The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP022362	Escherichia coli strain E302	5237933	2456	40277	5237933	protease,capsid,holin,tail,plate	Escherichia_phage(50.0%)	38	NA	NA
WP_064186423.1|2456_3530_+|capsid	phage major capsid protein, P2 family	capsid	Q94MK7	Enterobacteria_phage	98.9	2.2e-200
WP_000846399.1|4865_5069_+|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000123123.1|5072_5354_+|holin	phage holin family protein	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_163409456.1|5353_5851_+	glycoside hydrolase family protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	4.0e-93
WP_163409458.1|5865_6291_+	protein lysA	NA	A0A0F7LBP4	Escherichia_phage	94.3	7.2e-59
WP_001406878.1|6804_7272_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	99.4	6.7e-82
WP_001001780.1|7264_7717_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	100.0	6.3e-77
WP_053880123.1|7783_8419_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.6	1.5e-113
WP_000127163.1|8415_8763_+	GPW/gp25 family protein	NA	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_033550114.1|8767_9676_+|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.7	4.4e-162
WP_001461858.1|12505_13033_+|tail	tail fiber assembly protein	tail	Q7Y4D3	Escherichia_virus	95.4	2.3e-91
WP_061091942.1|13423_13951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001251408.1|18032_18551_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|18608_18884_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|18916_19036_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_061091943.1|19028_21476_+|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	99.0	0.0e+00
WP_061091944.1|21490_21970_+|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	98.7	3.3e-84
WP_047644366.1|21969_23133_+	phage late control D family protein	NA	A0A0F7LDZ2	Escherichia_phage	99.5	1.1e-205
WP_000468308.1|23214_23433_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001145759.1|23702_24215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001076748.1|24422_25325_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
WP_000591795.1|25505_26468_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_000758732.1|26787_27777_+	sulfate/thiosulfate ABC transporter substrate-binding protein Sbp	NA	NA	NA	NA	NA
WP_001296622.1|27883_28639_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001216325.1|28693_29461_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000802235.1|29568_30168_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_000155252.1|30268_30709_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000655986.1|30920_31220_+	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000323555.1|31246_31675_+	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000796342.1|31679_32426_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_001250644.1|32522_33533_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000136804.1|33703_35212_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_000084268.1|35234_36080_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|36504_36750_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|36834_37320_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001305044.1|37412_38339_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293344.1|38405_39737_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000208242.1|39746_40277_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
>prophage 2
NZ_AP022362	Escherichia coli strain E302	5237933	195549	214245	5237933	transposase,protease,integrase	Escherichia_phage(57.14%)	17	206085:206144	220031:220153
WP_000616807.1|195549_196203_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001067855.1|198249_198954_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000978817.1|199324_199786_+	thermonuclease family protein	NA	A0A1W6JP77	Staphylococcus_phage	36.4	4.1e-07
WP_001067855.1|201215_201920_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000219391.1|202041_202947_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000004159.1|202943_204182_+	MFS transporter	NA	NA	NA	NA	NA
WP_001137892.1|204181_204766_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|205258_206023_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
206085:206144	attL	CACACGAGTATTGAGCATAGTCGAGATTGGTGCAGATCACTTCTGATATTGAACTGTCAG	NA	NA	NA	NA
WP_000130000.1|206249_206555_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000184001.1|206565_207771_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000376616.1|207926_208130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|208257_209097_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|209090_209438_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000503573.1|209643_210432_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_001389366.1|210562_211036_-	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IBQ4	Erwinia_phage	33.1	7.6e-17
WP_001067855.1|212045_212750_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000845048.1|213231_214245_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
220031:220153	attR	CACACGAGTATTGAGCATAGTCGAGATTGGTGCAGATCACTTCTGATATTGAACTGTCAGGAGCTGGCTGCACAACAGCCATTACGCCCAATCAACTGGTGCAGTCGTCTTCTGAAAATGACA	NA	NA	NA	NA
>prophage 3
NZ_AP022362	Escherichia coli strain E302	5237933	1737647	1805077	5237933	tRNA,protease,capsid,holin,tail,portal,integrase,plate,terminase,head	Enterobacteria_phage(64.06%)	79	1747155:1747170	1805824:1805839
WP_000520781.1|1737647_1737968_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|1737998_1740275_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001040187.1|1740959_1741178_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241674.1|1741462_1742167_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202204.1|1742208_1743930_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	30.8	1.2e-14
WP_001043561.1|1743930_1745697_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_001385255.1|1745819_1746785_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.9e-62
1747155:1747170	attL	ACGCCATTCGTGATGT	NA	NA	NA	NA
WP_000228473.1|1747328_1747823_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000077041.1|1747957_1752064_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|1752222_1752834_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067797.1|1752844_1754188_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_000886683.1|1754278_1755571_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000078916.1|1755876_1756017_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_000488106.1|1756208_1756469_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000132830.1|1756509_1757619_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.9	1.3e-195
