The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP048787	Proteus mirabilis strain CC15031 chromosome, complete genome	4031742	910683	971138	4031742	transposase,protease	Synechococcus_phage(33.33%)	43	NA	NA
WP_004247335.1|910683_912159_-|protease	serralysin family metalloprotease	protease	NA	NA	NA	NA
WP_087740894.1|912648_914712_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_087740893.1|914942_916907_-|protease	metalloprotease	protease	NA	NA	NA	NA
WP_087740892.1|917213_919178_-|protease	metalloprotease	protease	NA	NA	NA	NA
WP_004244894.1|919642_920527_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_087740891.1|920520_921777_-	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_004247343.1|922145_923531_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_049201682.1|923587_924232_-	beta-phosphoglucomutase	NA	A0A1D8KNV9	Synechococcus_phage	23.2	3.7e-06
WP_134736356.1|924224_926942_-	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
WP_049198675.1|926967_928389_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_004244888.1|928507_929476_-	HTH-type transcriptional regulator TreR	NA	NA	NA	NA	NA
WP_004244887.1|929638_930091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004244885.1|930087_930912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004247348.1|931552_931837_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004247349.1|931981_932542_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_049201673.1|932731_933304_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_004247351.1|933364_935887_+	fimbria/pilus outer membrane usher protein	NA	NA	NA	NA	NA
WP_087740889.1|935922_936654_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_004247353.1|936685_937114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004252417.1|937106_937640_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_004247355.1|937639_938176_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_004247356.1|938188_939340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247357.1|939678_940536_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004244871.1|940509_941301_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004244870.1|941942_942248_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_026090475.1|947316_949254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001985440.1|949358_950612_+	TolC family protein	NA	NA	NA	NA	NA
WP_017628323.1|950636_952799_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	31.5	6.2e-29
WP_001985443.1|952818_954078_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_036894352.1|954345_955023_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004247370.1|955152_956481_-	putrescine-ornithine antiporter	NA	NA	NA	NA	NA
WP_087740888.1|956544_958707_-	ornithine decarboxylase SpeF	NA	NA	NA	NA	NA
WP_107034653.1|959080_959188_-	DUF2618 domain-containing protein	NA	NA	NA	NA	NA
WP_004244852.1|960328_961099_-	phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_087740887.1|962085_963396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087740886.1|964364_966125_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_087740885.1|966276_967302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062814457.1|967739_968294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012367552.1|968290_968995_+	TIGR03759 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_004244842.1|969319_969898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004244841.1|969901_970171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012367553.1|970397_970670_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_004247373.1|970889_971138_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	38.5	2.9e-07
>prophage 2
NZ_CP048787	Proteus mirabilis strain CC15031 chromosome, complete genome	4031742	1075368	1086712	4031742		Mycobacterium_phage(25.0%)	12	NA	NA
WP_004246075.1|1075368_1076568_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.6	3.8e-28
WP_049216863.1|1077176_1078145_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.0	3.5e-133
WP_004252248.1|1078170_1080297_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.3	1.5e-205
WP_004246072.1|1080325_1080730_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	38.5	3.7e-12
WP_004246071.1|1080741_1080966_-	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	47.9	1.4e-13
WP_004246069.1|1081247_1081721_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_004246068.1|1081918_1082128_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	74.2	5.9e-22
WP_004246058.1|1082585_1082960_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	52.0	2.7e-25
WP_004246057.1|1082975_1083941_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_134736556.1|1084042_1084687_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_026090527.1|1085038_1085302_-	YbeD family protein	NA	NA	NA	NA	NA
WP_004246054.1|1085500_1086712_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	49.1	8.6e-105
>prophage 3
NZ_CP048787	Proteus mirabilis strain CC15031 chromosome, complete genome	4031742	1110054	1165837	4031742	portal,holin,integrase,coat,tRNA,lysis,tail	Salmonella_phage(16.28%)	72	1131316:1131372	1167914:1167970
WP_004246028.1|1110054_1111485_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_017827457.1|1111697_1112885_+	2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase	NA	NA	NA	NA	NA
WP_087740868.1|1112933_1113764_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_004246024.1|1113817_1114930_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.2	7.3e-34
WP_004246023.1|1114949_1115225_-	formaldehyde-responsive transcriptional repressor FrmR	NA	NA	NA	NA	NA
WP_004246020.1|1116628_1117861_-	ROK family transcriptional regulator	NA	NA	NA	NA	NA
WP_004246019.1|1117870_1119034_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_004247451.1|1119156_1119963_-	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_004246016.1|1120308_1122354_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_026164649.1|1122581_1123583_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	44.3	1.9e-70
