The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP048627	Megamonas funiformis strain JCM 14723 chromosome, complete genome	2522577	41687	104583	2522577	protease,transposase	Helicobacter_phage(18.18%)	57	NA	NA
WP_163604654.1|41687_42797_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0H3UZC2	Geobacillus_virus	45.6	2.1e-86
WP_008539180.1|42905_43475_+	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_008539179.1|43526_44423_-	DMT family transporter	NA	NA	NA	NA	NA
WP_008539178.1|44446_45862_-	GntP family permease	NA	NA	NA	NA	NA
WP_008539177.1|45927_46815_-	myo-inosose-2 dehydratase	NA	NA	NA	NA	NA
WP_008540262.1|47258_48110_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_008540263.1|48155_48467_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_008539176.1|50012_50933_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_008539175.1|51052_51886_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_008539174.1|51930_52941_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_008539172.1|53148_54177_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_008539171.1|54298_54901_-	cytidylate kinase-like family protein	NA	NA	NA	NA	NA
WP_008539170.1|54929_56309_-	MFS transporter	NA	NA	NA	NA	NA
WP_008539168.1|56447_57473_-	inositol 2-dehydrogenase	NA	NA	NA	NA	NA
WP_008539167.1|57817_58735_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_008539166.1|58929_59499_+	DUF3793 family protein	NA	NA	NA	NA	NA
WP_008539165.1|59522_59954_+	flavodoxin	NA	NA	NA	NA	NA
WP_008539164.1|60101_61229_+	DUF362 domain-containing protein	NA	NA	NA	NA	NA
WP_008539163.1|61470_62154_+	membrane protein	NA	NA	NA	NA	NA
WP_008539162.1|62257_62833_+	hydrolase	NA	NA	NA	NA	NA
WP_008539161.1|62898_64182_-	adenylosuccinate synthase	NA	A0A0B5J049	Pandoravirus	31.8	1.1e-60
WP_008539159.1|64223_65519_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.2	8.2e-21
WP_117464361.1|65861_66257_+|transposase	IS200/IS605 family transposase	transposase	G9CU69	Helicobacter_phage	60.9	2.3e-43
WP_163604655.1|66285_67392_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	G9CU70	Helicobacter_phage	49.5	2.4e-77
WP_008539154.1|67489_68827_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	49.0	5.5e-113
WP_008539153.1|68840_70820_-|protease	ATP-dependent protease, Lon family	protease	A0A0R6PGP8	Moraxella_phage	25.5	2.0e-26
WP_008539152.1|70829_71273_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_008539151.1|71244_73254_-	DHH family phosphoesterase	NA	NA	NA	NA	NA
WP_008539150.1|73265_74219_-	YybS family protein	NA	NA	NA	NA	NA
WP_008539149.1|74353_75508_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_039881461.1|75500_75929_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_008539147.1|76291_76837_+	NADH peroxidase	NA	NA	NA	NA	NA
WP_008539146.1|76993_78298_+	M18 family aminopeptidase	NA	NA	NA	NA	NA
WP_008539144.1|78316_79264_+	D-2-hydroxyacid dehydrogenase	NA	M1I636	Acanthocystis_turfacea_Chlorella_virus	29.5	6.2e-10
WP_008539141.1|79314_79689_-	desulfoferrodoxin	NA	NA	NA	NA	NA
WP_008539139.1|79716_81813_-	glycogen debranching protein	NA	NA	NA	NA	NA
WP_008539137.1|81825_82167_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_008539136.1|82530_84435_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_008539135.1|84472_85384_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_008539134.1|85384_86128_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_008539133.1|86316_87177_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	27.8	1.4e-29
WP_008539132.1|87493_88600_+	hydrogenase small subunit	NA	NA	NA	NA	NA
WP_008539131.1|88606_90508_+	nickel-dependent hydrogenase large subunit	NA	NA	NA	NA	NA
WP_008539130.1|90500_91232_+	Ni/Fe-hydrogenase, b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_008539128.1|91247_91490_+	cation transporter	NA	NA	NA	NA	NA
WP_008539125.1|91539_91881_+	hydrogenase maturation nickel metallochaperone HypA	NA	NA	NA	NA	NA
WP_008539124.1|91881_92556_+	hydrogenase nickel incorporation protein HypB	NA	NA	NA	NA	NA