WP_000005447.1|1757776_1758961_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	97.5	8.4e-222
WP_000290462.1|1758960_1759473_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
WP_000651577.1|1759528_1759903_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	71.5	9.9e-36
WP_000333503.1|1759911_1760067_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000853410.1|1760053_1762861_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	90.1	0.0e+00
WP_000979945.1|1762873_1763362_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_000905061.1|1763390_1763990_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	98.9	3.8e-98
WP_032142265.1|1764208_1764766_+	hypothetical protein	NA	A0A0A7NPY7	Enterobacteria_phage	88.5	5.0e-84
WP_000972134.1|1764768_1765302_+|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	98.9	4.2e-96
WP_001554335.1|1765330_1765858_-|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	93.7	2.6e-90
WP_032140708.1|1765859_1768082_-|tail	tail fiber protein	tail	A0A0A7NV63	Enterobacteria_phage	65.0	3.8e-183
WP_000071703.1|1768084_1768615_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.2	3.6e-92
WP_001111954.1|1768607_1769504_-|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	3.3e-154
WP_001067543.1|1769507_1769837_-	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	99.1	8.4e-55
WP_001295912.1|1769854_1770421_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	98.4	6.6e-100
WP_000356366.1|1770432_1771068_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	4.1e-114
WP_000921127.1|1771060_1771528_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	95.5	3.5e-83
WP_000202148.1|1771551_1773429_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	80.2	2.7e-299
WP_000780577.1|1773567_1773963_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	93.3	1.0e-59
WP_000072341.1|1773959_1774352_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	96.9	1.9e-69
WP_001342221.1|1774348_1774672_-|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	93.5	1.7e-47
WP_000864901.1|1774674_1774875_-|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000063100.1|1774874_1775369_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	97.0	1.9e-87
WP_000632309.1|1775470_1776271_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	89.1	6.9e-127
WP_001055083.1|1776316_1777369_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.3	1.4e-188
WP_001262655.1|1777392_1778229_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.6	2.7e-150
WP_000613780.1|1778383_1780135_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	97.8	0.0e+00
WP_000087814.1|1780134_1781181_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	2.2e-202
WP_000236495.1|1781195_1781720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001068329.1|1782443_1782941_+	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
WP_000193205.1|1782980_1783823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000211282.1|1783906_1784221_-	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.3	4.1e-19
WP_000686485.1|1784225_1785185_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	4.2e-179
WP_000123489.1|1785261_1788084_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	98.4	0.0e+00
WP_000599382.1|1788090_1788456_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	97.5	1.7e-61
WP_023142408.1|1788452_1789070_-	ash family protein	NA	S5MQL6	Escherichia_phage	42.0	1.5e-09
WP_000104290.1|1789081_1789381_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	2.4e-40
WP_000153700.1|1789377_1789644_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	2.0e-30
WP_000985157.1|1789640_1789844_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000543036.1|1789867_1790278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021715.1|1790371_1790485_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	89.2	1.8e-09
WP_000514277.1|1790481_1790724_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000159455.1|1790735_1791014_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	79.3	3.1e-34
WP_000776267.1|1791024_1791375_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	93.1	8.1e-56
WP_001287828.1|1791512_1791704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000856387.1|1791710_1792133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204236.1|1792137_1792659_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001368591.1|1792763_1793105_+	helix-turn-helix transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	51.2	4.7e-16
WP_000023739.1|1793174_1794167_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	56.2	1.3e-103
WP_000850306.1|1794466_1796911_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
WP_000213098.1|1796921_1797539_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000534666.1|1797540_1798404_+	dimethyl sulfoxide reductase anchor subunit DmsC	NA	NA	NA	NA	NA
WP_000165876.1|1798439_1799066_-	hydrolase	NA	NA	NA	NA	NA
WP_000109283.1|1799379_1800528_+	MFS transporter	NA	NA	NA	NA	NA
WP_000067979.1|1800624_1801422_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.3e-21
WP_000023390.1|1801453_1802449_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	100.0	5.4e-190
WP_001389238.1|1802548_1802848_-	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	100.0	3.0e-51
WP_001389237.1|1802956_1803313_+	hypothetical protein	NA	Q1JS28	Enterobacteria_phage	99.2	1.5e-62
WP_162852172.1|1803323_1803494_+	hypothetical protein	NA	S4TNZ7	Salmonella_phage	98.2	3.9e-24
WP_000217679.1|1803490_1803991_+	hypothetical protein	NA	S4TTB7	Salmonella_phage	100.0	1.0e-91
WP_000557703.1|1804054_1804279_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001277944.1|1804278_1804581_+	DUF5405 family protein	NA	Q7Y4C1	Escherichia_virus	94.0	5.5e-45
WP_001113269.1|1804580_1804805_+	TraR/DksA family transcriptional regulator	NA	A0A0F7LDG9	Escherichia_phage	98.6	5.0e-35
WP_021540634.1|1804801_1805077_+	DUF5405 family protein	NA	M1TAP2	Escherichia_phage	98.9	8.6e-45
1805824:1805839	attR	ACGCCATTCGTGATGT	NA	NA	NA	NA
>prophage 4
NZ_AP022362	Escherichia coli strain E302	5237933	1815789	1889408	5237933	capsid,holin,tail,transposase,lysis,portal,integrase,plate,terminase	Burkholderia_virus(28.12%)	85	1821559:1821575	1885388:1885404
WP_053889110.1|1815789_1816824_-|portal	phage portal protein	portal	U5N087	Enterobacteria_phage	98.5	7.9e-200
WP_001085953.1|1818768_1819623_+|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	100.0	4.6e-137
WP_064186423.1|1819681_1820755_+|capsid	phage major capsid protein, P2 family	capsid	Q94MK7	Enterobacteria_phage	98.9	2.2e-200
WP_163409495.1|1820758_1821502_+|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	98.0	1.1e-123
1821559:1821575	attL	CACTGCACCGGCGTCCA	NA	NA	NA	NA
