866.1|1336203_1336557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163586867.1|1336553_1336946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163586868.1|1336997_1337807_-	hypothetical protein	NA	E9LUK0	Lactobacillus_phage	39.9	6.3e-27
WP_163586869.1|1337820_1338894_-|plate	BppU family phage baseplate upper protein	plate	NA	NA	NA	NA
WP_163586870.1|1338905_1340003_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_163586871.1|1340015_1340273_-	hypothetical protein	NA	E9LUJ7	Lactobacillus_phage	61.2	1.5e-19
WP_163586872.1|1340275_1340467_-	hypothetical protein	NA	E9LUJ6	Lactobacillus_phage	92.0	6.8e-17
WP_163586873.1|1340469_1345446_-	hypothetical protein	NA	E9LUJ5	Lactobacillus_phage	22.7	2.0e-30
WP_163586874.1|1345393_1347238_-	peptidoglycan DD-metalloendopeptidase family protein	NA	E9LUJ4	Lactobacillus_phage	35.8	3.9e-117
WP_163586875.1|1347238_1348072_-|tail	phage tail family protein	tail	A0A0M7RF73	Lactobacillus_phage	36.1	6.6e-40
WP_163586876.1|1348089_1353765_-|tail	phage tail tape measure protein	tail	F8J1C3	Lactobacillus_phage	41.6	2.3e-91
WP_163586877.1|1353986_1354391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163586878.1|1354569_1355217_-|tail	phage tail protein	tail	E9LUQ8	Lactobacillus_phage	60.4	3.9e-56
WP_163586879.1|1355209_1355605_-	DUF806 family protein	NA	NA	NA	NA	NA
WP_163586880.1|1355604_1356048_-	hypothetical protein	NA	F8J1B8	Lactobacillus_phage	33.6	9.0e-12
WP_163586881.1|1356040_1356397_-|head	phage head closure protein	head	E9LUQ5	Lactobacillus_phage	47.1	9.8e-25
WP_163586882.1|1356359_1356743_-|head,tail	phage gp6-like head-tail connector protein	head,tail	F8J1B6	Lactobacillus_phage	43.7	3.7e-14
WP_163586883.1|1357030_1358173_-|capsid	phage major capsid protein	capsid	A0A0C5AEH1	Paenibacillus_phage	58.3	1.4e-112
WP_163587057.1|1358174_1358927_-|protease	Clp protease ClpP	protease	F8J1B3	Lactobacillus_phage	58.8	4.4e-67
WP_163586884.1|1358874_1360167_-|portal	phage portal protein	portal	F8J1B2	Lactobacillus_phage	47.4	2.6e-107
WP_163586885.1|1360368_1362159_-|terminase	terminase large subunit	terminase	F8J1B1	Lactobacillus_phage	65.3	2.5e-238
1361889:1361906	attL	GGTGCTCATCAAATTCCC	NA	NA	NA	NA
WP_163586886.1|1362133_1362598_-|terminase	phage terminase small subunit P27 family	terminase	F8J1A9	Lactobacillus_phage	42.9	2.2e-24
WP_163586887.1|1363045_1363381_-	HNH endonuclease	NA	A0A0U4JIC7	Exiguobacterium_phage	41.8	2.6e-11
WP_163586888.1|1363625_1364057_-	transcriptional regulator	NA	F8J1G8	Lactobacillus_phage	39.7	2.3e-20
WP_163587058.1|1364069_1364348_-	hypothetical protein	NA	A0A2K9VC24	Lactobacillus_phage	55.6	6.9e-18
WP_163586889.1|1364842_1365250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163586890.1|1365253_1365436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163586891.1|1365438_1365984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163586892.1|1366209_1366527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163586893.1|1366523_1366943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163586894.1|1366932_1367133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163586895.1|1367218_1367479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163586896.1|1367668_1367890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163586897.1|1367886_1368147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163586898.1|1368143_1368431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163586899.1|1368450_1368771_-	DUF1642 domain-containing protein	NA	C1KFT5	Lactobacillus_virus	42.6	2.2e-12
WP_163586900.1|1368773_1369004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163586901.1|1369000_1369432_-	RusA family crossover junction endodeoxyribonuclease	NA	E9LUN0	Lactobacillus_phage	85.7	3.7e-42
WP_163586902.1|1369428_1369797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163586903.1|1369899_1370133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023467091.1|1370299_1370497_-	helix-turn-helix transcriptional regulator	NA	Q6SE98	Lactobacillus_prophage	41.3	1.6e-05
WP_163586904.1|1370960_1371143_-	hypothetical protein	NA	D2KRE6	Lactobacillus_phage	65.4	3.3e-13
WP_163586905.1|1371146_1371938_-	ATP-binding protein	NA	E9LUM7	Lactobacillus_phage	63.0	2.8e-96
WP_163586906.1|1371946_1372672_-	hypothetical protein	NA	D2KRE4	Lactobacillus_phage	89.2	9.3e-115
WP_163586907.1|1372689_1373157_-	single-stranded DNA-binding protein	NA	A0A097PAQ3	Streptococcus_pyogenes_phage	65.5	5.2e-34
WP_163586908.1|1373156_1373867_-	hypothetical protein	NA	E9LUM4	Lactobacillus_phage	78.5	2.3e-110
WP_163586909.1|1373859_1374888_-	recombinase RecT	NA	E9LUM3	Lactobacillus_phage	79.7	2.1e-112
WP_012391052.1|1374857_1375067_-	hypothetical protein	NA	E9LUM2	Lactobacillus_phage	75.4	4.8e-24
WP_163586910.1|1375103_1375265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163586911.1|1375279_1375591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143441862.1|1375647_1375911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163586912.1|1376015_1376270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163586913.1|1376272_1377064_-	phage antirepressor	NA	A0A1Q1PVU2	Staphylococcus_phage	54.3	1.9e-73
WP_062813347.1|1377077_1377299_-	helix-turn-helix domain-containing protein	NA	A0A141E0Q1	Streptococcus_phage	52.9	1.1e-10
WP_062813348.1|1377455_1378070_+	helix-turn-helix domain-containing protein	NA	A0A1B2APZ3	Phage_Wrath	43.3	4.1e-39
WP_163586914.1|1378477_1378987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163586915.1|1379066_1380182_+|integrase	site-specific integrase	integrase	A0A0M9JJ77	Lactobacillus_phage	38.6	1.2e-68
WP_035423834.1|1382406_1383528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021350286.1|1383582_1384602_-	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_003683354.1|1384630_1386037_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.8	7.3e-47
WP_021350287.1|1386043_1387378_-	2-oxo acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
WP_014562491.1|1387393_1388371_-	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_014562492.1|1388373_1389465_-	pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha	NA	NA	NA	NA	NA
WP_003683348.1|1390417_1390744_-	branched-chain amino acid transporter AzlD	NA	NA	NA	NA	NA
WP_070955652.1|1390740_1391442_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_070955653.1|1391449_1392958_-	threonine synthase	NA	NA	NA	NA	NA
WP_070955654.1|1393072_1394350_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_023465872.1|1394359_1395220_+	homoserine kinase	NA	NA	NA	NA	NA
