The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP044445	Acinetobacter indicus strain CMG3-2 chromosome, complete genome	3160342	913675	919599	3160342		Acinetobacter_phage(83.33%)	7	NA	NA
WP_005176471.1|913675_915037_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.8	9.9e-17
WP_005176472.1|915148_915505_-	DUF861 domain-containing protein	NA	NA	NA	NA	NA
WP_005176473.1|915601_916150_-	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	95.1	3.4e-93
WP_005176474.1|916243_916927_-	Smr/MutS family protein	NA	A0A0P0IDT4	Acinetobacter_phage	75.5	7.0e-88
WP_075167166.1|917133_917940_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	85.4	2.4e-127
WP_016659977.1|917957_919004_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	87.1	5.2e-167
WP_171065072.1|919023_919599_-	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	A0A0P0IKJ1	Acinetobacter_phage	93.7	1.0e-103
>prophage 2
NZ_CP044445	Acinetobacter indicus strain CMG3-2 chromosome, complete genome	3160342	986340	997202	3160342	transposase,protease	Acinetobacter_phage(37.5%)	12	NA	NA
WP_127800966.1|986340_986730_+|transposase	IS200/IS605 family transposase	transposase	Q38463	Halobacterium_phage	34.2	3.1e-08
WP_171457099.1|986794_987721_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_127800971.1|987732_988881_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	33.2	5.7e-42
WP_127800973.1|988873_989653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127800975.1|989645_990767_-	phosphoribosyltransferase domain-containing protein	NA	A0A172Q0Y1	Acinetobacter_phage	28.7	1.3e-33
WP_127800977.1|991152_991728_+	TerD family protein	NA	A0A2P1N0L4	Streptomyces_phage	37.5	1.3e-07
WP_127800979.1|991746_992823_+	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	52.6	1.6e-86
WP_127801911.1|992857_993436_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	39.7	8.7e-31
WP_127800983.1|993550_994771_+	TerD family protein	NA	NA	NA	NA	NA
WP_127800985.1|994789_995506_+	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_127800987.1|995533_996121_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	31.2	1.3e-13
WP_152342234.1|996269_997202_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	41.3	5.5e-59
>prophage 3
NZ_CP044445	Acinetobacter indicus strain CMG3-2 chromosome, complete genome	3160342	1035089	1078435	3160342	tRNA,integrase,head,transposase,protease	Pseudomonas_phage(11.11%)	41	1038212:1038227	1064651:1064666
WP_005176696.1|1035089_1035743_+|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_127801370.1|1036083_1036350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075174750.1|1036327_1036786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127801371.1|1036881_1038117_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
1038212:1038227	attL	TAAAAAATCACGAAAT	NA	NA	NA	NA
WP_005176699.1|1038336_1038519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045795109.1|1040174_1040954_-	hypothetical protein	NA	A0A127KNK1	Pseudomonas_phage	51.8	1.5e-25
WP_045795108.1|1041263_1043285_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_163169843.1|1043409_1043571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104988072.1|1043586_1044816_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_005176706.1|1045510_1046440_+	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_075167798.1|1046708_1048166_+	glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_016660046.1|1048323_1049049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075167800.1|1049062_1049737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075174753.1|1049750_1050602_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_127801485.1|1050717_1051092_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_075167802.1|1051594_1052782_-	MFS transporter	NA	NA	NA	NA	NA
WP_016660051.1|1053048_1054260_+	Obg family GTPase CgtA	NA	NA	NA	NA	NA
WP_005176735.1|1054289_1055423_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	43.1	1.2e-73
WP_163169980.1|1055615_1056737_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P9F9	Acinetobacter_phage	46.6	6.4e-62
WP_160232520.1|1056736_1057336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163169981.1|1057437_1057713_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_152342246.1|1057709_1057928_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_152342306.1|1057924_1058179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163169982.1|1058290_1058596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163169983.1|1058588_1058984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163169984.1|1058980_1061104_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_120371045.1|1061445_1061808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163169985.1|1061874_1062837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163169986.1|1062841_1063555_+|head,protease	HK97 family phage prohead protease	head,protease	A0A0R6PCV7	Moraxella_phage	51.9	1.4e-35
WP_163169987.1|1063551_1063905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163169988.1|1063960_1064278_+	HNH endonuclease	NA	C7BGG5	Burkholderia_phage	42.9	7.4e-08
WP_016660052.1|1064857_1065562_-	SIMPL domain-containing protein	NA	NA	NA	NA	NA
1064651:1064666	attR	ATTTCGTGATTTTTTA	NA	NA	NA	NA
WP_005176742.1|1066026_1067400_+	diaminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	4.5e-25
WP_005176744.1|1067403_1068936_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_005176703.1|1069066_1070218_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_005176746.1|1070813_1071839_+	substrate-binding domain-containing protein	NA	A0A1B1IWY0	uncultured_Mediterranean_phage	39.6	1.4e-60
WP_005176748.1|1071940_1073320_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_171260895.1|1073343_1074714_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_171065074.1|1074781_1075657_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.0	3.0e-14
WP_127801177.1|1076054_1077017_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	28.3	6.5e-23
WP_152342363.1|1077130_1078435_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP044445	Acinetobacter indicus strain CMG3-2 chromosome, complete genome	3160342	1225782	1296895	3160342	integrase,transposase	Erysipelothrix_phage(30.0%)	52	1273732:1273753	1301848:1301869
WP_163170009.1|1225782_1227036_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_163170010.1|1227028_1228732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163170011.1|1228728_1230687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163170012.1|1230658_1231045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163170013.1|1231057_1231285_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_163170014.1|1231365_1231860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163170015.1|1232078_1235354_+	ATP-dependent helicase	NA	A0A2K5B2B9	Erysipelothrix_phage	43.0	2.8e-243
WP_163170016.1|1235356_1236034_+	DUF4391 domain-containing protein	NA	NA	NA	NA	NA
WP_163170017.1|1236050_1237916_+	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	43.0	2.9e-120
WP_163170018.1|1237928_1241099_+	DEAD/DEAH box helicase family protein	NA	A0A2K5B2C2	Erysipelothrix_phage	31.3	1.7e-123