WP_004246013.1|1123539_1123785_-	excisionase	NA	NA	NA	NA	NA
WP_134736555.1|1124408_1124636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163801659.1|1124595_1124799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163801661.1|1124956_1125202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109023890.1|1125194_1125449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080047895.1|1125558_1125744_-	hook protein	NA	NA	NA	NA	NA
WP_063691711.1|1125774_1126200_-	single-stranded DNA-binding protein	NA	A0A1W6JNW8	Morganella_phage	75.2	1.5e-51
WP_163801663.1|1126189_1126888_-	YqaJ viral recombinase family protein	NA	A0A2R2Z325	Escherichia_phage	57.3	1.5e-74
WP_049199150.1|1126884_1127811_-	recombinase RecT	NA	F1C5B8	Cronobacter_phage	66.2	1.5e-109
WP_049199148.1|1127807_1128029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081261671.1|1128028_1128463_-	SAM-dependent methyltransferase	NA	A0A1W6JP48	Morganella_phage	72.0	3.9e-60
WP_063693270.1|1128495_1128771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163801665.1|1128991_1129900_-	cell envelope biogenesis protein TolA	NA	A0A2I7QK72	Vibrio_phage	47.3	1.3e-20
WP_163801667.1|1130514_1130799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163801669.1|1130828_1131104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063073722.1|1131120_1131309_-	hypothetical protein	NA	A0A068C8G2	Acinetobacter_phage	50.9	3.7e-07
1131316:1131372	attL	TCCTATCTATTAATCAACTCGCCACAGCCCACCTTGATGGACTGTAATTAGTTAACT	NA	NA	NA	NA
WP_135024775.1|1131502_1131991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163801670.1|1132006_1132324_-	hypothetical protein	NA	A0A1W6JNZ0	Morganella_phage	51.4	7.1e-19
WP_049264714.1|1132929_1133307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163801672.1|1133598_1134237_-	S24 family peptidase	NA	A0A1W6JNY2	Morganella_phage	62.0	5.2e-61
WP_154611330.1|1134332_1134560_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004247721.1|1134721_1135060_+	transcriptional regulator	NA	A0A1P8DTF0	Proteus_phage	92.9	5.4e-49
WP_163801673.1|1135081_1135777_+	phage regulatory protein/antirepressor Ant	NA	A0A1P8DTE1	Proteus_phage	83.1	2.2e-97
WP_163801675.1|1135773_1136859_+	DNA replication protein	NA	E5AGE9	Erwinia_phage	49.9	3.5e-81
WP_163801678.1|1136858_1138235_+	replicative DNA helicase	NA	E5AGF0	Erwinia_phage	58.3	5.4e-156
WP_163801679.1|1138254_1138590_+	hypothetical protein	NA	A0A1C9LVV9	Vibrio_phage	39.9	5.4e-25
WP_163801681.1|1138603_1138861_+	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_049216821.1|1139071_1139326_+	hypothetical protein	NA	A0A1P8DTF4	Proteus_phage	98.8	1.2e-45
WP_163801683.1|1139550_1139997_+	recombination protein NinB	NA	A0A1W6JNZ4	Morganella_phage	56.7	1.8e-36
WP_163801685.1|1140002_1140227_+	DUF3310 domain-containing protein	NA	A0A0A6Z5B6	Enterobacter_phage	73.9	2.3e-24
WP_036976904.1|1140500_1141121_+	bacteriophage Lambda NinG protein	NA	A0A2I7RAC0	Vibrio_phage	53.1	4.3e-44
WP_063693385.1|1141120_1141312_+	hypothetical protein	NA	A0A1P8DTD3	Proteus_phage	96.8	1.0e-28
WP_163801687.1|1141308_1142064_+	antitermination protein	NA	G0ZNC6	Cronobacter_phage	45.8	4.6e-48
WP_014656499.1|1142488_1142878_+	membrane protein	NA	S4TRS4	Salmonella_phage	35.0	4.2e-13
WP_004918415.1|1142874_1143168_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_036976899.1|1143154_1143487_+	M15 family peptidase	NA	F1BUL3	Cronobacter_phage	70.3	4.4e-35
WP_163801690.1|1143488_1143941_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	61.8	3.9e-34
WP_142836734.1|1144073_1144301_+	DUF2560 family protein	NA	A0A192Y6S9	Salmonella_phage	53.4	8.7e-11
WP_163801692.1|1144355_1144724_+	hypothetical protein	NA	R9VYK9	Serratia_phage	41.4	2.6e-20
WP_163801693.1|1144720_1145161_+	ubiquitin carboxyl-hydrolase	NA	Q716H4	Shigella_phage	51.7	3.3e-30
WP_163801695.1|1145138_1146572_+	DNA packaging protein	NA	Q2A0C1	Sodalis_phage	76.3	1.3e-221
WP_163801697.1|1146574_1148665_+|portal	portal protein	portal	A0A2H4FNE2	Salmonella_phage	66.3	6.8e-235
WP_104459283.1|1148679_1149594_+	scaffolding protein	NA	A0A192Y6T4	Salmonella_phage	61.5	1.1e-91
WP_063108518.1|1149593_1150877_+|coat	coat protein	coat	G5DA99	Enterobacteria_phage	67.6	4.4e-168
WP_036970140.1|1150928_1151132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124740862.1|1151109_1151607_+	recombinase RmuC	NA	A0A2D1GLR5	Escherichia_phage	61.9	5.7e-47
WP_113707119.1|1152121_1153360_+	hypothetical protein	NA	Q9T1S0	Acyrthosiphon_pisum_secondary_endosymbiont_phage	69.6	3.2e-147
WP_124740861.1|1153359_1154058_+|tail	phage tail protein	tail	Q9AYZ3	Salmonella_phage	42.9	4.4e-37
WP_036970131.1|1154057_1154519_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	70.7	2.7e-59
WP_036970128.1|1154512_1155172_+	hypothetical protein	NA	Q2A0B2	Sodalis_phage	68.1	6.6e-59
WP_036970125.1|1155181_1156627_+	phage DNA ejection protein	NA	A0A1R3Y5Q4	Salmonella_virus	41.9	2.0e-84
WP_163801699.1|1156626_1158657_+	lytic transglycosylase domain-containing protein	NA	Q716G2	Shigella_phage	50.1	4.5e-167
WP_163801701.1|1158723_1160184_+	hypothetical protein	NA	Q9AYY6	Salmonella_phage	78.9	4.0e-48
WP_163801702.1|1160180_1160948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163801704.1|1160928_1161171_-	DNA polymerase III subunit theta	NA	A0A1P8DTI0	Proteus_phage	94.5	2.1e-31
WP_026164649.1|1161446_1162448_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	44.3	1.9e-70
WP_004246013.1|1162404_1162650_-	excisionase	NA	NA	NA	NA	NA
WP_134736555.1|1163273_1163501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_134736554.1|1163647_1163827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_134736553.1|1163961_1164645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017827452.1|1164716_1165226_-	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	57.3	4.9e-54
