The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP048806	Morganella morganii strain MP63 chromosome, complete genome	4004672	107668	116515	4004672		Escherichia_phage(66.67%)	8	NA	NA
WP_015422350.1|107668_110122_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	49.7	1.7e-216
WP_004237907.1|110133_110751_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	8.0e-75
WP_004237908.1|110752_111613_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	35.7	1.1e-26
WP_004237909.1|111698_112310_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	35.2	2.4e-23
WP_004237910.1|112377_112668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015422349.1|112795_113482_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_004237912.1|113570_114191_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	55.5	3.0e-61
WP_024474702.1|114559_116515_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	37.0	7.4e-82
>prophage 2
NZ_CP048806	Morganella morganii strain MP63 chromosome, complete genome	4004672	1276548	1282961	4004672	integrase	Morganella_phage(33.33%)	13	1274002:1274015	1280540:1280553
1274002:1274015	attL	TACCGCGCTCCATA	NA	NA	NA	NA
WP_024475228.1|1276548_1277616_-|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	53.2	6.8e-114
WP_071592739.1|1277516_1277873_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_163652940.1|1278083_1278623_-	phage N-6-adenine-methyltransferase	NA	A0A1W6JP96	Morganella_phage	64.7	3.2e-59
WP_163652942.1|1278612_1278912_-	DUF2591 domain-containing protein	NA	E9NID9	Enterobacter_phage	50.0	3.8e-06
WP_163652944.1|1278957_1279326_-	DUF2528 family protein	NA	NA	NA	NA	NA
WP_163652946.1|1279477_1279765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163652948.1|1279761_1280070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163652950.1|1280126_1280723_-	YqaJ viral recombinase family protein	NA	A0A0S2SY31	Pseudomonas_phage	55.3	3.5e-51
1280540:1280553	attR	TACCGCGCTCCATA	NA	NA	NA	NA
WP_163652953.1|1280703_1281441_-	phage recombination protein Bet	NA	A0A088CBI3	Shigella_phage	69.2	2.3e-68
WP_163652958.1|1281437_1281647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163652961.1|1282052_1282316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_132274688.1|1282360_1282552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163652964.1|1282574_1282961_-	hypothetical protein	NA	A0A1W6JNZ6	Morganella_phage	51.9	3.9e-27
>prophage 3
NZ_CP048806	Morganella morganii strain MP63 chromosome, complete genome	4004672	1286019	1310805	4004672	tail,coat,portal,terminase	Salmonella_phage(29.63%)	33	NA	NA
WP_163652982.1|1286019_1286730_-	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	65.7	8.6e-81
WP_015422887.1|1286825_1287017_+	hypothetical protein	NA	A0A2K8HL98	Pseudomonas_phage	50.8	9.9e-08
WP_052927987.1|1287136_1287472_+	transcriptional regulator	NA	A0A1P8DTF0	Proteus_phage	76.1	2.3e-39
WP_163652985.1|1287726_1288815_+	DNA replication protein	NA	E5AGE9	Erwinia_phage	46.0	9.2e-82
WP_163652989.1|1288814_1290191_+	replicative DNA helicase	NA	E5AGF0	Erwinia_phage	59.6	7.3e-161
WP_163652991.1|1290215_1290425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163652992.1|1290809_1291025_+	restriction alleviation protein, Lar family	NA	NA	NA	NA	NA
WP_163652994.1|1291028_1291385_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	57.1	6.3e-24
WP_163652996.1|1291385_1291829_+	hypothetical protein	NA	A0A1P8DTD8	Proteus_phage	84.9	2.1e-29
WP_163652999.1|1291825_1292023_+	hypothetical protein	NA	A0A1W6JP14	Morganella_phage	89.2	1.2e-29
WP_163653002.1|1292019_1292445_+	hypothetical protein	NA	A0A1W6JNY5	Morganella_phage	49.3	3.9e-28
WP_163653004.1|1292437_1292629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163653006.1|1292719_1293319_+	recombination protein NinG	NA	A0A1P8DTE0	Proteus_phage	84.0	7.3e-81
WP_024473559.1|1293303_1293504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124538073.1|1293500_1294004_+	DUF1133 family protein	NA	A0A1P8DTF1	Proteus_phage	84.4	1.4e-77
WP_015422877.1|1294557_1294866_+	hypothetical protein	NA	E7C9S8	Salmonella_phage	47.5	1.6e-20
WP_163653008.1|1294862_1295195_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	71.3	4.4e-35
WP_163653010.1|1295196_1295574_+	hypothetical protein	NA	A0A1W6JNV2	Morganella_phage	59.5	3.6e-17
WP_163653012.1|1296072_1296279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070579453.1|1296477_1296702_+	DUF2560 family protein	NA	A0A192Y6S9	Salmonella_phage	57.5	5.9e-12
WP_163653014.1|1296756_1297248_+	DNA-packaging protein	NA	C6ZR06	Salmonella_phage	82.2	9.2e-74
WP_163653016.1|1297222_1298722_+|terminase	terminase	terminase	A0A2D1GLW6	Escherichia_phage	83.2	1.2e-257
WP_163653019.1|1298721_1300809_+|portal	portal protein	portal	G5DA97	Enterobacteria_phage	68.7	2.3e-238
WP_163653022.1|1300823_1301738_+	scaffolding protein	NA	A0A192Y6T4	Salmonella_phage	70.1	1.4e-104
WP_163653025.1|1301737_1303021_+|coat	coat protein	coat	A0A2D1GLV2	Escherichia_phage	65.3	1.9e-163
