The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP053792	Streptococcus canis strain HL_77_1 chromosome, complete genome	2261128	37262	47722	2261128		Microbacterium_phage(16.67%)	6	NA	NA
WP_164406340.1|37262_40988_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	27.8	1.1e-38
WP_125074320.1|41217_42672_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.1	5.2e-56
WP_125074319.1|42925_43954_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	44.0	5.1e-66
WP_164406342.1|43946_44501_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.3	1.8e-25
WP_125074329.1|44980_46528_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.9	4.1e-75
WP_125074317.1|46600_47722_-	SH3 domain-containing protein	NA	F8HGP2	Streptococcus_phage	30.3	3.1e-08
>prophage 2
NZ_CP053792	Streptococcus canis strain HL_77_1 chromosome, complete genome	2261128	253144	322281	2261128	integrase,tRNA,transposase,protease,holin	Staphylococcus_prophage(10.0%)	60	242549:242567	316872:316890
242549:242567	attL	AATTTGCCATTGGTATGGG	NA	NA	NA	NA
WP_125075051.1|253144_254671_+|transposase	IS1182 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	37.4	9.2e-88
WP_141290653.1|254878_255232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141290585.1|255313_257833_+	SEC10/PgrA surface exclusion domain-containing protein	NA	NA	NA	NA	NA
WP_164406607.1|259939_262429_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_141290587.1|262695_262998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141290589.1|263015_263465_+	DUF961 family protein	NA	NA	NA	NA	NA
WP_141290591.1|263468_265196_+	cell division protein FtsK	NA	A0A1S5SFB5	Streptococcus_phage	33.3	1.7e-58
WP_141290593.1|265497_266739_+	replication initiation factor domain-containing protein	NA	NA	NA	NA	NA
WP_141290595.1|266719_267079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141290597.1|267075_267429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141290599.1|267483_267723_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_141290601.1|267719_268007_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_141290603.1|268222_268498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141290605.1|268553_268922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141290607.1|268930_269407_+	DUF2309 domain-containing protein	NA	NA	NA	NA	NA
WP_141290609.1|269495_269762_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_141290611.1|269754_270009_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_141290613.1|270054_271005_+	conjugal transfer protein	NA	NA	NA	NA	NA
WP_011285000.1|271023_271293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141290615.1|271295_271706_+	conjugal transfer protein	NA	NA	NA	NA	NA
WP_164227714.1|271726_274228_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_172774125.1|274242_276558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141290617.1|276723_276870_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_141290619.1|277009_278362_+	CHAP domain-containing protein	NA	NA	NA	NA	NA
WP_141290620.1|278361_278919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141290622.1|278943_279699_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_141290624.1|279801_279990_+	DUF3173 family protein	NA	NA	NA	NA	NA
WP_164406601.1|279982_281167_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9AZR0	Lactococcus_phage	30.3	6.8e-38
WP_164406599.1|281554_282841_-	AAA family ATPase	NA	A0A127AWE7	Bacillus_phage	46.0	1.6e-96
WP_125074575.1|282873_283440_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	42.9	1.6e-32
WP_125074576.1|283473_285231_-	aminodeoxychorismate synthase component I	NA	S4VT78	Pandoravirus	28.1	1.3e-32
WP_164406597.1|285427_287407_-	amidase	NA	NA	NA	NA	NA
WP_125074578.1|287582_288053_+	DUF3013 family protein	NA	NA	NA	NA	NA
WP_125074579.1|288054_288399_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_125074580.1|288494_289448_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_125074581.1|289447_290206_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_125074582.1|290364_291357_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_125074583.1|291651_293838_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_164406595.1|293920_294757_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_164406593.1|295061_295214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003046383.1|295206_296244_-	M42 family metallopeptidase	NA	NA	NA	NA	NA
WP_125074585.1|296481_296943_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
WP_164406605.1|297418_298948_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_125074587.1|299140_300364_+	YSIRK-type signal peptide-containing protein	NA	NA	NA	NA	NA
WP_125074588.1|300661_302881_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	35.3	2.8e-08