WP_000123123.1|1822310_1822592_+|holin	phage holin family protein	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_163409456.1|1822591_1823089_+	glycoside hydrolase family protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	4.0e-93
WP_163409458.1|1823103_1823529_+	protein lysA	NA	A0A0F7LBP4	Escherichia_phage	94.3	7.2e-59
WP_053272320.1|1823516_1823942_+|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	96.5	4.0e-65
WP_072130739.1|1823913_1824087_+|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	93.0	1.2e-23
WP_000127163.1|1825657_1826005_+	GPW/gp25 family protein	NA	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_033550114.1|1826009_1826918_+|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.7	4.4e-162
WP_042032705.1|1826910_1827441_+|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	98.9	8.6e-102
WP_047603056.1|1827451_1829746_+|tail	tail fiber protein	tail	U5N099	Enterobacteria_phage	62.3	6.7e-183
WP_001461858.1|1829749_1830277_+|tail	tail fiber assembly protein	tail	Q7Y4D3	Escherichia_virus	95.4	2.3e-91
WP_001461859.1|1833246_1833774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001286716.1|1834072_1835263_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	100.0	1.6e-225
WP_001251408.1|1835275_1835794_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|1835850_1836126_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|1836158_1836278_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_163409497.1|1836270_1838718_+|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	98.8	0.0e+00
WP_001774113.1|1838732_1839212_+|tail	phage tail protein	tail	A0A0F7LBX3	Escherichia_phage	98.7	1.9e-84
WP_140041216.1|1839211_1840375_+	phage late control D family protein	NA	A0A0F7LDZ2	Escherichia_phage	99.0	3.5e-204
WP_000468308.1|1840456_1840675_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001292822.1|1840993_1843276_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_001295917.1|1843330_1844188_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_000194832.1|1844593_1846354_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_000642852.1|1846483_1847176_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_000057158.1|1847374_1848463_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	2.7e-81
WP_000445240.1|1848533_1849817_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000904922.1|1850072_1850645_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.2	4.6e-85
WP_063269479.1|1850704_1851229_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	48.6	1.8e-35
WP_000072165.1|1851228_1851843_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	60.5	2.5e-60
WP_023142129.1|1851849_1852311_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	50.0	3.9e-34
WP_163409564.1|1852321_1852795_-|tail	tail fiber protein	tail	K7PH60	Enterobacterial_phage	55.9	1.3e-40
WP_001751479.1|1852882_1853365_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.7e-48
WP_000138756.1|1856103_1856682_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.8	1.7e-66
WP_001219098.1|1856674_1857778_-|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	55.2	1.4e-106
WP_000859111.1|1857768_1858116_-	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	62.4	5.9e-35
WP_000148266.1|1858170_1858767_-|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	45.2	3.2e-36
WP_000808007.1|1858763_1859918_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.6	1.9e-85
WP_000478224.1|1859905_1860118_-|tail	tail protein X	tail	Q6QIA3	Burkholderia_phage	57.1	1.2e-17
WP_000458387.1|1860117_1861002_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.9	6.8e-51
WP_000016538.1|1861001_1863953_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	29.9	9.8e-86
WP_001202894.1|1864028_1864187_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_000084213.1|1864110_1864446_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000110114.1|1864543_1864825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162832341.1|1864827_1865352_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	66.7	1.1e-67
WP_000729834.1|1865348_1866776_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A4JWK5	Burkholderia_virus	76.3	4.5e-214
WP_000666499.1|1866765_1867017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101804.1|1867016_1867481_-	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
WP_000271668.1|1867480_1867927_-	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
WP_000537457.1|1867928_1868267_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_001286908.1|1868276_1869230_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.8	3.4e-64
WP_001273074.1|1869244_1870360_-	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.6	9.4e-98
WP_000135514.1|1870574_1871033_-	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	2.6e-30
WP_000117548.1|1871035_1871857_-|capsid	minor capsid protein	capsid	A4JWJ6	Burkholderia_virus	61.9	1.8e-98
WP_000090684.1|1871837_1873334_-	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.0	9.7e-167
WP_169542415.1|1873333_1874875_-	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.8	6.3e-185
WP_000124060.1|1874925_1875471_-	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
WP_000227701.1|1875470_1875782_-	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
WP_000175099.1|1875781_1876108_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	48.6	1.1e-17
WP_000264665.1|1876104_1876755_-	hypothetical protein	NA	J9SVN7	Pseudomonas_phage	32.9	2.8e-09
WP_001104440.1|1876738_1877479_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	51.4	2.5e-62
WP_000793146.1|1877481_1877832_-	membrane protein	NA	A4JWP3	Burkholderia_virus	53.0	1.5e-22
WP_000194951.1|1877962_1878691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295927.1|1878666_1879068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001069611.1|1879069_1879285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000783854.1|1879475_1880240_+	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	64.4	5.2e-100
WP_000031013.1|1880356_1880713_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000123378.1|1880806_1880995_+	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	3.9e-17
WP_000047759.1|1881047_1881356_+	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	55.9	2.7e-23
WP_000533817.1|1881366_1882287_+	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	56.2	1.6e-74
WP_001095645.1|1882286_1882604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000186588.1|1882619_1884389_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A4JWN2	Burkholderia_virus	69.4	1.5e-227
WP_000960679.1|1884399_1885566_+	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	59.4	2.2e-121
1885388:1885404	attR	TGGACGCCGGTGCAGTG	NA	NA	NA	NA