WP_163654257.1|1303314_1303542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163653028.1|1303519_1304017_+	recombinase RmuC	NA	Q76H19	Enterobacteria_phage	60.9	4.8e-46
WP_163653033.1|1303988_1305407_+	hypothetical protein	NA	I1TEJ1	Salmonella_phage	69.9	5.5e-204
WP_163653036.1|1305406_1306150_+|tail	phage tail protein	tail	C6ZR14	Salmonella_phage	63.1	7.7e-40
WP_163653039.1|1306157_1306616_+	DUF2824 family protein	NA	G5DA79	Enterobacteria_phage	84.8	1.5e-73
WP_163653041.1|1306618_1307311_+	DNA transfer protein	NA	I6S1K1	Salmonella_phage	63.0	8.2e-68
WP_163653044.1|1307320_1308709_+	DNA transfer protein	NA	A0A192Y834	Salmonella_phage	47.4	1.1e-100
WP_163653047.1|1308708_1310805_+	lytic transglycosylase domain-containing protein	NA	A0A2I7QW93	Vibrio_phage	44.5	5.6e-144
>prophage 4
NZ_CP048806	Morganella morganii strain MP63 chromosome, complete genome	4004672	1337846	1395362	4004672	holin,lysis,tRNA,integrase,terminase,head	Pectobacterium_phage(17.95%)	69	1341190:1341205	1367113:1367128
WP_163653070.1|1337846_1339262_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_155275760.1|1339408_1339558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004240267.1|1340379_1341486_+	hypothetical protein	NA	NA	NA	NA	NA
1341190:1341205	attL	ATGATGGAAAAAATGA	NA	NA	NA	NA
WP_163653072.1|1341523_1341988_-	HIT family protein	NA	Q5YEY9	Rock_bream_iridovirus	36.1	2.8e-19
WP_004240269.1|1342185_1342377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004240270.1|1342538_1343057_+	YgjV family protein	NA	NA	NA	NA	NA
WP_032099194.1|1343061_1343319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046024863.1|1343378_1343960_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_004240274.1|1344200_1344755_+	membrane protein	NA	NA	NA	NA	NA
WP_004240277.1|1344854_1345175_+	cupredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_004240281.1|1345198_1346038_+	membrane protein	NA	NA	NA	NA	NA
WP_046024862.1|1346027_1346927_+	EfeM/EfeO family lipoprotein	NA	NA	NA	NA	NA
WP_163653074.1|1346923_1348213_+	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_163653076.1|1348250_1349006_-	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_004240287.1|1350336_1351323_+	bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB	NA	NA	NA	NA	NA
WP_004904012.1|1351355_1352684_+	threonine/serine transporter TdcC	NA	NA	NA	NA	NA
WP_004240289.1|1352831_1353452_+	nitroreductase family protein	NA	NA	NA	NA	NA
WP_004240290.1|1353669_1354329_+	response regulator	NA	NA	NA	NA	NA
WP_004240292.1|1354362_1356210_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_004240294.1|1356418_1356967_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_163653078.1|1357479_1358502_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PLZ2	Enterobacterial_phage	63.4	4.1e-124
WP_046894825.1|1358504_1358723_-	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	48.6	1.5e-12
WP_163653080.1|1358706_1358886_-	hypothetical protein	NA	H9C154	Pectobacterium_phage	49.1	3.5e-07
WP_163654263.1|1358956_1359142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049242634.1|1359374_1359872_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	65.1	1.4e-50
WP_163653082.1|1359868_1361869_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	38.9	1.9e-125
WP_163653084.1|1361884_1362217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036415342.1|1362474_1362693_+	hypothetical protein	NA	A0A1W6JP23	Morganella_phage	60.6	8.1e-14
WP_125112315.1|1362685_1363000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036415337.1|1363274_1363970_-	helix-turn-helix transcriptional regulator	NA	G8C7L8	Escherichia_phage	45.6	1.1e-51
WP_036423348.1|1364075_1364321_+	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	46.6	2.8e-15
WP_045137517.1|1364364_1364817_+|tRNA	tRNA-(guanine-N1)-methyltransferase	tRNA	H9C162	Pectobacterium_phage	57.0	1.9e-33
WP_049242644.1|1364834_1365059_+	hypothetical protein	NA	H9C163	Pectobacterium_phage	63.5	3.1e-21
WP_163653087.1|1365060_1365912_+	GntR family transcriptional regulator	NA	Q8W642	Enterobacteria_phage	53.4	3.6e-33
WP_163653090.1|1365904_1366477_+	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	50.3	2.7e-48
WP_163653093.1|1366479_1367850_+	replicative DNA helicase	NA	A0A192Y673	Salmonella_phage	46.0	6.5e-101
1367113:1367128	attR	ATGATGGAAAAAATGA	NA	NA	NA	NA
WP_163653095.1|1368162_1371963_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_108943618.1|1372226_1372820_+	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	58.7	3.4e-62
WP_004240320.1|1372832_1373144_+	DUF968 domain-containing protein	NA	A0A1I9KFA7	Aeromonas_phage	69.8	7.0e-35
WP_163653098.1|1373131_1373665_+	DUF1133 family protein	NA	A5VW83	Enterobacteria_phage	48.4	5.9e-34
WP_052927923.1|1373994_1374183_+|holin	holin	holin	A0A1W6JNY9	Morganella_phage	72.9	2.9e-20
WP_163653101.1|1374179_1374656_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	92.4	8.9e-82
WP_163652602.1|1374637_1374796_+	hypothetical protein	NA	A0A1W6JP30	Morganella_phage	84.8	3.7e-16
