The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP048647	Escherichia coli strain GW-AmxH19 chromosome, complete genome	5037322	75933	88998	5037322	integrase	Morganella_phage(30.0%)	17	65737:65749	89390:89402
65737:65749	attL	GGCGGTCCAGTTC	NA	NA	NA	NA
WP_001536417.1|75933_77355_-	phage DNA ejection protein	NA	B6SCW4	Bacteriophage	53.0	1.3e-123
WP_000909175.1|77354_78032_-	hypothetical protein	NA	Q2A0B2	Sodalis_phage	71.6	9.2e-56
WP_001468271.1|78025_78487_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	71.5	2.9e-61
WP_042050967.1|79249_82006_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	56.9	4.4e-298
WP_001536415.1|81992_82364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001536413.1|82356_82698_-	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	60.6	4.6e-32
WP_001536412.1|82708_83311_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	36.3	5.7e-25
WP_000181940.1|83303_83525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024677.1|83521_83785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001065661.1|83781_83976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024188156.1|83968_85036_-	ash family protein	NA	A0A1C9IHV9	Salmonella_phage	44.1	5.7e-12
WP_000476150.1|85029_85212_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001019369.1|85204_86038_-	hypothetical protein	NA	G9L6G1	Escherichia_phage	47.5	5.3e-21
WP_000412546.1|86050_86482_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	48.6	1.1e-27
WP_001090781.1|86481_86685_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000735991.1|86797_87643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001384863.1|87738_88998_-|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	78.1	5.1e-193
89390:89402	attR	GGCGGTCCAGTTC	NA	NA	NA	NA
>prophage 2
NZ_CP048647	Escherichia coli strain GW-AmxH19 chromosome, complete genome	5037322	1142977	1153466	5037322		Escherichia_phage(62.5%)	9	NA	NA
WP_001278992.1|1142977_1143616_-	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.8e-82
WP_000590416.1|1143612_1144875_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	6.3e-135
WP_000847998.1|1144871_1145780_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	5.1e-118
WP_001272544.1|1145945_1146743_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.0	5.0e-69
WP_001141304.1|1146793_1147450_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.6	8.6e-51
WP_001467843.1|1147555_1150123_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.2e-31
WP_000784515.1|1150269_1151727_+	hypothetical protein	NA	A0A0R6PGY7	Moraxella_phage	28.1	4.4e-23
WP_042051186.1|1151738_1152323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020904.1|1152482_1153466_+	hypothetical protein	NA	Q2P9W8	Enterobacteria_phage	22.0	5.7e-06
>prophage 3
NZ_CP048647	Escherichia coli strain GW-AmxH19 chromosome, complete genome	5037322	1735611	1745056	5037322		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569375.1|1735611_1736538_+	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.3	3.3e-08
WP_000783151.1|1736542_1737274_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1737254_1737362_-	protein YohO	NA	NA	NA	NA	NA
WP_001240394.1|1737421_1738153_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.5	3.1e-110
WP_001295431.1|1738374_1740060_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1740056_1740776_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1740822_1741293_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001296231.1|1741333_1741795_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001332210.1|1741919_1743923_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.4	0.0e+00
WP_001292784.1|1743919_1745056_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	1.2e-161
>prophage 4
NZ_CP048647	Escherichia coli strain GW-AmxH19 chromosome, complete genome	5037322	1839779	1846089	5037322		Enterobacteria_phage(50.0%)	6	NA	NA
WP_001116060.1|1839779_1841174_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	6.3e-19
WP_000183060.1|1841348_1842242_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_163390072.1|1842614_1843700_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.1e-100
WP_001023615.1|1843699_1844599_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.2	7.4e-29
WP_000857506.1|1844657_1845536_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	2.3e-107
WP_001100788.1|1845540_1846089_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.6	1.2e-50
>prophage 5
NZ_CP048647	Escherichia coli strain GW-AmxH19 chromosome, complete genome	5037322	2622784	2635849	5037322	integrase	Morganella_phage(30.0%)	17	2628317:2628332	2640971:2640986
WP_001536417.1|2622784_2624206_-	phage DNA ejection protein	NA	B6SCW4	Bacteriophage	53.0	1.3e-123
WP_000909175.1|2624205_2624883_-	hypothetical protein	NA	Q2A0B2	Sodalis_phage	71.6	9.2e-56
WP_001468271.1|2624876_2625338_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	71.5	2.9e-61
WP_042050967.1|2626100_2628857_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	56.9	4.4e-298
2628317:2628332	attL	TATCCACCAGCGCCAG	NA	NA	NA	NA
WP_001536415.1|2628843_2629215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001536413.1|2629207_2629549_-	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	60.6	4.6e-32