WP_172774156.1|303089_304247_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_164406911.1|304522_304969_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_125074887.1|305226_306075_+	PucR family transcriptional regulator	NA	NA	NA	NA	NA
WP_125074886.1|306699_307833_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	31.8	2.1e-20
WP_125074885.1|307913_309527_+	alpha-glucosidase	NA	NA	NA	NA	NA
WP_164406916.1|309838_313462_+	pullulanase	NA	NA	NA	NA	NA
WP_003057858.1|313614_313905_-	hypothetical protein	NA	Q938I9	Temperate_phage	47.1	5.0e-11
WP_125074883.1|314061_314412_+	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_125074882.1|314524_314884_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_003046424.1|315114_315864_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	43.2	8.7e-23
WP_125074881.1|315876_316671_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_125074880.1|316768_318028_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
316872:316890	attR	AATTTGCCATTGGTATGGG	NA	NA	NA	NA
WP_125074879.1|318233_320093_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_125074878.1|320146_320704_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_125075056.1|320823_322281_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP053792	Streptococcus canis strain HL_77_1 chromosome, complete genome	2261128	490310	496731	2261128		Streptococcus_phage(100.0%)	10	NA	NA
WP_003046895.1|490310_490946_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	64.9	7.0e-66
WP_125074359.1|490961_491834_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	40.7	1.9e-53
WP_125074360.1|491830_492631_+	signal peptidase II	NA	NA	NA	NA	NA
WP_003046904.1|492623_492947_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	60.4	1.6e-29
WP_125074361.1|492951_493815_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	75.3	7.7e-116
WP_125074362.1|493842_494238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125074363.1|494283_494913_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_125074364.1|495260_495812_+	GNAT family N-acetyltransferase	NA	M1PSC3	Streptococcus_phage	53.6	6.1e-50
WP_125074365.1|495880_496378_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	54.0	6.7e-40
WP_125074366.1|496374_496731_+	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	65.8	2.4e-39
>prophage 5
NZ_CP053792	Streptococcus canis strain HL_77_1 chromosome, complete genome	2261128	814087	918586	2261128	integrase,capsid,terminase,tRNA,tail,portal,transposase,protease,holin	Streptococcus_phage(65.71%)	119	875107:875146	915942:915981
WP_125074554.1|814087_815302_+|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_125074553.1|815438_816638_+	CapA family protein	NA	A0A2H4JC87	uncultured_Caudovirales_phage	33.9	9.9e-37
WP_002985116.1|816851_817166_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_125074552.1|817177_817507_+|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_002985110.1|817534_817828_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_125074551.1|818169_819084_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	26.3	2.8e-07
WP_164407722.1|819080_819539_+	signal peptidase II	NA	NA	NA	NA	NA
WP_125074549.1|819528_820422_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_125074548.1|820551_821166_-	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	37.7	1.1e-23
WP_125074547.1|821443_821965_+	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR	NA	NA	NA	NA	NA
WP_125074546.1|821980_823240_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	34.5	6.3e-58
WP_164407720.1|823293_824229_+	aspartate carbamoyltransferase catalytic subunit	NA	M1HGA5	Paramecium_bursaria_Chlorella_virus	32.6	1.0e-25
WP_003048073.1|824262_825351_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	36.9	1.4e-61
WP_125074544.1|825708_828882_+	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_125073879.1|829101_830367_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_164407718.1|830366_831077_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	43.0	1.7e-36
WP_125073878.1|831088_832309_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_125073877.1|832301_832919_+	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	49.5	8.1e-43
WP_164407716.1|832995_834738_+	glycerophosphoryl diester phosphodiesterase membrane domain-containing protein	NA	NA	NA	NA	NA
WP_125073875.1|834863_835136_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_003048106.1|835145_835385_+	KH domain-containing protein	NA	NA	NA	NA	NA
WP_125073874.1|836113_836632_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_125073883.1|836621_837353_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_141290784.1|837352_838345_+	FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	55.6	2.0e-30
WP_125073872.1|838525_839584_+	PTS transporter subunit IIC	NA	NA	NA	NA	NA
