The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP044455	Acinetobacter indicus strain B18 chromosome, complete genome	3054651	8431	45278	3054651	tRNA,transposase	Helicobacter_phage(22.22%)	26	NA	NA
WP_163145339.1|8431_9031_+|transposase	IS607 family transposase	transposase	Q331V0	Clostridium_botulinum_C_phage	56.5	7.1e-60
WP_159153749.1|9034_10417_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	NA	NA	NA	NA
WP_004911237.1|10527_11733_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	80.3	2.1e-87
WP_163145340.1|11815_13753_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.8	1.8e-64
WP_163145341.1|13985_14642_+	RND transporter	NA	NA	NA	NA	NA
WP_171294843.1|14672_15122_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	50.0	2.1e-32
WP_163145342.1|15194_16586_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A2I7RKG5	Vibrio_phage	22.9	1.2e-06
WP_104472697.1|17244_18255_+	RND transporter	NA	NA	NA	NA	NA
WP_171065126.1|18599_19568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005181144.1|19690_20026_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.5	1.2e-24
WP_005181147.1|20099_21227_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_005181149.1|21290_22523_+|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_163145343.1|23014_23287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163145344.1|23394_25299_+	5'-nucleotidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_016658670.1|31513_32863_+	aromatic acid/H+ symport family MFS transporter	NA	NA	NA	NA	NA
WP_035363502.1|33047_33917_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_163145345.1|34213_35380_+	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
WP_163145346.1|35883_36426_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005181033.1|36564_37047_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_005181030.1|37039_37579_-	signal peptidase II	NA	NA	NA	NA	NA
WP_163145347.1|37571_40418_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	27.1	1.5e-78
WP_163140771.1|40479_41484_-	riboflavin biosynthesis protein RibF	NA	NA	NA	NA	NA
WP_162182856.1|41779_42349_+	5'-nucleosidase	NA	NA	NA	NA	NA
WP_005181018.1|42392_43046_-	TetR family transcriptional regulator C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_016659040.1|43509_44667_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A7P9	Microcystis_virus	36.9	2.7e-55
WP_152342396.1|44663_45278_-|transposase	IS607 family transposase	transposase	A0A1S5RGS9	Helicobacter_phage	62.7	3.5e-62
>prophage 2
NZ_CP044455	Acinetobacter indicus strain B18 chromosome, complete genome	3054651	253143	311393	3054651	tRNA,transposase	Paenibacillus_phage(33.33%)	51	NA	NA
WP_152342556.1|253143_254448_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_127800954.1|254489_257066_-	penicillin-binding protein PBP1a	NA	NA	NA	NA	NA
WP_099046172.1|257202_257954_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	41.2	2.5e-22
WP_160232596.1|258091_259114_+	type IV pilus assembly protein PilM	NA	NA	NA	NA	NA
WP_005180516.1|259113_259749_+	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_127800755.1|259745_260465_+	type 4a pilus biogenesis protein PilO	NA	NA	NA	NA	NA
WP_045795346.1|260464_260992_+	pilus assembly protein PilP	NA	NA	NA	NA	NA
WP_171499848.1|261052_263188_+	type IV pilus secretin PilQ family protein	NA	NA	NA	NA	NA
WP_075167858.1|263224_263767_+	shikimate kinase AroK	NA	NA	NA	NA	NA
WP_127800753.1|263789_264872_+	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_127800751.1|264884_265721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127800749.1|266159_270635_+	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_104483916.1|270708_272130_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005180484.1|273421_274012_+	LemA family protein	NA	NA	NA	NA	NA
WP_127800747.1|274038_275103_+	TPM domain-containing protein	NA	NA	NA	NA	NA
WP_127800745.1|275096_275657_+	TPM domain-containing protein	NA	NA	NA	NA	NA
WP_127800743.1|275918_276434_-	pilin	NA	NA	NA	NA	NA
WP_152342555.1|276509_277260_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	41.2	3.3e-22
WP_127800795.1|277590_279231_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_005180468.1|279342_279807_-	bacterioferritin	NA	NA	NA	NA	NA
WP_171065121.1|280033_280216_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_005180461.1|280382_280766_-	RidA family protein	NA	NA	NA	NA	NA
WP_075174935.1|280837_282937_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	J9Q7H7	Salmonella_phage	37.2	2.4e-09
WP_004809957.1|283160_283442_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_045795273.1|283518_284142_-	guanylate kinase	NA	A0A240FAU9	Liberibacter_phage	32.9	4.7e-14
WP_127800797.1|284277_285228_+	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_004809941.1|287342_287600_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_127800499.1|287628_288177_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_127800497.1|288203_288944_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_003792460.1|289150_289525_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_127800495.1|290451_291426_-	triacylglycerol lipase	NA	NA	NA	NA	NA
WP_127800493.1|291513_292500_-	triacylglycerol lipase	NA	NA	NA	NA	NA
WP_005180409.1|292911_293940_-	lipase secretion chaperone	NA	NA	NA	NA	NA
WP_127801824.1|294372_295341_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_099046172.1|296336_297088_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	41.2	2.5e-22