WP_163170019.1|1241148_1242072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163170020.1|1242276_1244625_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_163170021.1|1246513_1247821_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_163170022.1|1248014_1248932_+	Abi family protein	NA	A3QSC6	Clostridium_virus	32.4	2.2e-36
WP_163170023.1|1248954_1252209_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_104426529.1|1252394_1253738_-	outer membrane porin, OprD family	NA	NA	NA	NA	NA
WP_163170024.1|1253921_1255499_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_067763270.1|1255520_1257308_-	dihydroxy-acid dehydratase family protein	NA	NA	NA	NA	NA
WP_163170025.1|1257438_1258614_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_163170026.1|1258725_1259661_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_163170027.1|1259710_1260589_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_163170028.1|1260940_1261933_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_163170029.1|1261947_1263321_+	MFS transporter	NA	NA	NA	NA	NA
WP_163170030.1|1263324_1264203_+	NAD-binding protein	NA	NA	NA	NA	NA
WP_163170031.1|1264636_1265956_+	MFS transporter	NA	NA	NA	NA	NA
WP_163170032.1|1266089_1267040_-	D-2-hydroxyacid dehydrogenase	NA	M1HBE3	Paramecium_bursaria_Chlorella_virus	28.4	2.0e-24
WP_067763287.1|1267077_1267794_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_067763289.1|1267874_1269608_-	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_163170505.1|1269835_1271086_+	MFS transporter	NA	NA	NA	NA	NA
WP_163170033.1|1271090_1272089_+	FAH family protein	NA	NA	NA	NA	NA
WP_163170034.1|1272101_1273676_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
1273732:1273753	attL	GGGCTTTGTTGCACAAAGATTT	NA	NA	NA	NA
WP_163170035.1|1273784_1274717_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	41.1	3.5e-58
WP_168461597.1|1274956_1275115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104504291.1|1276406_1276805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004911237.1|1276915_1278121_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	80.3	2.1e-87
WP_163170036.1|1278166_1279432_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A221SAN4	Ralstonia_phage	22.9	8.1e-13
WP_127801374.1|1280543_1281206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127801947.1|1281281_1281647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163170037.1|1281648_1283052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075167881.1|1283044_1283476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127801915.1|1284187_1284508_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_158650619.1|1284840_1285950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127801917.1|1285961_1286840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104489485.1|1286858_1287224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127801918.1|1287235_1287526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163170038.1|1287536_1288508_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_005177227.1|1289143_1290502_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_163170039.1|1292886_1293222_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_168391271.1|1293218_1293518_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_005236300.1|1293950_1294133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127801953.1|1294232_1294982_-	metallophosphoesterase	NA	A0A172Q099	Acinetobacter_phage	41.0	1.3e-42
WP_163169972.1|1295290_1296895_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	54.0	1.2e-143
1301848:1301869	attR	AAATCTTTGTGCAACAAAGCCC	NA	NA	NA	NA
>prophage 5
NZ_CP044445	Acinetobacter indicus strain CMG3-2 chromosome, complete genome	3160342	1439004	1535076	3160342	plate,holin,transposase,protease	uncultured_virus(20.0%)	89	NA	NA
WP_163169974.1|1439004_1439388_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_163169973.1|1439384_1439720_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_163169972.1|1439794_1441399_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	54.0	1.2e-143
WP_005177656.1|1441703_1442006_-	cyd operon YbgE family protein	NA	NA	NA	NA	NA
WP_002120988.1|1442009_1442111_-	cytochrome bd-I oxidase subunit CydX	NA	NA	NA	NA	NA
WP_005177659.1|1442137_1443283_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_005177660.1|1443279_1444866_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_005177663.1|1444865_1445057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104513280.1|1445759_1446377_-	DUF1449 family protein	NA	NA	NA	NA	NA
WP_171065079.1|1446404_1446713_-	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_127799521.1|1446727_1447732_-	adenosine kinase	NA	NA	NA	NA	NA
WP_005177673.1|1447868_1448318_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_127799523.1|1448463_1451403_+	insulinase family protein	NA	E3T4Q7	Cafeteria_roenbergensis_virus	20.6	6.5e-05
WP_005177679.1|1451424_1452570_+	phospholipase A	NA	NA	NA	NA	NA
WP_075167765.1|1452641_1454006_-	potassium transporter TrkH	NA	NA	NA	NA	NA
WP_005177682.1|1454017_1454668_-	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
WP_005177685.1|1454812_1456351_-	threonine ammonia-lyase, biosynthetic	NA	NA	NA	NA	NA
WP_005177689.1|1456458_1457130_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_127799529.1|1457213_1457894_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_171521956.1|1458077_1459133_+	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_005177701.1|1459212_1459959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035363010.1|1459977_1460394_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.0	4.5e-13
WP_163170075.1|1460403_1462680_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.8	4.8e-165
WP_005177718.1|1462791_1463145_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	59.4	1.9e-28
WP_127799533.1|1463228_1463702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005177730.1|1465392_1466307_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_171521957.1|1466421_1467072_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005177735.1|1467298_1468183_+	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_163170077.1|1468187_1469327_+	2-methylcitrate synthase	NA	NA	NA	NA	NA
WP_127799537.1|1469404_1470025_-	aminotransferase	NA	NA	NA	NA	NA
WP_127799539.1|1470099_1470582_-	CinA family protein	NA	A0A218MNG4	uncultured_virus	38.1	3.6e-22
WP_005177745.1|1470791_1471025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005177747.1|1471202_1471346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127799543.1|1471464_1471797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005177751.1|1472199_1472436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104471465.1|1472811_1473159_-	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_005177756.1|1473197_1473437_-	DUF2171 domain-containing protein	NA	NA	NA	NA	NA
WP_163170078.1|1474739_1475900_+	MFS transporter	NA	NA	NA	NA	NA
WP_127799545.1|1475948_1477436_-	amidase	NA	NA	NA	NA	NA