WP_125073871.1|839596_840520_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_125073870.1|840774_841488_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_125073869.1|841484_842396_+	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_125073868.1|842392_844345_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_125073867.1|844466_845066_+	glycoside hydrolase family 73 protein	NA	A0A249Y0X5	Enterococcus_phage	34.5	1.9e-12
WP_125073866.1|845217_845925_+	glycoside hydrolase family 73 protein	NA	A0A0K2CP65	Brevibacillus_phage	38.7	3.6e-10
WP_125073865.1|845977_846499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003048130.1|846570_846951_+	DUF1149 family protein	NA	NA	NA	NA	NA
WP_164407714.1|846950_847796_+	DegV family EDD domain-containing protein	NA	NA	NA	NA	NA
WP_164407711.1|847892_849101_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	45.0	3.4e-37
WP_125073863.1|849097_850969_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	31.3	2.8e-62
WP_164407709.1|851327_852677_+	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_125073861.1|852808_853219_+	peptide deformylase	NA	NA	NA	NA	NA
WP_164407707.1|853344_855369_-	5'-nucleotidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_125073859.1|855826_857548_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.3	1.5e-38
WP_125073858.1|857549_859292_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.1	3.2e-44
WP_003048147.1|859916_860795_+	mevalonate kinase	NA	NA	NA	NA	NA
WP_125073856.1|860776_861721_+	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_125073855.1|861713_862727_+	phosphomevalonate kinase	NA	NA	NA	NA	NA
WP_125073854.1|862713_863706_+	type 2 isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_125073881.1|863993_864161_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_125073853.1|864348_864603_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_125073852.1|864700_865975_-	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
WP_125073851.1|865955_867137_-	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_125073850.1|867344_868184_+	thymidylate synthase	NA	U5J9N5	Bacillus_phage	53.9	7.5e-84
WP_125073849.1|868263_868761_+	dihydrofolate reductase	NA	A0A0K2QQK4	Ralstonia_phage	32.2	7.5e-15
WP_125073848.1|869103_870333_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	60.5	1.7e-137
WP_125073847.1|870342_870942_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_125073846.1|871091_871832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125073845.1|873072_873885_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_125073844.1|873965_874346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142998413.1|874398_874557_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
875107:875146	attL	GTTTTAGAGCTATGCTGTTTTGAATGGTCCCAAAACCCAA	NA	NA	NA	NA
WP_164407705.1|875409_876606_-|integrase	tyrosine-type recombinase/integrase	integrase	A3F610	Streptococcus_phage	98.2	7.4e-226
WP_125075055.1|876958_878251_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	82.0	1.7e-188
WP_164407456.1|878409_879003_-	hypothetical protein	NA	A0A1S5SDT5	Streptococcus_phage	32.7	5.8e-06
WP_164407458.1|879014_879398_-	ImmA/IrrE family metallo-endopeptidase	NA	Q938N7	Temperate_phage	60.8	1.8e-37
WP_063629762.1|879401_879752_-	helix-turn-helix transcriptional regulator	NA	A0A1S5S8C4	Streptococcus_phage	70.6	8.1e-40
WP_164407460.1|880041_880206_+	hypothetical protein	NA	A3F614	Streptococcus_phage	96.3	3.9e-21
WP_015984784.1|880247_880451_+	hypothetical protein	NA	A3F615	Streptococcus_phage	100.0	2.7e-27
WP_164407462.1|880695_881025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164407464.1|881024_881456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164407466.1|881515_882235_+	ORF6C domain-containing protein	NA	A3F617	Streptococcus_phage	80.7	7.6e-109
WP_164407468.1|882308_882566_+	DNA-binding protein	NA	A3F618	Streptococcus_phage	98.8	7.0e-41
WP_164407470.1|882703_882892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164407472.1|882904_883489_+	hypothetical protein	NA	A3F621	Streptococcus_phage	97.9	1.2e-107
WP_164407474.1|883528_884449_+	DnaD domain protein	NA	A3F622	Streptococcus_phage	98.0	8.1e-148
WP_164407476.1|884484_884712_+	hypothetical protein	NA	C5J991	Streptococcus_phage	50.7	1.2e-12
WP_155782846.1|884725_884932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085577387.1|884941_885127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164407478.1|885123_885288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164407480.1|885284_885569_+	hypothetical protein	NA	A3F628	Streptococcus_phage	97.9	6.3e-43
WP_164407482.1|885572_886055_+	methyltransferase domain-containing protein	NA	A0A097PAU8	Streptococcus_pyogenes_phage	95.6	3.1e-90
WP_164407484.1|886056_886791_+	DNA (cytosine-5-)-methyltransferase	NA	A0A140HLV8	Bacillus_phage	68.3	1.5e-67
WP_164407531.1|886888_887275_+	DNA cytosine methyltransferase	NA	A0A1X9I6Y5	Streptococcus_phage	61.9	2.0e-15
WP_002986215.1|887823_888156_+	hypothetical protein	NA	A0A1S5SCX1	Streptococcus_phage	57.4	1.2e-32