WP_127800907.1|297331_298237_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_104473447.1|298273_299041_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_075168265.1|299200_299659_+	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_034598244.1|299728_300601_-	EamA family transporter	NA	NA	NA	NA	NA
WP_005180400.1|300747_301623_-	EamA family transporter	NA	NA	NA	NA	NA
WP_005180397.1|301859_303092_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.1	4.5e-101
WP_127800910.1|303218_303425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045795292.1|303446_304856_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_016658494.1|305008_305380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127801601.1|305611_306841_+	MFS transporter	NA	S4TR35	Salmonella_phage	23.7	1.2e-13
WP_045795347.1|306955_307255_-	DUF3817 domain-containing protein	NA	NA	NA	NA	NA
WP_104471529.1|307541_308087_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	54.5	5.3e-38
WP_163143403.1|308192_309320_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_005180385.1|309456_310101_-	ParA family protein	NA	NA	NA	NA	NA
WP_127800916.1|310220_310688_+	endonuclease	NA	NA	NA	NA	NA
WP_171457094.1|310985_311393_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	48.8	3.7e-28
>prophage 3
NZ_CP044455	Acinetobacter indicus strain B18 chromosome, complete genome	3054651	393586	458526	3054651	tRNA,transposase,protease	Tupanvirus(10.0%)	54	NA	NA
WP_016659040.1|393586_394744_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A7P9	Microcystis_virus	36.9	2.7e-55
WP_075167936.1|394740_395355_-|transposase	IS607 family transposase	transposase	A0A1S5RGS9	Helicobacter_phage	63.2	2.7e-62
WP_163145412.1|395400_396432_-	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
WP_127800203.1|396461_396974_-	dihydrofolate reductase	NA	A0A1B2IBQ4	Erwinia_phage	44.1	2.4e-24
WP_005180203.1|397074_397917_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	60.7	2.1e-97
WP_075167417.1|398118_398610_-	lipocalin family protein	NA	A0A2I2L3Y4	Orpheovirus	32.1	1.1e-13
WP_104503620.1|398794_399169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127800199.1|399169_399547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016658551.1|399630_400440_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_163146296.1|400534_401317_+	NRDE family protein	NA	A0A0M3ZEJ9	Turkeypox_virus	27.6	1.8e-18
WP_104505419.1|401375_403622_-	PhoX family phosphatase	NA	NA	NA	NA	NA
WP_005180188.1|403802_404585_-	twin-arginine translocase subunit TatC	NA	NA	NA	NA	NA
WP_104489799.1|404581_405028_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_005180185.1|405047_405272_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_163145413.1|405432_406314_+	permease	NA	NA	NA	NA	NA
WP_016658557.1|406546_407173_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	A0A0P0A2M4	Ugandan_cassava_brown_streak_virus	33.2	6.1e-14
WP_171260924.1|407278_407821_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_005180178.1|407865_408459_-	methionine biosynthesis protein MetW	NA	NA	NA	NA	NA
WP_163145414.1|408458_409619_-	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_005180175.1|409703_411401_-	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_171524622.1|411656_412766_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_005180172.1|412765_413449_-	Fe2+-dependent dioxygenase	NA	A0A127KM56	Cyanophage	32.0	7.4e-21
WP_163145416.1|413556_415791_-	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_163145417.1|416112_418251_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	31.0	8.3e-10
WP_075167430.1|418496_419828_+	trigger factor	NA	NA	NA	NA	NA
WP_152342556.1|419934_421239_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_005180162.1|421421_422027_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	61.0	1.2e-62
WP_127800438.1|422054_423365_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.7	1.4e-129
WP_005180158.1|423534_424248_+	DUF2846 domain-containing protein	NA	NA	NA	NA	NA
WP_163145418.1|424318_425845_-	fumarate hydratase	NA	NA	NA	NA	NA
WP_143217961.1|426341_426719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099046172.1|426750_427502_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	41.2	2.5e-22
WP_163145419.1|427551_428418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075167434.1|428423_428897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163145420.1|429094_431233_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_005180151.1|431283_432504_-	acetate kinase	NA	NA	NA	NA	NA
WP_005180148.1|432818_433223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016658571.1|433338_434604_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	48.4	2.8e-98
WP_005180145.1|434911_436234_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_163145421.1|436308_437163_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016658574.1|437257_438280_-	beta-N-acetylhexosaminidase	NA	A0A1B1IVS3	uncultured_Mediterranean_phage	38.5	4.4e-09
WP_075167440.1|438475_440668_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	50.1	2.1e-186
WP_163145422.1|440947_443008_+	EAL domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.3	6.7e-17
WP_163145423.1|445660_447250_+	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	31.9	2.1e-10
WP_163145424.1|447329_448154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163145425.1|448210_449185_+	DUF3298 domain-containing protein	NA	NA	NA	NA	NA
WP_163145426.1|449184_450003_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_075167522.1|450110_450884_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	A0A291ATS8	Pandoravirus	34.9	6.8e-23