WP_005177765.1|1477660_1478125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005177767.1|1478190_1479555_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_005177770.1|1479572_1479995_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_005177772.1|1480011_1480467_-	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_005177774.1|1481532_1481790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163170079.1|1481793_1482540_+	zeta toxin	NA	NA	NA	NA	NA
WP_016658158.1|1483036_1483453_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_005177782.1|1483454_1483877_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_127801023.1|1483873_1484749_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_163170080.1|1484890_1485655_+	alpha/beta fold hydrolase	NA	A0A023W7H4	Mycobacterium_phage	34.8	2.3e-07
WP_075167752.1|1485668_1486631_-	M15 family metallopeptidase	NA	A0A0H3V0Q8	Geobacillus_virus	32.1	4.9e-10
WP_160241326.1|1486627_1487272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075167754.1|1487286_1488093_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_163170081.1|1488105_1489470_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_152342367.1|1489475_1490591_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_163170082.1|1490610_1493289_-	type VI secretion system ATPase TssH	NA	A0A248SJW6	Salicola_phage	29.5	1.4e-78
WP_104483770.1|1493679_1494318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045795670.1|1494338_1494842_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_005177804.1|1494834_1496316_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_005177807.1|1496360_1496864_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_127799557.1|1496931_1497408_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_075175233.1|1497419_1499225_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_163170083.1|1499188_1500184_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_127799563.1|1500180_1501599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163145820.1|1501639_1505455_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_005177824.1|1505486_1506446_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_075175237.1|1506447_1507215_+	OmpA family protein	NA	NA	NA	NA	NA
WP_127801714.1|1507320_1508646_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_163170084.1|1509134_1509347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163170085.1|1509461_1510537_-|transposase	IS3-like element ISAba20 family transposase	transposase	S5WIU1	Leptospira_phage	39.8	8.6e-48
WP_163170086.1|1511630_1512431_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_163170087.1|1512472_1512964_-	flavin reductase	NA	NA	NA	NA	NA
WP_163170088.1|1513073_1514102_-	methionine synthase	NA	NA	NA	NA	NA
WP_163170089.1|1514130_1515117_-	DUF1852 family protein	NA	NA	NA	NA	NA
WP_163170090.1|1515776_1516784_+	OmpA family protein	NA	NA	NA	NA	NA
WP_163170091.1|1516981_1517143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163170092.1|1518341_1519076_-	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
WP_163170093.1|1519094_1519937_-	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_163170094.1|1519933_1521916_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_163170095.1|1522025_1522697_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_163170096.1|1522699_1524091_+	sensor histidine kinase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_152342388.1|1524114_1524888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163170097.1|1525046_1526714_-|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	30.4	1.4e-52
WP_171065061.1|1526730_1528206_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_163170098.1|1528223_1528808_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_005177908.1|1529039_1531076_+|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	26.1	9.3e-19
WP_163170099.1|1531088_1531697_+	MarC family protein	NA	NA	NA	NA	NA
WP_163169929.1|1532644_1533886_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.9	4.2e-30
WP_163170100.1|1534378_1534732_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	58.6	7.4e-33
WP_163170101.1|1534797_1535076_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	65.0	5.1e-21
>prophage 6
NZ_CP044445	Acinetobacter indicus strain CMG3-2 chromosome, complete genome	3160342	1655779	1686754	3160342	terminase,capsid,tail,transposase	Acinetobacter_phage(35.0%)	45	NA	NA
WP_163170139.1|1655779_1658761_-|tail	phage tail protein	tail	A0A2H4PI09	Pseudomonas_phage	37.5	5.5e-44
WP_163170140.1|1658822_1659593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077670459.1|1659635_1660352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026056531.1|1660426_1660663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104498830.1|1660689_1661010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163166396.1|1661016_1661778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163170141.1|1661838_1662279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163170142.1|1662271_1662754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163170143.1|1662761_1662956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163170144.1|1662965_1663349_-	DUF4054 domain-containing protein	NA	NA	NA	NA	NA
WP_163170145.1|1663357_1663747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163170146.1|1663760_1664756_-	DUF2184 domain-containing protein	NA	M4SQD1	Psychrobacter_phage	36.6	7.9e-48
WP_163170147.1|1664762_1665233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163170148.1|1665247_1666432_-	DUF2213 domain-containing protein	NA	M4SN93	Psychrobacter_phage	37.8	9.1e-59
WP_163170149.1|1666521_1666950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163169972.1|1666980_1668585_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	54.0	1.2e-143
WP_163169973.1|1668659_1668995_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_163169974.1|1668991_1669375_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_163170150.1|1669564_1670374_-|capsid	minor capsid protein	capsid	M4T3R2	Psychrobacter_phage	39.5	4.8e-51
WP_163170510.1|1670348_1671662_-	DUF1073 domain-containing protein	NA	M4SN90	Psychrobacter_phage	39.4	7.4e-86
WP_163170151.1|1671712_1673239_-|terminase	phage terminase large subunit	terminase	A0A291LBL3	Klebsiella_phage	41.7	6.6e-94
WP_163170152.1|1673216_1673699_-	DUF2280 domain-containing protein	NA	A0A0P0HSK4	Acinetobacter_phage	52.2	3.0e-37
WP_163170153.1|1673745_1674393_-|transposase	transposase	transposase	A0A0N7IRF1	Acinetobacter_phage	68.4	3.2e-90
WP_171521958.1|1674389_1674560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163170154.1|1674698_1675001_-	hemolysin	NA	NA	NA	NA	NA
WP_163166426.1|1675200_1675503_-	hemolysin	NA	NA	NA	NA	NA
WP_163170155.1|1676371_1676782_-	antitermination protein	NA	NA	NA	NA	NA
WP_163170156.1|1676794_1677472_-	metallophosphoesterase	NA	A0A0A0RMI8	Acinetobacter_phage	46.7	3.3e-53
WP_104471641.1|1677482_1677821_-	DUF1064 domain-containing protein	NA	A0A0R6PIZ9	Moraxella_phage	54.5	3.8e-26
WP_163170157.1|1677813_1677996_-	DUF1653 domain-containing protein	NA	NA	NA	NA	NA
WP_163170158.1|1677992_1678262_-	hypothetical protein	NA	A0A2H4JC19	uncultured_Caudovirales_phage	56.8	4.5e-06
WP_163170159.1|1678458_1678716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163170160.1|1678712_1679345_-	DNA cytosine methyltransferase	NA	A0A2H4J383	uncultured_Caudovirales_phage	77.4	2.0e-89