WP_008539123.1|92558_93035_+	HyaD/HybD family hydrogenase maturation endopeptidase	NA	NA	NA	NA	NA
WP_008539122.1|93010_95320_+	carbamoyltransferase HypF	NA	NA	NA	NA	NA
WP_008539121.1|95335_95599_+	HypC/HybG/HupF family hydrogenase formation chaperone	NA	NA	NA	NA	NA
WP_008539120.1|95549_96647_+	hydrogenase formation protein HypD	NA	NA	NA	NA	NA
WP_039881468.1|96709_97699_+	hydrogenase expression/formation protein HypE	NA	NA	NA	NA	NA
WP_008539118.1|97970_99317_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_008539117.1|99676_101674_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	47.9	7.4e-154
WP_163604656.1|101754_102267_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_163604657.1|102221_103115_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	56.1	8.6e-78
WP_008539112.1|103473_104583_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
>prophage 2
NZ_CP048627	Megamonas funiformis strain JCM 14723 chromosome, complete genome	2522577	612408	619713	2522577		Staphylococcus_phage(66.67%)	9	NA	NA
WP_008538650.1|612408_613203_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	31.1	3.9e-21
WP_008538649.1|613214_613406_-	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
WP_008538648.1|613487_613817_-	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
WP_008538647.1|613844_614822_-	polyprenyl synthetase family protein	NA	A0A1V0SE37	Indivirus	24.2	4.5e-11
WP_008538646.1|615069_615876_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_008538644.1|616183_617311_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	33.1	4.8e-49
WP_008538643.1|617315_617963_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	40.0	2.5e-34
WP_008538642.1|617981_619181_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	6.5e-105
WP_008538641.1|619245_619713_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	63.3	3.5e-46
>prophage 3
NZ_CP048627	Megamonas funiformis strain JCM 14723 chromosome, complete genome	2522577	813101	861139	2522577	tRNA,transposase,protease	Geobacillus_virus(20.0%)	42	NA	NA
WP_163604674.1|813101_814208_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	G9CU70	Helicobacter_phage	49.1	1.1e-85
WP_008538414.1|814319_816017_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_008538413.1|816272_817055_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.4	2.9e-29
WP_008538412.1|817057_818731_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_008538411.1|818727_819744_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_008538410.1|819907_821002_+	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_008538409.1|821058_821826_+	phosphonoacetaldehyde hydrolase	NA	NA	NA	NA	NA
WP_008538408.1|822024_822198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008538407.1|822229_823015_-|tRNA	tRNA 2-thiocytidine biosynthesis protein TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	30.2	8.2e-24
WP_008538405.1|823253_824897_+	putative manganese-dependent inorganic diphosphatase	NA	NA	NA	NA	NA
WP_008538396.1|825116_825566_+|transposase	IS200/IS605 family transposase	transposase	A0A0H3UZM0	Geobacillus_virus	31.1	6.8e-15
WP_008538403.1|825663_827166_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_008538402.1|827582_828185_+	LUD domain-containing protein	NA	NA	NA	NA	NA
WP_008538401.1|828216_830388_+	LUD domain-containing protein	NA	NA	NA	NA	NA
WP_008538400.1|830416_831208_+	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_008538399.1|831222_832419_+	electron transfer flavoprotein subunit alpha	NA	NA	NA	NA	NA
WP_008538398.1|832415_833813_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_008538397.1|833955_836241_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	42.9	3.8e-146
WP_008538396.1|836440_836890_+|transposase	IS200/IS605 family transposase	transposase	A0A0H3UZM0	Geobacillus_virus	31.1	6.8e-15
WP_050900408.1|837531_837954_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_039881432.1|838014_840015_+	NAD-dependent DNA ligase LigA	NA	Q332J4	Clostridium_botulinum_C_phage	36.5	4.0e-99