WP_163145427.1|450941_451964_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_163146297.1|452510_452942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163145428.1|453060_455187_-	catalase HPII	NA	A0A2K9L572	Tupanvirus	46.3	2.1e-138
WP_127801927.1|455205_456621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163145429.1|456857_457325_+	nicotinamide-nucleotide amidohydrolase family protein	NA	A0A218MNG4	uncultured_virus	50.6	1.6e-38
WP_127801807.1|457464_458526_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP044455	Acinetobacter indicus strain B18 chromosome, complete genome	3054651	997220	1049451	3054651	head,holin,transposase,integrase,terminase,coat	Acinetobacter_phage(63.41%)	68	998398:998414	1049630:1049646
WP_005179107.1|997220_998156_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	33.2	2.4e-22
998398:998414	attL	CCCGCCGGGCGCACCAA	NA	NA	NA	NA
WP_045795619.1|998494_998761_-	hypothetical protein	NA	A0A1B1P9G0	Acinetobacter_phage	56.8	3.4e-22
WP_163145608.1|998757_999072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163145609.1|999064_999301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163145610.1|999293_999539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163145611.1|999538_999883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163145612.1|999882_1000209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163145613.1|1000208_1000523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163145614.1|1000519_1001137_-	YqaJ viral recombinase family protein	NA	A0A2H4J882	uncultured_Caudovirales_phage	73.2	1.1e-84
WP_163145615.1|1001117_1001966_-	phage recombination protein Bet	NA	B5AX97	Iodobacteriophage	54.1	8.5e-51
WP_163145616.1|1001977_1002985_-	hypothetical protein	NA	Q9MC69	Pseudomonas_phage	31.6	1.1e-15
WP_163145617.1|1002981_1003329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163145618.1|1003325_1003886_-	hypothetical protein	NA	A0A2D0W9R1	Bordetella_phage	35.9	1.4e-17
WP_163145619.1|1003882_1004134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156190915.1|1004606_1005086_-	hypothetical protein	NA	A0A127KNL4	Pseudomonas_phage	30.7	5.4e-10
WP_163145620.1|1005139_1005445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163145621.1|1005711_1006413_-	peptidase S24	NA	A0A0R6PJ00	Moraxella_phage	36.8	1.8e-30
WP_163145622.1|1006524_1006734_+	Cro/Cl family transcriptional regulator	NA	NA	NA	NA	NA
WP_163145623.1|1006785_1007244_+	phage regulatory CII family protein	NA	A0A2H4J3D5	uncultured_Caudovirales_phage	71.5	1.3e-58
WP_163146305.1|1007374_1008199_+	replication protein	NA	NA	NA	NA	NA
WP_163145624.1|1008195_1008948_+	ATP-binding protein	NA	A0A0D4DBZ2	Acinetobacter_phage	61.1	4.8e-82
WP_075175320.1|1009201_1009495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163145625.1|1009572_1009974_+	DUF559 domain-containing protein	NA	A0A0P0I8E8	Acinetobacter_phage	57.9	4.0e-35
WP_104499044.1|1009981_1010485_+	hypothetical protein	NA	A0A0P0IY98	Acinetobacter_phage	31.7	2.5e-18
WP_104499043.1|1010712_1011132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163145626.1|1011823_1012048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163145627.1|1012364_1012853_+	recombination protein NinB	NA	A0A2H4JB76	uncultured_Caudovirales_phage	55.1	1.2e-49
WP_163145628.1|1012914_1013157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163145629.1|1013196_1013853_+|transposase	transposase	transposase	A0A1B1P9K3	Acinetobacter_phage	83.6	6.3e-110
WP_163145630.1|1013899_1014427_+	DUF2280 domain-containing protein	NA	A0A1B1P9C2	Acinetobacter_phage	70.6	1.9e-37
WP_163145631.1|1014410_1015727_+|terminase	terminase	terminase	A0A0N7IRE3	Acinetobacter_phage	88.6	2.8e-242
WP_163145632.1|1015767_1017171_+	DUF4055 domain-containing protein	NA	A0A0P0IDW1	Acinetobacter_phage	76.1	2.4e-199
WP_163145633.1|1017136_1018246_+|head	phage head morphogenesis protein	head	A0A1B1P9B7	Acinetobacter_phage	50.5	3.5e-97
WP_163145634.1|1018242_1018479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163145635.1|1018615_1019341_+	hypothetical protein	NA	A0A0P0J090	Acinetobacter_phage	64.6	9.1e-78
WP_163145636.1|1019343_1020321_+|coat	phage coat protein	coat	A0A2H4JIE6	uncultured_Caudovirales_phage	79.4	5.2e-153
WP_163145637.1|1020808_1021192_+	hypothetical protein	NA	A0A0P0IVQ3	Acinetobacter_phage	48.0	7.5e-23
WP_163146306.1|1021200_1021575_+	glutamate 5-kinase	NA	A0A1B1P9E3	Acinetobacter_phage	48.9	5.4e-26
WP_171524601.1|1021571_1021970_+	hypothetical protein	NA	A0A0D4DBK8	Acinetobacter_phage	65.6	1.2e-39
WP_163145638.1|1021944_1022322_+	hypothetical protein	NA	A0A0D4DBN1	Acinetobacter_phage	42.4	2.4e-21
WP_163145639.1|1022318_1022729_+	hypothetical protein	NA	A0A1B1P9D6	Acinetobacter_phage	29.6	1.6e-10
WP_163145640.1|1022730_1022952_+	hypothetical protein	NA	A0A1B1P9D7	Acinetobacter_phage	47.0	1.0e-08
WP_163145641.1|1023199_1023682_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_163145642.1|1023671_1023935_+	hypothetical protein	NA	A0A1B1P9E1	Acinetobacter_phage	60.7	4.8e-21
WP_163145643.1|1024014_1024953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163145644.1|1025410_1025896_+	hypothetical protein	NA	A0A0N7IRG3	Acinetobacter_phage	56.8	1.9e-39
WP_075174790.1|1025898_1026165_+	hypothetical protein	NA	A0A1B1P9F7	Acinetobacter_phage	66.3	6.6e-26
WP_163145645.1|1026236_1026416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163145646.1|1026510_1027176_+	DUF1902 domain-containing protein	NA	A0A0M4R2Z9	Salmonella_phage	38.5	9.7e-34