WP_004563200.1|1395451_1395976_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003683336.1|1396076_1396718_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_046025922.1|1396840_1397497_+	HD domain-containing protein	NA	A0A1S5V2G8	Saudi_moumouvirus	27.9	1.7e-06
WP_070955655.1|1397493_1398237_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_024500995.1|1398504_1399116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004563204.1|1399112_1399991_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	38.2	1.2e-15
WP_163586916.1|1400181_1401888_+	fibronectin/fibrinogen-binding protein	NA	M1I5P2	Paramecium_bursaria_Chlorella_virus	36.2	2.5e-09
WP_003684310.1|1402042_1403293_-|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	37.0	2.6e-56
WP_003686706.1|1404312_1404507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003686704.1|1404496_1404853_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_163586917.1|1404920_1406444_+|transposase	IS66 family transposase	transposase	S5VTP8	Leptospira_phage	27.7	6.1e-07
WP_003617037.1|1407178_1407814_+	carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_070955658.1|1408006_1410511_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
1408927:1408944	attR	GGTGCTCATCAAATTCCC	NA	NA	NA	NA
WP_021816255.1|1410512_1411595_-	carbamoyl phosphate synthase small subunit	NA	NA	NA	NA	NA
WP_054173511.1|1411624_1412500_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_003683312.1|1412540_1412978_-	signal peptidase II	NA	NA	NA	NA	NA
WP_070955659.1|1412977_1413412_-	VPDSG-CTERM exosortase interaction domain protein	NA	NA	NA	NA	NA
WP_003683308.1|1413424_1413826_+	ribonuclease HI family protein	NA	NA	NA	NA	NA
WP_004563210.1|1413981_1414584_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_070955660.1|1414817_1415681_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004563212.1|1415894_1416584_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_163586918.1|1416670_1417099_-	glycosyl transferase family 2	NA	NA	NA	NA	NA
WP_163586919.1|1417235_1417523_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_021349406.1|1417673_1418894_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.2	6.2e-95
WP_163587059.1|1418948_1419764_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.4	8.5e-40
WP_011241750.1|1419889_1420393_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_163586920.1|1420478_1421456_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_021349406.1|1422141_1423362_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.2	6.2e-95
WP_163587060.1|1423844_1425323_+	amidase	NA	NA	NA	NA	NA
WP_163586921.1|1425473_1426991_+	YfcC family protein	NA	NA	NA	NA	NA
WP_163586922.1|1427003_1428335_+	Sapep family Mn(2+)-dependent dipeptidase	NA	NA	NA	NA	NA
WP_163586923.1|1428572_1429706_-	class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_003683293.1|1429748_1430198_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_163586924.1|1430201_1431383_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_163586925.1|1431490_1433425_-	GTP-binding protein	NA	D0R0F5	Streptococcus_phage	28.5	1.2e-63
WP_003684379.1|1433529_1434555_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.6	1.7e-45
WP_003683290.1|1435055_1435424_-	cell division regulator GpsB	NA	NA	NA	NA	NA
WP_163586926.1|1435522_1436119_-	DUF1273 domain-containing protein	NA	NA	NA	NA	NA
WP_021349975.1|1436210_1436846_+	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	36.6	1.1e-23
WP_163586927.1|1436838_1439091_+	carboxypeptidase	NA	NA	NA	NA	NA
WP_004563221.1|1439213_1440125_-	EamA family transporter	NA	NA	NA	NA	NA
WP_163586928.1|1440247_1441267_+	L-glyceraldehyde 3-phosphate reductase	NA	NA	NA	NA	NA
WP_163586929.1|1441821_1442829_-	DUF1002 domain-containing protein	NA	NA	NA	NA	NA
WP_003683269.1|1442928_1443657_-	DnaD domain protein	NA	A0A0N7AE27	Bacillus_phage	37.1	3.5e-13
WP_004563225.1|1443748_1445044_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	29.2	7.4e-54
WP_004563226.1|1445070_1445589_-	DUF5590 domain-containg protein	NA	NA	NA	NA	NA
WP_163586930.1|1445639_1448480_-	ATP-dependent DNA helicase	NA	A0A1X9I5C8	Streptococcus_phage	34.6	3.6e-61
WP_163586931.1|1448709_1449645_+	mevalonate kinase	NA	NA	NA	NA	NA
WP_004563229.1|1449646_1450636_+	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_118033731.1|1450655_1451765_+	phosphomevalonate kinase	NA	NA	NA	NA	NA
WP_003683262.1|1451820_1452906_+	type 2 isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_163586932.1|1453062_1453860_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	31.8	1.5e-12
WP_163587061.1|1453870_1454752_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_035423854.1|1454747_1455677_-	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_004563234.1|1455654_1456518_-	phosphate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_163587062.1|1456723_1458097_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_023465983.1|1458225_1459032_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_163586933.1|1459263_1460181_-	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_163586934.1|1460193_1463373_-	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_003683908.1|1463372_1464455_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	35.6	2.5e-55
WP_075667596.1|1464456_1465746_-	dihydroorotase	NA	NA	NA	NA	NA
WP_163586935.1|1465745_1466711_-	aspartate carbamoyltransferase catalytic subunit	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	31.6	2.0e-24
WP_163586936.1|1467046_1467499_-	DUF1445 domain-containing protein	NA	NA	NA	NA	NA
WP_163586937.1|1467619_1471840_-	dextransucrase	NA	NA	NA	NA	NA
WP_163586938.1|1472252_1472540_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_163586939.1|1472563_1473442_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.9	8.8e-43
>prophage 15
NZ_CP047584	Lactobacillus fermentum strain AGR1485 chromosome, complete genome	2226862	1488328	1590914	2226862	protease,tail,portal,tRNA,head,integrase,capsid,transposase,terminase	Lactobacillus_phage(57.89%)	110	1530440:1530458	1566811:1566829
WP_016370900.1|1488328_1489852_+|transposase	IS66 family transposase	transposase	S5VTP8	Leptospira_phage	27.7	6.1e-07
WP_163586941.1|1490203_1491652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163586942.1|1491806_1492730_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.8e-31