WP_008538392.1|840088_840985_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_008538391.1|841091_842519_-	MFS transporter	NA	NA	NA	NA	NA
WP_008538390.1|842680_842971_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_008538389.1|843011_844475_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_008538388.1|844474_845902_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_008538387.1|846085_847192_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_008538386.1|847188_849438_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	39.3	4.5e-107
WP_008538385.1|849463_850789_+|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_008538384.1|850830_851373_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_008538383.1|851387_852782_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	29.2	8.2e-43
WP_008538382.1|852916_853690_+	GTP-sensing pleiotropic transcriptional regulator CodY	NA	NA	NA	NA	NA
WP_008538381.1|853930_854659_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_008538379.1|854743_855391_+	translation elongation factor Ts	NA	NA	NA	NA	NA
WP_008538378.1|855573_856299_+	UMP kinase	NA	NA	NA	NA	NA
WP_008538377.1|856298_856856_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_008538376.1|856860_857061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008538375.1|857064_857232_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_008538374.1|857315_858092_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	45.5	1.6e-27
WP_008538373.1|858116_858941_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_008538372.1|858959_860111_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_008538371.1|860104_861139_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
>prophage 4
NZ_CP048627	Megamonas funiformis strain JCM 14723 chromosome, complete genome	2522577	956928	999844	2522577	plate,integrase,tail,terminase,tRNA	Clostridium_phage(26.92%)	56	952073:952088	987583:987598
952073:952088	attL	TTTGCAATATCTTTTT	NA	NA	NA	NA
WP_008538275.1|956928_957669_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_008538273.1|959256_960363_-|integrase	site-specific integrase	integrase	A0A0A8WIE1	Clostridium_phage	28.7	1.2e-25
WP_008538272.1|960468_960729_+	DUF4160 domain-containing protein	NA	NA	NA	NA	NA
WP_008538271.1|960763_961117_+	DUF2442 domain-containing protein	NA	NA	NA	NA	NA
WP_008538270.1|961121_961364_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_008538269.1|961408_962506_-	SAP domain-containing protein	NA	NA	NA	NA	NA
WP_163604675.1|962560_963010_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_008538267.1|963135_963333_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_008538266.1|963422_963575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008538265.1|963595_964624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008538264.1|964626_964923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008538263.1|964961_965453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154645558.1|965457_965874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008538260.1|966011_967985_+	AAA family ATPase	NA	A0A1L2K2K3	Aeribacillus_phage	30.6	1.9e-77
WP_008538259.1|968000_968804_+	hypothetical protein	NA	S4U0C4	uncultured_phage	53.3	1.2e-57
WP_008538258.1|968823_969633_+	MBL fold metallo-hydrolase	NA	A0A1L2JY21	Aeribacillus_phage	45.2	1.3e-51
WP_008538257.1|969637_970099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008538256.1|970100_970709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163604676.1|970724_971567_+	DnaD domain protein	NA	NA	NA	NA	NA
WP_008538254.1|971553_972159_+	ATP-binding protein	NA	S4U0J1	uncultured_phage	38.9	3.5e-30
WP_008538253.1|972163_972472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008538252.1|972473_972758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008538251.1|972802_973180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008538250.1|973189_973648_+	DUF3850 domain-containing protein	NA	J9QD24	Clostridium_phage	48.8	1.4e-12
WP_008538249.1|973625_974129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008538247.1|974121_974619_+	hypothetical protein	NA	S4TZY4	uncultured_phage	38.8	5.4e-13