WP_163653104.1|1374792_1375242_+|lysis	lysis protein	lysis	A0A1W6JP00	Morganella_phage	63.9	1.0e-15
WP_163653107.1|1375219_1375525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163653110.1|1375625_1376654_+|terminase	terminase small subunit	terminase	A0A248SKT2	Klebsiella_phage	45.0	2.0e-41
WP_163653113.1|1376779_1377256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036415295.1|1377501_1378902_+|terminase	phage terminase large subunit	terminase	A0A2K9V3I6	Faecalibacterium_phage	41.3	4.2e-87
WP_163653117.1|1378903_1380418_+	DUF1073 domain-containing protein	NA	A0A2H4P6S9	Pseudomonas_phage	44.8	2.4e-104
WP_163654266.1|1380440_1381154_+|head	phage head morphogenesis protein	head	Q6IWU3	Burkholderia_phage	38.6	3.4e-37
WP_163653120.1|1381150_1382431_+	DUF2213 domain-containing protein	NA	A0A2H5BG39	Pseudoalteromonas_phage	41.2	2.7e-40
WP_004240333.1|1382430_1382928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049241635.1|1382927_1383995_+	DUF2184 domain-containing protein	NA	A0A2H4P6S2	Pseudomonas_phage	39.6	6.1e-54
WP_163653123.1|1384051_1384405_+	hypothetical protein	NA	Q6IWU7	Burkholderia_phage	36.2	3.1e-07
WP_036406833.1|1384414_1384843_+	DUF4054 domain-containing protein	NA	Q6IWU8	Burkholderia_phage	30.9	7.7e-08
WP_163653126.1|1384839_1385298_+	hypothetical protein	NA	A0A077KC03	Edwardsiella_phage	40.4	3.2e-20
WP_163653129.1|1385297_1385666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163653132.1|1385655_1386171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163653134.1|1386180_1387668_+	DUF3383 domain-containing protein	NA	A0A088C3U1	Shewanella_sp._phage	37.1	7.3e-82
WP_004240341.1|1387677_1388130_+	hypothetical protein	NA	A0A2H4P6T4	Pseudomonas_phage	43.5	1.5e-25
WP_135052103.1|1388171_1388633_+	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	47.7	1.3e-24
WP_163653136.1|1388715_1390851_+	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	26.6	3.1e-17
WP_135052099.1|1390847_1391378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135052097.1|1391374_1391668_+	hypothetical protein	NA	Q6IWP9	Burkholderia_phage	35.5	8.1e-09
WP_135052095.1|1391660_1392476_+	hypothetical protein	NA	A0A0H4M7L6	Pseudomonas_phage	28.7	1.7e-19
WP_163653138.1|1392489_1393182_+	hypothetical protein	NA	A1Z003	Burkholderia_virus	43.1	5.9e-34
WP_046024501.1|1393178_1393523_+	phage related-protein	NA	NA	NA	NA	NA
WP_163653140.1|1393515_1394703_+	hypothetical protein	NA	A0A2H5BG53	Pseudoalteromonas_phage	39.2	4.3e-77
WP_163653142.1|1394699_1395362_+	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	40.2	1.5e-39
>prophage 5
NZ_CP048806	Morganella morganii strain MP63 chromosome, complete genome	4004672	1429006	1471334	4004672	capsid,protease,tail,portal,terminase,head	Morganella_phage(72.34%)	54	NA	NA
WP_163653168.1|1429006_1430233_-	DUF3440 domain-containing protein	NA	A0A220GKF8	Streptococcus_phage	33.2	1.0e-57
WP_032098716.1|1430465_1430939_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_163653171.1|1431185_1431848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163653174.1|1431844_1432279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163653176.1|1432265_1433114_-	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	36.4	1.2e-31
WP_163653179.1|1433213_1434386_-	recombinase	NA	A0A2H4J1K3	uncultured_Caudovirales_phage	29.1	7.9e-31
WP_163653182.1|1434633_1435209_-	3'-5' exoribonuclease	NA	A0A1W6JP74	Morganella_phage	76.3	3.8e-79
WP_163653185.1|1435214_1435748_-	HD family hydrolase	NA	A0A1W6JP41	Morganella_phage	82.6	7.4e-77
WP_163653188.1|1435856_1436684_-	YfdQ family protein	NA	U5P439	Shigella_phage	54.9	3.8e-80
WP_163653191.1|1436748_1437111_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	61.2	1.4e-34
WP_024475296.1|1437331_1437544_-	hypothetical protein	NA	A0A1W6JP89	Morganella_phage	81.4	2.0e-25
WP_024475295.1|1437644_1438277_-	LexA family transcriptional regulator	NA	K7PLZ5	Enterobacterial_phage	43.5	1.1e-39
WP_163653194.1|1438378_1438591_+	cell division protein	NA	A0A1W6JP24	Morganella_phage	45.5	2.9e-08
WP_049246711.1|1438620_1439106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163653197.1|1439170_1439362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112544666.1|1439358_1439550_+	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	87.1	4.0e-25
WP_072870517.1|1439546_1440431_+	helix-turn-helix domain-containing protein	NA	A0A1W6JP36	Morganella_phage	86.1	8.7e-131
WP_112544603.1|1440433_1441081_+	phage N-6-adenine-methyltransferase	NA	K7PGU4	Enterobacteria_phage	69.3	1.1e-85
WP_112544605.1|1441591_1442380_+	KilA-N domain-containing protein	NA	A0A1W6JP13	Morganella_phage	96.6	1.4e-140
WP_163653200.1|1442379_1443396_+	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	89.9	1.0e-183
WP_163653202.1|1443426_1444104_+	hypothetical protein	NA	A0A1W6JP37	Morganella_phage	93.3	4.6e-124
WP_112544611.1|1444269_1444464_+	hypothetical protein	NA	A0A1W6JP28	Morganella_phage	93.8	1.3e-26