WP_024501039.1|1493138_1494569_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_003686289.1|1494755_1495097_-	putative DNA-binding protein	NA	NA	NA	NA	NA
WP_024501040.1|1495113_1496643_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_118033484.1|1496658_1500222_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_003686282.1|1500235_1500934_-	ribonuclease III	NA	A0A1V0SDK0	Indivirus	34.5	2.2e-20
WP_003683858.1|1501080_1501326_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_012391443.1|1501368_1502406_-	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_118033485.1|1502418_1504455_-	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_003686279.1|1504519_1506214_-	DAK2 domain-containing protein	NA	NA	NA	NA	NA
WP_003683850.1|1506241_1506604_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_012391446.1|1506750_1506939_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_081011380.1|1507059_1507719_-	thiamine diphosphokinase	NA	NA	NA	NA	NA
WP_003686276.1|1507786_1508440_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_070955697.1|1508451_1509342_-	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_070955698.1|1509361_1511284_-	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	G9BWE0	Planktothrix_phage	29.6	9.4e-21
WP_003683838.1|1511287_1512025_-	Stp1/IreP family PP2C-type Ser/Thr phosphatase	NA	NA	NA	NA	NA
WP_015639219.1|1512043_1513390_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_003683834.1|1513382_1514333_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	32.7	1.5e-11
WP_024501045.1|1514355_1516773_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_015639220.1|1516744_1517974_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	37.5	1.5e-48
WP_003686267.1|1518044_1518329_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_003683827.1|1518325_1518946_-	guanylate kinase	NA	A0A0M5KCK5	Mollivirus	38.9	2.2e-11
WP_015639221.1|1519138_1519456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003686264.1|1519547_1521242_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_003683822.1|1521259_1521709_-	ArgR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003683820.1|1521722_1522538_-	TlyA family RNA methyltransferase	NA	NA	NA	NA	NA
WP_023466856.1|1522547_1523423_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_003683813.1|1523422_1523716_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_163586943.1|1523715_1525164_-	exodeoxyribonuclease VII large subunit	NA	A0A1V0SIT1	Klosneuvirus	30.7	1.2e-33
WP_003683810.1|1525164_1526022_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	38.9	8.4e-38
WP_046025326.1|1526199_1526619_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_003683803.1|1526618_1527059_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_024501048.1|1527149_1528226_-	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_003683800.1|1528311_1528593_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_003683798.1|1528616_1528940_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_003683797.1|1528952_1529261_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_003686253.1|1529424_1530066_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
1530440:1530458	attL	TGGTGCACATTTGGTGCAC	NA	NA	NA	NA
WP_163586944.1|1530859_1531588_-	DUF3800 domain-containing protein	NA	A0A059T7P7	Listeria_phage	42.6	1.9e-35
WP_163586945.1|1531745_1532909_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A075KJD2	Lactobacillus_phage	37.4	1.2e-39
WP_151466474.1|1532859_1533294_-	hypothetical protein	NA	A0A0A1ELI5	Lactobacillus_phage	40.9	3.3e-14
WP_163586946.1|1533290_1533617_-	hypothetical protein	NA	D2KRC5	Lactobacillus_phage	55.6	8.6e-28
WP_163586947.1|1533695_1534184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163586948.1|1534197_1534581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163586949.1|1534580_1535051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163586950.1|1535064_1535313_-	hypothetical protein	NA	E9LUJ7	Lactobacillus_phage	78.0	4.3e-27
WP_163586951.1|1535315_1535492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100184533.1|1535521_1538902_-	hypothetical protein	NA	E9LUJ5	Lactobacillus_phage	32.2	1.6e-47
WP_100184532.1|1538888_1540493_-	hypothetical protein	NA	E9LUJ4	Lactobacillus_phage	26.4	3.2e-38
WP_163586952.1|1541489_1542329_-|tail	phage tail family protein	tail	A0A2H4J4B7	uncultured_Caudovirales_phage	25.6	2.8e-14
WP_163586953.1|1542391_1546582_-	transglycosylase SLT domain-containing protein	NA	E9LUR1	Lactobacillus_phage	32.0	3.2e-26
WP_163586954.1|1546786_1547116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163586955.1|1547182_1547806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163586956.1|1547817_1548189_-	DUF806 family protein	NA	NA	NA	NA	NA
WP_163586957.1|1548188_1548626_-	hypothetical protein	NA	A0A2P0ZLE6	Lactobacillus_phage	49.0	1.9e-25
WP_163586958.1|1548618_1548987_-|head	phage head closure protein	head	B8R652	Lactobacillus_phage	44.1	4.4e-20
WP_003685944.1|1548958_1549261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163586959.1|1549281_1551030_-|capsid	phage major capsid protein	capsid	B8R651	Lactobacillus_phage	52.1	7.4e-134
WP_163586960.1|1550962_1552183_-|portal	phage portal protein	portal	B8R650	Lactobacillus_phage	48.5	9.6e-96
WP_163586961.1|1552182_1552365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163587063.1|1552379_1554281_-|terminase	terminase large subunit	terminase	B8R649	Lactobacillus_phage	63.7	1.9e-244
WP_163587064.1|1554280_1554742_-|terminase	phage terminase small subunit P27 family	terminase	B8R648	Lactobacillus_phage	52.4	5.3e-39
WP_163586962.1|1554937_1555444_-	HNH endonuclease	NA	B8R694	Lactobacillus_phage	56.6	1.1e-42
WP_163586963.1|1555576_1556398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163586964.1|1556573_1557092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163586965.1|1557270_1557723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163586966.1|1557793_1558486_-	helix-turn-helix domain-containing protein	NA	Q8SDH3	Lactococcus_phage	41.9	4.3e-16
WP_012391055.1|1558499_1559021_-	single-stranded DNA-binding protein	NA	A8ATZ7	Listeria_phage	54.3	2.3e-30
WP_075667202.1|1559020_1559872_-	hypothetical protein	NA	E9LUM4	Lactobacillus_phage	82.3	4.7e-142
WP_163586967.1|1559864_1560872_-	recombinase RecT	NA	E9LUM3	Lactobacillus_phage	81.1	8.1e-117
WP_062813262.1|1560874_1561084_-	hypothetical protein	NA	E9LUM2	Lactobacillus_phage	78.3	7.5e-25
WP_163586968.1|1561122_1561281_-	hypothetical protein	NA	E9LUM1	Lactobacillus_phage	86.5	1.7e-13