WP_163170161.1|1679341_1680091_-	ATP-binding protein	NA	A0A0D4DBZ2	Acinetobacter_phage	61.4	6.7e-84
WP_163170511.1|1680087_1680912_-	replication protein	NA	NA	NA	NA	NA
WP_075175325.1|1681042_1681501_-	phage regulatory CII family protein	NA	A0A2H4J3D5	uncultured_Caudovirales_phage	72.2	4.6e-59
WP_075174451.1|1681552_1681783_-	helix-turn-helix domain-containing protein	NA	A0A0P0IY81	Acinetobacter_phage	57.7	5.3e-16
WP_081410735.1|1681940_1682603_+	LexA family transcriptional regulator	NA	A0A1I9KG86	Aeromonas_phage	37.1	2.1e-28
WP_034703035.1|1682718_1682988_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_163170162.1|1682984_1683425_+	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_163170163.1|1683452_1683896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163170164.1|1684206_1684638_+	hypothetical protein	NA	A0A0N7IRF7	Acinetobacter_phage	46.6	2.0e-27
WP_163170165.1|1684637_1684937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163170166.1|1684949_1686071_+	AAA family ATPase	NA	A0A0N7IRE0	Acinetobacter_phage	82.6	1.6e-177
WP_163170167.1|1686067_1686754_+	DUF3820 family protein	NA	A0A1L2C8X2	Pseudomonas_phage	39.0	2.6e-34
>prophage 7
NZ_CP044445	Acinetobacter indicus strain CMG3-2 chromosome, complete genome	3160342	1910047	1920614	3160342		Catovirus(16.67%)	9	NA	NA
WP_163170228.1|1910047_1912681_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	23.6	3.8e-33
WP_005178805.1|1912886_1913210_+	ferredoxin family protein	NA	NA	NA	NA	NA
WP_005178806.1|1913340_1914063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005178807.1|1914195_1914861_+	O-methyltransferase	NA	S5YRC3	Mycobacterium_phage	38.7	5.0e-30
WP_005178808.1|1915003_1915846_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	33.9	1.3e-35
WP_171521972.1|1915982_1916579_-	acyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	49.2	7.4e-09
WP_005178810.1|1916592_1917192_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	39.1	5.0e-21
WP_005178811.1|1917294_1918479_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_163170230.1|1918475_1920614_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	23.7	1.1e-25
>prophage 8
NZ_CP044445	Acinetobacter indicus strain CMG3-2 chromosome, complete genome	3160342	2022187	2031040	3160342	tRNA	uncultured_Caudovirales_phage(50.0%)	10	NA	NA
WP_034598177.1|2022187_2022892_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	70.5	4.1e-91
WP_127799995.1|2022891_2023941_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_016659186.1|2023944_2024418_-	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	53.8	3.0e-37
WP_005179068.1|2024422_2024740_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	64.4	7.9e-26
WP_163170262.1|2024824_2025253_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	59.9	2.6e-40
WP_160242989.1|2025397_2026789_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	64.7	4.7e-131
WP_005179080.1|2026792_2027047_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	46.6	2.0e-16
WP_163170263.1|2027182_2028748_-	alkyl hydroperoxide reductase subunit F	NA	A0A1W6JK46	Lactococcus_phage	30.5	6.7e-25
WP_127799568.1|2028948_2029863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127799570.1|2029906_2031040_-	toxic anion resistance protein	NA	K4F9M7	Cronobacter_phage	22.8	2.2e-17
>prophage 9
NZ_CP044445	Acinetobacter indicus strain CMG3-2 chromosome, complete genome	3160342	2358130	2422287	3160342	coat,integrase,transposase	Gordonia_phage(14.29%)	52	2389218:2389277	2422401:2422485
WP_127799757.1|2358130_2359102_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_075168017.1|2359751_2360825_+	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_163170339.1|2360882_2361824_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_163170340.1|2361932_2362622_-	FCD domain-containing protein	NA	NA	NA	NA	NA
WP_075168018.1|2362786_2363233_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_114541911.1|2363304_2364543_-	3-(3-hydroxy-phenyl)propionate transporter MhpT	NA	NA	NA	NA	NA
WP_004892382.1|2364804_2365638_+	p-hydroxycinnamoyl CoA hydratase/lyase	NA	NA	NA	NA	NA
WP_163170341.1|2365688_2367140_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_127801137.1|2367216_2369103_+	feruloyl-CoA synthase	NA	NA	NA	NA	NA
WP_163170342.1|2369176_2370316_+	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_171521976.1|2370370_2371624_+	OprD family porin	NA	NA	NA	NA	NA
WP_004892370.1|2371676_2372213_+	DUF3237 domain-containing protein	NA	NA	NA	NA	NA
WP_075168024.1|2372260_2372650_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_075168025.1|2372791_2373850_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_075168026.1|2374057_2374537_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_075168027.1|2374662_2375292_-	protocatechuate 3,4-dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_119879474.1|2375306_2376032_-	protocatechuate 3,4-dioxygenase subunit beta	NA	NA	NA	NA	NA
WP_004892353.1|2376068_2376467_-	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
WP_127801131.1|2376550_2377333_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_127801130.1|2377338_2378691_-	3-carboxy-cis,cis-muconate cycloisomerase	NA	A0A1B3B081	Gordonia_phage	27.0	8.6e-05
WP_075168030.1|2378769_2379975_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_075168031.1|2380071_2380725_-	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_075168032.1|2380746_2381418_-	3-oxoacid CoA-transferase subunit A	NA	NA	NA	NA	NA
WP_127801129.1|2381702_2382527_+	IclR family transcriptional regulator PcaU	NA	NA	NA	NA	NA
WP_127801128.1|2382662_2383856_-	4-hydroxybenzoate 3-monooxygenase	NA	NA	NA	NA	NA
WP_075168034.1|2384010_2384820_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_127801127.1|2385233_2386583_+	MFS transporter	NA	NA	NA	NA	NA
WP_075168036.1|2386654_2387923_+	outer membrane porin, OprD family	NA	NA	NA	NA	NA
WP_163170038.1|2388013_2388985_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
2389218:2389277	attL	ATAAAAAAAGCCTTTAAACATTGAGTTTAAAGGCTTTTTTAGATTCCGATGGATTACTTC	NA	NA	NA	NA
WP_114541532.1|2389888_2390791_-	cation transporter	NA	A0A1V0SED0	Indivirus	29.8	1.6e-23
WP_163170344.1|2390854_2394019_-	CusA/CzcA family heavy metal efflux RND transporter	NA	NA	NA	NA	NA
WP_163170345.1|2394008_2395259_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_163170346.1|2395242_2396571_-	TolC family protein	NA	NA	NA	NA	NA
WP_114541535.1|2396619_2396976_-	cation transporter	NA	NA	NA	NA	NA
WP_104488381.1|2397369_2398101_+	Fic family protein	NA	A0A1V0E025	Clostridioides_phage	28.2	3.3e-11
WP_163170347.1|2398572_2399049_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_104488383.1|2399093_2399843_+	molecular chaperone	NA	NA	NA	NA	NA
WP_104488384.1|2399849_2402219_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_104488386.1|2402209_2403187_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_104488387.1|2403210_2403681_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_163170348.1|2404964_2406329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163170349.1|2406335_2407307_-	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_163170350.1|2408953_2410429_-	N-6 DNA methylase	NA	J7I0U9	Acinetobacter_phage	33.2	1.5e-31