WP_017827451.1|1165225_1165837_-	single-stranded DNA-binding protein	NA	A0A1W6JP21	Morganella_phage	69.2	1.1e-73
1167914:1167970	attR	TCCTATCTATTAATCAACTCGCCACAGCCCACCTTGATGGACTGTAATTAGTTAACT	NA	NA	NA	NA
>prophage 4
NZ_CP048787	Proteus mirabilis strain CC15031 chromosome, complete genome	4031742	1169026	1208881	4031742	lysis,tail	Cronobacter_phage(18.92%)	56	NA	NA
WP_017827445.1|1169026_1169344_-	hypothetical protein	NA	A0A1W6JNZ0	Morganella_phage	52.3	9.3e-19
WP_060556508.1|1169788_1170244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060556509.1|1170240_1170819_-	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_060556510.1|1170815_1171115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163801707.1|1171179_1171824_-	LexA family transcriptional regulator	NA	A0A077KGZ5	Edwardsiella_phage	64.0	4.7e-78
WP_004247477.1|1171929_1172139_+	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	83.3	1.2e-25
WP_004247478.1|1172284_1172632_+	hypothetical protein	NA	A0A1W6JNY4	Morganella_phage	72.9	8.3e-37
WP_060556512.1|1172897_1173665_+	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	51.9	1.5e-22
WP_012367618.1|1173664_1175050_+	helicase	NA	Q716D2	Shigella_phage	47.7	1.0e-114
WP_163801709.1|1175075_1175525_+	hypothetical protein	NA	A0A2H4FNF5	Salmonella_phage	32.2	1.7e-13
WP_004245984.1|1175603_1175894_+	DUF1364 domain-containing protein	NA	A0A2H4JIC4	uncultured_Caudovirales_phage	68.1	7.2e-34
WP_004245983.1|1175890_1176247_+	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	71.6	3.2e-44
WP_004247487.1|1176246_1176879_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	34.3	7.3e-23
WP_004247148.1|1177189_1177711_+	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_004247488.1|1177869_1178292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247489.1|1178345_1178615_+	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	53.5	6.0e-19
WP_080047831.1|1178614_1179085_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	61.2	2.4e-47
WP_163801711.1|1179227_1179689_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	46.5	9.7e-25
WP_004247494.1|1180036_1180621_+	Bro-N domain-containing protein	NA	Q3LZN7	Bacteriophage	48.2	2.0e-22
WP_004245979.1|1180617_1180824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004245977.1|1181006_1181615_+	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	69.6	4.4e-65
WP_004247496.1|1181617_1183105_+	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	88.8	1.3e-264
WP_004247497.1|1183104_1184475_+	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	48.6	5.3e-119
WP_163801713.1|1184471_1185593_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	51.2	3.9e-104
WP_004247499.1|1185662_1185908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247500.1|1186004_1186766_+	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	59.3	2.6e-67
WP_004247501.1|1186779_1187733_+	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	71.9	1.1e-126
WP_107033975.1|1187735_1188020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004245968.1|1188059_1188539_+	hypothetical protein	NA	G8C7P9	Escherichia_phage	47.7	2.9e-32
WP_004247502.1|1188541_1188892_+	hypothetical protein	NA	I6PD77	Cronobacter_phage	45.1	4.9e-21
WP_004247503.1|1188893_1189475_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	51.6	3.0e-47
WP_004247504.1|1189471_1189873_+	DUF4128 domain-containing protein	NA	NA	NA	NA	NA
WP_004247505.1|1189918_1190575_+	hypothetical protein	NA	G8C7Q3	Escherichia_phage	57.7	8.6e-59
WP_004245960.1|1190626_1190932_+	hypothetical protein	NA	I6PDG2	Cronobacter_phage	55.4	6.6e-22
WP_051008871.1|1190946_1191234_+	hypothetical protein	NA	A0A2H4J4F7	uncultured_Caudovirales_phage	49.3	6.9e-13
WP_004247508.1|1191262_1191469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004247509.1|1191621_1191993_+	hypothetical protein	NA	E7C9U7	Salmonella_phage	65.7	4.4e-36
WP_004247510.1|1192006_1192189_-	hypothetical protein	NA	A0A192Y6A8	Salmonella_phage	76.3	3.7e-20
WP_109880200.1|1192523_1193525_+	hypothetical protein	NA	A0A0R6PIZ6	Moraxella_phage	31.0	1.8e-36
WP_046334559.1|1193797_1194631_-	antirepressor	NA	I6S627	Salmonella_phage	55.6	3.7e-67
WP_004245955.1|1194700_1194862_-	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_046334560.1|1194975_1195233_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_049257266.1|1195229_1196123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046334561.1|1196160_1197030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247511.1|1197089_1200029_+|tail	phage tail tape measure protein	tail	A0A2P0WA05	Enterobacter_phage	35.4	1.2e-141
WP_004247512.1|1200051_1200264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247513.1|1200303_1200594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247514.1|1200613_1200814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004247516.1|1200957_1201299_+|tail	phage tail protein	tail	I6PBN7	Cronobacter_phage	50.0	9.0e-28
WP_004247517.1|1201295_1202039_+|tail	phage minor tail protein L	tail	K7PJS0	Enterobacterial_phage	58.6	7.1e-86
WP_004247518.1|1202035_1202746_+	C40 family peptidase	NA	A0A1P8DTI6	Proteus_phage	62.0	8.9e-86
WP_004247519.1|1202742_1203348_+|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	56.8	1.9e-52
WP_004247520.1|1203399_1207593_+	DUF1983 domain-containing protein	NA	F1C571	Cronobacter_phage	54.5	1.7e-301
WP_004245936.1|1207586_1207955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247523.1|1207956_1208571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247524.1|1208620_1208881_+	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	57.4	1.9e-17
>prophage 5
NZ_CP048787	Proteus mirabilis strain CC15031 chromosome, complete genome	4031742	1383574	1462577	4031742	plate,tRNA,protease	Bacillus_phage(23.53%)	58	NA	NA
WP_004244558.1|1383574_1383889_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.1	1.5e-13
WP_004244559.1|1383919_1386214_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.9	1.3e-170