WP_163586969.1|1561420_1561747_-	hypothetical protein	NA	E9LUL9	Lactobacillus_phage	96.3	6.8e-57
WP_163586970.1|1561804_1562014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163586971.1|1562032_1562170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163586972.1|1562181_1562397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163587065.1|1562399_1563176_-	phage antirepressor protein	NA	A0A0A7DN31	Lactobacillus_phage	71.8	1.3e-85
WP_163586973.1|1563196_1563460_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_021815782.1|1563594_1563930_+	helix-turn-helix transcriptional regulator	NA	B8R672	Lactobacillus_phage	52.4	1.4e-09
WP_021815781.1|1563942_1564401_+	hypothetical protein	NA	A0A059T5E8	Listeria_phage	32.7	8.7e-18
WP_100184447.1|1564407_1564935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163586974.1|1564990_1565344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163586975.1|1565424_1565634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163586976.1|1565721_1566810_+|integrase	site-specific integrase	integrase	E9LUK6	Lactobacillus_phage	98.3	1.3e-200
WP_003686251.1|1567371_1567905_-	hypothetical protein	NA	NA	NA	NA	NA
1566811:1566829	attR	TGGTGCACATTTGGTGCAC	NA	NA	NA	NA
WP_163586977.1|1567897_1568866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024501050.1|1568858_1569752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003686242.1|1570321_1571674_-	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_015639231.1|1571872_1572796_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_003683779.1|1572894_1573071_+	DUF3042 family protein	NA	NA	NA	NA	NA
WP_003686239.1|1573250_1573670_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_003686237.1|1573694_1574657_-	ROK family glucokinase	NA	NA	NA	NA	NA
WP_003683770.1|1574674_1574911_-	YqgQ family protein	NA	NA	NA	NA	NA
WP_003686235.1|1574907_1575573_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_012391465.1|1575575_1576130_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_003683763.1|1576353_1576503_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_070955700.1|1576645_1578730_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_070955701.1|1578932_1581560_+	YfhO family protein	NA	NA	NA	NA	NA
WP_070955702.1|1581611_1582088_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_070955703.1|1582160_1582811_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.1	3.8e-35
WP_118033401.1|1582943_1585382_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_070955705.1|1585387_1586434_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	36.9	3.1e-26
WP_003683749.1|1586724_1587057_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003686227.1|1587076_1587583_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_003683745.1|1587696_1588503_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_003683743.1|1588541_1588820_+	acylphosphatase	NA	NA	NA	NA	NA
WP_003683740.1|1588886_1589798_+	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_118033400.1|1589945_1590914_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP047584	Lactobacillus fermentum strain AGR1485 chromosome, complete genome	2226862	1632291	1700350	2226862	protease,transposase,tRNA	Streptococcus_phage(22.22%)	58	NA	NA
WP_070955719.1|1632291_1632975_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_163586979.1|1632993_1634001_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_070955721.1|1634074_1634683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003683652.1|1634812_1635445_+	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	46.8	8.6e-48
WP_163586980.1|1635544_1636663_-	glycoside hydrolase family 73 protein	NA	A0A0K2CP65	Brevibacillus_phage	43.1	3.9e-19
WP_014562562.1|1636753_1638142_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_003683646.1|1638266_1638767_-	universal stress protein	NA	NA	NA	NA	NA
WP_003686153.1|1638846_1640247_-	dipeptidase PepV	NA	NA	NA	NA	NA
WP_118033393.1|1640354_1641221_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_003683641.1|1641222_1641600_+	DUF302 domain-containing protein	NA	NA	NA	NA	NA
WP_070955724.1|1641644_1643291_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_070955725.1|1643403_1643667_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_012391498.1|1643988_1646406_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	66.8	0.0e+00
WP_118033392.1|1646743_1647475_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_096494374.1|1647733_1648975_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	55.1	1.4e-107
WP_035423977.1|1648977_1649769_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.1	1.2e-43
WP_003686137.1|1650051_1651239_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	67.9	2.7e-143
WP_003683626.1|1651432_1652164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003686133.1|1652832_1654266_-	MFS transporter	NA	NA	NA	NA	NA
WP_118033391.1|1654387_1654843_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_003686129.1|1655061_1656429_-	amino acid permease	NA	NA	NA	NA	NA
WP_163586981.1|1656600_1656759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046025365.1|1657487_1657730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035168979.1|1658037_1659288_-|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	37.0	2.0e-56
WP_012390701.1|1659366_1659819_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	51.5	2.8e-32
WP_118033839.1|1660571_1661237_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024501077.1|1661391_1661823_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_012391509.1|1662036_1662540_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_118033838.1|1662693_1663521_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A288TY55	Enterococcus_phage	63.2	1.5e-15
WP_163586982.1|1663588_1663789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163586983.1|1663929_1665000_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	26.3	3.3e-07
WP_003683599.1|1665208_1666546_-	xanthine/uracil permease	NA	Q9KX94	Enterobacteria_phage	29.2	5.0e-21
WP_114698833.1|1666697_1667570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012391514.1|1667578_1668160_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A0C5K925	Enterococcus_phage	59.7	3.6e-53
WP_031274637.1|1668104_1670321_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	58.8	1.3e-247
