The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP022578	Mycolicibacterium aubagnense strain JCM 15296 plasmid pJCM15296, complete sequence	266447	53486	106732	266447	integrase,transposase	uncultured_virus(40.0%)	52	94446:94466	120560:120580
WP_138230748.1|53486_54768_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	49.0	4.6e-56
WP_163912231.1|55688_56177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138230762.1|56302_57403_+	PLP-dependent cysteine synthase family protein	NA	NA	NA	NA	NA
WP_101930914.1|57399_58650_+	MFS transporter	NA	NA	NA	NA	NA
WP_082761872.1|58686_59562_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_061004511.1|59706_59964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061004513.1|60249_60894_-	YHS domain-containing protein	NA	NA	NA	NA	NA
WP_061009838.1|60890_61481_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_138230750.1|61516_62962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082761870.1|63132_63897_+	NlpC/P60 family peptidoglycan endopeptidase RipB	NA	A0A1J0GW44	Streptomyces_phage	44.1	3.3e-17
WP_138230751.1|63950_64895_-	M56 family metallopeptidase	NA	NA	NA	NA	NA
WP_061006727.1|64891_65281_-	BlaI/MecI/CopY family transcriptional regulator	NA	NA	NA	NA	NA
WP_061006718.1|65461_66199_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_061006719.1|66273_66750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061009841.1|66785_68042_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_082761869.1|68453_70025_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	29.0	2.9e-20
WP_061006720.1|70332_70959_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_061006721.1|71186_71780_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_170212399.1|71897_72071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162563658.1|72088_72256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082761868.1|72306_74775_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	31.8	5.5e-74
WP_138230752.1|74829_75891_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_061006725.1|75939_76161_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_138230753.1|76157_76865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138230754.1|76878_77181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061009829.1|77207_77927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061005458.1|77966_78506_-	cation transporter	NA	NA	NA	NA	NA
WP_061005451.1|78673_79027_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_138230755.1|79082_79616_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_053855802.1|79693_81031_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	36.7	8.2e-32
WP_061005448.1|81320_81854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061005446.1|82016_82958_-	M56 family metallopeptidase	NA	NA	NA	NA	NA
WP_061005443.1|82954_83338_-	BlaI/MecI/CopY family transcriptional regulator	NA	NA	NA	NA	NA
WP_163912234.1|83602_83935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138230756.1|84025_84253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138230757.1|84583_90406_-	relaxase domain-containing protein	NA	NA	NA	NA	NA
WP_138230758.1|90714_91227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138230759.1|91494_91992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138230764.1|92051_92591_-	phosphoadenosine phosphosulfate reductase family protein	NA	NA	NA	NA	NA
WP_138230760.1|92785_93790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138230761.1|93925_94237_+	hypothetical protein	NA	NA	NA	NA	NA
94446:94466	attL	TTCTCATTGAATCTGGGGCAC	NA	NA	NA	NA
WP_011894084.1|94484_95225_+|transposase	TnsA-like heteromeric transposase endonuclease subunit	transposase	NA	NA	NA	NA
WP_005148662.1|95348_97313_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_005148661.1|97300_98329_+	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_005148660.1|98330_99173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024444598.1|99309_100158_-	mercury transporter	NA	NA	NA	NA	NA
WP_138232149.1|100846_101245_-	DUF302 domain-containing protein	NA	NA	NA	NA	NA
WP_138232148.1|101748_102474_-	sulfocyanin	NA	NA	NA	NA	NA
WP_138232345.1|102479_102740_-	SHOCT domain-containing protein	NA	NA	NA	NA	NA
WP_138232344.1|102909_103275_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_138232146.1|104093_104519_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_163912237.1|104515_106732_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
120560:120580	attR	GTGCCCCAGATTCAATGAGAA	NA	NA	NA	NA
