The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP022560	Mycolicibacterium moriokaense strain JCM 6375	6225779	1849891	1862455	6225779	integrase,transposase	Mycobacterium_phage(81.82%)	17	1842046:1842060	1871156:1871170
1842046:1842060	attL	TGCCCAGTTCGTCGA	NA	NA	NA	NA
WP_110810564.1|1849891_1850920_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	53.3	4.8e-72
WP_083157464.1|1850976_1851783_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2K9VF00	Mycobacterium_phage	45.4	7.3e-60
WP_163658054.1|1851791_1851962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083157423.1|1852513_1852729_+	hypothetical protein	NA	G3MCP2	Mycobacterium_phage	59.2	2.0e-17
WP_083157422.1|1852719_1853100_+	hypothetical protein	NA	A0A142K826	Mycobacterium_phage	35.5	1.0e-11
WP_083157420.1|1853749_1854502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110810599.1|1854550_1855835_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	51.3	1.4e-60
WP_083157813.1|1856099_1856369_+	hypothetical protein	NA	G8I4Q1	Mycobacterium_phage	42.5	5.1e-10
WP_133056605.1|1856402_1857170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_133056606.1|1857213_1857654_-	hypothetical protein	NA	A0A0B5A609	Mycobacterium_phage	29.1	8.1e-05
WP_083157802.1|1857845_1858640_-	hypothetical protein	NA	G8I4L7	Mycobacterium_phage	55.2	9.9e-09
WP_083157803.1|1858827_1859625_-	hypothetical protein	NA	G8I4L8	Mycobacterium_phage	53.3	2.2e-64
WP_083157804.1|1859818_1860637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083157805.1|1860633_1860864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083157806.1|1861251_1861608_-	hypothetical protein	NA	G8I4U1	Mycobacterium_phage	54.3	8.3e-24
WP_133056607.1|1861663_1862059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083157808.1|1862179_1862455_-	hypothetical protein	NA	A0A159B6D7	Gordonia_phage	43.2	9.6e-12
1871156:1871170	attR	TCGACGAACTGGGCA	NA	NA	NA	NA
>prophage 2
NZ_AP022560	Mycolicibacterium moriokaense strain JCM 6375	6225779	2537243	2581279	6225779	protease,integrase,transposase	Tupanvirus(20.0%)	34	2537076:2537098	2539743:2539765
2537076:2537098	attL	GATGTCTCAAGACATCGGAATAG	NA	NA	NA	NA
WP_163658080.1|2537243_2538590_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	25.8	1.4e-31
WP_163658290.1|2538592_2539729_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_110810321.1|2540048_2540486_+	hypothetical protein	NA	NA	NA	NA	NA
2539743:2539765	attR	CTATTCCGATGTCTTGAGACATC	NA	NA	NA	NA
WP_083150231.1|2540564_2542049_+	wax ester/triacylglycerol synthase family O-acyltransferase	NA	NA	NA	NA	NA
WP_083150230.1|2542045_2543737_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_083150229.1|2543733_2546079_+	glycerol-3-phosphate 1-O-acyltransferase	NA	NA	NA	NA	NA
WP_083150228.1|2546215_2548216_+	bifunctional copper resistance protein CopD/cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_083150257.1|2548788_2549268_+	single-stranded DNA-binding protein	NA	A0A1D8EU69	Propionibacterium_phage	37.8	2.3e-13
WP_083150227.1|2549417_2551091_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	27.9	5.1e-47
WP_083150226.1|2551183_2556052_+	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_083150225.1|2556054_2556468_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_083150224.1|2556464_2557124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083150256.1|2557120_2558686_-	glycoside hydrolase family 13 protein	NA	NA	NA	NA	NA
WP_083150223.1|2558718_2559114_-	globin	NA	NA	NA	NA	NA
WP_083150222.1|2559253_2559922_+	HNH endonuclease	NA	H6WG01	Cyanophage	35.6	1.8e-19
WP_083150221.1|2559945_2560191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083150220.1|2560177_2560660_+	DUF5130 domain-containing protein	NA	NA	NA	NA	NA
WP_083150219.1|2560656_2561019_-	HNH endonuclease	NA	A0A0K0N676	Gordonia_phage	41.1	2.6e-09
WP_083150218.1|2561064_2563650_-	aminopeptidase N	NA	A0A2K9L1R3	Tupanvirus	32.5	1.1e-43
WP_165761852.1|2563699_2564083_-	DUF732 domain-containing protein	NA	NA	NA	NA	NA
WP_083150217.1|2564255_2564879_+	DsbA family protein	NA	NA	NA	NA	NA
WP_110810320.1|2564921_2565410_+	ribose-5-phosphate isomerase	NA	NA	NA	NA	NA
WP_083150216.1|2565412_2566207_+	Fpg/Nei family DNA glycosylase	NA	A0A1V0CNR6	Kaumoebavirus	24.0	6.2e-11
WP_083150215.1|2566284_2567046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163658082.1|2567109_2568222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083150213.1|2568709_2570110_+	trigger factor	NA	NA	NA	NA	NA
WP_083150212.1|2570217_2570820_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	48.0	3.3e-41
WP_083150211.1|2570816_2571476_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A2H4JEX1	uncultured_Caudovirales_phage	32.7	9.0e-08
WP_083150210.1|2571911_2572811_-	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_083150209.1|2573065_2574346_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.5	3.2e-142
WP_083150208.1|2574550_2575855_-	glycosyl transferase	NA	NA	NA	NA	NA
WP_083150207.1|2575931_2576762_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_083150206.1|2576761_2579119_-	FdhF/YdeP family oxidoreductase	NA	NA	NA	NA	NA
WP_163658084.1|2580934_2581279_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_AP022560	Mycolicibacterium moriokaense strain JCM 6375	6225779	2833172	2842943	6225779	tail,portal,capsid,head,protease	Mycobacterium_phage(33.33%)	9	NA	NA
WP_163658090.1|2833172_2833700_-	glycosyltransferase	NA	A0A218M8W4	Mycobacterium_phage	53.7	6.0e-47
WP_133056570.1|2833723_2834290_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_083155542.1|2834325_2835507_-|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	32.3	3.7e-36
WP_083155544.1|2835503_2836076_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	35.1	5.6e-14
WP_083155548.1|2836068_2837247_-|portal	phage portal protein	portal	Q6JIM9	Burkholderia_virus	32.7	1.2e-47
WP_133056571.1|2837258_2838578_-	hypothetical protein	NA	K7PKT2	Enterobacteria_phage	24.3	2.9e-13
WP_083155554.1|2838733_2839087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163658092.1|2839362_2839455_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_083155562.1|2839649_2842943_-	hypothetical protein	NA	M4WNS7	Mycobacterium_phage	29.8	7.8e-76