WP_003683592.1|1670687_1671371_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_024501083.1|1671393_1672215_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_023467376.1|1672478_1672799_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_163586984.1|1672946_1673096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003684211.1|1679950_1680199_-	DUF1797 family protein	NA	NA	NA	NA	NA
WP_070955732.1|1680532_1681552_-	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_070955733.1|1681553_1682579_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_035437163.1|1682571_1683789_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_163586985.1|1684004_1685735_-	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_004563061.1|1685736_1686003_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_004563060.1|1686132_1686375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012391520.1|1686548_1688795_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	39.1	1.7e-122
WP_023466065.1|1689047_1689755_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_015639292.1|1689881_1690457_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_070955735.1|1690449_1691877_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	44.7	7.8e-97
WP_050755181.1|1692612_1693233_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	37.9	7.4e-28
WP_107760586.1|1693220_1694105_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_003684189.1|1694178_1694772_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_070955736.1|1694927_1695647_+	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_070955737.1|1695657_1696446_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	34.1	2.6e-25
WP_004563054.1|1696435_1697320_+	DMT family transporter	NA	NA	NA	NA	NA
WP_070955738.1|1697398_1698643_+	carboxylate--amine ligase	NA	NA	NA	NA	NA
WP_016370900.1|1698826_1700350_-|transposase	IS66 family transposase	transposase	S5VTP8	Leptospira_phage	27.7	6.1e-07
>prophage 17
NZ_CP047584	Lactobacillus fermentum strain AGR1485 chromosome, complete genome	2226862	1720534	1806374	2226862	protease,transposase,tRNA	Paenibacillus_phage(26.09%)	81	NA	NA
WP_127429449.1|1720534_1721692_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.1	3.3e-37
WP_111523422.1|1722044_1723472_-	flippase	NA	NA	NA	NA	NA
WP_100184702.1|1723474_1724596_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	77.8	7.5e-172
WP_014562705.1|1724822_1726010_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.1	4.4e-37
WP_080983522.1|1726170_1727322_-	acyltransferase	NA	NA	NA	NA	NA
WP_004563039.1|1727380_1727998_-	LPS biosynthesis protein	NA	NA	NA	NA	NA
WP_004563038.1|1727972_1729196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163586988.1|1729206_1729968_-	DUF4422 domain-containing protein	NA	NA	NA	NA	NA
WP_003684130.1|1729979_1730633_-	sugar transferase	NA	NA	NA	NA	NA
WP_004563035.1|1730802_1731621_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_003684128.1|1731714_1731921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003684127.1|1731956_1732172_+	DUF2922 domain-containing protein	NA	NA	NA	NA	NA
WP_035423753.1|1732352_1733249_-	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_004563033.1|1733377_1736317_-	LTA synthase family protein	NA	NA	NA	NA	NA
WP_021816412.1|1736472_1737330_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_012391556.1|1737442_1737889_+	flavodoxin	NA	NA	NA	NA	NA
WP_012391557.1|1737898_1738333_+	GtrA family protein	NA	NA	NA	NA	NA
WP_107504378.1|1738570_1738660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163587066.1|1738987_1740307_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	29.4	1.0e-34
WP_004563028.1|1740319_1741330_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_003684113.1|1741494_1741860_+	DUF4828 domain-containing protein	NA	NA	NA	NA	NA
WP_003684112.1|1742092_1742662_+	TIGR00730 family Rossman fold protein	NA	NA	NA	NA	NA
WP_100184707.1|1742662_1743565_-	L-2-hydroxyisocaproate dehydrogenase	NA	NA	NA	NA	NA
WP_163586989.1|1743729_1745238_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_118033536.1|1745352_1746132_-	flavoprotein	NA	NA	NA	NA	NA
WP_004563023.1|1746272_1746626_+	iron-sulfur cluster biosynthesis protein	NA	NA	NA	NA	NA
WP_163586990.1|1747181_1748807_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	26.2	1.7e-44
WP_023465808.1|1748977_1749445_-	DNA starvation/stationary phase protection protein	NA	A0A291I9P0	Lactobacillus_phage	31.5	7.1e-15
WP_118033533.1|1749525_1750086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003684096.1|1750558_1751818_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_118033532.1|1752040_1752589_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_118033531.1|1752796_1753345_+	MFS transporter	NA	NA	NA	NA	NA
WP_118033530.1|1753977_1754496_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	46.2	2.1e-31
WP_021816428.1|1754586_1755180_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_004563006.1|1755196_1755418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075667507.1|1755455_1756145_-	class I SAM-dependent methyltransferase	NA	A0A097BYE1	Leuconostoc_phage	41.6	9.1e-35
WP_012391566.1|1756307_1756880_-	NADPH-dependent F420 reductase	NA	NA	NA	NA	NA
WP_075667505.1|1756882_1757326_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_024501117.1|1757467_1759006_-	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_003684080.1|1759069_1759576_-|tRNA	prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_100184711.1|1759651_1760434_+	dimethylargininase	NA	NA	NA	NA	NA
WP_100184712.1|1760821_1762219_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_024501118.1|1762671_1763766_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_035437199.1|1764175_1764439_-	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_118033529.1|1764435_1764690_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_015639439.1|1764859_1765558_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	31.3	6.8e-22
WP_137876789.1|1765494_1766403_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	30.2	6.4e-12
WP_100184421.1|1766809_1768168_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_163586991.1|1768534_1769887_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_003684065.1|1770267_1771638_-	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.2	1.1e-10
WP_014562705.1|1771766_1772954_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.1	4.4e-37
WP_021349406.1|1773260_1774481_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.2	6.2e-95
WP_041812692.1|1775357_1776236_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.8	5.2e-43