WP_163145647.1|1027182_1027380_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0M4RCZ9	Salmonella_phage	67.7	1.4e-20
WP_163145648.1|1027668_1028304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163145650.1|1029358_1029658_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_008304580.1|1029771_1029933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163145651.1|1030011_1030851_+	hypothetical protein	NA	G9L6D8	Escherichia_phage	42.7	1.5e-44
WP_163145652.1|1030957_1031578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163145653.1|1031655_1032417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163145654.1|1032483_1036473_+	tape measure protein	NA	A0A0D4DC37	Acinetobacter_phage	29.0	2.0e-97
WP_163145655.1|1036551_1037295_+	hypothetical protein	NA	J7HXF9	Acinetobacter_phage	39.0	3.2e-38
WP_163145656.1|1037291_1037678_+	hypothetical protein	NA	J7I476	Acinetobacter_phage	41.9	1.2e-20
WP_163145657.1|1037731_1038208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163145658.1|1038207_1038705_+	DUF1833 family protein	NA	A0A1B1P9F1	Acinetobacter_phage	56.4	1.0e-51
WP_163145659.1|1038704_1039088_+	hypothetical protein	NA	A0A1B1P9H4	Acinetobacter_phage	77.9	1.0e-51
WP_163145660.1|1039053_1041867_+	hypothetical protein	NA	A0A1B1P9G8	Acinetobacter_phage	49.0	1.5e-248
WP_163145661.1|1045557_1046637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104498821.1|1046700_1046982_+|holin	holin	holin	C7BGD7	Burkholderia_phage	49.4	3.1e-18
WP_163146308.1|1047260_1047776_+	peptidoglycan-binding protein	NA	H9C0H1	Vibrio_phage	60.2	1.1e-56
WP_163145662.1|1047885_1048302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163145663.1|1048464_1049451_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P9F9	Acinetobacter_phage	71.0	2.2e-135
1049630:1049646	attR	CCCGCCGGGCGCACCAA	NA	NA	NA	NA
>prophage 5
NZ_CP044455	Acinetobacter indicus strain B18 chromosome, complete genome	3054651	1058636	1068308	3054651	tRNA,transposase	uncultured_Caudovirales_phage(44.44%)	11	NA	NA
WP_045794839.1|1058636_1059770_+	toxic anion resistance protein	NA	K4F9M7	Cronobacter_phage	22.8	2.8e-17
WP_104472513.1|1059813_1060728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163145666.1|1060928_1062494_+	alkyl hydroperoxide reductase subunit F	NA	A0A1W6JK46	Lactococcus_phage	30.2	1.5e-24
WP_005179080.1|1062630_1062885_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	46.6	2.0e-16
WP_163145667.1|1062888_1064280_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	64.7	6.1e-131
WP_099046172.1|1064397_1065148_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	41.2	2.5e-22
WP_005179075.1|1065242_1065671_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	59.9	7.6e-40
WP_005179068.1|1065755_1066073_+	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	64.4	7.9e-26
WP_163145668.1|1066077_1066551_+	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	53.8	2.3e-37
WP_163145669.1|1066554_1067604_+	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_104501016.1|1067603_1068308_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	70.5	8.2e-92
>prophage 6
NZ_CP044455	Acinetobacter indicus strain B18 chromosome, complete genome	3054651	1183905	1194473	3054651		Bacillus_phage(16.67%)	9	NA	NA
WP_163145711.1|1183905_1186044_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	23.7	1.1e-25
WP_005178811.1|1186040_1187225_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005178810.1|1187328_1187928_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	39.1	5.0e-21
WP_171524626.1|1187941_1188538_+	acyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	49.2	1.3e-08
WP_005178808.1|1188674_1189517_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	33.9	1.3e-35
WP_005178807.1|1189659_1190325_-	O-methyltransferase	NA	S5YRC3	Mycobacterium_phage	38.7	5.0e-30
WP_005178806.1|1190457_1191180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005178805.1|1191310_1191634_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_104471029.1|1191839_1194473_-	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	23.6	3.8e-33
>prophage 7
NZ_CP044455	Acinetobacter indicus strain B18 chromosome, complete genome	3054651	1532136	1566012	3054651	holin,transposase,plate	Vibrio_phage(50.0%)	24	NA	NA
WP_163145810.1|1532136_1534173_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.5	2.1e-18
WP_034597681.1|1534402_1534987_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_171524605.1|1535004_1536480_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_127801582.1|1536496_1538164_+|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	30.4	1.8e-52
WP_163145812.1|1538323_1539097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163145813.1|1539121_1540513_-	sensor histidine kinase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_104471322.1|1540515_1541187_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_163145814.1|1541296_1543279_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_104471320.1|1543275_1544118_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_163145815.1|1544130_1544871_+	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
WP_163145816.1|1546337_1547345_-	OmpA family protein	NA	NA	NA	NA	NA
WP_016658148.1|1548005_1548992_+	DUF1852 domain-containing protein	NA	NA	NA	NA	NA
WP_163145817.1|1549020_1550049_+	methionine synthase	NA	NA	NA	NA	NA
WP_005177877.1|1550158_1550650_+	flavin reductase	NA	NA	NA	NA	NA