WP_004244560.1|1386333_1386552_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_012367702.1|1386871_1387564_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_004244562.1|1387565_1389317_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	22.8	4.0e-18
WP_017628444.1|1389319_1391089_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	23.5	3.0e-21
WP_004244564.1|1391227_1392187_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.8	9.0e-65
WP_004244566.1|1392729_1393224_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_162279491.1|1393351_1397143_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.3	1.3e-90
WP_004244569.1|1397255_1397861_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_012367706.1|1397871_1399221_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.6	1.8e-79
WP_004244571.1|1399354_1400644_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.2	4.1e-97
WP_104459800.1|1400812_1401145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049236236.1|1401544_1402594_+	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_004244574.1|1402666_1403572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004244575.1|1403928_1404669_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	27.0	2.3e-20
WP_004244576.1|1404776_1407059_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.6	1.0e-159
WP_004244577.1|1407113_1407968_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_036900836.1|1408638_1410396_-	30S ribosomal protein S12 methylthiotransferase accessory factor YcaO	NA	NA	NA	NA	NA
WP_004244579.1|1410623_1411661_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_012367709.1|1411735_1413004_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_017628442.1|1413140_1414571_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	25.1	4.4e-07
WP_004244582.1|1414707_1415796_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	47.0	5.7e-84
WP_012367711.1|1415992_1417279_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_004244585.1|1417567_1418245_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_004244586.1|1418426_1420100_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_004244587.1|1420164_1420452_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.0	8.4e-11
WP_017628440.1|1420894_1423264_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q0H255	Geobacillus_phage	29.3	3.6e-22
WP_004244589.1|1423300_1425046_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.9	8.4e-61
WP_134736440.1|1425042_1426044_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_004247631.1|1426539_1426755_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_004244593.1|1427169_1427349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004244594.1|1427353_1428115_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_134736439.1|1428238_1429072_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_004244596.1|1429451_1430225_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_004244597.1|1430234_1431557_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_004247634.1|1431537_1432269_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_049217979.1|1432265_1436723_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_004244601.1|1437005_1437659_-	type A chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	79.0	1.0e-99
WP_004247637.1|1438064_1438778_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_004251995.1|1439169_1440885_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_004244605.1|1441216_1441765_+	YcbK family protein	NA	NA	NA	NA	NA
WP_134736438.1|1441814_1442465_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_004244607.1|1442557_1443031_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_004244608.1|1443121_1444858_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_004244609.1|1444850_1446206_-	membrane protein	NA	NA	NA	NA	NA
WP_004244610.1|1446243_1449792_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_110144416.1|1449794_1451258_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_004244612.1|1451263_1451914_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_004244614.1|1451915_1452704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_134736437.1|1452707_1455419_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.7	4.9e-84
WP_004244617.1|1455427_1456183_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004244618.1|1456175_1457543_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004244619.1|1457535_1458087_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004247648.1|1458088_1459357_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_163801718.1|1459361_1460399_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_049218375.1|1460362_1462138_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004244624.1|1462145_1462577_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 6
NZ_CP048787	Proteus mirabilis strain CC15031 chromosome, complete genome	4031742	1622712	1693108	4031742	portal,integrase,transposase,head,tRNA,tail,capsid,lysis,terminase,protease	Morganella_phage(16.67%)	82	1626433:1626447	1682137:1682151
WP_004247117.1|1622712_1623816_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_004247118.1|1623921_1624374_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004247119.1|1624366_1624996_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_004247120.1|1625134_1626388_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.6e-21
1626433:1626447	attL	TTTTTATTATCAATA	NA	NA	NA	NA
WP_004247122.1|1626508_1627636_-|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	60.3	1.4e-125
WP_004251672.1|1627616_1627859_-	excisionase	NA	NA	NA	NA	NA
WP_004247124.1|1627920_1628451_-	hypothetical protein	NA	A0A1W6JP41	Morganella_phage	58.6	5.7e-53
WP_004247125.1|1628507_1629335_-	YfdQ family protein	NA	A0A2R2Z323	Escherichia_phage	56.6	5.5e-79
WP_004247126.1|1629400_1629775_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	71.4	3.2e-42