WP_100184957.1|1776876_1777044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050755181.1|1777253_1777874_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	37.9	7.4e-28
WP_107760586.1|1777861_1778746_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_118033877.1|1778822_1779473_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_003681670.1|1779497_1779779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003681668.1|1779830_1780058_-	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_003681665.1|1780080_1782009_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	34.0	4.9e-94
WP_070955758.1|1782157_1782718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_118033876.1|1782875_1783799_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.1	1.4e-30
WP_015639373.1|1785246_1785750_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004562979.1|1786231_1787608_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	51.7	3.3e-129
WP_070955761.1|1787716_1788730_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_070955762.1|1788742_1790167_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_070955763.1|1790181_1791645_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_070955764.1|1791644_1791965_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_070955914.1|1792139_1793213_-	CamS family sex pheromone protein	NA	NA	NA	NA	NA
WP_070955765.1|1793254_1795294_-	NAD-dependent DNA ligase LigA	NA	A0A1W6DX16	Sphingobium_phage	36.3	3.7e-100
WP_100184901.1|1795295_1797566_-	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	41.8	4.8e-133
WP_003681628.1|1797743_1798916_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_163586992.1|1798917_1799505_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_003681625.1|1799520_1800135_-	glycoside hydrolase family 73 protein	NA	S5M633	Brevibacillus_phage	51.7	2.9e-32
WP_100184903.1|1800529_1801303_-	(S)-acetoin forming diacetyl reductase	NA	NA	NA	NA	NA
WP_127429338.1|1801721_1802897_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0ICY9	Lactobacillus_phage	54.1	1.4e-112
WP_014081459.1|1802896_1803295_-|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	62.9	1.1e-45
WP_163586993.1|1803448_1804543_+	endonuclease	NA	NA	NA	NA	NA
WP_004562969.1|1804638_1805034_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_004562968.1|1805047_1805491_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_163586994.1|1805597_1806374_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
>prophage 18
NZ_CP047584	Lactobacillus fermentum strain AGR1485 chromosome, complete genome	2226862	1838046	1894094	2226862	protease,transposase	Lactobacillus_phage(21.43%)	50	NA	NA
WP_070955772.1|1838046_1840551_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	39.8	8.2e-126
WP_003681550.1|1840569_1841040_-	CtsR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004562952.1|1841178_1842198_-	alcohol dehydrogenase AdhP	NA	A0A2K9L7I1	Tupanvirus	29.9	8.4e-29
WP_118033433.1|1842484_1843201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349855.1|1843262_1843928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004562946.1|1844186_1844729_-	cobalt ABC transporter permease	NA	NA	NA	NA	NA
WP_004562945.1|1845075_1845906_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_080543045.1|1845964_1846309_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003681527.1|1846224_1846545_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_031274403.1|1846557_1846728_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003681522.1|1847467_1848109_-	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	52.5	5.4e-58
WP_003681521.1|1848239_1849730_-	amino acid permease	NA	NA	NA	NA	NA
WP_004562939.1|1850039_1850507_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_118033434.1|1850551_1851361_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_024501147.1|1851579_1852248_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_035423726.1|1852302_1852791_-	threonine/serine exporter	NA	NA	NA	NA	NA
WP_118033435.1|1852800_1853550_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_021350084.1|1853721_1853922_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	69.7	6.9e-20
WP_021350085.1|1854087_1854753_-	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_004562926.1|1854905_1855811_+	cation transporter	NA	A0A1V0SED0	Indivirus	32.0	1.0e-09
WP_004562925.1|1855965_1856661_-	VIT family protein	NA	NA	NA	NA	NA
WP_004562924.1|1856678_1857362_-	VIT family protein	NA	NA	NA	NA	NA
WP_048339939.1|1857510_1857987_-	universal stress protein	NA	NA	NA	NA	NA
WP_003681491.1|1858192_1858627_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_031274409.1|1858675_1859890_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_004562921.1|1860060_1861893_-	ribonuclease J	NA	A0A0C5AJ83	Bacteriophage	33.3	6.9e-05
WP_003681484.1|1862164_1862506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003681483.1|1862600_1863128_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_070955915.1|1863206_1864670_+	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_070955778.1|1864673_1865378_+	DUF4811 domain-containing protein	NA	NA	NA	NA	NA
WP_118033436.1|1866446_1867331_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	31.7	3.1e-11
WP_004562914.1|1867604_1870193_+	bifunctional lysylphosphatidylglycerol flippase/synthetase MprF	NA	NA	NA	NA	NA
WP_118033437.1|1870468_1871053_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_003681472.1|1871068_1872067_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_080650612.1|1872302_1872965_-	uracil-DNA glycosylase	NA	NA	NA	NA	NA
WP_023466024.1|1872982_1874320_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_118033438.1|1874394_1875288_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004562908.1|1876948_1878340_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	33.9	3.1e-58
WP_118033439.1|1878349_1879738_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_163586999.1|1880120_1880732_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	51.9	2.0e-49
WP_118033440.1|1880751_1882104_+	NADPH-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	55.4	7.7e-54
WP_118033441.1|1882332_1883991_-	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_004562903.1|1884139_1885024_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_118033442.1|1885109_1885811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163587000.1|1885887_1887108_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.5	2.8e-95