WP_164407488.1|888148_888376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155782953.1|888365_888758_+	single-stranded DNA-binding protein	NA	A0A1P8VVS8	Streptococcus_phage	70.3	5.9e-47
WP_029713970.1|888771_889050_+	hypothetical protein	NA	A3F632	Streptococcus_phage	96.7	9.6e-44
WP_164407490.1|889046_889388_+	helix-turn-helix domain-containing protein	NA	A3F633	Streptococcus_phage	100.0	1.4e-57
WP_164407492.1|889510_890338_+	prohibitin family protein	NA	A3F634	Streptococcus_phage	98.9	7.4e-116
WP_164407495.1|890352_890754_+	transcriptional regulator	NA	A3F635	Streptococcus_phage	99.2	1.3e-70
WP_011054435.1|890913_891489_+|integrase	site-specific integrase	integrase	A3F636	Streptococcus_phage	99.5	7.4e-107
WP_164407497.1|891642_891939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164407499.1|891977_892364_+	hypothetical protein	NA	A3F638	Streptococcus_phage	94.5	2.1e-65
WP_164407501.1|892356_892662_+	HNH endonuclease	NA	A3F639	Streptococcus_phage	97.0	3.8e-54
WP_164407503.1|892804_893122_+|terminase	P27 family phage terminase small subunit	terminase	A3F640	Streptococcus_phage	97.1	7.3e-48
WP_164407506.1|893134_894865_+|terminase	terminase large subunit	terminase	A3F641	Streptococcus_phage	98.8	0.0e+00
WP_164407508.1|895232_896420_+|portal	phage portal protein	portal	A3F643	Streptococcus_phage	96.2	7.4e-218
WP_164407510.1|896400_897207_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A3F644	Streptococcus_phage	94.0	4.5e-142
WP_164407512.1|897223_898357_+|capsid	phage major capsid protein	capsid	A3F645	Streptococcus_phage	98.9	1.1e-207
WP_164407515.1|898377_898551_+	hypothetical protein	NA	A3F646	Streptococcus_phage	94.7	2.2e-22
WP_027970290.1|898550_898859_+	hypothetical protein	NA	A3F647	Streptococcus_phage	96.1	4.3e-45
WP_037562728.1|898851_899214_+	hypothetical protein	NA	A3F648	Streptococcus_phage	97.5	1.5e-60
WP_143978750.1|899215_899614_+	HK97 gp10 family phage protein	NA	A3F649	Streptococcus_phage	75.0	9.5e-53
WP_164407517.1|899606_899987_+	hypothetical protein	NA	A3F650	Streptococcus_phage	96.8	9.0e-61
WP_164407519.1|899998_900583_+|tail	phage tail protein	tail	A3F651	Streptococcus_phage	92.2	1.1e-94
WP_164407521.1|900678_900981_+	hypothetical protein	NA	A3F652	Streptococcus_phage	90.9	5.5e-45
WP_164407454.1|900995_901163_+	hypothetical protein	NA	A3F653	Streptococcus_phage	97.4	1.2e-12
WP_164407523.1|901206_905307_+|tail	phage tail tape measure protein	tail	A3F654	Streptococcus_phage	76.9	0.0e+00
WP_164407525.1|905319_906090_+|tail	phage tail family protein	tail	A3F655	Streptococcus_phage	94.9	2.6e-139
WP_164407527.1|906086_908135_+|tail	phage tail protein	tail	A3F656	Streptococcus_phage	85.0	0.0e+00
WP_164407529.1|909315_909690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172774133.1|909701_911405_+	hypothetical protein	NA	Q938J9	Temperate_phage	67.6	3.0e-140
WP_164407648.1|911416_911845_+	DUF1617 family protein	NA	Q938J8	Temperate_phage	80.7	7.5e-56
WP_143928019.1|911847_912273_+	DUF1366 domain-containing protein	NA	NA	NA	NA	NA
WP_164406953.1|912298_912460_+	hypothetical protein	NA	Q9MCJ3	Streptococcus_virus	57.4	2.9e-08
WP_125073767.1|912468_912843_+|holin	phage holin family protein	holin	A0A097QQ04	Enterococcus_phage	54.7	4.0e-29
WP_164406948.1|912965_914183_+	glucosaminidase domain-containing protein	NA	A0A1P8VVM5	Streptococcus_phage	60.9	2.3e-166
WP_164406943.1|914326_914578_-	hypothetical protein	NA	A3F666	Streptococcus_phage	97.6	1.2e-42
WP_164406938.1|914718_914865_-	hypothetical protein	NA	A3F667	Streptococcus_phage	100.0	2.3e-17
WP_011054450.1|915017_915227_+	helix-turn-helix transcriptional regulator	NA	A3F668	Streptococcus_phage	100.0	1.2e-30
WP_164406925.1|915420_915603_+	Paratox	NA	A3F673	Streptococcus_phage	75.0	1.3e-17
WP_125073843.1|916225_916684_+	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	47.8	3.3e-25
915942:915981	attR	GTTTTAGAGCTATGCTGTTTTGAATGGTCCCAAAACCCAA	NA	NA	NA	NA
WP_125073842.1|916753_918586_+	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	40.3	6.4e-19
>prophage 6
NZ_CP053792	Streptococcus canis strain HL_77_1 chromosome, complete genome	2261128	980481	989403	2261128	transposase	Planktothrix_phage(33.33%)	7	NA	NA
WP_003048296.1|980481_981285_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.6	2.1e-11
WP_125074048.1|981297_982056_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.8	1.3e-18
WP_003048299.1|982134_982788_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_125074025.1|982992_985530_+	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	26.5	1.0e-75
WP_125075051.1|985607_987134_-|transposase	IS1182 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	37.4	9.2e-88
WP_003048303.1|987425_988100_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.2	8.0e-28
WP_125074024.1|988092_989403_+	HAMP domain-containing histidine kinase	NA	Q8QNA2	Ectocarpus_siliculosus_virus	34.3	7.6e-06
>prophage 7