WP_163170351.1|2410486_2412865_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_004811081.1|2413008_2413239_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_163170352.1|2413335_2414235_-	hydrolase or metal-binding protein	NA	NA	NA	NA	NA
WP_163170353.1|2414430_2415489_-	YqaJ viral recombinase family protein	NA	A0A139ZPJ9	Marinitoga_camini_virus	42.7	1.1e-42
WP_163170354.1|2415663_2416695_-	DUF932 domain-containing protein	NA	A0A0H4INH5	Stenotrophomonas_phage	40.2	1.1e-60
WP_163170355.1|2416717_2416996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163170356.1|2417102_2417972_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_163170357.1|2418443_2420897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163170358.1|2421150_2422287_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4J339	uncultured_Caudovirales_phage	38.9	9.0e-72
2422401:2422485	attR	ATAAAAAAAGCCTTTAAACATTGAGTTTAAAGGCTTTTTTAGATTCCGATGGATTACTTCGGAAAGAATTTTGGTGGAGGTGGCG	NA	NA	NA	NA
>prophage 10
NZ_CP044445	Acinetobacter indicus strain CMG3-2 chromosome, complete genome	3160342	2547831	2685487	3160342	integrase,tRNA,transposase	Enterobacteria_phage(15.15%)	111	2623385:2623404	2686668:2686687
WP_035269493.1|2547831_2549136_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_127800357.1|2549301_2550747_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	34.2	6.5e-43
WP_016658646.1|2550822_2551203_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_104505830.1|2551272_2551539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005180005.1|2551803_2552490_-	response regulator	NA	W8CYM9	Bacillus_phage	32.4	8.2e-28
WP_127800355.1|2552505_2554176_-	sensor histidine kinase efflux regulator BaeS	NA	NA	NA	NA	NA
WP_163170374.1|2554310_2554922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075168330.1|2555218_2557021_+	acyl-CoA dehydrogenase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_075168331.1|2557194_2558976_+	acyl-CoA dehydrogenase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_005180016.1|2559124_2559622_+	phosphate-starvation-inducible PsiE family protein	NA	NA	NA	NA	NA
WP_163170375.1|2559769_2560195_-	RcnB family protein	NA	NA	NA	NA	NA
WP_005180018.1|2560378_2560834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127801755.1|2561075_2562539_-	phospholipase	NA	NA	NA	NA	NA
WP_163170376.1|2562645_2564751_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_163170377.1|2564892_2565657_+	DUF4184 family protein	NA	NA	NA	NA	NA
WP_163170378.1|2565801_2567586_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	25.6	1.4e-18
WP_005180031.1|2567697_2567916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127800613.1|2567939_2568815_+	lysophospholipid acyltransferase family protein	NA	NA	NA	NA	NA
WP_127800611.1|2569296_2570310_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_127800609.1|2570389_2571487_+	glycoside hydrolase family 99-like domain-containing protein	NA	A0A1V0SDW6	Indivirus	29.2	7.2e-34
WP_127800607.1|2571523_2572072_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	53.0	1.1e-48
WP_127800605.1|2572068_2572953_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	68.3	1.5e-111
WP_127800603.1|2572949_2573843_-	dTDP-4-dehydrorhamnose reductase	NA	NA	NA	NA	NA
WP_127800601.1|2573846_2574914_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	52.8	1.1e-100
WP_163170379.1|2575065_2575998_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	41.5	1.0e-57
WP_127800686.1|2576268_2577156_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_127800688.1|2577202_2577979_-	glycosyltransferase family 25 protein	NA	NA	NA	NA	NA
WP_104490082.1|2577987_2578752_-	glycosyltransferase family 25 protein	NA	NA	NA	NA	NA
WP_127800690.1|2578751_2579735_-	Stealth CR1 domain-containing protein	NA	NA	NA	NA	NA
WP_104470838.1|2579760_2580489_-	glycosyltransferase	NA	A0A292GAQ8	Xanthomonas_phage	26.4	4.3e-11
WP_163170380.1|2580693_2581863_+	nucleotide sugar dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	53.2	1.7e-110
WP_005180046.1|2581921_2582848_-	branched-chain amino acid transaminase	NA	NA	NA	NA	NA
WP_163170381.1|2582872_2585623_-	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_163170382.1|2585698_2586973_-	GAF domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	28.8	1.1e-22
WP_163170383.1|2587754_2589992_+	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_171521962.1|2590667_2593913_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	28.9	2.8e-65
WP_163170385.1|2593987_2594464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163170386.1|2594493_2595027_-	DUF2939 domain-containing protein	NA	NA	NA	NA	NA
WP_163170387.1|2595081_2596206_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_152342537.1|2596202_2597750_-	N-6 DNA methylase	NA	A0A2H4PQP4	Staphylococcus_phage	27.4	3.8e-49
WP_004911237.1|2598136_2599342_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	80.3	2.1e-87
WP_163170388.1|2599394_2600201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163170389.1|2601585_2601945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163170390.1|2602099_2602678_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A2H4J538	uncultured_Caudovirales_phage	60.0	6.2e-53
WP_163170391.1|2602693_2603998_+	DUF4113 domain-containing protein	NA	A0A2H4JBL5	uncultured_Caudovirales_phage	59.7	3.7e-154
WP_163170392.1|2604135_2604465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004911237.1|2604524_2605730_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	80.3	2.1e-87
WP_152342542.1|2606034_2606439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163169972.1|2606681_2608286_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	54.0	1.2e-143
WP_163169973.1|2608360_2608696_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_163169974.1|2608692_2609076_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_163170393.1|2609288_2610125_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_163170394.1|2610587_2611217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163170395.1|2611300_2611564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163170396.1|2611599_2612898_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	33.1	2.4e-52
WP_163141236.1|2613350_2614388_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_163170397.1|2614413_2615442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163170398.1|2615464_2616031_+	LemA family protein	NA	A0A1X9IGG1	Lactococcus_phage	27.1	9.5e-06
WP_163170399.1|2616092_2617043_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.2	5.3e-17
WP_075167471.1|2617471_2618602_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	48.5	8.3e-94
WP_005180065.1|2618704_2619034_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_016658621.1|2619087_2620989_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_171521963.1|2620997_2621969_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	33.5	2.9e-34
WP_152342363.1|2622084_2623389_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
2623385:2623404	attL	CTTAACTGACTGGCATTACA	NA	NA	NA	NA
WP_127799670.1|2623421_2624066_-	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_045796610.1|2624141_2626448_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_127799672.1|2626479_2627871_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	26.3	1.4e-29