WP_004247127.1|1629798_1629981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004247128.1|1630423_1630906_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	51.4	3.7e-11
WP_004247129.1|1631009_1631249_+	helix-turn-helix domain-containing protein	NA	D0UIL8	Aggregatibacter_phage	54.8	3.0e-14
WP_004247130.1|1631333_1631792_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	50.8	3.9e-26
WP_004247132.1|1632080_1632260_+	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	55.2	1.1e-11
WP_004247133.1|1632272_1633364_+	hypothetical protein	NA	H2DE83	Erwinia_phage	55.3	8.2e-30
WP_004247134.1|1633535_1634243_+	phage regulatory protein/antirepressor Ant	NA	G0ZND1	Cronobacter_phage	51.7	5.6e-56
WP_004247135.1|1634242_1635268_+	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	47.6	2.8e-88
WP_004247136.1|1635295_1635694_+	antitermination protein	NA	Q8W638	Enterobacteria_phage	55.0	1.0e-30
WP_004247137.1|1636036_1636249_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	75.7	7.6e-25
WP_004247148.1|1636650_1637172_+	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_004251632.1|1637495_1637831_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_004251618.1|1637934_1638861_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004251614.1|1639277_1639700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004251611.1|1639752_1640022_+	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	52.3	6.7e-18
WP_163801724.1|1640021_1640492_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	62.5	2.6e-49
WP_004251606.1|1640634_1641096_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	46.3	1.4e-23
WP_004242468.1|1641993_1642332_+	HNH endonuclease	NA	F1C587	Cronobacter_phage	67.9	5.4e-41
WP_017628364.1|1642450_1642918_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	59.7	1.6e-43
WP_017628363.1|1642871_1644605_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	46.6	3.1e-148
WP_017628362.1|1644604_1645873_+|portal	phage portal protein	portal	Q77W97	Enterobacteria_phage	80.4	1.8e-201
WP_004242476.1|1645890_1646559_+|head,protease	HK97 family phage prohead protease	head,protease	K7PM91	Enterobacterial_phage	65.8	6.6e-83
WP_017628361.1|1646562_1647729_+|capsid	phage major capsid protein	capsid	F1C582	Cronobacter_phage	79.5	1.6e-169
WP_017628360.1|1647767_1648067_+	hypothetical protein	NA	K7PKV5	Enterobacterial_phage	65.3	5.7e-34
WP_017628359.1|1648066_1648396_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_017628358.1|1648385_1648859_+	hypothetical protein	NA	A0A0R6PHU8	Moraxella_phage	30.2	8.2e-11
WP_017628357.1|1648864_1649206_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_017628356.1|1649215_1649881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628355.1|1649945_1650362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628354.1|1650358_1650637_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_004242485.1|1650661_1650853_-	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_017628353.1|1650979_1654255_+|tail	phage tail tape measure protein	tail	B7SE05	Pseudomonas_virus	46.7	2.9e-54
WP_017628352.1|1654255_1654852_+	hypothetical protein	NA	S4TSP7	Salmonella_phage	52.3	1.6e-51
WP_017628351.1|1654851_1655433_+	hypothetical protein	NA	Q7Y3Z7	Yersinia_phage	50.5	8.1e-53
WP_049219722.1|1655449_1655785_+	hypothetical protein	NA	Q775B6	Bordetella_phage	35.3	3.7e-10
WP_049219720.1|1655863_1656262_+	hypothetical protein	NA	A0A059VK01	Pseudomonas_phage	46.2	7.1e-32
WP_049219718.1|1660668_1661007_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_049219717.1|1661150_1661399_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_081041966.1|1661452_1663762_-	hypothetical protein	NA	A0A2L1IV32	Escherichia_phage	60.3	2.2e-16
WP_049219712.1|1664323_1664524_+	hypothetical protein	NA	Q77Z09	Phage_21	92.6	3.3e-22
WP_134736583.1|1664943_1665396_+	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	92.4	6.5e-66
WP_134736582.1|1665481_1666576_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_134736581.1|1666619_1667201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017827607.1|1667629_1667782_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	6.8e-20
WP_049219711.1|1667926_1668085_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_134736580.1|1668403_1669609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_134736579.1|1670893_1672018_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_004247907.1|1672457_1672670_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	78.6	2.0e-25
WP_134736578.1|1673002_1673461_+	Hsp20 family protein	NA	NA	NA	NA	NA
WP_004242517.1|1673951_1674413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247909.1|1674535_1674910_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004242519.1|1674999_1675848_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_004242521.1|1676087_1676285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087740799.1|1676308_1676851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004242524.1|1677690_1678005_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012367820.1|1678379_1678640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004247912.1|1678648_1679290_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	47.8	2.4e-50
WP_004251487.1|1679302_1680529_-	DUF3440 domain-containing protein	NA	A0A220GKF8	Streptococcus_phage	33.2	2.0e-61
WP_004247914.1|1681086_1681749_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_012367822.1|1682310_1682667_+	hypothetical protein	NA	NA	NA	NA	NA
1682137:1682151	attR	TATTGATAATAAAAA	NA	NA	NA	NA
WP_134736577.1|1683324_1684320_+	DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_004242534.1|1685204_1685426_+	DUF465 domain-containing protein	NA	NA	NA	NA	NA
WP_004242536.1|1685852_1686134_+	DUF5339 domain-containing protein	NA	NA	NA	NA	NA