WP_004562901.1|1887385_1888099_-	EcsC family protein	NA	NA	NA	NA	NA
WP_163587001.1|1889566_1889938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118033913.1|1890013_1890934_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	37.1	6.9e-22
WP_163587002.1|1892550_1893249_+|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	30.4	2.9e-20
WP_163587067.1|1893185_1894094_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	30.2	6.4e-12
>prophage 19
NZ_CP047584	Lactobacillus fermentum strain AGR1485 chromosome, complete genome	2226862	1917072	1956609	2226862	transposase	Lactobacillus_virus(18.18%)	34	NA	NA
WP_003684310.1|1917072_1918323_-|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	37.0	2.6e-56
WP_163587003.1|1918401_1918854_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	50.8	6.1e-32
WP_086031824.1|1920119_1921406_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_003681402.1|1921764_1921980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003681397.1|1923134_1923368_+	cytochrome b5	NA	NA	NA	NA	NA
WP_003681394.1|1923750_1924227_-	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_070955799.1|1924287_1925403_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	40.8	1.6e-73
WP_100184838.1|1925834_1926095_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_014562645.1|1926162_1927173_-	aspartate--ammonia ligase	NA	NA	NA	NA	NA
WP_100184836.1|1927981_1928494_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_070955800.1|1928798_1930319_+	LytTR family transcriptional regulator	NA	O64031	Bacillus_phage	25.1	2.1e-31
WP_012391656.1|1930315_1930774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004562871.1|1931016_1931439_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003681371.1|1931715_1932450_+	5-oxoprolinase subunit PxpB	NA	NA	NA	NA	NA
WP_070955801.1|1932450_1933467_+	biotin-dependent carboxyltransferase family protein	NA	NA	NA	NA	NA
WP_003681368.1|1933469_1933898_+	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
WP_118033712.1|1933869_1935258_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_070447553.1|1935244_1935994_+	LamB/YcsF family protein	NA	NA	NA	NA	NA
WP_070955804.1|1936006_1937218_+	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_003681364.1|1937429_1938599_-	MFS transporter	NA	NA	NA	NA	NA
WP_070955805.1|1939059_1940391_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	24.2	6.9e-23
WP_003681362.1|1940544_1940859_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	39.6	1.4e-14
WP_004562853.1|1941871_1942120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163587004.1|1942414_1943578_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	71.4	3.1e-160
WP_015638546.1|1943574_1944012_-|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	71.7	6.3e-50
WP_070955807.1|1944305_1945658_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	24.3	5.2e-18
WP_070955808.1|1945638_1947093_-	amino acid permease	NA	NA	NA	NA	NA
WP_015639481.1|1948016_1948847_-	YbgC/FadM family acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_118033679.1|1948944_1949475_+	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_012391669.1|1949697_1951080_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_014562655.1|1951079_1952369_-	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_046025475.1|1952595_1954791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046025578.1|1954992_1955421_+|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	65.2	1.9e-46
WP_088460459.1|1955442_1956609_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	74.1	1.9e-162
>prophage 20
NZ_CP047584	Lactobacillus fermentum strain AGR1485 chromosome, complete genome	2226862	2081355	2203074	2226862	transposase,tRNA	Paenibacillus_phage(21.21%)	105	NA	NA
WP_163587017.1|2081355_2082543_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.1	4.4e-37
WP_070955844.1|2082731_2084453_-	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_012391749.1|2084640_2085969_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_003681135.1|2085983_2086379_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_163587018.1|2086402_2087320_-	ribokinase	NA	NA	NA	NA	NA
WP_070955845.1|2087564_2088524_-	sugar-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003685473.1|2088627_2089281_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_070955846.1|2089294_2090311_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_003685479.1|2090344_2091292_+	ribokinase	NA	NA	NA	NA	NA
WP_003685481.1|2091351_2092776_-	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_062813589.1|2092973_2093978_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_062813588.1|2094531_2096037_-	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_163586742.1|2097075_2098296_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.0	1.8e-94
WP_163587019.1|2100020_2101715_-	oleate hydratase	NA	NA	NA	NA	NA
WP_163587020.1|2101955_2102531_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_163587021.1|2103907_2104465_+	recombinase family protein	NA	A0A1J1J8Z4	Escherichia_phage	44.0	1.7e-31
WP_021349406.1|2104875_2106096_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.2	6.2e-95
WP_070955847.1|2106284_2108684_-	phosphoketolase family protein	NA	NA	NA	NA	NA
WP_070955848.1|2108889_2109687_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_003685491.1|2109693_2110422_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003681115.1|2110565_2111066_+|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_003681114.1|2111069_2111813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070955849.1|2111872_2113309_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_070955850.1|2113663_2114476_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_014562717.1|2114741_2115257_-	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_070955852.1|2115266_2115794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003681106.1|2115942_2117328_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_003681105.1|2117414_2117879_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
WP_021349399.1|2118123_2118555_-	VOC family protein	NA	NA	NA	NA	NA
WP_070955853.1|2118747_2119917_+	MFS transporter	NA	NA	NA	NA	NA
WP_070955854.1|2120407_2121901_+	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	36.9	4.1e-72
WP_012391767.1|2122073_2123513_+	NADP-dependent phosphogluconate dehydrogenase	NA	E3SPS4	Prochlorococcus_phage	30.2	1.1e-29