WP_001536412.1|2629559_2630162_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	36.3	5.7e-25
WP_000181940.1|2630154_2630376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024677.1|2630372_2630636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001065661.1|2630632_2630827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024188156.1|2630819_2631887_-	ash family protein	NA	A0A1C9IHV9	Salmonella_phage	44.1	5.7e-12
WP_000476150.1|2631880_2632063_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001019369.1|2632055_2632889_-	hypothetical protein	NA	G9L6G1	Escherichia_phage	47.5	5.3e-21
WP_000412546.1|2632901_2633333_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	48.6	1.1e-27
WP_001090781.1|2633332_2633536_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000735991.1|2633648_2634494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001384863.1|2634589_2635849_-|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	78.1	5.1e-193
2640971:2640986	attR	TATCCACCAGCGCCAG	NA	NA	NA	NA
>prophage 6
NZ_CP048647	Escherichia coli strain GW-AmxH19 chromosome, complete genome	5037322	2817330	2862589	5037322	integrase,tail,capsid,terminase,lysis,head,portal,protease	Enterobacteria_phage(52.38%)	69	2819524:2819537	2862926:2862939
WP_000654167.1|2817330_2817609_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	56.5	7.6e-25
WP_000290543.1|2817605_2819666_-|tail	phage tail protein	tail	A0A0E3M194	Enterobacteria_phage	53.4	2.0e-125
2819524:2819537	attL	CGTCCGGCTTCATC	NA	NA	NA	NA
WP_000515326.1|2819724_2823207_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.5	0.0e+00
WP_000090917.1|2823267_2823900_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_000140699.1|2823836_2824580_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.1e-147
WP_001152660.1|2824585_2825284_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	4.0e-131
WP_000847405.1|2825283_2825613_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	94.5	5.4e-54
WP_000840269.1|2825609_2828171_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	94.5	0.0e+00
WP_000459474.1|2828163_2828598_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	90.0	9.0e-57
WP_000479129.1|2828579_2829002_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	91.4	2.7e-66
WP_001351266.1|2829017_2829758_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	3.7e-127
WP_000683101.1|2829765_2830161_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	97.7	5.5e-69
WP_000975062.1|2830157_2830736_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	2.9e-79
WP_001204540.1|2830747_2831101_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	65.0	3.4e-38
WP_000201530.1|2831093_2831468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522648.1|2831519_2832548_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	61.6	5.9e-115
WP_000256840.1|2832605_2832953_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_001253913.1|2832989_2834495_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	3.6e-100
WP_000831761.1|2834484_2836077_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	4.2e-184
WP_000258997.1|2836073_2836280_-|head	phage head-stabilizing protein	head	K7PM10	Enterobacteria_phage	55.4	3.0e-10
WP_001304453.1|2836263_2838192_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.7	3.3e-260
WP_000867568.1|2838163_2838712_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_000881610.1|2839274_2839457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000830178.1|2839663_2839990_-	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_001298464.1|2840470_2840764_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_001228695.1|2840854_2841037_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001135277.1|2841253_2841751_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
WP_000839596.1|2841750_2841966_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737271.1|2842554_2843637_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
WP_001204776.1|2843825_2844209_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	1.5e-55
WP_000971053.1|2844294_2844435_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	3.6e-07
WP_001099712.1|2844431_2844794_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000950951.1|2844813_2845008_-	protein ninF	NA	NA	NA	NA	NA
WP_000386643.1|2845000_2845342_-	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	96.5	1.6e-61
WP_001254243.1|2845344_2845521_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	96.6	3.3e-26
WP_000153286.1|2845517_2846045_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	99.4	4.7e-100
WP_000736913.1|2846041_2846482_-	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_000145927.1|2846555_2846846_-	protein ren	NA	O48423	Enterobacteria_phage	97.9	2.8e-46
WP_000788872.1|2846842_2847544_-	Replication protein 14	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	2.9e-129
WP_000185431.1|2847540_2848440_-	replication protein	NA	K7P7F0	Enterobacteria_phage	99.0	3.5e-172
WP_000442609.1|2848472_2848769_-	hypothetical protein	NA	G9L678	Escherichia_phage	94.9	2.2e-46
WP_000067727.1|2848910_2849126_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_001302016.1|2849201_2849897_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_001062368.1|2849936_2850494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000968518.1|2850490_2851243_+	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_042051116.1|2851519_2851702_+	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	96.7	5.3e-27