WP_163653205.1|1444602_1445658_+	site-specific DNA-methyltransferase	NA	A0A1W6JP25	Morganella_phage	94.8	5.1e-170
WP_112544615.1|1445958_1446171_+	cold shock domain-containing protein	NA	A0A1W6JNX5	Morganella_phage	95.7	2.9e-32
WP_163653208.1|1446396_1447326_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	95.8	3.0e-142
WP_004238694.1|1447876_1448068_+	hypothetical protein	NA	A0A1W6JNY9	Morganella_phage	100.0	1.4e-30
WP_163653211.1|1448060_1448537_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	96.8	2.3e-85
WP_004238718.1|1448673_1449051_+	hypothetical protein	NA	A0A1W6JNV2	Morganella_phage	88.8	2.4e-53
WP_015422814.1|1449672_1449984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036422667.1|1450028_1450382_+	HNH endonuclease	NA	A0A1W6JP27	Morganella_phage	95.7	5.3e-63
WP_015422647.1|1450528_1450999_+|terminase	phage terminase small subunit P27 family	terminase	A0A1W6JP17	Morganella_phage	92.9	1.3e-80
WP_163653213.1|1451002_1452733_+|terminase	terminase large subunit	terminase	A0A1W6JP18	Morganella_phage	97.0	0.0e+00
WP_024473752.1|1452742_1452922_+	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	60.7	7.6e-10
WP_024473751.1|1452921_1454142_+|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	73.7	7.7e-178
WP_163654272.1|1454131_1454782_+|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	77.3	1.1e-95
WP_163653215.1|1454791_1456003_+|capsid	phage major capsid protein	capsid	A0A1B5FPI9	Escherichia_phage	63.2	1.3e-140
WP_163653217.1|1456070_1456376_+	hypothetical protein	NA	Q8HA83	Salmonella_phage	69.7	5.2e-35
WP_072870548.1|1456426_1456720_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B5FP86	Escherichia_phage	40.8	6.6e-11
WP_163653219.1|1456730_1457057_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	85.2	5.4e-46
WP_163653221.1|1457049_1457499_+	HK97 gp10 family phage protein	NA	A0A1W6JP15	Morganella_phage	97.3	2.2e-74
WP_163653223.1|1457495_1457831_+	hypothetical protein	NA	A0A1W6JP05	Morganella_phage	93.7	5.9e-56
WP_004238669.1|1457890_1458358_+	hypothetical protein	NA	A0A1W6JP06	Morganella_phage	100.0	1.0e-82
WP_163653225.1|1458361_1458745_+|tail	phage tail protein	tail	A0A1W6JP08	Morganella_phage	97.6	6.7e-64
WP_163653227.1|1458756_1459041_+	DUF4035 domain-containing protein	NA	A0A1W6JP68	Morganella_phage	97.9	5.2e-45
WP_163653230.1|1459065_1462323_+|tail	phage tail tape measure protein	tail	A0A1W6JP49	Morganella_phage	95.5	0.0e+00
WP_163653233.1|1462319_1462655_+|tail	phage tail protein	tail	A0A1W6JP11	Morganella_phage	98.2	4.2e-62
WP_163653236.1|1462651_1463410_+|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	96.8	4.8e-146
WP_163654275.1|1463412_1464120_+	peptidase P60	NA	A0A1W6JP31	Morganella_phage	94.8	2.1e-135
WP_163653239.1|1464109_1464514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163653242.1|1464592_1465195_+|tail	tail assembly protein	tail	A0A1W6JNY8	Morganella_phage	92.5	1.3e-101
WP_163653246.1|1465228_1468405_+	host specificity protein J	NA	A0A1W6JNZ7	Morganella_phage	94.7	0.0e+00
WP_163653249.1|1468406_1468727_+	hypothetical protein	NA	A0A1W6JNW9	Morganella_phage	98.1	5.8e-61
WP_036414557.1|1468723_1469410_+	hypothetical protein	NA	A0A1W6JNU1	Morganella_phage	100.0	2.4e-136
WP_163654278.1|1470764_1471334_+	hypothetical protein	NA	A0A1W6JNW0	Morganella_phage	91.6	4.5e-80
>prophage 6
NZ_CP048806	Morganella morganii strain MP63 chromosome, complete genome	4004672	1571304	1631899	4004672	capsid,holin,lysis,integrase,terminase,head	Morganella_phage(21.31%)	85	1574589:1574610	1632063:1632084
WP_004235063.1|1571304_1572012_-	helix-turn-helix domain-containing protein	NA	K7P8B2	Enterobacteria_phage	56.1	4.4e-69
WP_004235065.1|1572377_1572815_+	hypothetical protein	NA	A0A1W6JNY5	Morganella_phage	47.5	5.2e-28
WP_004235068.1|1572887_1573082_+	hypothetical protein	NA	A0A1W6JNY9	Morganella_phage	73.0	2.6e-24
WP_163653272.1|1573071_1573548_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	78.3	1.6e-67
WP_163623504.1|1573684_1574062_+	hypothetical protein	NA	A0A1W6JP00	Morganella_phage	38.4	2.6e-12
WP_036417780.1|1574033_1574231_+	hypothetical protein	NA	A0A1W6JP52	Morganella_phage	67.9	1.1e-12
1574589:1574610	attL	TTGGTGTCCCCTGCAGGAATCG	NA	NA	NA	NA
WP_163653274.1|1575129_1575348_+	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	58.0	3.2e-10
WP_163653276.1|1575347_1576190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163653278.1|1576219_1577239_+|capsid	P2 family phage major capsid protein	capsid	F1BUM2	Cronobacter_phage	45.4	1.6e-75
WP_163623501.1|1577235_1577757_+|capsid	capsid protein	capsid	A5X9H4	Aeromonas_virus	55.0	6.4e-33
WP_163653279.1|1577840_1578350_+	ash family protein	NA	A0A1W6JPK3	Morganella_phage	69.9	9.3e-53
WP_102831178.1|1578346_1578586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163653281.1|1578572_1581293_+	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	31.8	2.9e-60
WP_163653283.1|1581578_1581815_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	53.6	9.7e-13