WP_000843446.1|1885568_1885838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001140136.1|1885865_1886396_+	host-nuclease inhibitor Gam family protein	NA	L7P7T1	Pseudomonas_phage	66.7	1.2e-58
WP_000632576.1|1886684_1886957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295929.1|1886966_1887263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763554.1|1887277_1887493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000132039.1|1887489_1888173_+	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	36.1	1.1e-32
WP_000631813.1|1888169_1888400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000206212.1|1888389_1888596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001170114.1|1888597_1889047_+	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	45.1	6.1e-24
WP_001281701.1|1889018_1889408_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	54.2	1.5e-31
>prophage 5
NZ_AP022362	Escherichia coli strain E302	5237933	2100734	2146443	5237933	tRNA,capsid,holin,tail,lysis,integrase,portal,terminase,head	Enterobacteria_phage(56.0%)	58	2099052:2099066	2127646:2127660
2099052:2099066	attL	GCTGCCAGCGGGAAA	NA	NA	NA	NA
WP_001295972.1|2100734_2101841_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|2101894_2102356_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248677.1|2102365_2103019_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444487.1|2103190_2104441_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741335.1|2104554_2105697_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z02	Phage_21	100.0	3.6e-206
WP_000088653.1|2105686_2105923_-	excisionase	NA	NA	NA	NA	NA
WP_000490213.1|2106062_2106302_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.2	4.7e-39
WP_000002139.1|2106285_2106612_-	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	95.7	9.8e-48
WP_000763374.1|2106611_2106833_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	93.2	2.3e-32
WP_021533932.1|2106931_2107213_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	95.7	3.0e-45
WP_000548516.1|2107223_2107415_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	93.7	1.8e-25
WP_000149537.1|2107387_2107570_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.3	1.8e-27
WP_000186848.1|2107566_2108247_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000100847.1|2108243_2109029_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995418.1|2109034_2109331_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	8.9e-48
WP_000233576.1|2109406_2109613_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000858975.1|2110208_2110898_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_001067458.1|2111002_2111233_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_001182900.1|2111302_2111842_+	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	67.0	2.6e-61
WP_000147894.1|2111838_2112858_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.1	8.8e-111
WP_000788794.1|2112854_2113556_+	replication protein P of bacteriophage	NA	M1FJ72	Enterobacteria_phage	97.0	1.5e-125
WP_022645049.1|2113805_2118071_+	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_000700202.1|2118107_2119151_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_072147164.1|2119500_2119602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053005.1|2119598_2120054_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	1.6e-59
WP_000224914.1|2120053_2120224_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774479.1|2120216_2120507_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	95.8	2.3e-48
WP_001099488.1|2120503_2120866_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	95.7	1.6e-59
WP_000971096.1|2120862_2121003_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	68.9	8.5e-09
WP_001097224.1|2120999_2121689_+	antiterminator Q	NA	I6PDF8	Cronobacter_phage	48.5	4.9e-57
WP_000544528.1|2122010_2122316_+|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001180486.1|2122302_2122779_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	94.9	7.3e-84
WP_001228695.1|2122995_2123178_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001298464.1|2123268_2123562_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_000830178.1|2124042_2124369_+	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_000881610.1|2124575_2124758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163409504.1|2125321_2125867_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	8.9e-94
WP_001027261.1|2125841_2127767_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
2127646:2127660	attR	TTTCCCGCTGGCAGC	NA	NA	NA	NA
WP_000198149.1|2127763_2127970_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001295977.1|2127966_2129568_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	1.4e-309
WP_000123268.1|2129548_2130868_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	1.1e-230
WP_001295978.1|2130877_2131210_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063293.1|2131265_2132291_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.4	7.8e-192
WP_000158908.1|2132332_2132731_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	1.0e-62
WP_000753018.1|2132742_2133096_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.2e-61
WP_000985120.1|2133107_2133686_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	92.7	5.9e-80
WP_000683150.1|2133682_2134078_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	2.9e-70
WP_001295979.1|2134085_2134826_+|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	98.0	1.6e-130
WP_000479203.1|2134841_2135264_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	94.3	2.2e-68
WP_000459457.1|2135245_2135680_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840216.1|2135672_2138234_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	98.4	0.0e+00
WP_000847375.1|2138230_2138560_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	2.8e-58
WP_001152626.1|2138559_2139258_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	5.1e-134
WP_023146277.1|2139262_2140006_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	5.0e-148
WP_023149564.1|2139942_2140545_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	2.1e-88
WP_001531667.1|2140605_2144088_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.3	0.0e+00
WP_000290538.1|2144146_2146168_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M0V5	Enterobacteria_phage	72.3	7.2e-181
WP_000654172.1|2146164_2146443_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	55.4	9.9e-25
>prophage 6
NZ_AP022362	Escherichia coli strain E302	5237933	2285656	2357908	5237933	protease,capsid,holin,tail,integrase,portal,terminase,head	Stx2-converting_phage(25.86%)	80	2281830:2281844	2287740:2287754
2281830:2281844	attL	ACTCCTTGTTCGGGA	NA	NA	NA	NA
WP_000113700.1|2285656_2286787_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|2286764_2287013_-	excisionase	NA	NA	NA	NA	NA