WP_008538245.1|974625_974808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154645557.1|974794_975226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008538243.1|975243_975717_+	hypothetical protein	NA	A0A2H4PBD2	Lactobacillus_phage	36.4	1.1e-07
WP_008538241.1|975969_976173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008538239.1|976384_976879_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_163604677.1|977138_977894_+	ParB N-terminal domain-containing protein	NA	F8J155	Lactobacillus_virus	51.8	5.2e-68
WP_008538237.1|977886_978753_+	hypothetical protein	NA	X2CXE2	Lactobacillus_phage	48.8	5.2e-72
WP_008538236.1|978836_979778_+	radical SAM protein	NA	NA	NA	NA	NA
WP_008538234.1|979823_980255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154645566.1|980283_981654_+|terminase	terminase B	terminase	B6SBS6	Clostridium_virus	50.8	1.1e-127
WP_008538231.1|983139_984108_+	hypothetical protein	NA	A0A0N7ACI5	Bacillus_phage	37.3	1.2e-53
WP_050900407.1|984125_985421_+	hypothetical protein	NA	A0A0A8WFF1	Clostridium_phage	42.0	1.1e-68
WP_008538229.1|985439_986138_+	DUF2190 family protein	NA	A0A0A8WJN5	Clostridium_phage	45.9	1.2e-21
WP_008538228.1|986151_987186_+	hypothetical protein	NA	A0A0A8WEW9	Clostridium_phage	57.2	4.3e-113
WP_008538227.1|987198_987561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008538226.1|987557_987947_+	hypothetical protein	NA	NA	NA	NA	NA
987583:987598	attR	AAAAAGATATTGCAAA	NA	NA	NA	NA
WP_008538225.1|987957_988371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008538223.1|988374_989241_+	DUF3168 domain-containing protein	NA	A0A0N7ACG6	Bacillus_phage	39.3	2.1e-49
WP_008538222.1|989240_989465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008538220.1|989481_990948_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A0N7AEC6	Bacillus_phage	33.6	8.6e-75
WP_008538219.1|990962_991397_+|tail	phage tail tube protein	tail	A0A0N7ACS0	Bacillus_phage	46.9	1.3e-34
WP_050900419.1|991516_991915_+	XkdN	NA	A0A2H4J883	uncultured_Caudovirales_phage	42.4	9.6e-21
WP_008538216.1|992086_995092_+|tail	phage tail tape measure protein	tail	A0A059T5F4	Listeria_phage	45.9	1.1e-31
WP_008538215.1|995096_995873_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0N7ACL7	Bacillus_phage	40.3	1.2e-27
WP_008538214.1|995869_996895_+	hypothetical protein	NA	A0A0N6W8H4	Bacillus_phage	42.8	5.1e-74
WP_008538213.1|996878_997262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008538211.1|997264_997717_+	DUF2634 domain-containing protein	NA	A0A0A7RUS1	Clostridium_phage	30.9	1.4e-12
WP_008538210.1|997716_998403_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	32.6	1.0e-22
WP_008538209.1|998418_998841_+|plate	baseplate J/gp47 family protein	plate	A0A0A7S0L4	Clostridium_phage	37.2	3.1e-17
WP_163604678.1|998830_999844_+	DUF2313 domain-containing protein	NA	S6BFJ0	Thermus_phage	31.3	1.2e-11
>prophage 5
NZ_CP048627	Megamonas funiformis strain JCM 14723 chromosome, complete genome	2522577	1156978	1181465	2522577	holin,head,terminase,integrase	Pseudomonas_phage(25.0%)	32	1171644:1171660	1181218:1181234
WP_008538014.1|1156978_1158424_+	ParB N-terminal domain-containing protein	NA	A0A0E3U266	Fusobacterium_phage	37.4	2.1e-81
WP_008538012.1|1158465_1158654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008538010.1|1158695_1159190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008538009.1|1159192_1160542_+|terminase	phage terminase large subunit	terminase	A0A2H4P855	Pseudomonas_phage	38.0	4.3e-81
WP_008538008.1|1160574_1161870_+	DUF1073 domain-containing protein	NA	A0A2K9V3H1	Faecalibacterium_phage	33.9	4.8e-53
WP_050900405.1|1161862_1162639_+|head	phage head morphogenesis protein	head	A9DEG6	Yersinia_phage	32.0	1.1e-23
WP_008538006.1|1162654_1163713_+	DUF2213 domain-containing protein	NA	E5AGA6	Erwinia_phage	38.9	9.3e-55
WP_008538005.1|1163717_1164167_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_008538004.1|1164172_1165162_+	DUF2184 domain-containing protein	NA	A0A0N9SG07	Pseudomonas_phage	33.9	3.3e-38