WP_163145818.1|1550691_1551492_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_163145819.1|1551845_1554035_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_127801714.1|1554297_1555623_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_075175237.1|1555728_1556496_-	OmpA family protein	NA	NA	NA	NA	NA
WP_005177824.1|1556497_1557457_-	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_163145820.1|1557488_1561304_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_127799563.1|1561344_1562763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163145821.1|1562759_1563755_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_163145822.1|1563718_1565524_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_127799557.1|1565535_1566012_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 8
NZ_CP044455	Acinetobacter indicus strain B18 chromosome, complete genome	3054651	1756427	1805236	3054651	integrase,transposase	Bacillus_phage(18.18%)	48	1793621:1793635	1807434:1807448
WP_163146318.1|1756427_1756826_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_005176703.1|1756829_1757981_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_005177339.1|1758320_1759310_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_163145888.1|1759306_1760230_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_163145889.1|1760547_1763007_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_163145890.1|1763065_1765033_+	phytase	NA	NA	NA	NA	NA
WP_104472268.1|1765104_1765791_+	protein TolQ	NA	NA	NA	NA	NA
WP_075166740.1|1765797_1766244_+	protein TolR	NA	NA	NA	NA	NA
WP_163145891.1|1766240_1767035_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_163145892.1|1767606_1769760_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_163145893.1|1769824_1770436_+	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
WP_163145894.1|1770476_1770761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163145895.1|1770764_1772324_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_005177306.1|1772320_1772602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163145896.1|1772664_1773597_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	39.9	3.5e-58
WP_005177227.1|1774274_1775633_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_163145897.1|1777142_1778051_-	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
WP_163145898.1|1778586_1779189_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.4	2.7e-43
WP_163145899.1|1779315_1780104_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_104851852.1|1780100_1781312_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_163145900.1|1781414_1782296_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_026438210.1|1782415_1782988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163145901.1|1782963_1783464_+	chalcone isomerase family protein	NA	NA	NA	NA	NA
WP_099046172.1|1783477_1784229_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	41.2	2.5e-22
WP_005177281.1|1784293_1784986_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.3	1.5e-29
WP_171524631.1|1784982_1786296_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_163142172.1|1786344_1787394_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_163145903.1|1787402_1788182_-	DUF1295 domain-containing protein	NA	NA	NA	NA	NA
WP_163145904.1|1788207_1789404_-	class I SAM-dependent methyltransferase	NA	A0A2I2L5L3	Orpheovirus	33.6	5.2e-46
WP_163146319.1|1789400_1790195_-	DUF1365 family protein	NA	NA	NA	NA	NA
WP_163145905.1|1790204_1791488_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_163145906.1|1791484_1792471_-	fatty acid desaturase	NA	NA	NA	NA	NA
WP_163145907.1|1792608_1793157_-	lipocalin family protein	NA	A0A2P1EMA7	Moumouvirus	38.3	4.7e-18
WP_171524607.1|1793257_1794031_-	NAD(+) diphosphatase	NA	NA	NA	NA	NA
1793621:1793635	attL	CAGAATTTCATCTTC	NA	NA	NA	NA
WP_163145908.1|1794413_1795937_+	cryptochrome/photolyase family protein	NA	E3T4R9	Cafeteria_roenbergensis_virus	28.0	1.3e-44
WP_163145909.1|1795940_1796075_+	DUF2256 domain-containing protein	NA	NA	NA	NA	NA
WP_163145910.1|1796089_1796344_-	TIGR03643 family protein	NA	NA	NA	NA	NA
WP_163145911.1|1796502_1796904_-	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_171521832.1|1796914_1797403_-	heme-binding protein	NA	NA	NA	NA	NA
WP_005177241.1|1797508_1798180_+	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.7	1.8e-35
WP_155756615.1|1798176_1799559_+	heavy metal sensor histidine kinase	NA	NA	NA	NA	NA
WP_163145912.1|1799582_1800287_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.0	2.7e-34
WP_163142199.1|1800279_1801503_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_171502409.1|1801499_1802732_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_163145913.1|1802817_1803893_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.6	2.6e-44
WP_171524608.1|1803959_1804235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163145915.1|1804185_1804596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163145916.1|1804636_1805236_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A2H4JAT5	uncultured_Caudovirales_phage	30.6	5.5e-12
1807434:1807448	attR	GAAGATGAAATTCTG	NA	NA	NA	NA
>prophage 9
NZ_CP044455	Acinetobacter indicus strain B18 chromosome, complete genome	3054651	2014674	2025536	3054651	transposase,protease	Acinetobacter_phage(37.5%)	12	NA	NA
WP_163145976.1|2014674_2015607_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	41.0	1.6e-58
WP_127800987.1|2015755_2016343_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	31.2	1.3e-13