WP_016230610.1|2287077_2289549_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.0	5.7e-55
2287740:2287754	attR	ACTCCTTGTTCGGGA	NA	NA	NA	NA
WP_001090200.1|2289641_2289833_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449179.1|2289829_2290018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001171951.1|2290583_2290802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|2290961_2291117_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_000103687.1|2291389_2292106_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.0	1.7e-52
WP_000471549.1|2292155_2292371_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000693845.1|2292367_2292793_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095675.1|2292815_2293778_+	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	56.4	1.4e-70
WP_000788950.1|2293784_2294531_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.8	4.0e-113
WP_000450998.1|2294552_2295323_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	1.6e-80
WP_001151161.1|2295338_2295764_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	94.0	2.2e-63
WP_000150294.1|2295938_2296604_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_000018429.1|2296784_2296997_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	5.2e-26
WP_001329966.1|2297164_2297437_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	5.5e-12
WP_001265085.1|2297438_2298494_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.4	4.0e-90
WP_000140014.1|2298494_2298875_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.5	2.9e-35
WP_001513213.1|2298871_2299693_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	1.7e-80
WP_000917751.1|2299919_2300117_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	6.1e-29
WP_000024331.1|2300268_2301318_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.4	4.4e-198
WP_023142244.1|2302119_2302251_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	1.1e-05
WP_000871291.1|2302531_2302867_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_156838760.1|2304675_2305014_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	67.0	3.0e-39
WP_000422741.1|2305010_2305436_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_016230612.1|2305663_2307517_+	SASA family carbohydrate esterase	NA	Q08JA2	Stx2-converting_phage	90.3	0.0e+00
WP_000284510.1|2307667_2307883_+|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000193278.1|2307887_2308232_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.8e-37
WP_000369850.1|2308197_2308470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992071.1|2308575_2309109_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	4.8e-100
WP_032140280.1|2309663_2309750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012578895.1|2309971_2310157_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.4	2.7e-18
WP_000736382.1|2310242_2310458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000095741.1|2310656_2310857_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	98.5	4.3e-30
WP_000829185.1|2310898_2311264_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	93.4	2.5e-60
WP_000958366.1|2311554_2312118_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	92.0	1.6e-82
WP_001296023.1|2312114_2313776_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.7	0.0e+00
WP_000173031.1|2313839_2315777_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	100.0	0.0e+00
WP_001063099.1|2315821_2316043_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267294.1|2315988_2318574_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	100.0	0.0e+00
WP_000125990.1|2318570_2318897_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001007905.1|2318906_2319257_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|2319253_2319700_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|2319696_2320041_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275441.1|2320107_2320824_+	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	99.6	3.6e-127
WP_000710949.1|2320838_2321213_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001513217.1|2321308_2321518_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000212991.1|2321565_2324808_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	91.6	0.0e+00
WP_000807937.1|2324800_2325142_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	95.6	9.0e-60
WP_001296027.1|2325141_2325840_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	97.4	5.8e-130
WP_000194730.1|2325850_2326594_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	4.3e-147
WP_061089814.1|2326539_2327172_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.6	3.0e-101
WP_000514710.1|2327514_2330988_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.7	0.0e+00
WP_001016257.1|2333185_2333932_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_023363168.1|2334393_2337219_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q858V4	Yersinia_virus	63.6	9.0e-04
WP_000972097.1|2337220_2337754_+|tail	tail fiber assembly protein	tail	A0A077SL44	Escherichia_phage	70.1	1.8e-67
WP_001164137.1|2337784_2338312_-|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	77.7	8.4e-73
WP_001513292.1|2338327_2339296_-	hypothetical protein	NA	A0A0F7LDR4	Escherichia_phage	38.8	6.5e-47
WP_001421220.1|2339421_2339604_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	95.0	1.4e-24
WP_000240999.1|2339802_2340471_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937495.1|2340527_2340797_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
WP_000251936.1|2340911_2341082_+	hypothetical protein	NA	A0A0U2RK60	Escherichia_phage	62.5	9.4e-10
WP_001348267.1|2341208_2341766_-	Rha family transcriptional regulator	NA	Q8H9L9	Vibrio_phage	63.8	4.2e-30
WP_001296031.1|2341762_2342038_-	ash family protein	NA	S5MQL6	Escherichia_phage	52.9	1.1e-10
WP_000443082.1|2342413_2343220_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209513.1|2343219_2344413_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001195273.1|2344424_2345783_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.9e-37
WP_000763535.1|2345786_2347382_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001194644.1|2347381_2348944_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|2349035_2349080_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285702.1|2349217_2350099_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|2350095_2350716_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001296033.1|2350743_2352639_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291206.1|2352851_2353727_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_000622024.1|2353896_2354919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001000715.1|2354928_2355237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001278898.1|2355293_2355884_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559273.1|2355880_2356639_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	4.4e-06