WP_154645550.1|1165172_1165412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008538002.1|1165401_1165797_+	DUF4054 domain-containing protein	NA	NA	NA	NA	NA
WP_008538001.1|1165793_1166237_+	hypothetical protein	NA	A0A2K9V3I1	Faecalibacterium_phage	39.6	3.8e-18
WP_008538000.1|1166241_1166583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008537999.1|1166575_1167103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008537998.1|1167102_1168458_+	DUF3383 family protein	NA	A0A0N9SJA3	Pseudomonas_phage	39.5	7.7e-78
WP_008537997.1|1168471_1168906_+	DUF3277 family protein	NA	NA	NA	NA	NA
WP_143052061.1|1168902_1169439_+	hypothetical protein	NA	A0A0N9RR02	Pseudomonas_phage	25.5	3.6e-07
WP_008537993.1|1169601_1171677_+	tape measure protein	NA	H9EB42	Vibrio_phage	34.5	1.1e-27
1171644:1171660	attL	ATTAGATTTTCCACCAT	NA	NA	NA	NA
WP_008537992.1|1171689_1172400_+	hypothetical protein	NA	E5AGB8	Erwinia_phage	29.0	3.6e-10
WP_008537991.1|1172413_1172755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008537989.1|1172729_1173620_+	hypothetical protein	NA	A0A2K9V3M6	Faecalibacterium_phage	30.8	2.7e-31
WP_008537987.1|1173616_1174213_+	hypothetical protein	NA	A0A0K1YAB2	Cronobacter_phage	29.6	2.3e-10
WP_008537986.1|1174227_1174605_+	hypothetical protein	NA	I3PGV7	Xanthomonas_phage	39.4	8.2e-14
WP_008537985.1|1174588_1176019_+	hypothetical protein	NA	A0A2K9V3N8	Faecalibacterium_phage	31.1	4.6e-57
WP_008537984.1|1176011_1176698_+	DUF2612 domain-containing protein	NA	W8EDG3	Pseudomonas_phage	31.5	1.8e-14
WP_163604683.1|1176694_1177843_+	hypothetical protein	NA	A0A2H4J9C3	uncultured_Caudovirales_phage	36.3	7.8e-23
WP_163604684.1|1177839_1178097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163604685.1|1178108_1178339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008537982.1|1178583_1179603_-|integrase	tyrosine-type recombinase/integrase	integrase	H7BVE3	unidentified_phage	34.4	4.0e-47
WP_008537981.1|1179668_1180133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163604686.1|1180253_1180703_+|holin	phage holin family protein	holin	M9Q253	Clostridium_phage	40.6	8.6e-18
WP_008537977.1|1180916_1181465_+	N-acetylmuramoyl-L-alanine amidase	NA	M4ZRP4	Bacillus_phage	35.2	3.1e-14
1181218:1181234	attR	ATGGTGGAAAATCTAAT	NA	NA	NA	NA
>prophage 6
NZ_CP048627	Megamonas funiformis strain JCM 14723 chromosome, complete genome	2522577	1314496	1321716	2522577		Prochlorococcus_phage(28.57%)	8	NA	NA
WP_039881320.1|1314496_1314841_-	helix-turn-helix transcriptional regulator	NA	Q786F1	Bacillus_phage	43.3	4.4e-06
WP_008537824.1|1315191_1316463_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_008537823.1|1316550_1317144_-	IMP cyclohydrolase	NA	E3SNU8	Prochlorococcus_phage	54.5	1.6e-48
WP_008537822.1|1317178_1317793_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	41.3	6.0e-30
WP_008537821.1|1317785_1318853_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.0	9.6e-68
WP_008537820.1|1318875_1320309_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.7	2.2e-67
WP_008537819.1|1320423_1321134_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	39.3	2.7e-42
WP_008537818.1|1321224_1321716_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	45.3	1.0e-24
>prophage 7
NZ_CP048627	Megamonas funiformis strain JCM 14723 chromosome, complete genome	2522577	1373956	1389488	2522577	holin,integrase,terminase,protease,capsid	Clostridium_phage(33.33%)	20	1372536:1372551	1380082:1380097
1372536:1372551	attL	ATATAAAAGCTCATAA	NA	NA	NA	NA
WP_083826925.1|1373956_1374421_-|holin	phage holin family protein	holin	M9Q253	Clostridium_phage	45.6	1.9e-20
WP_008537749.1|1374434_1374731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008537748.1|1374723_1374867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008537746.1|1375113_1375551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008537745.1|1375594_1376617_+|integrase	tyrosine-type recombinase/integrase	integrase	H7BVE3	unidentified_phage	33.7	3.5e-43