WP_127800985.1|2016370_2017087_-	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_127800983.1|2017105_2018326_-	TerD family protein	NA	NA	NA	NA	NA
WP_127801911.1|2018440_2019019_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	39.7	8.7e-31
WP_127800979.1|2019053_2020130_-	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	52.6	1.6e-86
WP_127800977.1|2020148_2020724_-	TerD family protein	NA	A0A2P1N0L4	Streptomyces_phage	37.5	1.3e-07
WP_127800975.1|2021109_2022231_+	phosphoribosyltransferase domain-containing protein	NA	A0A172Q0Y1	Acinetobacter_phage	28.7	1.3e-33
WP_127800973.1|2022223_2023003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127800971.1|2022995_2024144_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	33.2	5.7e-42
WP_171457099.1|2024155_2025082_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_127800966.1|2025146_2025536_-|transposase	IS200/IS605 family transposase	transposase	Q38463	Halobacterium_phage	34.2	3.1e-08
>prophage 10
NZ_CP044455	Acinetobacter indicus strain B18 chromosome, complete genome	3054651	2106450	2124028	3054651	terminase	Acinetobacter_phage(29.41%)	25	NA	NA
WP_163146007.1|2106450_2107848_-	hypothetical protein	NA	U6C697	Ralstonia_phage	37.8	2.9e-88
WP_163146008.1|2107851_2108295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163146009.1|2108287_2108770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171524611.1|2108741_2109146_-	hypothetical protein	NA	A0A0D4DBK8	Acinetobacter_phage	63.1	2.7e-39
WP_163146010.1|2109164_2109593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163146011.1|2109658_2110921_-	hypothetical protein	NA	U6C6F9	Ralstonia_phage	46.3	6.2e-90
WP_163146012.1|2110931_2111828_-	hypothetical protein	NA	U6C6Y4	Ralstonia_phage	36.5	7.9e-31
WP_163146013.1|2111817_2113893_-	hypothetical protein	NA	U6C855	Ralstonia_phage	45.3	5.3e-147
WP_163146014.1|2113910_2115359_-	DNA packaging protein	NA	Q2A0C1	Sodalis_phage	62.4	2.7e-182
WP_163146015.1|2115336_2115894_-|terminase	terminase small subunit	terminase	G0ZND3	Cronobacter_phage	54.8	1.4e-41
WP_163146016.1|2115904_2116399_-	hypothetical protein	NA	A0A2H4JDI9	uncultured_Caudovirales_phage	89.3	7.1e-82
WP_010116666.1|2116831_2117005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163146017.1|2117752_2118193_-	hypothetical protein	NA	A0A2H4J548	uncultured_Caudovirales_phage	67.1	1.4e-52
WP_163146018.1|2118203_2118374_-	DUF1653 domain-containing protein	NA	NA	NA	NA	NA
WP_163146019.1|2118460_2118877_-	hypothetical protein	NA	A0A0P0HSP6	Acinetobacter_phage	73.0	9.3e-51
WP_171524612.1|2118884_2119361_-	HNH endonuclease	NA	K7P7B7	Enterobacteria_phage	49.2	3.7e-27
WP_163145336.1|2119347_2119554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163146020.1|2119550_2119787_-	hypothetical protein	NA	A0A2H4J558	uncultured_Caudovirales_phage	40.9	7.9e-07
WP_163146021.1|2119783_2119987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163146022.1|2119983_2120208_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_163146023.1|2120216_2121542_-	AAA family ATPase	NA	A0A2H4J6D5	uncultured_Caudovirales_phage	86.2	5.7e-195
WP_163146024.1|2121541_2122315_-	helix-turn-helix domain-containing protein	NA	E2GLZ1	Acinetobacter_phage	50.7	1.1e-25
WP_171524613.1|2122311_2122473_-	hypothetical protein	NA	A0A1B1P9H5	Acinetobacter_phage	56.0	2.0e-06
WP_075175048.1|2122517_2122892_-	transcriptional regulator	NA	A0A0N7IRF8	Acinetobacter_phage	61.7	3.5e-33
WP_163146329.1|2123254_2124028_+	helix-turn-helix domain-containing protein	NA	M4T3N8	Psychrobacter_phage	31.2	4.9e-21
>prophage 11
NZ_CP044455	Acinetobacter indicus strain B18 chromosome, complete genome	3054651	2127686	2137349	3054651		Acinetobacter_phage(55.56%)	15	NA	NA
WP_163146029.1|2127686_2128631_+	hypothetical protein	NA	A0A2H4JAZ0	uncultured_Caudovirales_phage	88.4	2.3e-150
WP_163146030.1|2129442_2129673_+	hypothetical protein	NA	A0A2H4J515	uncultured_Caudovirales_phage	86.8	4.8e-33
WP_163145611.1|2129672_2130017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163145610.1|2130016_2130262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163145609.1|2130254_2130491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163146031.1|2130483_2130798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163146032.1|2130794_2131103_+	hypothetical protein	NA	A0A2H4J8T6	uncultured_Caudovirales_phage	46.7	3.1e-11
WP_075175062.1|2131099_2131303_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_171065072.1|2131425_2132001_+	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	A0A0P0IKJ1	Acinetobacter_phage	93.7	1.0e-103
WP_016659977.1|2132020_2133067_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	87.1	5.2e-167
WP_005176475.1|2133084_2133891_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	85.1	1.2e-126
WP_163146033.1|2134097_2134781_+	Smr/MutS family protein	NA	A0A0P0IDT4	Acinetobacter_phage	75.5	5.4e-88
WP_005176473.1|2134874_2135423_+	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	95.1	3.4e-93
WP_005176472.1|2135519_2135876_+	DUF861 domain-containing protein	NA	NA	NA	NA	NA
WP_163146034.1|2135987_2137349_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.2	3.4e-17
>prophage 12
NZ_CP044455	Acinetobacter indicus strain B18 chromosome, complete genome	3054651	2487860	2543383	3054651	tRNA,transposase	Enterobacteria_phage(14.29%)	53	NA	NA
WP_163146114.1|2487860_2490482_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	40.5	4.6e-172