WP_000422062.1|2356858_2357908_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 7
NZ_AP022362	Escherichia coli strain E302	5237933	2853989	2936499	5237933	tRNA,capsid,holin,tail,portal,integrase,plate,terminase	Escherichia_phage(24.39%)	95	2893949:2894008	2936561:2936685
WP_001258676.1|2853989_2855762_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000891625.1|2856071_2856638_+	hydrolase	NA	NA	NA	NA	NA
WP_000639277.1|2856634_2857453_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
WP_000252980.1|2857505_2857901_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_000019588.1|2857941_2858685_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000564759.1|2858681_2859653_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000176764.1|2859688_2862118_-	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_001214293.1|2862142_2863243_-	NapC/NirT family cytochrome c	NA	NA	NA	NA	NA
WP_001185734.1|2863630_2864377_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001490174.1|2864390_2864957_-	VOC family protein	NA	NA	NA	NA	NA
WP_001025326.1|2865172_2866906_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
WP_001202076.1|2866958_2867351_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000066973.1|2867350_2869429_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278946.1|2869421_2870570_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983600.1|2870758_2871403_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|2871413_2871803_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036371.1|2871817_2872867_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204320.1|2872869_2873730_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_001296146.1|2874020_2875682_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_000147302.1|2875826_2876330_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001531763.1|2876350_2878315_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795641.1|2878319_2879246_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906342.1|2879242_2880130_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|2880256_2880835_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001295647.1|2880837_2881188_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122413.1|2881967_2882396_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001296148.1|2882402_2883827_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001296149.1|2883801_2884602_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_000100203.1|2884768_2885755_-	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187827.1|2885769_2887284_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.7	1.3e-12
WP_000548680.1|2887353_2888343_-	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_000179469.1|2889137_2889641_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000082127.1|2889718_2889970_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|2890084_2890171_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237881.1|2890434_2890758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917208.1|2890929_2891427_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377224.1|2891464_2891704_-	YecH family protein	NA	NA	NA	NA	NA
WP_163409518.1|2891894_2893106_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847882.1|2893156_2893822_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
2893949:2894008	attL	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTA	NA	NA	NA	NA
WP_001296152.1|2894293_2894713_-	hypothetical protein	NA	G8C7Q7	Escherichia_phage	68.8	1.8e-49
WP_001531767.1|2895927_2896152_-|tail	tail protein X	tail	NA	NA	NA	NA
WP_001531768.1|2896313_2896703_-|tail	phage tail protein	tail	E5FFG4	Burkholderia_phage	37.9	1.0e-14
WP_001018353.1|2896738_2898379_-	hypothetical protein	NA	A0A2I7R3J9	Vibrio_phage	29.3	1.2e-19
WP_000444667.1|2898487_2898769_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000785563.1|2898781_2899294_-|tail	phage major tail tube protein	tail	NA	NA	NA	NA
WP_000117510.1|2899311_2900814_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	R9TMQ0	Vibrio_phage	33.5	5.5e-69
WP_000626358.1|2900810_2901200_-	hypothetical protein	NA	A0A2H4EXG4	Aeromonas_phage	30.8	9.4e-05
WP_000829621.1|2901199_2902384_-|tail	phage tail protein	tail	J9QDX3	Clostridium_phage	35.2	2.5e-16
WP_000203868.1|2902376_2903003_-|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	38.8	2.0e-25
WP_000633314.1|2903005_2903926_-|plate	baseplate J/gp47 family protein	plate	D5LGZ3	Escherichia_phage	47.8	6.4e-68
WP_000901289.1|2903922_2904264_-	GPW/gp25 family protein	NA	D4HTV2	Vibrio_phage	51.6	1.1e-20
WP_000079174.1|2904266_2905169_-|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_000015612.1|2905149_2905686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774516.1|2905682_2906363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001531773.1|2906394_2906775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000105179.1|2906771_2907191_-	DNA-packaging protein	NA	NA	NA	NA	NA
WP_001283997.1|2907225_2908260_-|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	56.5	6.6e-106
WP_000206292.1|2908318_2908648_-	hypothetical protein	NA	A0A2R9YJN3	Escherichia_phage	39.5	2.0e-08
WP_001145892.1|2908647_2909955_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	4.9e-106
WP_000126513.1|2909954_2911529_-|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	64.0	8.6e-190
WP_000203897.1|2911525_2911759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000148195.1|2911758_2913621_-|terminase	phage terminase large subunit family protein	terminase	A0A1I9KF19	Aeromonas_phage	53.2	1.1e-191
WP_000168117.1|2913607_2914174_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	46.2	2.9e-31
WP_001531775.1|2914542_2914788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000734931.1|2914847_2915042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000131873.1|2915049_2915529_-	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	68.8	4.6e-62
WP_000172496.1|2915528_2915801_-|holin	phage holin family protein	holin	A0A0A0YPY6	Escherichia_phage	42.9	9.8e-09
WP_001294589.1|2915800_2916184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000064384.1|2916296_2916968_-	antitermination protein	NA	Q7Y3X2	Yersinia_phage	33.5	1.9e-16
WP_000717783.1|2916967_2917261_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	70.5	3.3e-34
WP_000057010.1|2917257_2917854_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	64.1	1.5e-70
WP_001025459.1|2917931_2918111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163409520.1|2918262_2918904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000536919.1|2919147_2919381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000224749.1|2919779_2920268_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A142KB62	Gordonia_phage	42.7	6.4e-27