WP_000088199.1|2851679_2851952_+	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	98.9	2.8e-40
WP_001066176.1|2851968_2852550_-	superinfection exclusion protein B	NA	K7P6T7	Enterobacteria_phage	92.2	5.2e-92
WP_000213979.1|2852763_2852964_+	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	98.5	7.1e-33
WP_000065374.1|2853146_2853515_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_001198860.1|2853587_2853752_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	100.0	1.4e-26
WP_000372923.1|2853720_2853864_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	97.9	2.7e-18
WP_000995434.1|2853939_2854236_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	1.1e-48
WP_000100847.1|2854241_2855027_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186790.1|2855023_2855704_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.1	5.1e-131
WP_000149544.1|2855700_2855883_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
WP_000548537.1|2855855_2856047_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_001360114.1|2856057_2856339_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000763378.1|2856437_2856659_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	97.3	8.4e-35
WP_001289890.1|2856655_2857420_+	ead/Ea22-like family protein	NA	K7PKG8	Enterobacteria_phage	94.8	3.6e-56
WP_001518554.1|2857421_2857676_+	hypothetical protein	NA	A5LH60	Enterobacteria_phage	91.1	1.7e-34
WP_001327280.1|2857693_2858227_+	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	82.1	2.5e-64
WP_000951713.1|2858228_2858438_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	91.2	1.3e-32
WP_000208010.1|2858434_2859175_+	DUF550 domain-containing protein	NA	K7PGV7	Enterobacterial_phage	67.1	6.5e-47
WP_001304460.1|2859167_2859452_+	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	89.4	4.0e-45
WP_000490215.1|2859477_2859717_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	93.7	8.8e-38
WP_000088653.1|2859856_2860093_+	excisionase	NA	NA	NA	NA	NA
WP_000741334.1|2860082_2861225_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	99.7	1.1e-205
WP_000444487.1|2861338_2862589_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
2862926:2862939	attR	GATGAAGCCGGACG	NA	NA	NA	NA
>prophage 7
NZ_CP048647	Escherichia coli strain GW-AmxH19 chromosome, complete genome	5037322	3207536	3294759	5037322	plate,integrase,tail,tRNA,capsid,terminase,lysis,head,portal,protease	Salmonella_phage(58.33%)	94	3259935:3259960	3294834:3294859
WP_000886683.1|3207536_3208829_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067755.1|3208919_3210263_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|3210273_3210885_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_001535955.1|3211043_3215111_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|3215245_3215740_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537432.1|3216283_3217249_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.1e-62
WP_001043561.1|3217371_3219138_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_001202164.1|3219138_3220860_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	30.8	1.2e-14
WP_001241667.1|3220901_3221606_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3221890_3222109_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|3222793_3225070_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|3225100_3225421_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|3225743_3225968_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_001467831.1|3226040_3227987_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	2.5e-37
WP_000746478.1|3227983_3229099_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_001351020.1|3229249_3230206_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000599826.1|3230202_3231861_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001298299.1|3232286_3232982_+	aquaporin Z	NA	NA	NA	NA	NA
WP_000491135.1|3233302_3234202_+	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_000458843.1|3234345_3235998_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000178690.1|3236009_3236978_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000815365.1|3237110_3238829_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	8.9e-31
WP_000566390.1|3238865_3239867_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_001136520.1|3239877_3241308_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001305933.1|3241406_3242420_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001255186.1|3242416_3243247_-	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001160737.1|3243243_3243567_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001295906.1|3243692_3244208_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027205.1|3244425_3245154_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_000756575.1|3245171_3245903_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001001692.1|3245909_3246626_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000464487.1|3246625_3247294_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001467833.1|3247519_3248251_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001149763.1|3248279_3249407_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	28.0	1.3e-27