NZ_CP053792	Streptococcus canis strain HL_77_1 chromosome, complete genome	2261128	1645291	1689701	2261128	bacteriocin,transposase,tRNA	Paenibacillus_phage(42.86%)	30	NA	NA
WP_003044832.1|1645291_1645558_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_164407671.1|1645743_1647729_-	transketolase	NA	NA	NA	NA	NA
WP_003044839.1|1647947_1648592_-	fructose-6-phosphate aldolase	NA	A0A0C5AMY8	Cyanophage	45.6	1.4e-45
WP_003044841.1|1648717_1650229_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_164407669.1|1650218_1651565_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003044848.1|1651678_1652380_-	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	36.1	1.5e-29
WP_164407666.1|1652381_1654220_-	type 1 glycerol-3-phosphate oxidase	NA	NA	NA	NA	NA
WP_003044854.1|1654235_1655750_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_172774143.1|1656111_1656504_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_002983550.1|1656634_1656892_-	DUF896 family protein	NA	NA	NA	NA	NA
WP_164407664.1|1657044_1659084_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003044867.1|1659295_1660213_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_003044869.1|1661120_1661654_-	isoprenylcysteine carboxyl methyltransferase family protein	NA	NA	NA	NA	NA
WP_125073697.1|1662741_1663614_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	40.8	6.7e-35
WP_125073698.1|1663666_1663963_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_125073700.1|1664383_1665175_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_125073701.1|1665171_1666284_-	SPASM domain-containing protein	NA	NA	NA	NA	NA
WP_172774144.1|1667081_1667447_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_125073702.1|1667954_1668818_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_125073709.1|1669008_1670475_-	arylsulfatase	NA	A0A1V0SA98	Catovirus	23.8	7.9e-12
WP_172774145.1|1670952_1671768_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_164407662.1|1671754_1672567_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_164407659.1|1672708_1678012_-	YSIRK-type signal peptide-containing protein	NA	NA	NA	NA	NA
WP_125073705.1|1679901_1680228_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	37.1	1.2e-08
WP_125073706.1|1680224_1681109_+|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	50.9	3.7e-57
WP_125073707.1|1681179_1681575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125073708.1|1683074_1684223_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_039994872.1|1685424_1687056_-	Na/Pi cotransporter family protein	NA	NA	NA	NA	NA
WP_125075065.1|1687404_1688100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125075051.1|1688174_1689701_-|transposase	IS1182 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	37.4	9.2e-88
>prophage 8
NZ_CP053792	Streptococcus canis strain HL_77_1 chromosome, complete genome	2261128	1958616	2020401	2261128	transposase,protease,tRNA	Bacillus_phage(25.0%)	56	NA	NA
WP_003045439.1|1958616_1960428_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	36.9	4.1e-95
WP_003045441.1|1960414_1962163_-	DNA topoisomerase III	NA	A0A1V0SCS0	Indivirus	24.3	6.1e-27
WP_164227766.1|1962272_1965956_-	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_003045444.1|1965968_1966229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003045446.1|1966567_1968865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003045449.1|1968891_1969347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003045451.1|1969376_1970165_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_003045453.1|1970176_1970515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003045455.1|1970507_1970843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003045457.1|1971203_1971482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125074974.1|1971600_1972431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000044821.1|1973299_1973740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000049574.1|1973752_1974754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164227764.1|1974737_1975193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164227763.1|1975179_1975614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000385052.1|1975610_1975817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164406573.1|1975959_1977450_-	primase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_000081408.1|1977458_1977950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003045471.1|1977995_1979342_-	DNA (cytosine-5-)-methyltransferase	NA	A0A141E1L1	Streptococcus_phage	63.8	1.9e-153
WP_003045473.1|1979390_1979663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125075051.1|1979825_1981352_+|transposase	IS1182 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	37.4	9.2e-88
WP_125074950.1|1981426_1982335_-	protein jag	NA	NA	NA	NA	NA