WP_005180079.1|2627877_2628699_-	3'-5' exonuclease	NA	NA	NA	NA	NA
WP_171065091.1|2628725_2629664_-	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	42.3	7.4e-56
WP_127799674.1|2629809_2632620_+	response regulator	NA	A0A1V0SGX0	Hokovirus	29.4	2.8e-50
WP_127801484.1|2632728_2633514_+	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_005180090.1|2633544_2634417_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	24.8	4.2e-13
WP_127799676.1|2634453_2635242_+	TIM barrel protein	NA	NA	NA	NA	NA
WP_171065092.1|2635372_2635726_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_005180098.1|2635973_2637419_-	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta	NA	NA	NA	NA	NA
WP_005180100.1|2637422_2637746_-	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_016658612.1|2637757_2638885_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005180104.1|2639729_2640656_+	DMT family transporter	NA	NA	NA	NA	NA
WP_127799678.1|2640803_2641991_+	MFS transporter	NA	NA	NA	NA	NA
WP_127799680.1|2642016_2642658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127800932.1|2643114_2643489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005180111.1|2643543_2643828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068568838.1|2644203_2645136_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	40.9	9.3e-59
WP_127801927.1|2645710_2647126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127801928.1|2649388_2649820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163170401.1|2650564_2653669_-	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	30.5	1.3e-72
WP_163170402.1|2653670_2656070_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_127800845.1|2657458_2658328_+|transposase	IS982-like element ISAcsp2 family transposase	transposase	NA	NA	NA	NA
WP_127801480.1|2658439_2659843_-	putative DNA binding domain-containing protein	NA	NA	NA	NA	NA
WP_127801481.1|2659832_2661563_-	type I restriction-modification system subunit M	NA	NA	NA	NA	NA
WP_127801482.1|2661804_2662704_-	hydrolase or metal-binding protein	NA	NA	NA	NA	NA
WP_127801483.1|2662899_2663958_-	YqaJ viral recombinase family protein	NA	A0A139ZPJ9	Marinitoga_camini_virus	43.6	4.8e-43
WP_127801832.1|2664152_2665184_-	DUF932 domain-containing protein	NA	A0A0H4INH5	Stenotrophomonas_phage	40.5	8.5e-61
WP_171521964.1|2665204_2665534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163170403.1|2665741_2665900_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_127800863.1|2666020_2666626_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_086208627.1|2666778_2667225_-	protein TolR	NA	NA	NA	NA	NA
WP_127801834.1|2667237_2667936_-	protein TolQ	NA	NA	NA	NA	NA
WP_127800855.1|2668030_2670010_-	phytase	NA	NA	NA	NA	NA
WP_127800857.1|2670086_2672573_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_127800859.1|2672897_2673824_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_121533352.1|2673820_2674822_+	AraC family transcriptional regulator ligand-binding domain-containing protein	NA	NA	NA	NA	NA
WP_127800861.1|2674895_2675621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049590879.1|2675620_2677132_-	alkaline phosphatase	NA	NA	NA	NA	NA
WP_049590878.1|2677146_2678763_-	alkaline phosphatase	NA	NA	NA	NA	NA
WP_104487443.1|2679039_2680114_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.0	1.2e-44
WP_127801638.1|2680124_2680925_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_045795896.1|2681388_2682285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163170519.1|2682769_2683774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029574588.1|2684088_2684385_+	pyocin activator PrtN family protein	NA	NA	NA	NA	NA
WP_127800281.1|2684350_2685487_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4J8L8	uncultured_Caudovirales_phage	46.9	1.4e-96
2686668:2686687	attR	TGTAATGCCAGTCAGTTAAG	NA	NA	NA	NA
>prophage 11
NZ_CP044445	Acinetobacter indicus strain CMG3-2 chromosome, complete genome	3160342	2817313	2824761	3160342	transposase,protease	Helicobacter_phage(40.0%)	9	NA	NA
WP_160240927.1|2817313_2817748_-|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_016658503.1|2817788_2818352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104488148.1|2818522_2819071_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016659780.1|2819100_2819550_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	49.2	2.7e-32
WP_163170420.1|2819622_2821014_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A2I7RKG5	Vibrio_phage	23.6	2.0e-09
WP_163170521.1|2821020_2821542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163170421.1|2821628_2822847_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	53.6	1.1e-78
WP_016659040.1|2822992_2824150_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A7P9	Microcystis_virus	36.9	2.7e-55
WP_152342123.1|2824146_2824761_-|transposase	IS607 family transposase	transposase	A0A1S5RGS9	Helicobacter_phage	63.2	2.7e-62
>prophage 12
NZ_CP044445	Acinetobacter indicus strain CMG3-2 chromosome, complete genome	3160342	2969162	3022787	3160342	transposase	Bacillus_phage(22.22%)	51	NA	NA
WP_163170468.1|2969162_2970467_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_152342563.1|2970681_2971482_+	putative porin	NA	NA	NA	NA	NA
WP_163170469.1|2971533_2973234_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	32.2	4.8e-69
WP_104471918.1|2973234_2973891_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_163170470.1|2973902_2975240_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_005180795.1|2975366_2976833_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.8	1.5e-90
WP_075167288.1|2977012_2977378_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_005180798.1|2977486_2978284_-	FprA family A-type flavoprotein	NA	NA	NA	NA	NA
WP_016658743.1|2978467_2979043_-	TMEM165/GDT1 family protein	NA	NA	NA	NA	NA
WP_163170471.1|2979367_2981389_-	2-oxo acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
WP_127800553.1|2981391_2984094_-	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_005180807.1|2984362_2985046_-	M23 family metallopeptidase	NA	G3MBP9	Bacillus_virus	39.9	3.4e-18
WP_016658741.1|2985154_2985595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005180809.1|2985692_2986595_-	UDP-3-O-acyl-N-acetylglucosamine deacetylase	NA	NA	NA	NA	NA
WP_005180810.1|2986719_2987907_-	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_163170472.1|2988067_2989330_-	cell division protein FtsA	NA	NA	NA	NA	NA
WP_163170473.1|2989395_2990250_-	FtsQ-type POTRA domain-containing protein	NA	NA	NA	NA	NA
WP_016658739.1|2990253_2991183_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_016658738.1|2991239_2992688_-	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_152342570.1|2992700_2993798_-	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_096901158.1|2994123_2995275_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_104513186.1|2995400_2996339_-	glutathione synthase	NA	NA	NA	NA	NA
WP_005180819.1|2996456_2996651_+	DUF3565 domain-containing protein	NA	NA	NA	NA	NA
WP_004911237.1|2996794_2998000_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	80.3	2.1e-87