WP_134736576.1|1686502_1686916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004251481.1|1686943_1687186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_134736575.1|1687248_1687809_-	AAA family ATPase	NA	A0A219VHB7	Ochrobactrum_phage	49.4	5.7e-19
WP_004242542.1|1688184_1688382_+	ParD-like family protein	NA	NA	NA	NA	NA
WP_004242544.1|1688399_1689176_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_004242548.1|1689410_1689794_+	antitermination protein	NA	A0A1W6JNX1	Morganella_phage	47.8	2.3e-24
WP_004247922.1|1689936_1690800_+	triacylglycerol lipase	NA	NA	NA	NA	NA
WP_004247923.1|1690910_1691342_-	hypothetical protein	NA	Q7Y3V7	Yersinia_phage	38.1	1.8e-20
WP_036894048.1|1691460_1691877_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	62.8	2.0e-45
WP_163801726.1|1691899_1693108_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	81.3	2.5e-189
>prophage 7
NZ_CP048787	Proteus mirabilis strain CC15031 chromosome, complete genome	4031742	1908231	1918223	4031742		Escherichia_phage(66.67%)	8	NA	NA
WP_049210313.1|1908231_1910289_-	potassium-transporting ATPase subunit KdpB	NA	E4ZFI9	Streptococcus_phage	26.1	4.8e-31
WP_004248043.1|1910300_1912001_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_004242887.1|1912336_1913023_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_004242888.1|1913022_1913484_+	nucleoside deaminase	NA	S4VYZ2	Pandoravirus	34.6	7.0e-15
WP_004242890.1|1913536_1914148_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	39.1	7.3e-28
WP_004242891.1|1914287_1915148_-	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	35.5	3.7e-25
WP_004242892.1|1915149_1915767_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.6	2.2e-72
WP_017628118.1|1915778_1918223_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	50.4	5.6e-220
>prophage 8
NZ_CP048787	Proteus mirabilis strain CC15031 chromosome, complete genome	4031742	2449302	2468111	4031742	lysis,holin	Burkholderia_phage(26.67%)	22	NA	NA
WP_012368081.1|2449302_2451741_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	54.5	5.0e-261
WP_004243609.1|2451752_2452370_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	67.8	1.3e-88
WP_004243611.1|2452373_2453150_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	39.8	5.1e-42
WP_004243612.1|2453265_2453808_-	DUF924 domain-containing protein	NA	A0A1V0SIY0	Klosneuvirus	34.7	1.9e-19
WP_017628013.1|2454376_2454556_+	GhoT/OrtT family toxin	NA	NA	NA	NA	NA
WP_049236711.1|2454659_2455865_-	hypothetical protein	NA	Q6IWQ6	Burkholderia_phage	34.1	2.4e-14
WP_004243615.1|2455870_2456527_-	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	39.9	2.3e-35
WP_017628010.1|2456523_2457711_-	hypothetical protein	NA	A0A2H5BG53	Pseudoalteromonas_phage	37.7	1.9e-72
WP_004243617.1|2457703_2458048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243621.1|2458044_2458737_-	hypothetical protein	NA	A0A2H4P6V3	Pseudomonas_phage	35.7	1.2e-29
WP_004243622.1|2458739_2459552_-	hypothetical protein	NA	Q6IWQ0	Burkholderia_phage	39.2	9.0e-42
WP_004243623.1|2459520_2459841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152118395.1|2459853_2460348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049198725.1|2460350_2462654_-	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	23.1	2.0e-14
WP_004243627.1|2462736_2463195_-	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	48.5	1.9e-25
WP_004243628.1|2463253_2463706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017628008.1|2463716_2465204_-	DUF3383 domain-containing protein	NA	A0A088C3U1	Shewanella_sp._phage	35.7	1.4e-77
WP_004248364.1|2465212_2465725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017628007.1|2465761_2466211_-|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_017628006.1|2466207_2466612_-	hypothetical protein	NA	A0A0E3JJ20	Enterobacteria_phage	46.6	1.0e-25
WP_004248367.1|2466614_2466914_-|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	51.0	1.9e-21
WP_004243640.1|2467295_2468111_-	antitermination protein	NA	M9NZB0	Enterobacteria_phage	43.4	2.1e-54
>prophage 9
NZ_CP048787	Proteus mirabilis strain CC15031 chromosome, complete genome	4031742	2953145	2969946	4031742	integrase	Morganella_phage(61.54%)	21	2948243:2948264	2968805:2968826
2948243:2948264	attL	AATGGTACGCCCTACAGGATTC	NA	NA	NA	NA
WP_163801761.1|2953145_2956376_-	hypothetical protein	NA	A0A1W6JNU2	Morganella_phage	42.4	1.1e-101
WP_036900256.1|2956392_2956734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072271821.1|2956733_2956907_-	3-hydroxybutyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_036918875.1|2957078_2957591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163801763.1|2957665_2958103_-	osmoprotectant transporter ProQ	NA	A0A1W6JPI6	Morganella_phage	60.3	5.1e-15
WP_163748685.1|2958422_2961170_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	47.5	2.9e-225
WP_115286924.1|2961166_2961511_-	hypothetical protein	NA	A0A1W6JPD8	Morganella_phage	71.9	6.3e-45
WP_115286925.1|2961525_2962122_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	38.8	2.2e-29
WP_036900272.1|2962121_2962316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163748683.1|2962485_2963097_-	ORF6N domain-containing protein	NA	A0A1B5FPC0	Escherichia_phage	44.6	4.0e-18
WP_163748681.1|2963093_2963303_-	hypothetical protein	NA	A0A1W6JPF1	Morganella_phage	52.2	1.4e-10
WP_115286929.1|2963299_2963479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115286930.1|2963475_2963733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071843629.1|2963735_2963909_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_163801820.1|2963901_2964933_-	ash family protein	NA	A0A1W6JPK3	Morganella_phage	52.1	1.5e-81
WP_163801765.1|2964953_2965562_-	antirepressor protein	NA	A0A1W6JPH8	Morganella_phage	68.8	1.4e-71
WP_109829123.1|2965574_2965970_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	56.9	2.1e-28
WP_049257508.1|2965969_2966188_-	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	45.3	8.6e-08
WP_152691671.1|2966304_2967222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104836667.1|2967429_2968641_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	55.7	3.8e-129