WP_021350129.1|2123767_2124241_-	universal stress protein	NA	NA	NA	NA	NA
WP_070955855.1|2124402_2124858_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_070955856.1|2125016_2125784_+	glucose 1-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.9	2.5e-17
WP_070955857.1|2125800_2126802_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_163587022.1|2127073_2128882_-	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_014562721.1|2128884_2130177_-	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_163587023.1|2130424_2131096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163587024.1|2131500_2132569_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	34.0	7.5e-36
WP_023467458.1|2132751_2134431_+	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_163587025.1|2134703_2136227_-|transposase	IS66 family transposase	transposase	S5VTP8	Leptospira_phage	28.3	3.2e-08
WP_003686704.1|2136294_2136651_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_003686706.1|2136640_2136835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004562986.1|2137302_2137962_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.3	8.1e-41
WP_046026069.1|2139734_2140922_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.1	2.6e-37
WP_070955335.1|2143000_2144017_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.1	1.6e-35
WP_163587026.1|2146352_2146580_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_163587070.1|2147451_2147829_-|transposase	transposase	transposase	A0A1B1P773	Bacillus_phage	42.5	2.0e-12
WP_021349406.1|2147868_2149089_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.2	6.2e-95
WP_163587027.1|2149300_2149924_-	cation transporter	NA	NA	NA	NA	NA
WP_076640292.1|2149893_2150520_-	recombinase family protein	NA	K7PJT4	Enterobacteria_phage	35.3	1.3e-11
WP_002817475.1|2150805_2151102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003688746.1|2151120_2151285_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_114807153.1|2151337_2153533_-	copper-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	30.3	1.1e-60
WP_003672153.1|2153783_2154215_-	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
WP_163587028.1|2154725_2155913_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.1	3.4e-37
WP_163587029.1|2156399_2157104_-	class I SAM-dependent methyltransferase	NA	A0A097BYE1	Leuconostoc_phage	43.0	3.1e-38
WP_163587071.1|2157613_2157739_-	LtrC	NA	NA	NA	NA	NA
WP_010011610.1|2157772_2158651_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.4	2.0e-42
WP_003688751.1|2158674_2158962_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_163587030.1|2159806_2160277_+|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	29.9	1.0e-13
WP_080965008.1|2160441_2161350_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	29.6	1.9e-11
WP_003685535.1|2161605_2163549_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_163587031.1|2163624_2165847_+	alpha-galactosidase	NA	NA	NA	NA	NA
WP_070955868.1|2166061_2167063_-	substrate-binding domain-containing protein	NA	C6ZCU4	Enterobacteria_phage	22.8	9.9e-06
WP_046025672.1|2167090_2168545_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_046025671.1|2168572_2169739_-	galactokinase	NA	NA	NA	NA	NA
WP_003685545.1|2169910_2170861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003685547.1|2170866_2171655_+	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_003682203.1|2171673_2172186_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_003682205.1|2172198_2172423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003682207.1|2172538_2173273_-	amino acid ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	28.1	1.1e-14
WP_003682208.1|2173274_2173964_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003685553.1|2174066_2174867_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003682214.1|2175005_2175332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070955869.1|2175433_2176372_+	phosphoglycerate dehydrogenase	NA	A0A2R8FDS8	Brazilian_cedratvirus	33.2	3.2e-30
WP_003682220.1|2176373_2176856_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_003682221.1|2177072_2177867_+	nicotinamide mononucleotide transporter	NA	A0A0C5K6M3	Enterococcus_phage	33.1	5.8e-25
WP_070955870.1|2177973_2178483_-	O-acetyl-ADP-ribose deacetylase	NA	A0A0K1L687	Scale_drop_disease_virus	49.4	2.5e-37
WP_070955871.1|2178491_2180396_-	peptidase M13	NA	E3T4I7	Cafeteria_roenbergensis_virus	29.8	1.2e-71
WP_070955872.1|2180655_2181966_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	33.7	1.4e-47
WP_003685567.1|2182062_2182356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163587072.1|2182348_2183509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163587032.1|2183501_2184644_-	AAA family ATPase	NA	A0A141HRX4	Bacillus_phage	31.1	1.0e-22
WP_003682233.1|2184645_2185275_-	DNA-3-methyladenine glycosylase	NA	NA	NA	NA	NA
WP_070955874.1|2185334_2185703_+	DUF488 family protein	NA	NA	NA	NA	NA
WP_003685574.1|2185993_2186179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003685576.1|2186179_2186854_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003685578.1|2186856_2187180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003682248.1|2187273_2187900_+	NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_003682249.1|2188080_2188638_-	elongation factor P	NA	NA	NA	NA	NA
WP_003685581.1|2188784_2189417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003682253.1|2189553_2189787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118033642.1|2189833_2190781_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_118033641.1|2191210_2193274_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A7RUS8	Clostridium_phage	48.3	5.5e-27
WP_003682256.1|2193392_2193713_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003685587.1|2193894_2194353_-	arginine repressor	NA	NA	NA	NA	NA
WP_003685589.1|2194514_2195207_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.2	3.8e-33
WP_003682259.1|2195219_2196281_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_070955922.1|2196204_2196807_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_070955878.1|2196963_2197974_-	zinc-dependent alcohol dehydrogenase family protein	NA	A0A2K9L7I1	Tupanvirus	27.7	6.2e-08
WP_070955879.1|2198269_2199832_+	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_163587033.1|2200206_2200953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070955881.1|2201268_2203074_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	33.8	1.4e-87