WP_005182353.1|2490860_2491388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163146115.1|2491384_2492374_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_163146116.1|2492492_2493836_+	MacA family efflux pump subunit	NA	A0A140XAI1	Dickeya_phage	59.2	6.3e-08
WP_005182346.1|2493838_2495818_+	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	39.2	5.6e-37
WP_163146117.1|2495828_2497247_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_163146118.1|2497276_2497921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163146119.1|2498056_2498812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163146120.1|2498814_2499192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163146121.1|2499341_2500277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163146122.1|2500298_2500457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001988464.1|2500708_2501734_+|transposase	IS30-like element ISAba125 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.1	5.7e-25
WP_004911237.1|2502750_2503956_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	80.3	2.1e-87
WP_163146123.1|2504102_2504621_-	SEL1-like repeat protein	NA	NA	NA	NA	NA
WP_163146124.1|2505225_2505969_-	SEL1-like repeat protein	NA	NA	NA	NA	NA
WP_163146125.1|2506134_2507013_-	SEL1-like repeat protein	NA	NA	NA	NA	NA
WP_163146126.1|2508534_2509470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163146127.1|2509550_2510387_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	37.3	5.4e-50
WP_163146128.1|2510631_2511078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001195446.1|2511093_2511585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035363502.1|2513296_2514166_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_163146129.1|2514162_2514681_-	SEL1-like repeat protein	NA	NA	NA	NA	NA
WP_163146130.1|2514785_2515655_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	39.6	1.0e-51
WP_163146131.1|2515888_2516980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163146132.1|2516996_2517506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163146133.1|2518255_2518720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163146134.1|2518761_2519220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163145337.1|2519231_2520776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163146135.1|2520777_2523579_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	56.2	4.6e-287
WP_005182307.1|2523721_2524525_-	enoyl-ACP reductase	NA	NA	NA	NA	NA
WP_016659546.1|2524673_2525408_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_005182297.1|2525661_2526216_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.7	7.8e-29
WP_104490218.1|2526341_2527400_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_005182291.1|2527496_2527904_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_005182284.1|2527924_2528182_+	glutaredoxin 3	NA	A0A248SKD6	Salicola_phage	41.5	3.5e-08
WP_005182282.1|2528222_2528681_+	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_005182280.1|2528754_2530029_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	31.9	3.0e-39
WP_005182279.1|2530142_2530838_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_005182277.1|2530908_2531820_+	bestrophin	NA	NA	NA	NA	NA
WP_016659548.1|2531869_2532745_-	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_005182273.1|2532789_2533401_+	septation protein IspZ	NA	NA	NA	NA	NA
WP_163146136.1|2533432_2533735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005182267.1|2533740_2534223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171524616.1|2534253_2536131_+	FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	NA	NA	NA	NA	NA
WP_005182260.1|2536318_2536633_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_005182257.1|2536724_2537213_+	YajQ family cyclic di-GMP-binding protein	NA	NA	NA	NA	NA
WP_104473309.1|2537241_2537748_+	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_005182243.1|2537814_2538237_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_163146138.1|2538254_2538686_-	thioredoxin TrxC	NA	A0A1V0SD63	Indivirus	33.3	1.5e-11
WP_163146139.1|2538686_2539583_-	alpha/beta fold hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	33.1	4.1e-27
WP_005182227.1|2539707_2540043_+	TIGR01244 family phosphatase	NA	NA	NA	NA	NA
WP_163146140.1|2540035_2540458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163145382.1|2542363_2543383_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	46.4	2.8e-80
>prophage 13
NZ_CP044455	Acinetobacter indicus strain B18 chromosome, complete genome	3054651	2588146	2598693	3054651	transposase	Catovirus(16.67%)	9	NA	NA
WP_005182090.1|2588146_2590783_-	type I DNA topoisomerase	NA	A0A1V0SB35	Catovirus	33.7	2.1e-92
WP_163146155.1|2590816_2591266_-	ammonium transporter	NA	NA	NA	NA	NA
WP_005182088.1|2591336_2592359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005182087.1|2592579_2592825_-	SlyX family protein	NA	NA	NA	NA	NA
WP_163146156.1|2592860_2594771_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	27.1	2.3e-43
WP_163146157.1|2594871_2595807_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	33.7	2.2e-39
WP_034586922.1|2595902_2596961_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0H3UZC2	Geobacillus_virus	36.2	4.8e-27
WP_104490858.1|2596981_2597395_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.9	2.3e-46
WP_004911237.1|2597487_2598693_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	80.3	2.1e-87
>prophage 1
NZ_CP044457	Acinetobacter indicus strain B18 plasmid pB18-2, complete sequence	136195	20	66184	136195	integrase,transposase	Escherichia_phage(47.06%)	55	39348:39407	75043:75863