WP_001138663.1|2920277_2920883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000536231.1|2921345_2922044_-	hypothetical protein	NA	Q858R8	Enterobacteria_phage	91.4	1.5e-117
WP_001237642.1|2923232_2924156_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_001531776.1|2924330_2925119_-	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	69.8	1.1e-39
WP_000661082.1|2925800_2926025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000875806.1|2926021_2926333_-	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	65.7	1.2e-34
WP_000918616.1|2926329_2926566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000214056.1|2926567_2926978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000609322.1|2927016_2928432_-	AAA family ATPase	NA	H9C165	Pectobacterium_phage	66.7	6.6e-173
WP_001023813.1|2928421_2929177_-	hypothetical protein	NA	H9C164	Pectobacterium_phage	68.5	2.4e-41
WP_000943914.1|2929173_2929398_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	54.1	6.1e-17
WP_000431205.1|2929437_2929914_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	48.6	1.9e-23
WP_000360804.1|2929972_2930203_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	63.2	1.5e-21
WP_001296165.1|2930301_2930715_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	49.1	8.7e-09
WP_163409522.1|2931725_2932046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000151806.1|2932076_2934293_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.6	4.7e-101
WP_000100753.1|2934289_2934859_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	49.2	6.1e-37
WP_000916334.1|2934858_2935041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000833838.1|2935250_2935514_+	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	38.0	1.2e-06
WP_001531780.1|2935482_2936499_+|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	63.6	1.1e-126
2936561:2936685	attR	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTATCTTTCCCATGGTACCCGGAGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGATTTTAAAT	NA	NA	NA	NA
>prophage 8
NZ_AP022362	Escherichia coli strain E302	5237933	3119131	3125434	5237933		Enterobacteria_phage(66.67%)	6	NA	NA
WP_001100793.1|3119131_3119674_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	61.8	6.0e-50
WP_000857525.1|3119678_3120557_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	6.6e-107
WP_001023641.1|3120614_3121514_-	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	34.8	1.7e-28
WP_000699407.1|3121513_3122599_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	8.8e-101
WP_000183040.1|3122971_3123865_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.0e-46
WP_001116066.1|3124039_3125434_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.0	6.3e-19
>prophage 9
NZ_AP022362	Escherichia coli strain E302	5237933	3219417	3228862	5237933		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292786.1|3219417_3220554_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	96.7	6.1e-161
WP_001296230.1|3220550_3222554_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001296231.1|3222678_3223140_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001295430.1|3223180_3223651_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|3223697_3224417_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|3224413_3226099_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240408.1|3226320_3227052_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.5	6.3e-111
WP_001216963.1|3227111_3227219_+	protein YohO	NA	NA	NA	NA	NA
WP_000783109.1|3227199_3227931_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569347.1|3227935_3228862_-	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	2.6e-08
>prophage 10
NZ_AP022362	Escherichia coli strain E302	5237933	3807963	3815103	5237933		Escherichia_phage(83.33%)	6	NA	NA
WP_000103863.1|3807963_3810525_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.6e-31
WP_001141293.1|3810630_3811287_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.1	3.3e-50
WP_001296319.1|3811337_3812105_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	9.7e-70
WP_000847996.1|3812300_3813209_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.2	1.9e-117
WP_000590411.1|3813205_3814468_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_001279004.1|3814464_3815103_+	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.4e-82
>prophage 11
NZ_AP022362	Escherichia coli strain E302	5237933	4064369	4123389	5237933	tRNA,protease,transposase,lysis,integrase	Staphylococcus_phage(50.0%)	48	4065578:4065595	4122786:4122803
WP_001296354.1|4064369_4065128_+|protease	metalloprotease LoiP	protease	NA	NA	NA	NA
WP_000105562.1|4065557_4066478_-	agmatinase	NA	NA	NA	NA	NA
4065578:4065595	attL	CCTGAATATACAGCATCT	NA	NA	NA	NA
WP_000758881.1|4066613_4067345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295380.1|4067490_4069467_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_001297406.1|4069475_4069607_-	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001331575.1|4069742_4069958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001062128.1|4070261_4071416_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_001112301.1|4071851_4073246_+	galactose/proton symporter	NA	NA	NA	NA	NA
WP_001296359.1|4073322_4073820_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_000286500.1|4073914_4074622_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001222509.1|4074701_4075433_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593274.1|4075445_4076396_+	glutathione synthase	NA	NA	NA	NA	NA
WP_001053178.1|4076504_4077068_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017111.1|4077067_4077484_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001296360.1|4077598_4078579_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997795.1|4078596_4079301_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094831.1|4079318_4079885_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_001277229.1|4079881_4080172_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174754.1|4080179_4080773_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_000239963.1|4080765_4081902_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000783999.1|4082216_4083203_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000577034.1|4083247_4083751_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_000378955.1|4083750_4085052_+	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_000745240.1|4085107_4086115_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000394132.1|4086231_4087278_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984796.1|4087453_4088173_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001296361.1|4088193_4088334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001107566.1|4088356_4088683_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786911.1|4088682_4089402_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001296362.1|4089562_4090615_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091700.1|4090642_4090918_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_000760323.1|4090982_4092062_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001296363.1|4092263_4093520_+	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_000839781.1|4093568_4095704_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234526.1|4096096_4096804_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001218869.1|4097182_4098448_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	2.1e-77