WP_164406649.1|1982346_1983156_-	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_125074952.1|1983139_1983499_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_003045484.1|1984041_1984782_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_125074953.1|1984785_1986069_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_125074954.1|1986069_1987413_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_125074955.1|1987917_1989366_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_125074956.1|1989976_1990654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125074957.1|1990657_1991104_-	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_125075055.1|1991484_1992777_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	82.0	1.7e-188
WP_125074687.1|1992981_1993704_-	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_125074688.1|1993857_1994352_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_125074689.1|1994542_1995904_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_003045504.1|1996001_1996448_-	dUTP diphosphatase	NA	A5GYP0	Lactococcus_phage	52.8	4.5e-35
WP_125074690.1|1996660_1997515_-	Abi family protein	NA	A0A2H4JB40	uncultured_Caudovirales_phage	22.7	3.4e-07
WP_125074691.1|1997670_1998438_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_125074692.1|1998555_2000340_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.2	3.5e-46
WP_125074693.1|2000339_2002049_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.5	2.2e-37
WP_003045511.1|2002041_2002491_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_125074694.1|2002790_2003807_+	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_125074695.1|2003838_2004744_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	51.2	1.4e-75
WP_125074696.1|2005007_2005679_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_125074697.1|2005675_2006203_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_164406582.1|2007242_2008748_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_125074699.1|2008942_2009200_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_125074700.1|2009304_2010654_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_003045529.1|2011129_2011750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125074701.1|2012593_2013814_+	S-layer protein	NA	NA	NA	NA	NA
WP_125074702.1|2014056_2014584_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_125074703.1|2014583_2015363_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_125074704.1|2015497_2016037_-	biotin transporter BioY	NA	NA	NA	NA	NA
WP_125074705.1|2016040_2016352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125074707.1|2016534_2017677_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	43.6	6.4e-86
WP_125074706.1|2017897_2018761_+	DUF975 family protein	NA	NA	NA	NA	NA
WP_125075051.1|2018874_2020401_-|transposase	IS1182 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	37.4	9.2e-88
>prophage 9
NZ_CP053792	Streptococcus canis strain HL_77_1 chromosome, complete genome	2261128	2090100	2188661	2261128	integrase,capsid,head,terminase,tail,tRNA,portal,transposase,holin	Streptococcus_phage(74.63%)	110	2094716:2094732	2192236:2192252
WP_172774156.1|2090100_2091258_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_125073934.1|2091533_2092433_+	glutamate formimidoyltransferase	NA	NA	NA	NA	NA
WP_125073933.1|2092443_2093076_+	cyclodeaminase/cyclohydrolase family protein	NA	NA	NA	NA	NA
WP_164406346.1|2093086_2094760_+	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
2094716:2094732	attL	AAAATTGATATTGACGA	NA	NA	NA	NA
WP_125073931.1|2094781_2095378_+	HutD family protein	NA	NA	NA	NA	NA
WP_125073930.1|2095598_2096942_+	APC family permease	NA	NA	NA	NA	NA
WP_125073929.1|2096953_2098495_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	44.1	8.1e-100
WP_125073928.1|2098682_2099669_+	formimidoylglutamase	NA	NA	NA	NA	NA
WP_125073927.1|2099709_2102784_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_003045688.1|2103100_2103868_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_093999281.1|2104001_2105042_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_172774154.1|2105615_2107088_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	73.9	1.3e-203
WP_164407727.1|2107088_2108000_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_125073926.1|2108136_2109822_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_125073925.1|2110228_2112124_-	M13 family metallopeptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	29.1	7.7e-68
WP_164407693.1|2112343_2113972_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_164407695.1|2114038_2116066_-	PTS system trehalose-specific EIIBC component	NA	NA	NA	NA	NA
WP_125073922.1|2116269_2116983_+	trehalose operon repressor	NA	NA	NA	NA	NA
WP_125073937.1|2117076_2117205_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_125073936.1|2117454_2118186_+	peroxide stress protein YaaA	NA	A0A1X9I5I0	Streptococcus_phage	37.9	4.3e-35