WP_017627899.1|2969073_2969946_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	36.8	9.7e-34
2968805:2968826	attR	AATGGTACGCCCTACAGGATTC	NA	NA	NA	NA
>prophage 10
NZ_CP048787	Proteus mirabilis strain CC15031 chromosome, complete genome	4031742	3232118	3240998	4031742		Caulobacter_phage(50.0%)	9	NA	NA
WP_004245601.1|3232118_3233687_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.7	7.2e-11
WP_004245602.1|3234087_3234768_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_004245603.1|3234864_3235440_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	40.3	1.2e-27
WP_004249446.1|3235516_3236095_-	tellurium resistance membrane protein TerD	NA	K4JRX3	Caulobacter_phage	41.5	2.4e-33
WP_004245605.1|3236162_3237188_-	TerC/Alx family metal homeostasis membrane protein	NA	K7QKE8	Escherichia_phage	47.9	1.3e-74
WP_004245607.1|3237222_3237678_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_163801775.1|3237702_3238875_-	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_004250201.1|3238875_3239460_-	tellurium resistance-associated protein TerZ	NA	K4JRX3	Caulobacter_phage	30.2	4.2e-17
WP_017628546.1|3239852_3240998_+	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	27.2	4.5e-31
>prophage 11
NZ_CP048787	Proteus mirabilis strain CC15031 chromosome, complete genome	4031742	3307544	3349227	4031742	transposase,integrase	Escherichia_phage(52.94%)	43	3304504:3304563	3349532:3349594
3304504:3304563	attL	AAAATAATAAAAGCAGACTTGACCTGATAGTTTGGCTGTGAGCAATTATGTGCTTAGTGC	NA	NA	NA	NA
WP_015057121.1|3307544_3308504_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.5	1.7e-47
3304504:3304563	attL	AAAATAATAAAAGCAGACTTGACCTGATAGTTTGGCTGTGAGCAATTATGTGCTTAGTGC	NA	NA	NA	NA
WP_001067855.1|3308394_3309099_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000184001.1|3309252_3310458_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000376616.1|3310613_3310817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|3310904_3311609_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_063102497.1|3311802_3312189_+	bleomycin binding protein	NA	NA	NA	NA	NA
WP_000084745.1|3312508_3312901_-	NimC/NimA family protein	NA	NA	NA	NA	NA
WP_001067858.1|3313096_3313801_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_124743826.1|3313964_3314804_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|3314797_3315145_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001749986.1|3315367_3315820_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
3315188:3315258	attR	AAAATAATAAAAGCAGACTTGACCTGATAGTTTGGCTGTGAGCAATTATGTGCTTAGTGCATCTAACGCCG	NA	NA	NA	NA
WP_000186237.1|3315904_3316537_-	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
3315188:3315258	attR	AAAATAATAAAAGCAGACTTGACCTGATAGTTTGGCTGTGAGCAATTATGTGCTTAGTGCATCTAACGCCG	NA	NA	NA	NA
WP_001334766.1|3316674_3317505_-	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_063840321.1|3317635_3318190_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001067855.1|3318333_3319038_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001199192.1|3319151_3319928_+	aminoglycoside N-acetyltransferase AAC(3)-IV	NA	NA	NA	NA	NA
WP_000742814.1|3320156_3321182_+	aminoglycoside O-phosphotransferase APH(4)-Ia	NA	NA	NA	NA	NA
WP_000602738.1|3321603_3322356_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
WP_061456197.1|3324166_3324652_+	phenol hydroxylase	NA	NA	NA	NA	NA
WP_085940648.1|3324848_3325939_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_001043260.1|3326028_3326844_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_000251875.1|3326930_3327233_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001445143.1|3327126_3327378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015344975.1|3327408_3328902_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001255015.1|3329013_3329319_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000214122.1|3329346_3330561_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	1.2e-18
WP_001447541.1|3330777_3331662_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_001067784.1|3332586_3333291_+|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
WP_046788546.1|3333375_3333777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124785907.1|3333785_3336737_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.4	0.0e+00
WP_001067858.1|3337118_3337823_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000434930.1|3338420_3339047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014342101.1|3339449_3339572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013188475.1|3339551_3340427_+	class A extended-spectrum beta-lactamase CTX-M-65	NA	A0A1B0VBP7	Salmonella_phage	98.9	6.8e-152
WP_013362812.1|3340461_3341430_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	100.0	1.6e-186
WP_001067855.1|3343180_3343885_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|3344014_3344830_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|3345019_3345724_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001038045.1|3346556_3347216_-	tetracycline resistance transcriptional repressor TetR(C)	NA	NA	NA	NA	NA
WP_053409934.1|3347308_3348499_+	tetracycline efflux MFS transporter Tet(C)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.0	8.1e-07
WP_002310911.1|3348402_3348741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071533317.1|3348737_3348923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000015696.1|3348948_3349227_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
3349532:3349594	attR	GGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTTCA	NA	NA	NA	NA
>prophage 12
NZ_CP048787	Proteus mirabilis strain CC15031 chromosome, complete genome	4031742	3393840	3424280	4031742	integrase,transposase	Escherichia_phage(25.0%)	27	3405185:3405199	3411261:3411275
WP_002001451.1|3393840_3395025_+|transposase	IS4-like element ISEc29 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	35.4	4.5e-50