WP_000389260.1|3249447_3249936_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061658.1|3249995_3250841_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_001535954.1|3250837_3251791_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000996010.1|3251800_3252934_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000126095.1|3253028_3254141_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|3254490_3254967_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|3255054_3255957_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000189182.1|3256017_3256740_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201570.1|3256723_3257011_-	YbjC family protein	NA	NA	NA	NA	NA
WP_001195230.1|3257170_3257428_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	63.1	1.0e-23
WP_000681104.1|3257457_3257835_-	membrane protein	NA	NA	NA	NA	NA
WP_001024876.1|3258104_3259790_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
3259935:3259960	attL	ATGGGTTTTTTGTTGCCTGAAATTTA	NA	NA	NA	NA
WP_000972391.1|3260025_3260244_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_042051081.1|3260334_3261435_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.7	4.9e-176
WP_042051079.1|3261431_3261917_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	3.7e-67
WP_042051077.1|3261913_3264991_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	62.9	0.0e+00
WP_042051071.1|3264983_3265103_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	84.6	1.4e-12
WP_001281009.1|3265117_3265420_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_001207660.1|3265474_3265990_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_032182339.1|3265999_3267172_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.5	7.8e-204
WP_032181904.1|3267314_3267881_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	84.8	1.9e-86
WP_059328584.1|3267911_3268301_+	hypothetical protein	NA	F1BUP1	Erwinia_phage	45.8	1.7e-14
WP_038996884.1|3268322_3268763_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	70.3	7.3e-54
WP_042050375.1|3268734_3269328_-|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	65.8	1.4e-60
WP_059319214.1|3269327_3270833_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	66.9	8.0e-177
WP_042049999.1|3270829_3271435_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	5.8e-110
WP_042050688.1|3271427_3272336_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.4	2.3e-142
WP_001522712.1|3272322_3272682_-	hypothetical protein	NA	A0A1S6KZZ4	Salmonella_phage	88.2	5.0e-53
WP_042050686.1|3272678_3273257_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	94.8	2.9e-103
WP_042050682.1|3273355_3274876_+	phage protein	NA	A0A1S5SA14	Streptococcus_phage	28.8	6.5e-09
WP_042050681.1|3274879_3275332_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	76.4	4.7e-56
WP_001039944.1|3275324_3275756_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.7	4.4e-72
WP_042050676.1|3275851_3276280_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	77.3	1.3e-47
WP_042050675.1|3276276_3276654_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.8	1.8e-16
WP_033548140.1|3276655_3277168_-	lysozyme	NA	E5G6N1	Salmonella_phage	92.3	6.9e-88
WP_000171568.1|3277148_3277364_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_042050673.1|3277367_3277574_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	91.2	1.3e-29
WP_000673520.1|3277573_3278038_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	4.2e-76
WP_042050672.1|3278133_3278784_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.4	3.3e-111
WP_000742511.1|3278787_3279846_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	2.9e-181
WP_000216257.1|3279862_3280696_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.3	2.2e-123
WP_042050671.1|3280838_3282605_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.3	0.0e+00
WP_042050670.1|3282604_3283642_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	88.0	1.3e-170
WP_042050668.1|3283677_3284325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042050665.1|3284324_3284753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032254892.1|3284765_3285872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000834899.1|3286376_3286802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|3286961_3287195_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|3287205_3287394_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_042050664.1|3287546_3289961_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_000104157.1|3289957_3290815_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	98.2	4.1e-162
WP_000752613.1|3290811_3291039_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_001244216.1|3291038_3291272_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	9.2e-32
WP_001352070.1|3291339_3291681_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	96.5	4.3e-54
WP_000956182.1|3291644_3291845_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
WP_000460891.1|3291852_3292362_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
WP_001247707.1|3292394_3292616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047320.1|3292741_3293311_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	43.9	2.9e-39