WP_154645545.1|1376807_1377023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039881314.1|1377311_1377551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008537741.1|1377551_1377827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008537740.1|1377988_1378243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008537739.1|1378478_1379105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008537738.1|1379085_1380255_-	hypothetical protein	NA	NA	NA	NA	NA
1380082:1380097	attR	ATATAAAAGCTCATAA	NA	NA	NA	NA
WP_008537737.1|1380267_1381791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008537736.1|1381790_1382441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008537735.1|1382455_1383529_-|capsid	N4-gp56 family major capsid protein	capsid	A0A248SKT9	Klebsiella_phage	27.4	9.5e-31
WP_008537734.1|1383560_1384742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008537733.1|1384747_1385104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008537732.1|1385117_1387286_-	hypothetical protein	NA	Q8W6I4	Sinorhizobium_phage	23.2	1.1e-33
WP_008537730.1|1387292_1387616_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_008537729.1|1387636_1389049_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0S0KEN9	Bacillus_phage	54.1	2.5e-71
WP_008537728.1|1389041_1389488_-|terminase	terminase small subunit	terminase	A0A0A8WDX8	Clostridium_phage	33.8	5.2e-15
>prophage 8
NZ_CP048627	Megamonas funiformis strain JCM 14723 chromosome, complete genome	2522577	1397596	1509673	2522577	plate,holin,integrase,tail,lysis,terminase,transposase,tRNA,portal,capsid	Clostridium_phage(33.33%)	105	1444989:1445009	1490227:1490247
WP_008537717.1|1397596_1398562_-|lysis	5-bromo-4-chloroindolyl phosphate hydrolysis family protein	lysis	NA	NA	NA	NA
WP_008537716.1|1398758_1399250_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_008537715.1|1399386_1399647_-	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_008537714.1|1399647_1399896_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_008537710.1|1401386_1402493_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	G9CU70	Helicobacter_phage	45.8	7.1e-82
WP_008537708.1|1402955_1403429_+	nucleoside deaminase	NA	NA	NA	NA	NA
WP_008537707.1|1403507_1404434_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_008537706.1|1404437_1407998_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_008537704.1|1408037_1409069_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_008537703.1|1409252_1409897_-	HAD hydrolase-like protein	NA	NA	NA	NA	NA
WP_008537702.1|1410047_1411241_-	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
WP_008537701.1|1411256_1411745_-	membrane protein	NA	NA	NA	NA	NA
WP_008537700.1|1411759_1412398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008537699.1|1412560_1413424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008537698.1|1413442_1414201_-	creatininase family protein	NA	NA	NA	NA	NA
WP_008537696.1|1414233_1415718_-	sodium:solute symporter family protein	NA	NA	NA	NA	NA
WP_008537694.1|1415723_1415966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008537693.1|1416169_1418125_+	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_008537688.1|1420869_1423122_-	alpha-galactosidase	NA	NA	NA	NA	NA
WP_008537687.1|1423396_1425316_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2H4UUX5	Bodo_saltans_virus	28.4	1.7e-51
WP_008537685.1|1425377_1425764_-	thioesterase family protein	NA	NA	NA	NA	NA
WP_008537684.1|1426049_1427312_+	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_008537683.1|1427371_1429336_-	glycoside hydrolase family 127 protein	NA	NA	NA	NA	NA
WP_008537682.1|1429379_1430726_-	MFS transporter	NA	NA	NA	NA	NA
WP_008537681.1|1430964_1431855_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_008537680.1|1431924_1432515_+	viroplasmin family protein	NA	D9J0S8	Brochothrix_phage	37.3	2.1e-11
WP_008537679.1|1432552_1433584_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	43.8	5.1e-74
WP_008537678.1|1434058_1434799_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_008537677.1|1434810_1435494_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	24.9	2.9e-09