WP_125073921.1|2118359_2118974_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	56.7	1.5e-52
WP_125073920.1|2118973_2119483_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003045707.1|2120260_2120407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125073919.1|2120671_2122870_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	64.6	2.0e-277
WP_125073918.1|2122967_2124527_-	DUF2079 domain-containing protein	NA	NA	NA	NA	NA
WP_164407697.1|2124730_2124913_-	Paratox	NA	A3F673	Streptococcus_phage	86.7	2.0e-21
WP_164407699.1|2125119_2126301_+	streptodornase Sda1	NA	A7J2B8	Streptococcus_phage	49.4	9.6e-77
WP_159323069.1|2126473_2126953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159323070.1|2126939_2127233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159323071.1|2127601_2128354_-	SH3 domain-containing protein	NA	A3F665	Streptococcus_phage	95.6	6.0e-141
WP_003052353.1|2128355_2128688_-|holin	phage holin	holin	A3F664	Streptococcus_phage	100.0	5.7e-51
WP_164407578.1|2128689_2129010_-	hypothetical protein	NA	A3F663	Streptococcus_phage	82.1	7.1e-43
WP_164406953.1|2129019_2129181_-	hypothetical protein	NA	Q9MCJ3	Streptococcus_virus	57.4	2.9e-08
WP_099982971.1|2129206_2129632_-	DUF1366 domain-containing protein	NA	NA	NA	NA	NA
WP_164406959.1|2129634_2130066_-	DUF1617 family protein	NA	Q938J8	Temperate_phage	81.1	6.2e-58
WP_164406964.1|2130074_2131847_-	hyaluronidase	NA	Q938J9	Temperate_phage	72.7	1.1e-190
WP_164406970.1|2131857_2132097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164406974.1|2133742_2135725_-|tail	phage tail protein	tail	A7J2A7	Streptococcus_phage	94.4	0.0e+00
WP_164406983.1|2135734_2136577_-|tail	phage tail family protein	tail	A7J2A6	Streptococcus_phage	99.3	8.5e-160
WP_164406993.1|2136588_2140746_-	tape measure protein	NA	A7J2A5	Streptococcus_phage	99.3	1.4e-242
WP_002983445.1|2140760_2140994_-	hypothetical protein	NA	A7J2A4	Streptococcus_phage	100.0	4.4e-34
WP_164406999.1|2141068_2141524_-	hypothetical protein	NA	A7J2A3	Streptococcus_phage	99.3	1.8e-76
WP_164407011.1|2141577_2142177_-|tail	phage major tail protein, TP901-1 family	tail	A7J2A2	Streptococcus_phage	97.7	1.6e-91
WP_115245942.1|2142188_2142548_-	hypothetical protein	NA	A7J2A1	Streptococcus_phage	99.2	6.1e-59
WP_023611373.1|2142551_2142896_-	HK97 gp10 family phage protein	NA	A7J2A0	Streptococcus_phage	98.2	1.4e-55
WP_000639437.1|2142892_2143171_-	hypothetical protein	NA	A7J299	Streptococcus_phage	98.9	4.2e-47
WP_023611376.1|2143181_2143538_-|head,tail	phage head-tail connector protein	head,tail	A7J298	Streptococcus_phage	96.6	1.7e-56
WP_002983429.1|2143549_2144437_-	hypothetical protein	NA	A7J297	Streptococcus_phage	100.0	2.1e-161
WP_164407016.1|2144449_2145019_-	DUF4355 domain-containing protein	NA	A7J296	Streptococcus_phage	96.8	2.9e-79
WP_164407021.1|2145174_2145441_-	hypothetical protein	NA	Q938K9	Temperate_phage	81.8	1.2e-30
WP_002983423.1|2145443_2145632_-	hypothetical protein	NA	A7J294	Streptococcus_phage	98.4	1.4e-22
WP_164407287.1|2145662_2147108_-|capsid	minor capsid protein	capsid	A7J293	Streptococcus_phage	93.3	3.6e-259
WP_164407026.1|2147067_2148600_-|portal	phage portal protein	portal	A7J292	Streptococcus_phage	98.4	1.9e-287
WP_164407031.1|2148615_2149893_-|terminase	PBSX family phage terminase large subunit	terminase	A7J291	Streptococcus_phage	98.4	4.2e-243
WP_164407293.1|2149882_2150335_-|terminase	terminase small subunit	terminase	A7J290	Streptococcus_phage	92.7	5.1e-71
WP_164407034.1|2150430_2150844_-	transcriptional regulator	NA	A7J289	Streptococcus_phage	64.2	1.3e-44
WP_164407039.1|2150840_2151032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164407044.1|2151123_2151459_-	hypothetical protein	NA	A0A097PAS4	Streptococcus_pyogenes_phage	90.1	2.0e-43
WP_164407298.1|2151461_2151728_-	hypothetical protein	NA	A7J287	Streptococcus_phage	52.8	2.9e-13
WP_164407049.1|2151724_2151892_-	hypothetical protein	NA	A7J285	Streptococcus_phage	92.7	4.3e-23
WP_164407054.1|2151892_2153215_-	DEAD/DEAH box helicase family protein	NA	A7J284	Streptococcus_phage	97.3	6.6e-252
WP_002988730.1|2153211_2153487_-	VRR-NUC domain-containing protein	NA	A7J283	Streptococcus_phage	100.0	9.1e-47
WP_164407057.1|2153873_2156258_-	DNA primase	NA	A7J282	Streptococcus_phage	95.0	1.7e-277
WP_164407061.1|2156262_2158185_-	DNA polymerase	NA	A7J280	Streptococcus_phage	98.8	0.0e+00
WP_164407067.1|2158227_2158785_-	DUF2815 family protein	NA	D2J040	Enterococcus_phage	57.9	4.3e-51
WP_164407072.1|2158796_2159951_-	DUF2800 domain-containing protein	NA	A7J278	Streptococcus_phage	92.7	6.9e-205
WP_136263278.1|2159950_2160250_-	hypothetical protein	NA	A7J277	Streptococcus_phage	99.0	5.1e-43
WP_164407077.1|2160337_2160541_-	hypothetical protein	NA	A7J276	Streptococcus_phage	95.5	3.0e-31
WP_164407079.1|2160687_2161074_-	hypothetical protein	NA	A7J274	Streptococcus_phage	89.0	3.6e-57