WP_001296368.1|4101431_4101653_+	pap operon regulatory protein PapI	NA	NA	NA	NA	NA
WP_001513409.1|4103520_4103634_-|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_001110186.1|4105467_4105728_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000109147.1|4105769_4106330_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001296373.1|4106369_4106798_+	DUF417 family protein	NA	NA	NA	NA	NA
WP_163409542.1|4107515_4108709_-	MFS transporter	NA	NA	NA	NA	NA
WP_001296374.1|4108844_4110569_+	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_001287500.1|4110569_4111517_+	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_001015715.1|4111516_4113259_+	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_011076574.1|4117360_4117504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001034083.1|4117753_4121641_+|protease	serine protease autotransporter toxin Sat	protease	Q9LA58	Enterobacterial_phage	39.0	1.2e-227
WP_001254932.1|4122237_4123389_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
4122786:4122803	attR	CCTGAATATACAGCATCT	NA	NA	NA	NA
>prophage 12
NZ_AP022362	Escherichia coli strain E302	5237933	5191716	5237486	5237933	tRNA,capsid,tail,lysis,portal,integrase,terminase,head	Escherichia_phage(36.0%)	51	5184964:5184978	5230930:5230944
5184964:5184978	attL	GGGCAAAGGCGATGA	NA	NA	NA	NA
WP_000560981.1|5191716_5192154_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_001297068.1|5192198_5193140_+	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_001385591.1|5193203_5194112_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000897302.1|5194340_5194652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000356397.1|5194652_5194943_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001296612.1|5195301_5195580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001251293.1|5195976_5196195_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_032140890.1|5196379_5196829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001038650.1|5197144_5197993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001068514.1|5198282_5198525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000027696.1|5198706_5199636_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_000829013.1|5199632_5200268_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000331383.1|5200264_5201167_-	formate dehydrogenase O subunit beta	NA	NA	NA	NA	NA
WP_077633686.1|5201179_5204230_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
WP_000753589.1|5204423_5205257_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_000749934.1|5206252_5207647_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_000619499.1|5207687_5208002_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_001179746.1|5208011_5208836_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_001296617.1|5209102_5210362_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_000144100.1|5210358_5211828_-	rhamnulokinase	NA	NA	NA	NA	NA
WP_000217147.1|5212115_5212952_+	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_001296618.1|5212935_5213874_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000063507.1|5213870_5214905_-	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_001296619.1|5215189_5215810_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	5.4e-63
WP_001166063.1|5216069_5217053_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001270242.1|5217201_5217876_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580417.1|5218046_5219420_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033720.1|5219416_5220115_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_001223800.1|5220264_5220765_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
WP_000985246.1|5220951_5221932_-|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	100.0	4.7e-186
WP_000777029.1|5222001_5222295_-	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
WP_001308179.1|5222431_5222704_+	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
WP_001005162.1|5222706_5222877_+	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_000217670.1|5222873_5223374_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000557703.1|5223437_5223662_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001277952.1|5223661_5223964_+	DUF5405 family protein	NA	A0A0F7LDT6	Escherichia_phage	96.0	2.5e-45
WP_001113270.1|5223963_5224188_+	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	98.6	3.8e-35
WP_000027659.1|5224184_5224460_+	DUF5405 family protein	NA	A0A0F7LCM4	Escherichia_phage	100.0	2.3e-45
WP_061091937.1|5224449_5226732_+	replication endonuclease	NA	Q858T4	Yersinia_virus	97.9	0.0e+00
WP_016236400.1|5226908_5227106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061091938.1|5227102_5228209_-	Fic family protein	NA	S4TP71	Salmonella_phage	77.7	1.6e-158
WP_053889110.1|5228760_5229795_-|portal	phage portal protein	portal	U5N087	Enterobacteria_phage	98.5	7.9e-200
WP_163409556.1|5231736_5232588_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	96.8	1.1e-151
5230930:5230944	attR	GGGCAAAGGCGATGA	NA	NA	NA	NA
WP_163409570.1|5232681_5233668_+|capsid	phage major capsid protein, P2 family	capsid	Q94MK7	Enterobacteria_phage	99.1	3.7e-183
WP_163409495.1|5233723_5234467_+|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	98.0	1.1e-123
WP_000988636.1|5234566_5235076_+|head	head completion/stabilization protein	head	A0A0F7LDJ1	Escherichia_phage	100.0	8.6e-91
WP_163409456.1|5235563_5236061_+	glycoside hydrolase family protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	4.0e-93
WP_163409458.1|5236075_5236501_+	protein lysA	NA	A0A0F7LBP4	Escherichia_phage	94.3	7.2e-59
WP_163409558.1|5236488_5236911_+|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	94.3	1.2e-61
WP_072130739.1|5236882_5237056_+|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	93.0	1.2e-23
WP_001406878.1|5237018_5237486_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	99.4	6.7e-82