WP_001067855.1|20_725_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_159153817.1|2035_3571_+	phosphorylase	NA	NA	NA	NA	NA
WP_163143569.1|3590_4538_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_151208077.1|4541_5039_+	four-carbon acid sugar kinase family protein	NA	NA	NA	NA	NA
WP_127798918.1|5035_5932_+	ATP-binding protein	NA	B2YG10	Musca_hytrovirus	26.6	1.2e-05
WP_127798920.1|5960_6500_+	3'-5' exonuclease	NA	NA	NA	NA	NA
WP_127798922.1|6540_7056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159153816.1|7319_8538_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	52.2	4.9e-76
WP_159153815.1|8660_9434_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	56.6	1.2e-75
WP_163145943.1|10989_12315_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_127800962.1|12913_13234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127800960.1|13233_13515_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_163143575.1|13671_14055_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_004780063.1|14051_14387_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_127800924.1|16508_17054_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_104505828.1|17937_18261_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_104505827.1|18241_18556_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_104505826.1|18594_18909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074163995.1|19614_20115_-	META domain-containing protein	NA	NA	NA	NA	NA
WP_074163994.1|20117_20801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163146584.1|21038_21743_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	5.3e-139
WP_000376623.1|21872_22373_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259031.1|22500_23340_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_052238321.1|23333_23669_-	ethidium bromide resistance protein	NA	NA	NA	NA	NA
WP_025999322.1|23561_23927_+	hydrogenase maturation nickel metallochaperone HypA	NA	NA	NA	NA	NA
WP_004193231.1|23930_24806_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004236386.1|24916_26056_+	class C beta-lactamase DHA-1	NA	NA	NA	NA	NA
WP_000050481.1|27372_28914_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000259031.1|29318_30158_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_163146594.1|31827_32808_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	42.5	5.9e-64
WP_163141132.1|32807_33581_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	55.4	5.5e-73
WP_001206316.1|33913_34705_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_001256773.1|34797_36057_-	chloramphenicol efflux MFS transporter CmlA6	NA	S4TR35	Salmonella_phage	31.7	2.8e-26
WP_001261740.1|36318_37110_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_001931474.1|37150_38017_-	PSE family carbenicillin-hydrolyzing class A beta-lactamase CARB-2	NA	A0A077SL40	Escherichia_phage	44.1	4.8e-57
WP_032490158.1|38181_38655_-	trimethoprim-resistant dihydrofolate reductase DfrA16	NA	G3MBI7	Bacillus_virus	30.8	1.4e-18
39348:39407	attL	TGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATT	NA	NA	NA	NA
WP_001067855.1|39400_40105_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_127800989.1|41039_42212_-	replication initiation protein	NA	NA	NA	NA	NA
WP_127800991.1|43068_43842_+	ParA family protein	NA	Q8JL10	Natrialba_phage	33.3	7.6e-14
WP_127800993.1|43855_44767_+	ParB/RepB/Spo0J family partition protein	NA	S5VSZ7	Leptospira_phage	35.1	1.4e-14
WP_163143549.1|45197_45581_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_163143552.1|45577_45913_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_127801007.1|47984_49646_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	54.9	3.6e-170
WP_127801006.1|50156_50396_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000934717.1|52226_53492_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_000366814.1|53491_53797_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004726728.1|54717_54975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004658347.1|55324_55921_-	putative adenosine monophosphate-protein transferase Fic	NA	NA	NA	NA	NA
WP_002125865.1|55933_56101_-	DUF2559 family protein	NA	NA	NA	NA	NA
WP_127800793.1|56417_56867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127800787.1|56853_59193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127800785.1|59197_62398_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000550047.1|62710_62929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159153749.1|62959_64342_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	NA	NA	NA	NA
WP_005245164.1|64984_66184_+|integrase	tyrosine-type recombinase/integrase	integrase	E5AGD0	Erwinia_phage	29.3	2.6e-37
75043:75863	attR	AATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCATTTTAAGCGTTATGCTAAGCCCAGGAAGCCGCAGGATCTTTTGAACCACAACTGCATTAACGTCCGCTATTCTGATACGAGTGGATTGTACGCCTGGGAATTCGAGAAAGATGCTCAGAAATTCAGTCTGAAAGTCAAAGGGCAATATATTGCGAACAGCACGATTCATCAGCTCGATGCAGCATTAGACGGGCTGGGGATTGCCTATATTCCCGAGTATGTTGCAGATGGATATATCAAAAGCGGCAAGCTGATTGCTGTTCTGACCGAGTGGTGTCCATATTTTGACGGCTACCATATTTATTATCCTCACCGCCGACAGGATTCTCCTGCGTTTATGGCTTTTCTGCAAGTTTTGCGTGACAGGTACAATAATGGAATAAGATAAATTTATGAGTAAAGGATTATGTCCACGATAAGCACCTGGGTCGATTCCTGGGAGGCGGCCATGAGGGTAGGGAAGCGCCGTCCCGTCAAGTCAGCGTAATGCTCTGCCAGTGTTACAACCAATTAACCAATTCTGATTAGAAAAACTCATCGAGCATCAAATGAAACTGCAATTTATTCATATCAGGATTATCAATACCATATTTTTGAAAAAGCCGTTTCTGTAATGAAGGAGAAAACTCACCGAGGCAGTTCCATAGGATGGCAAGATCCTGGTATCGGTCTGCGATTCCGACTCGTCCAACATCAATACAACCTATTAATTTCCCCTCGTCAAAAATAAGGTTATCAAGTGAGAAATCACCATGAGTGAC	NA	NA	NA	NA