WP_164407085.1|2161070_2161274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015986705.1|2161266_2161437_-	hypothetical protein	NA	A7J273	Streptococcus_phage	100.0	3.7e-22
WP_164407092.1|2161466_2161721_-	hypothetical protein	NA	A0A1P8VVV6	Streptococcus_phage	94.0	3.8e-39
WP_001283052.1|2161980_2162172_-	hypothetical protein	NA	A7J270	Streptococcus_phage	100.0	7.3e-27
WP_064056122.1|2162546_2162897_+	helix-turn-helix transcriptional regulator	NA	M1I9X0	Streptococcus_phage	84.5	8.1e-48
WP_015986701.1|2162910_2163294_+	hypothetical protein	NA	A7J268	Streptococcus_phage	100.0	4.1e-69
WP_164407097.1|2163304_2163856_+	hypothetical protein	NA	A7J267	Streptococcus_phage	95.6	3.9e-89
WP_164407102.1|2164027_2165194_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A141E0Q7	Streptococcus_phage	41.2	8.9e-75
WP_003045716.1|2165556_2165862_-	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_125073917.1|2165872_2166292_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_003045720.1|2166288_2166558_-	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_003053105.1|2166669_2167068_-	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_093999149.1|2167465_2168602_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	62.6	1.4e-120
WP_164407107.1|2168704_2169979_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_125073915.1|2170095_2170449_-	VOC family protein	NA	NA	NA	NA	NA
WP_125073914.1|2170451_2171024_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_125073913.1|2171033_2171630_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_125073912.1|2171613_2172852_-	MFS transporter	NA	NA	NA	NA	NA
WP_125073911.1|2172862_2174845_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.8	9.2e-64
WP_172774155.1|2174939_2176091_-|integrase	site-specific integrase	integrase	A0A1X9I5Y5	Streptococcus_phage	45.6	3.8e-86
WP_003045741.1|2176336_2177191_-	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	52.0	4.0e-56
WP_003049152.1|2177917_2178169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003045746.1|2178221_2178806_-	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_164407119.1|2178870_2179359_-|tRNA	prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_125073907.1|2180073_2180754_-	helix-turn-helix transcriptional regulator	NA	A0A1W6JQE6	Staphylococcus_phage	47.3	4.9e-33
WP_011185068.1|2180917_2181115_+	helix-turn-helix transcriptional regulator	NA	A0A1X9I5U5	Streptococcus_phage	63.1	1.3e-15
WP_125073906.1|2181128_2181737_+	phage repressor protein	NA	A0A1W6JPC3	Staphylococcus_phage	46.9	1.0e-42
WP_002992501.1|2181757_2182165_+	hypothetical protein	NA	A0A1X9I5V7	Streptococcus_phage	69.4	1.3e-49
WP_125073905.1|2182177_2182795_+	Rha family transcriptional regulator	NA	A0A192Y918	Salmonella_phage	34.7	1.5e-09
WP_003045758.1|2183037_2183220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125073904.1|2183231_2183564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081587273.1|2183563_2183755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003045763.1|2183766_2184096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003046150.1|2184098_2184371_+	hypothetical protein	NA	A0A1X9I5U9	Streptococcus_phage	60.0	1.8e-18
WP_164407124.1|2184371_2185238_+	primase C-terminal domain-containing protein	NA	A0A1X9I6L2	Streptococcus_phage	74.1	5.5e-122
WP_164407129.1|2185249_2186644_+	virulence-associated protein E	NA	W8CQP1	Croceibacter_phage	33.7	6.3e-43
WP_164407133.1|2186936_2187191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556410.1|2187187_2187361_+	DUF2758 domain-containing protein	NA	A0A1X9I5U0	Streptococcus_phage	61.4	3.5e-12
WP_164407139.1|2187366_2187540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164407141.1|2187541_2188099_+	hypothetical protein	NA	A0A1X9I5U4	Streptococcus_phage	57.4	1.4e-30
WP_164407144.1|2188172_2188661_+	hypothetical protein	NA	A0A1X9I5V2	Streptococcus_phage	56.8	6.6e-48
2192236:2192252	attR	TCGTCAATATCAATTTT	NA	NA	NA	NA
>prophage 10
NZ_CP053792	Streptococcus canis strain HL_77_1 chromosome, complete genome	2261128	2194830	2206316	2261128	tRNA	Streptococcus_phage(50.0%)	9	NA	NA
WP_125073895.1|2194830_2197386_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	22.1	4.1e-40
WP_125073894.1|2197372_2197726_-	YlbF family regulator	NA	NA	NA	NA	NA
WP_125073893.1|2197722_2198160_-	arginine repressor	NA	NA	NA	NA	NA
WP_125073892.1|2198439_2200131_+|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.2	2.2e-74
WP_164407174.1|2200182_2201592_-	ATP-binding cassette domain-containing protein	NA	A0A1B0RXA0	Streptococcus_phage	29.1	8.3e-51
WP_125073890.1|2201766_2202681_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	39.4	9.8e-53
WP_164407179.1|2202736_2203615_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	33.8	5.5e-45
WP_125073888.1|2203633_2204575_-	YitT family protein	NA	NA	NA	NA	NA
WP_125073887.1|2204567_2206316_-|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SJ84	Klosneuvirus	25.3	5.0e-13