WP_163170474.1|2997996_2998275_-	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_005180822.1|2998658_2999357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005180824.1|2999437_2999782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163170523.1|2999765_3000515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163170475.1|3000520_3001000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075175540.1|3002148_3002799_-	orotate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_016658733.1|3002839_3003661_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_016658732.1|3004156_3004507_+	Spx/MgsR family RNA polymerase-binding regulatory protein	NA	NA	NA	NA	NA
WP_005180835.1|3004603_3005041_-	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_163170476.1|3005196_3006108_+	alpha/beta hydrolase fold domain-containing protein	NA	A0A2K9L3Q5	Tupanvirus	24.5	1.7e-09
WP_005180838.1|3006171_3006735_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_163170477.1|3006970_3008161_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	34.4	6.4e-20
WP_163170478.1|3008164_3008851_-	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_163140867.1|3009169_3009940_-	transporter	NA	NA	NA	NA	NA
WP_045796529.1|3009956_3010499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152342363.1|3010693_3011998_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_005180845.1|3012051_3012414_-	HPF/RaiA family ribosome-associated protein	NA	NA	NA	NA	NA
WP_163170479.1|3012661_3013636_+	allantoinase PuuE	NA	NA	NA	NA	NA
WP_163170480.1|3013759_3014263_+	2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase	NA	NA	NA	NA	NA
WP_075168214.1|3014259_3014586_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_163170481.1|3014687_3015422_+	ion channel protein Tsx	NA	NA	NA	NA	NA
WP_163145374.1|3015520_3016060_+	GNAT family N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	33.5	1.6e-15
WP_104513247.1|3016095_3017253_-	FAD-dependent urate hydroxylase HpxO	NA	NA	NA	NA	NA
WP_163170482.1|3017473_3018481_+	allantoicase	NA	NA	NA	NA	NA
WP_163170483.1|3018585_3019095_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_087835735.1|3019414_3020489_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.6	2.6e-44
WP_004911237.1|3021581_3022787_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	80.3	2.1e-87
>prophage 13
NZ_CP044445	Acinetobacter indicus strain CMG3-2 chromosome, complete genome	3160342	3052822	3107776	3160342	tRNA,transposase	Helicobacter_phage(18.75%)	58	NA	NA
WP_163170492.1|3052822_3054214_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A2I7RKG5	Vibrio_phage	23.8	1.8e-10
WP_023274418.1|3054286_3054736_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	50.0	7.2e-33
WP_016658706.1|3054889_3055729_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_075167957.1|3055944_3056646_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005180894.1|3056869_3057580_+	phosphate regulon transcriptional regulator PhoB	NA	W8CYM9	Bacillus_phage	36.2	7.9e-34
WP_016658705.1|3057589_3058945_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	33.3	1.8e-31
WP_163170493.1|3059006_3059858_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_075175038.1|3059854_3060697_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_163170494.1|3060866_3062066_-	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	33.6	1.6e-42
WP_005180904.1|3062184_3062715_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_005180906.1|3062900_3064415_-	catalase	NA	A0A2K9L0T1	Tupanvirus	47.9	2.1e-100
WP_075175037.1|3064637_3065078_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_075175036.1|3065148_3065634_-	SCP-2 sterol transfer family protein	NA	NA	NA	NA	NA
WP_005180916.1|3065788_3066124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005180917.1|3066525_3067746_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_104473403.1|3067823_3069077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075175034.1|3069140_3071204_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_104473404.1|3071441_3072371_-	bile acid:sodium symporter family protein	NA	NA	NA	NA	NA
WP_127801070.1|3072408_3073065_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	40.8	6.6e-27
WP_163170495.1|3073210_3074419_-	3-(3-hydroxy-phenyl)propionate transporter MhpT	NA	NA	NA	NA	NA
WP_005180931.1|3075145_3076042_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_005180933.1|3076057_3076660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005180935.1|3076697_3077417_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	36.4	1.6e-37
WP_075167950.1|3077685_3078960_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	5.3e-81
WP_016658695.1|3079134_3079587_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_005006601.1|3079778_3079937_+	DUF1328 domain-containing protein	NA	A0A0R6PJ30	Moraxella_phage	61.7	1.8e-07
WP_016658694.1|3080154_3080892_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_005180943.1|3080952_3081318_+	HIT family protein	NA	NA	NA	NA	NA
WP_163170496.1|3081429_3082464_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_005180945.1|3082521_3083061_+	M23 family metallopeptidase	NA	G9FHQ8	Rhodococcus_virus	33.9	1.9e-08
WP_005180946.1|3083080_3083326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163170497.1|3083347_3083935_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_104484362.1|3083931_3084954_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	28.7	2.7e-43
WP_005180950.1|3085190_3085895_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_075167944.1|3085941_3086634_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_171066694.1|3086760_3088311_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_016658689.1|3088345_3088960_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	NA	NA	NA	NA
WP_016658688.1|3089124_3089970_+	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_005180961.1|3090382_3091099_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_127798561.1|3091307_3091991_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_075175029.1|3092021_3092639_-	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_016658684.1|3092820_3093537_+	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_075167943.1|3093533_3094229_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_005180975.1|3094255_3095002_+	YciK family oxidoreductase	NA	NA	NA	NA	NA
WP_163170498.1|3095134_3096286_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075167942.1|3096452_3096872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164844941.1|3097049_3097205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127798993.1|3097434_3097830_+	RcnB family protein	NA	NA	NA	NA	NA
WP_005180985.1|3098074_3098428_+	RcnB family protein	NA	NA	NA	NA	NA
WP_016659040.1|3098590_3099748_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A7P9	Microcystis_virus	36.9	2.7e-55
WP_075167936.1|3099744_3100359_-|transposase	IS607 family transposase	transposase	A0A1S5RGS9	Helicobacter_phage	63.2	2.7e-62
WP_127799908.1|3100525_3101881_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_127799906.1|3102214_3103198_+	sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_104473410.1|3103209_3104205_+	aliphatic sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_075167938.1|3104241_3105417_+	FMNH2-dependent alkanesulfonate monooxygenase	NA	NA	NA	NA	NA