WP_163653285.1|1582431_1582761_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_163653287.1|1582762_1583773_+	DUF4263 domain-containing protein	NA	NA	NA	NA	NA
WP_163653290.1|1583820_1584987_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.4	2.1e-145
WP_163653293.1|1585255_1585444_-	AlpA family transcriptional regulator	NA	E5AGD1	Erwinia_phage	58.6	4.5e-13
WP_163652940.1|1585654_1586194_-	phage N-6-adenine-methyltransferase	NA	A0A1W6JP96	Morganella_phage	64.7	3.2e-59
WP_163652942.1|1586183_1586483_-	DUF2591 domain-containing protein	NA	E9NID9	Enterobacter_phage	50.0	3.8e-06
WP_163652944.1|1586528_1586897_-	DUF2528 family protein	NA	NA	NA	NA	NA
WP_163653297.1|1587052_1587328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163653300.1|1587347_1587620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163653303.1|1588002_1588803_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	88.6	7.8e-131
WP_163653305.1|1588795_1589614_-	exodeoxyribonuclease VIII	NA	A0A1P8DTH1	Proteus_phage	79.0	6.1e-131
WP_163653308.1|1589591_1589822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163652961.1|1590227_1590491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_132274688.1|1590535_1590727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163652964.1|1590749_1591136_-	hypothetical protein	NA	A0A1W6JNZ6	Morganella_phage	51.9	3.9e-27
WP_163652967.1|1591416_1591593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163652970.1|1591584_1591743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163653310.1|1591808_1592024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163653312.1|1592431_1593322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163653314.1|1593314_1593884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052928006.1|1593936_1594644_-	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	42.5	8.1e-47
WP_052928005.1|1594747_1594975_+	helix-turn-helix domain-containing protein	NA	E5AGE7	Erwinia_phage	67.6	1.0e-19
WP_025154244.1|1595184_1595511_+	hypothetical protein	NA	A0A1W6JNY4	Morganella_phage	91.7	6.1e-50
WP_163653316.1|1595535_1596330_+	DNA-binding protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	71.1	1.7e-101
WP_101924258.1|1596875_1597277_+	replication protein	NA	A0A1I9LJP3	Stx_converting_phage	58.2	7.9e-39
WP_163653319.1|1597273_1597969_+	DNA replication protein	NA	A0A077KCC8	Edwardsiella_phage	49.6	2.0e-58
WP_163653320.1|1597993_1598203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096875365.1|1598395_1598638_+	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_163653322.1|1598637_1598811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163653325.1|1598807_1599002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163653328.1|1599005_1599263_+	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	38.0	8.9e-12
WP_115072129.1|1599271_1599715_+	hypothetical protein	NA	A0A1P8DTD8	Proteus_phage	84.9	1.6e-29
WP_163653331.1|1599711_1599921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163653334.1|1599892_1600324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163653337.1|1600419_1601019_+	recombination protein NinG	NA	A0A1P8DTE0	Proteus_phage	80.9	1.2e-75
WP_024473559.1|1601003_1601204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163653340.1|1601200_1602019_+	antitermination protein	NA	M9NZB0	Enterobacteria_phage	50.7	1.4e-71
WP_163653343.1|1602491_1602788_+	DUF4406 domain-containing protein	NA	A0A1I9KFD3	Aeromonas_phage	64.7	5.6e-26
WP_163653346.1|1602889_1603207_+|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	74.3	1.0e-41
WP_163653349.1|1603199_1603682_+	TIGR02594 family protein	NA	A0A1U9ZAE8	Proteus_phage	69.9	3.0e-61
WP_163653353.1|1603683_1604136_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	51.7	6.6e-34
WP_163653356.1|1604417_1604951_+	Rha family transcriptional regulator	NA	G8C7W4	Escherichia_phage	52.9	1.5e-48
WP_049245839.1|1605440_1605638_+	hypothetical protein	NA	A0A1W6JNV6	Morganella_phage	93.8	1.4e-28
WP_163653360.1|1606337_1607630_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.9	5.1e-148
WP_163654281.1|1607692_1609078_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	59.6	4.5e-150
WP_163653363.1|1609031_1610027_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	62.4	2.9e-106
WP_163653366.1|1610043_1611447_+	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	64.6	2.3e-157
WP_163653369.1|1611453_1611891_+	hypothetical protein	NA	F1C5E0	Cronobacter_phage	59.3	9.1e-41
WP_046024087.1|1611901_1612978_+	hypothetical protein	NA	F1C5E1	Cronobacter_phage	67.4	9.2e-135
WP_025154868.1|1613346_1613718_+	hypothetical protein	NA	A0A0M3LQS8	Mannheimia_phage	46.3	7.6e-20
WP_143971432.1|1613714_1614056_+	hypothetical protein	NA	R9TRK0	Aeromonas_phage	43.4	4.5e-19
WP_036423416.1|1614057_1614498_+	hypothetical protein	NA	H6WRT9	Salmonella_phage	50.3	4.6e-32
WP_163653372.1|1614494_1614863_+	hypothetical protein	NA	F1C5E4	Cronobacter_phage	33.6	6.8e-13