WP_001513672.1|3293326_3293518_+	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	65.9	6.8e-09
WP_000290937.1|3293706_3294759_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
3294834:3294859	attR	ATGGGTTTTTTGTTGCCTGAAATTTA	NA	NA	NA	NA
>prophage 8
NZ_CP048647	Escherichia coli strain GW-AmxH19 chromosome, complete genome	5037322	3833295	3885128	5037322	plate,integrase,transposase	Enterobacteria_phage(20.0%)	46	3833190:3833210	3845288:3845308
3833190:3833210	attL	AATGGTGCCGATAATAGGAGT	NA	NA	NA	NA
WP_032143510.1|3833295_3834630_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000974933.1|3834704_3835361_-	hypothetical protein	NA	A0A1D7XFF4	Escherichia_phage	62.0	1.3e-59
WP_001535838.1|3835434_3837336_-	hypothetical protein	NA	I7HJD8	Enterobacteria_phage	29.5	2.5e-42
WP_001535837.1|3837721_3838753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000013184.1|3838767_3839151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807036.1|3839155_3839353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000390658.1|3840347_3840656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001535836.1|3840655_3841216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001535835.1|3841461_3841644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001273869.1|3843415_3843967_+	recombinase family protein	NA	Q2A092	Sodalis_phage	43.9	3.2e-30
WP_000893298.1|3845479_3846733_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	5.8e-96
3845288:3845308	attR	AATGGTGCCGATAATAGGAGT	NA	NA	NA	NA
WP_001285288.1|3846744_3847848_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749898.1|3848136_3849192_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.3	1.7e-117
WP_000174684.1|3849230_3849632_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189573.1|3849689_3850934_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291991.1|3851025_3851484_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001292999.1|3851744_3853202_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_042051261.1|3853258_3853873_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_019841423.1|3853869_3855021_-	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	31.8	3.5e-31
WP_001059894.1|3855199_3855652_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001226165.1|3855648_3856704_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000207543.1|3856774_3857560_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001468261.1|3857504_3859244_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_153275555.1|3859322_3859481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000543510.1|3859662_3859983_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000093934.1|3860335_3861085_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.5e-19
WP_001225679.1|3861396_3862137_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001468560.1|3862107_3862875_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|3863079_3863658_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_001535833.1|3863897_3866342_+	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000532690.1|3866384_3866858_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001468559.1|3867011_3867782_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_001298174.1|3868052_3868541_-	integrating conjugative element protein	NA	NA	NA	NA	NA
WP_000513317.1|3870387_3870678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001535830.1|3870652_3872092_-	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_000571853.1|3872084_3873131_-	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_001535828.1|3873237_3875220_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.8	1.4e-24
WP_001142963.1|3875440_3875959_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000041480.1|3876660_3877164_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000111582.1|3877186_3878671_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000946069.1|3878675_3879101_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000863398.1|3879106_3880948_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000896717.1|3880911_3881961_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000433570.1|3881965_3883258_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001013429.1|3883254_3883779_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000224516.1|3883781_3885128_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 1
NZ_CP048648	Escherichia coli strain GW-AmxH19 plasmid unnamed, complete sequence	126964	113661	121085	126964	transposase	Enterobacteria_phage(33.33%)	8	NA	NA
WP_000544830.1|113661_114459_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	99.6	1.9e-145
WP_000952372.1|114458_115631_-|transposase	IS21-like element IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	99.5	3.5e-228
WP_000115885.1|116226_116745_-	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_000619112.1|116879_117128_+	DinI-like family protein	NA	Q2A098	Sodalis_phage	48.0	1.2e-13
WP_000109079.1|117124_117562_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	47.6	1.1e-25
WP_000340835.1|118836_119229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001103694.1|119233_120205_-	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	42.9	9.7e-67
WP_000633911.1|120440_121085_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	43.5	8.8e-40