WP_127799902.1|3105416_3106232_+	aliphatic sulfonate ABC transporter permease SsuC	NA	NA	NA	NA	NA
WP_016658676.1|3106245_3107049_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	36.4	7.3e-28
WP_075167936.1|3107161_3107776_+|transposase	IS607 family transposase	transposase	A0A1S5RGS9	Helicobacter_phage	63.2	2.7e-62
>prophage 1
NZ_CP044446	Acinetobacter indicus strain CMG3-2 plasmid pCMG3-2-1, complete sequence	120957	2588	66016	120957	integrase,transposase	Escherichia_phage(35.71%)	55	3203:3262	63048:63868
WP_152342664.1|2588_3116_-|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	39.8	1.1e-27
3203:3262	attL	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTT	NA	NA	NA	NA
WP_001067855.1|3254_3959_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_077782102.1|5017_5878_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_064754130.1|5895_7059_-	tetracycline-inactivating monooxygenase Tet(X)	NA	NA	NA	NA	NA
WP_044502095.1|7055_7433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082987283.1|7727_7973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163167828.1|8003_9497_-|transposase	IS91-like element ISVsa3 family transposase	transposase	NA	NA	NA	NA
WP_127800590.1|9689_10854_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	84.9	5.1e-139
WP_077170035.1|11089_11548_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_038350081.1|11674_12463_-	DUF4111 domain-containing protein	NA	NA	NA	NA	NA
WP_004658364.1|14057_14279_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004658363.1|14473_14725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127800877.1|15429_16317_-	cation transporter	NA	NA	NA	NA	NA
WP_127800879.1|16303_17035_-	transglutaminase family protein	NA	NA	NA	NA	NA
WP_005245164.1|17569_18769_-|integrase	tyrosine-type recombinase/integrase	integrase	E5AGD0	Erwinia_phage	29.3	2.6e-37
WP_159153749.1|19411_20794_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	NA	NA	NA	NA
WP_000550047.1|20824_21043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127800785.1|21355_24556_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_127800787.1|24560_26900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127800793.1|26886_27336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002125865.1|27652_27820_+	DUF2559 family protein	NA	NA	NA	NA	NA
WP_004658347.1|27832_28429_+	putative adenosine monophosphate-protein transferase Fic	NA	NA	NA	NA	NA
WP_004726728.1|28778_29036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000366814.1|29956_30262_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000934717.1|30261_31527_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_127801006.1|33357_33597_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_127801007.1|34107_35769_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	54.9	3.6e-170
WP_163143552.1|37840_38176_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_163143549.1|38172_38556_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_127800993.1|38986_39898_-	ParB/RepB/Spo0J family partition protein	NA	S5VSZ7	Leptospira_phage	35.1	1.4e-14
WP_127800991.1|39911_40685_-	ParA family protein	NA	Q8JL10	Natrialba_phage	33.3	7.6e-14
WP_127800989.1|41541_42714_+	replication initiation protein	NA	NA	NA	NA	NA
WP_163143546.1|43334_44267_-|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	41.7	1.4e-59
WP_159153817.1|44835_46371_+	phosphorylase	NA	NA	NA	NA	NA
WP_163143569.1|46390_47338_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_151208077.1|47341_47839_+	four-carbon acid sugar kinase family protein	NA	NA	NA	NA	NA
WP_127798918.1|47835_48732_+	ATP-binding protein	NA	B2YG10	Musca_hytrovirus	26.6	1.2e-05
WP_127798920.1|48760_49300_+	3'-5' exonuclease	NA	NA	NA	NA	NA
WP_127798922.1|49340_49856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159153816.1|50119_51338_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	52.2	4.9e-76
WP_159153815.1|51460_52234_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	56.6	1.2e-75
WP_127800962.1|54225_54546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127800960.1|54545_54827_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_163143575.1|54983_55367_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_163143578.1|55363_55699_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_127800924.1|57820_58366_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_104505828.1|59249_59573_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_104505827.1|59553_59868_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_104505826.1|59906_60221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074163995.1|60926_61427_-	META domain-containing protein	NA	NA	NA	NA	NA
WP_074163994.1|61429_62113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|62350_63055_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000376623.1|63184_63685_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259031.1|63812_64652_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
63048:63868	attR	AAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCTCGCGGTCGGACTGCAAGTGATCTTGAAGCCACGGGCCCGTCCCACCCCGACATGGACCTCGATGCCCGAACGGACGTTAGATTTCGAGTTCTAGGCGTTCTGCGATGAAGGTTGGATCCCAGCCGGGATTGAAAGTGTCGACGTGGGTGAATCCGAGCCGCTCGTATAGGCCACGCAGGTTCGGGTGGCAGTCGAGCCGCAGCTTGGCGCACCCCTGCGTTCGCGCGGCATGGCGGCAAGCCTCGATCAGCGCGGAGCTGACACCCCGGCCCGCATGTGTCCGTCGCACCGCGAGCTTGTGCAGATATGCGGCCTCCCCCTTGAGGGCGTCGGGCCAGAACTCGGGATCCTCGGCCGACAAGGTGCAACAGCCGACGATGCCGTCGCTGCAACTCGCGACTAGGAGCTCGGATCTCAGGACGAAGGTCTCCGCGAATGTCCGGTCGATCCGCGCGACGTCCCAGGCGGGCGTTCCCTTGGCGGACATCCACGCCGCAGCGTCGTGCATCAGCCGCACAACCTCGTCGATATCACCCGAGCAGGCGACCCGAACGTTCGGAGGCTCCTCGCTGTCCATTCGCTCCCCTGGCGCGGTATGAACCGCCGCCTCATAGTGCAGTTTGATCCTGACGAGCCCAGCATGTCTGCGCCCACCTTCGCGGAACCTGACCAGGGTCCGCTAGCGGGCGGCCGGAAGGTGAATGCTAGGCATGATCTAACCCTCGGTCTCTGGCGTCGCGACTGCGAAATTTCGCGAGGG	NA	NA	NA	NA
WP_102025745.1|64990_66016_+|transposase	IS21-like element ISEc57 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	44.4	6.0e-75
>prophage 1
NZ_CP044447	Acinetobacter indicus strain CMG3-2 plasmid pCMG3-2-2, complete sequence	16151	0	10194	16151	transposase	Escherichia_phage(40.0%)	11	NA	NA
WP_121523934.1|0_576_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_166135762.1|595_739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000052512.1|1335_2811_+	ABC-F type ribosomal protection protein Msr(E)	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
WP_000155092.1|2866_3751_+	Mph(E) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_015060246.1|3940_4552_-	recombinase family protein	NA	NA	NA	NA	NA
WP_171521980.1|4896_5184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163170421.1|5158_6377_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	53.6	1.1e-78
WP_163170527.1|7150_7357_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_163170528.1|7358_8527_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	53.6	1.0e-78
WP_163170085.1|8593_9669_-|transposase	IS3-like element ISAba20 family transposase	transposase	S5WIU1	Leptospira_phage	39.8	8.6e-48
WP_000221358.1|9900_10194_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	46.9	2.6e-15
