The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP022573	Mycobacterium saskatchewanense strain JCM 13016	6008916	4112441	4177237	6008916	transposase,integrase,protease	Mycobacterium_phage(40.0%)	56	4144537:4144582	4149721:4149766
WP_085254617.1|4112441_4113842_+|protease	type VII secretion-associated serine protease mycosin	protease	V5UPA7	Mycobacterium_phage	40.6	5.1e-69
WP_085254616.1|4113838_4114819_+	type VII secretion protein EccE	NA	NA	NA	NA	NA
WP_085254680.1|4114815_4116024_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_085254615.1|4116160_4116946_+	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
WP_085254614.1|4116959_4118360_-	sulfatase	NA	NA	NA	NA	NA
WP_085254613.1|4118359_4119007_-	5,6-dimethylbenzimidazole synthase	NA	NA	NA	NA	NA
WP_085254612.1|4119074_4119359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085254611.1|4119342_4119825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085254610.1|4119883_4120549_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_085254609.1|4120575_4121232_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_085254608.1|4121243_4121744_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_085254607.1|4121730_4122366_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_085254606.1|4122404_4123631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163645143.1|4123796_4125707_+	Hsp70 family protein	NA	NA	NA	NA	NA
WP_163645144.1|4125799_4127143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085256142.1|4127208_4127610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085256141.1|4127610_4128207_-	DUF3060 domain-containing protein	NA	NA	NA	NA	NA
WP_085256140.1|4128216_4129314_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_085256139.1|4129428_4130025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085256138.1|4130265_4131102_+	glycoside hydrolase family 16 protein	NA	NA	NA	NA	NA
WP_085256146.1|4131105_4132611_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_085256137.1|4132661_4132967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163645145.1|4132992_4133661_+	GAP family protein	NA	NA	NA	NA	NA
WP_085256136.1|4133689_4134373_+	GAP family protein	NA	NA	NA	NA	NA
WP_085256135.1|4134363_4135092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085256134.1|4135117_4136608_+	bifunctional phosphatase PAP2/diacylglycerol kinase family protein	NA	NA	NA	NA	NA
WP_085256133.1|4136617_4136959_-	DUF732 domain-containing protein	NA	NA	NA	NA	NA
WP_085256132.1|4137155_4139006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085256144.1|4139114_4139561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085256131.1|4139488_4140118_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_142280635.1|4140218_4140905_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_085256129.1|4141002_4141551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085256128.1|4141547_4144478_+	MMPL family transporter	NA	NA	NA	NA	NA
4144537:4144582	attL	TGGAGCCGATGACGGGAATCGAACCCGCGTATTCAGCTTGGGAAGC	NA	NA	NA	NA
WP_142280636.1|4144864_4145635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142280634.1|4145779_4146022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085256125.1|4146741_4147071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085256124.1|4147072_4148461_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0E3XBN7	Gordonia_phage	27.2	8.5e-16
WP_085256123.1|4148457_4149612_-	nucleotide-binding protein	NA	NA	NA	NA	NA
WP_169717527.1|4150038_4150701_+	hypothetical protein	NA	A0A2D1GPL9	Mycobacterium_phage	44.9	2.0e-23
4149721:4149766	attR	TGGAGCCGATGACGGGAATCGAACCCGCGTATTCAGCTTGGGAAGC	NA	NA	NA	NA
WP_085256122.1|4150737_4151310_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	75.8	4.5e-80
WP_085256121.1|4151416_4153336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163645146.1|4153532_4154999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163645221.1|4154995_4156120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085258024.1|4157840_4159166_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	36.0	7.5e-70
WP_042909771.1|4162351_4162777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163645147.1|4163105_4163918_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_042792003.1|4167539_4168553_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_042792002.1|4168679_4169000_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_051472937.1|4169071_4170412_+	cytochrome P450	NA	NA	NA	NA	NA
WP_042792000.1|4170408_4171611_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_134770488.1|4171827_4172520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042791998.1|4172516_4173017_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_085240917.1|4173819_4173933_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_142278381.1|4173989_4174439_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_142278382.1|4174416_4174863_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_082278410.1|4176037_4177237_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_AP022573	Mycobacterium saskatchewanense strain JCM 13016	6008916	5536805	5543476	6008916		Bacillus_phage(33.33%)	7	NA	NA
WP_085255006.1|5536805_5537738_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	29.1	4.9e-07
WP_085255005.1|5537672_5538707_-	DNA polymerase IV	NA	F1C5A5	Cronobacter_phage	28.0	2.6e-17
WP_085255004.1|5538706_5539315_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_163645174.1|5539405_5539978_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	30.3	2.8e-05
WP_085255002.1|5540535_5540775_+	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	65.3	2.0e-21
WP_085255001.1|5540882_5541341_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A217ER62	Bacillus_phage	31.1	3.3e-09
WP_085255000.1|5541310_5543476_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.5	8.2e-207