WP_098935814.1|1614927_1615683_+	DNA breaking-rejoining protein	NA	A0A1W6JNT1	Morganella_phage	96.4	3.3e-131
WP_163653375.1|1615733_1616426_+	hypothetical protein	NA	A0A1W6JNX2	Morganella_phage	96.9	3.1e-123
WP_087696794.1|1616470_1616791_-	Arc family DNA-binding protein	NA	H6WRU6	Salmonella_phage	56.8	2.2e-15
WP_087696795.1|1616913_1617084_+	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	50.0	2.2e-06
WP_087696796.1|1617154_1617721_+	hypothetical protein	NA	H6WRU8	Salmonella_phage	49.1	2.0e-35
WP_046024094.1|1617797_1618580_+	ORF6N domain-containing protein	NA	H6WRU9	Salmonella_phage	44.9	5.6e-49
WP_163653378.1|1618704_1619157_+	hypothetical protein	NA	Q5G8W9	Enterobacteria_phage	41.5	1.7e-05
WP_163653381.1|1619222_1622663_+	tape measure protein	NA	A0A1W6JNU2	Morganella_phage	56.8	1.0e-259
WP_163653383.1|1622841_1623342_-	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	41.3	1.3e-22
WP_163653386.1|1623433_1623910_+	hypothetical protein	NA	F1C5F0	Cronobacter_phage	64.0	1.8e-58
WP_163653389.1|1623909_1624380_+	DUF1833 domain-containing protein	NA	F1C5F1	Cronobacter_phage	50.0	7.5e-41
WP_163653403.1|1624376_1624769_+	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	58.7	3.7e-41
WP_163653406.1|1624755_1627227_+	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	51.7	1.5e-249
WP_163653409.1|1627288_1628560_+	glycerophosphodiester phosphodiesterase	NA	F1C5A8	Cronobacter_phage	60.9	8.3e-42
WP_163653412.1|1628553_1629312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163653415.1|1629332_1630298_-	acyltransferase family protein	NA	NA	NA	NA	NA
WP_015422866.1|1630498_1630723_-	DNA polymerase III theta subunit	NA	H9C187	Pectobacterium_phage	59.7	7.3e-18
WP_163653418.1|1630735_1631899_-|integrase	tyrosine-type recombinase/integrase	integrase	E5AGD0	Erwinia_phage	64.9	4.8e-145
1632063:1632084	attR	TTGGTGTCCCCTGCAGGAATCG	NA	NA	NA	NA
>prophage 7
NZ_CP048806	Morganella morganii strain MP63 chromosome, complete genome	4004672	2314075	2398678	4004672	capsid,protease,tail,portal,integrase,terminase,head	Morganella_phage(65.15%)	99	2354355:2354401	2398720:2398766
WP_124127576.1|2314075_2315284_-|integrase	site-specific integrase	integrase	T1S9J3	Salmonella_phage	53.9	1.4e-118
WP_004237402.1|2315592_2317170_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_004237403.1|2317229_2318696_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	6.8e-88
WP_036418335.1|2318868_2320245_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	37.5	2.9e-40
WP_119312824.1|2320292_2322326_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_015422667.1|2322478_2323027_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	36.8	1.5e-16
WP_004239615.1|2323045_2323852_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_004237409.1|2324043_2324502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004239617.1|2324630_2325296_+	response regulator	NA	W8CYM9	Bacillus_phage	31.8	4.4e-26
WP_080939474.1|2325347_2326715_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_004237412.1|2326750_2327323_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_004237413.1|2327365_2327692_-	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_004237414.1|2327691_2328354_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_015422664.1|2328460_2329018_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004237416.1|2329161_2329734_+	HdeD family acid-resistance protein	NA	NA	NA	NA	NA
WP_004237418.1|2329933_2331217_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_032098766.1|2331193_2331730_-	DUF924 domain-containing protein	NA	E3T4R4	Cafeteria_roenbergensis_virus	30.6	4.0e-14
WP_036418352.1|2331858_2332752_+	drug/metabolite DMT transporter permease	NA	NA	NA	NA	NA
WP_049246141.1|2332833_2333958_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_004237422.1|2334234_2334513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049246140.1|2334725_2335625_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036418357.1|2335852_2336080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004237426.1|2336191_2336410_+	osmotically-inducible lipoprotein OsmB	NA	NA	NA	NA	NA
WP_101495309.1|2336439_2337036_-	DUF1287 domain-containing protein	NA	NA	NA	NA	NA
WP_163653639.1|2337051_2337555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004237430.1|2337761_2338031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004237433.1|2338501_2339128_-|tail	tail assembly chaperone	tail	A0A218M4J2	Erwinia_phage	33.0	5.4e-26
WP_036425853.1|2340481_2341144_-	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	38.3	7.1e-37
WP_163653641.1|2341140_2342328_-	hypothetical protein	NA	A0A2H5BG53	Pseudoalteromonas_phage	39.4	1.4e-75
WP_046892360.1|2342320_2342665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004239639.1|2342661_2343354_-	phage-related protein	NA	Q6IWQ1	Burkholderia_phage	40.1	1.8e-35
WP_004237444.1|2343370_2344186_-	hypothetical protein	NA	B5M9T8	Pseudomonas_phage	27.5	2.9e-16
WP_036418366.1|2344178_2344472_-	hypothetical protein	NA	Q6IWP9	Burkholderia_phage	32.3	1.2e-07