WP_121523926.1|3395873_3396107_+	recombinase family protein	NA	NA	NA	NA	NA
WP_000155092.1|3396296_3397181_-	Mph(E) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000052512.1|3397236_3398712_-	ABC-F type ribosomal protection protein Msr(E)	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
WP_163801597.1|3399074_3399218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011789342.1|3399159_3399921_+|transposase	IS5-like element ISSpu10 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	32.2	8.3e-13
WP_001067855.1|3400042_3400747_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|3400897_3401713_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_000985631.1|3402190_3405169_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
3405185:3405199	attL	TATTAAATGTACGAT	NA	NA	NA	NA
WP_000348524.1|3407342_3407786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497807.1|3408250_3409225_+	ParM/StbA family protein	NA	NA	NA	NA	NA
WP_001995600.1|3409227_3409497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163801789.1|3409498_3410740_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A291AWU1	Escherichia_phage	39.5	3.8e-76
WP_000211147.1|3410869_3412888_-	DNA mismatch repair protein	NA	NA	NA	NA	NA
3411261:3411275	attR	ATCGTACATTTAATA	NA	NA	NA	NA
WP_000127615.1|3413033_3413222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036973667.1|3413660_3413753_-	peptide chain release factor 3	NA	NA	NA	NA	NA
WP_004249304.1|3414122_3414659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004249303.1|3414648_3415569_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_004245652.1|3415880_3416327_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_004245653.1|3416295_3416706_-	DNA polymerase III subunit psi	NA	NA	NA	NA	NA
WP_004245656.1|3416835_3417849_+	16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC	NA	NA	NA	NA	NA
WP_017628532.1|3417969_3418233_-	DUF1435 family protein	NA	NA	NA	NA	NA
WP_004245658.1|3418416_3418959_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004245660.1|3418955_3420593_-	Na/Pi cotransporter family protein	NA	NA	NA	NA	NA
WP_012368409.1|3421021_3422461_-	alkaline phosphatase	NA	NA	NA	NA	NA
WP_163801790.1|3422632_3423841_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	81.5	3.1e-187
WP_012368599.1|3423863_3424280_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	62.8	1.5e-45
>prophage 13
NZ_CP048787	Proteus mirabilis strain CC15031 chromosome, complete genome	4031742	3903501	3949806	4031742	integrase,transposase,tRNA	Salmonella_phage(20.0%)	37	3911274:3911287	3952305:3952318
WP_004246627.1|3903501_3904530_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_163801808.1|3904590_3905799_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	81.5	2.3e-190
WP_012368720.1|3905821_3906238_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	62.0	3.4e-45
WP_049217556.1|3906318_3906993_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_004249861.1|3907110_3907734_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.5	6.4e-64
WP_134736601.1|3908101_3910060_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	39.1	2.8e-89
WP_004246621.1|3910224_3910536_+	DUF485 domain-containing protein	NA	NA	NA	NA	NA
WP_163801810.1|3910532_3912188_+	cation acetate symporter	NA	NA	NA	NA	NA
3911274:3911287	attL	AAAGGCTTTTCTAT	NA	NA	NA	NA
WP_012368601.1|3912510_3914142_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_163801812.1|3914181_3914937_-|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	53.1	9.1e-105
WP_147715593.1|3914959_3915376_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	63.5	2.0e-45
WP_049217438.1|3915462_3916155_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_004246616.1|3916158_3917577_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_017628596.1|3917567_3918305_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_004249867.1|3924204_3924891_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012368605.1|3924971_3926369_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_134736377.1|3926450_3927377_-	ribokinase	NA	NA	NA	NA	NA
WP_134736378.1|3927657_3929157_+	ATPase RavA	NA	A0A0N9PBE1	Sulfolobus_monocaudavirus	37.3	1.1e-21
WP_004246605.1|3929164_3930622_+	ATPase RavA stimulator ViaA	NA	NA	NA	NA	NA
WP_004246604.1|3930622_3931615_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.5	1.3e-50
WP_004246603.1|3931775_3932237_+	transcriptional regulator AsnC	NA	NA	NA	NA	NA
WP_004249871.1|3932337_3932778_+	FMN-binding protein MioC	NA	NA	NA	NA	NA
WP_004246600.1|3933157_3935056_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_134736379.1|3935052_3935679_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_004246598.1|3936293_3936671_+	F0F1 ATP synthase subunit I	NA	NA	NA	NA	NA
WP_004246597.1|3936702_3937527_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_004246596.1|3937572_3937812_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_004246595.1|3937873_3938344_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_004246594.1|3938356_3938890_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_004246592.1|3938904_3940446_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_004246591.1|3940503_3941367_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_004246589.1|3941401_3942784_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_004246588.1|3942805_3943222_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_004246587.1|3943372_3944746_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7P8	Chrysochromulina_ericina_virus	32.3	9.6e-28
WP_004246586.1|3944903_3946730_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1I9J5	Paramecium_bursaria_Chlorella_virus	44.6	1.2e-131
WP_001029679.1|3946889_3947711_+|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
WP_000267723.1|3947697_3949806_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
3952305:3952318	attR	ATAGAAAAGCCTTT	NA	NA	NA	NA