WP_036418368.1|2344468_2345008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163653645.1|2345004_2346975_-	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	23.1	2.9e-17
WP_062771783.1|2347057_2347516_-	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	49.3	6.0e-27
WP_062771786.1|2347558_2348011_-	hypothetical protein	NA	I7ATP4	Escherichia_phage	38.5	2.9e-21
WP_163653648.1|2348026_2349514_-	DUF3383 domain-containing protein	NA	A0A088C3U1	Shewanella_sp._phage	37.1	1.6e-81
WP_004237451.1|2349523_2350039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036418372.1|2350189_2350753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036415836.1|2350901_2351336_-	antitermination protein Q	NA	B6SCU4	Bacteriophage	47.8	5.4e-25
WP_081120342.1|2351544_2352231_-	DUF4431 domain-containing protein	NA	NA	NA	NA	NA
WP_163653651.1|2352500_2353577_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_004237458.1|2353674_2354334_-	hypothetical protein	NA	NA	NA	NA	NA
2354355:2354401	attL	TGCCGGCTACCGGAGTCGAACTGGTGACCTACTGATTACAAGTCAGT	NA	NA	NA	NA
WP_096875109.1|2354600_2355863_-	translesion error-prone DNA polymerase V subunit UmuC	NA	A0A1W6JNT0	Morganella_phage	97.4	1.9e-235
WP_015422655.1|2355862_2356279_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	94.2	4.1e-67
WP_015422654.1|2356724_2356982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015422653.1|2356991_2358629_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_163653654.1|2359097_2363186_-	DUF1983 domain-containing protein	NA	A0A1W6JNZ7	Morganella_phage	67.6	0.0e+00
WP_096875111.1|2363219_2363822_-|tail	tail assembly protein	tail	A0A1W6JNY8	Morganella_phage	90.5	1.5e-97
WP_126117449.1|2363854_2364556_-	peptidase P60	NA	A0A1W6JP31	Morganella_phage	94.8	9.3e-136
WP_096875113.1|2364558_2365317_-|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	95.6	7.7e-144
WP_004238700.1|2365313_2365649_-|tail	phage tail protein	tail	A0A1W6JP11	Morganella_phage	95.5	6.7e-60
WP_096875114.1|2365645_2368906_-|tail	phage tail tape measure protein	tail	A0A1W6JP49	Morganella_phage	94.3	0.0e+00
WP_046025031.1|2368931_2369216_-	DUF4035 domain-containing protein	NA	A0A1W6JP68	Morganella_phage	86.0	1.5e-36
WP_096875115.1|2369227_2369611_-|tail	phage tail protein	tail	A0A1W6JP08	Morganella_phage	93.7	1.6e-60
WP_087826249.1|2369614_2370082_-|tail	phage tail protein	tail	A0A1W6JP06	Morganella_phage	92.3	6.5e-77
WP_096875116.1|2370141_2370477_-	hypothetical protein	NA	A0A1W6JP05	Morganella_phage	92.8	2.0e-56
WP_004238667.1|2370473_2370923_-	HK97 gp10 family phage protein	NA	A0A1W6JP15	Morganella_phage	97.3	8.4e-74
WP_096875117.1|2370915_2371242_-|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	82.4	1.0e-44
WP_046025035.1|2371252_2371546_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B5FP86	Escherichia_phage	39.8	6.2e-09
WP_096875118.1|2371587_2372799_-|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	62.8	2.0e-141
WP_048884178.1|2372808_2373465_-|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	76.9	1.7e-94
WP_096875119.1|2373448_2374669_-|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	73.5	5.0e-177
WP_004238661.1|2374668_2374848_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	62.5	4.4e-10
WP_126117390.1|2374857_2376588_-|terminase	terminase large subunit	terminase	A0A1W6JP18	Morganella_phage	93.3	0.0e+00
WP_015422647.1|2376591_2377062_-|terminase	phage terminase small subunit P27 family	terminase	A0A1W6JP17	Morganella_phage	92.9	1.3e-80
WP_071823269.1|2377208_2377562_-	HNH endonuclease	NA	A0A1W6JP27	Morganella_phage	94.0	8.4e-61
WP_096875121.1|2377670_2378186_-	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	98.8	1.4e-96
WP_004238716.1|2378805_2379183_-	hypothetical protein	NA	A0A1W6JP00	Morganella_phage	96.8	1.7e-59
WP_015422645.1|2379179_2379320_-	hypothetical protein	NA	A0A1W6JP30	Morganella_phage	91.3	5.0e-17
WP_096875122.1|2379319_2379769_-	lysozyme	NA	A0A1W6JNW4	Morganella_phage	94.6	1.8e-79
WP_004238694.1|2379788_2379980_-	hypothetical protein	NA	A0A1W6JNY9	Morganella_phage	100.0	1.4e-30
WP_015422643.1|2380651_2380861_-	hypothetical protein	NA	A0A1W6JNU4	Morganella_phage	67.2	8.5e-21
WP_004242347.1|2381630_2382089_-	Hsp20 family protein	NA	NA	NA	NA	NA
WP_015422642.1|2382395_2382836_+	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	54.0	5.2e-28
WP_079549287.1|2383164_2383926_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_096875123.1|2383997_2384927_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	99.2	2.8e-148
WP_046024440.1|2385152_2385365_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	98.6	5.8e-33
WP_046024441.1|2385739_2386177_-	antitermination protein	NA	A0A1W6JNX1	Morganella_phage	97.9	1.9e-78
WP_096875124.1|2386466_2387105_-	NinG family protein	NA	A0A1W6JNX3	Morganella_phage	99.5	3.5e-105
WP_036414499.1|2387381_2387810_+	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	100.0	9.8e-72
WP_096875125.1|2388450_2388894_-	protein ninB	NA	A0A1W6JNZ4	Morganella_phage	99.3	7.0e-81
WP_052927416.1|2389142_2389871_-	ATP-binding protein	NA	A0A1W6JP39	Morganella_phage	99.6	1.0e-132
WP_096875134.1|2389870_2390662_-	replication protein	NA	A0A1W6JNY0	Morganella_phage	99.2	1.4e-132
WP_036414494.1|2390803_2391130_-	hypothetical protein	NA	A0A1W6JNY4	Morganella_phage	100.0	1.8e-54
WP_036414492.1|2391260_2391470_-	helix-turn-helix transcriptional regulator	NA	A0A1W6JNW6	Morganella_phage	97.8	4.8e-16
WP_036414490.1|2391569_2392217_+	helix-turn-helix transcriptional regulator	NA	A0A1W6JNY2	Morganella_phage	100.0	4.0e-117
WP_036414488.1|2392255_2392597_+	DUF3024 domain-containing protein	NA	A0A1W6JP12	Morganella_phage	100.0	1.6e-61
WP_036414486.1|2392748_2392946_-	DUF2767 family protein	NA	A0A1W6JNW1	Morganella_phage	100.0	8.0e-29
WP_036415812.1|2393342_2393651_+	hypothetical protein	NA	A0A1W6JNZ0	Morganella_phage	100.0	1.3e-49
WP_004240099.1|2393679_2393889_-	hypothetical protein	NA	A0A1W6JP23	Morganella_phage	100.0	5.9e-30
WP_125460924.1|2394243_2394507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155735002.1|2394647_2394806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004240098.1|2395279_2395456_+	hypothetical protein	NA	A0A1W6JNY7	Morganella_phage	100.0	6.3e-25
WP_015422640.1|2395613_2395976_+	hypothetical protein	NA	A0A1W6JNZ2	Morganella_phage	85.8	6.4e-56
WP_096875126.1|2395978_2396593_+	single-stranded DNA-binding protein	NA	A0A1W6JP21	Morganella_phage	98.5	5.0e-109
WP_015422639.1|2396593_2396989_+	single-stranded DNA-binding protein	NA	A0A1W6JNW8	Morganella_phage	97.7	1.0e-70
WP_015422638.1|2397526_2398678_+|integrase	site-specific integrase	integrase	A0A2H5BFK7	Salmonella_phage	69.8	6.6e-155
2398720:2398766	attR	TGCCGGCTACCGGAGTCGAACTGGTGACCTACTGATTACAAGTCAGT	NA	NA	NA	NA
>prophage 8
NZ_CP048806	Morganella morganii strain MP63 chromosome, complete genome	4004672	2768166	2778009	4004672	protease,tRNA	Bacillus_phage(16.67%)	8	NA	NA
WP_015422571.1|2768166_2769936_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.6	2.2e-24
WP_163653769.1|2769938_2771705_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	F2Y2R6	Organic_Lake_phycodnavirus	27.9	5.8e-17
WP_049246903.1|2771682_2772402_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_002211347.1|2772552_2772771_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_163653772.1|2772847_2775133_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.5	3.7e-173
WP_015422570.1|2775166_2775487_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	46.7	2.6e-16
WP_004235798.1|2775745_2775976_+	cold shock domain-containing protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	56.7	2.6e-15
WP_046024240.1|2776062_2778009_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.3	1.5e-37
>prophage 9
NZ_CP048806	Morganella morganii strain MP63 chromosome, complete genome	4004672	2961600	2969655	4004672	tRNA	Mycobacterium_phage(33.33%)	8	NA	NA
WP_004235583.1|2961600_2961810_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	4.5e-22
WP_064483339.1|2962009_2962477_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_064483340.1|2962658_2963741_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_024474189.1|2964049_2964268_+	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	51.4	2.3e-16
WP_036424930.1|2964289_2964706_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	40.4	8.5e-12
WP_004235574.1|2964736_2966857_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	52.6	3.6e-207
WP_036417132.1|2966881_2967844_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	73.4	2.8e-135
WP_004235572.1|2968449_2969655_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.5	5.5e-27
>prophage 10
NZ_CP048806	Morganella morganii strain MP63 chromosome, complete genome	4004672	3716325	3731339	4004672		Moraxella_phage(11.11%)	12	NA	NA
WP_004238244.1|3716325_3717672_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	69.6	5.5e-153
WP_049246653.1|3717717_3718728_+	M15 family metallopeptidase	NA	L7TND1	Rhizobium_phage	35.6	6.4e-05
WP_163654089.1|3718734_3719484_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_004238248.1|3719654_3720212_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	31.7	1.2e-05
WP_004238249.1|3720254_3720539_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_036418934.1|3720556_3722248_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	31.0	1.8e-63
WP_004238253.1|3723439_3723961_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	86.0	2.2e-49
WP_032099137.1|3724237_3727072_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.6	0.0e+00
WP_036413658.1|3727203_3727470_+	DksA/TraR family C4-type zinc finger protein	NA	A0A2C9CZU7	Yersinia_phage	54.5	2.1e-16
WP_064483640.1|3727521_3728718_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_046024963.1|3728773_3729853_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.0	2.0e-28
WP_015422419.1|3729932_3731339_-	replicative DNA helicase	NA	O80281	Escherichia_phage	75.0	3.3e-193