WP_008537676.1|1435578_1435956_+	PH domain-containing protein	NA	A6N235	Microbacterium_phage	37.7	3.1e-13
WP_008537675.1|1436043_1438935_+	DEAD/DEAH box helicase	NA	Q3V5F4	Corynebacterium_phage	27.6	8.5e-26
WP_008537673.1|1438999_1439503_-	cell division protein SepF	NA	NA	NA	NA	NA
WP_008537672.1|1439735_1441550_-	translational GTPase TypA	NA	A0A1B0RXH7	Streptococcus_phage	39.9	1.3e-19
WP_008537671.1|1441688_1442570_-	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_008537670.1|1442717_1443404_-	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_008537669.1|1443433_1444552_-	aldo/keto reductase	NA	NA	NA	NA	NA
1444989:1445009	attL	ATGGTACCAAAATGGTACCTC	NA	NA	NA	NA
WP_008537975.1|1445225_1445432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008537976.1|1445434_1445710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163604692.1|1445726_1446272_-	N-acetylmuramoyl-L-alanine amidase	NA	M4ZRP4	Bacillus_phage	34.8	1.4e-14
WP_163604693.1|1446485_1446935_-|holin	phage holin family protein	holin	M9Q253	Clostridium_phage	40.6	3.8e-18
WP_008537667.1|1446975_1448025_+|integrase	site-specific integrase	integrase	A0A0E3Y5J2	Fusobacterium_phage	32.1	1.0e-37
WP_008537666.1|1448144_1448309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008537665.1|1448301_1448712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039881526.1|1449367_1449652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163604694.1|1449648_1451196_-	hypothetical protein	NA	A0A1V0DY51	Dinoroseobacter_phage	64.3	3.4e-05
WP_008537663.1|1451209_1451683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163604695.1|1451679_1452705_-	DUF2313 domain-containing protein	NA	A0A2H4J717	uncultured_Caudovirales_phage	32.7	1.6e-11
WP_008537661.1|1452688_1453723_-|plate	baseplate J/gp47 family protein	plate	A0A0A7RUN3	Clostridium_phage	40.0	6.1e-59
WP_008537660.1|1453715_1454138_-	DUF2634 domain-containing protein	NA	A0A0A7S0E2	Clostridium_phage	46.9	2.0e-24
WP_008537658.1|1454130_1454553_-	DUF2577 domain-containing protein	NA	NA	NA	NA	NA
WP_163604726.1|1454562_1455387_-	hypothetical protein	NA	A0A0K2SUC1	Clostridium_phage	29.8	7.5e-28
WP_154645564.1|1455524_1456223_-	hypothetical protein	NA	A0A0N7ACF7	Bacillus_phage	29.9	5.4e-11
WP_008537653.1|1456240_1459543_-|tail	phage tail tape measure protein	tail	A0A288WG88	Bacillus_phage	31.9	1.8e-40
WP_008537652.1|1459738_1460095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008537651.1|1460121_1460580_-|tail	phage tail tube protein	tail	A0A0A8WF55	Clostridium_phage	48.2	2.8e-32
WP_008537650.1|1460593_1461802_-	hypothetical protein	NA	A0A0A8WJR2	Clostridium_phage	39.8	4.0e-62
WP_039881311.1|1461814_1462255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008537648.1|1462251_1462650_-	HK97 gp10 family phage protein	NA	S6B9X8	Thermus_phage	36.0	2.5e-05
WP_039881310.1|1462646_1463015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008537647.1|1462993_1463383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008537645.1|1463453_1463714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008537644.1|1463725_1465600_-|capsid	minor capsid protein	capsid	A0A1P8BLD7	Lactococcus_phage	32.6	5.8e-60
WP_008537643.1|1465609_1466578_-	hypothetical protein	NA	A0A0A8WJ45	Clostridium_phage	60.6	4.9e-103
WP_008537642.1|1466577_1467216_-	phage scaffolding protein	NA	S5M9M5	Brevibacillus_phage	39.3	5.8e-28
WP_008537641.1|1467228_1467711_-	collagen-like protein	NA	NA	NA	NA	NA
WP_008537640.1|1467715_1467928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008537639.1|1467927_1469334_-|portal	phage portal protein	portal	A0A0A7S0I9	Clostridium_phage	54.0	5.8e-145
WP_008537637.1|1469346_1470597_-|terminase	PBSX family phage terminase large subunit	terminase	B6CXD2	Clostridium_phage	48.3	2.8e-111
WP_008537636.1|1470577_1471258_-	hypothetical protein	NA	A0A0A8WJN3	Clostridium_phage	43.3	4.7e-36
WP_008537635.1|1471433_1471739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008537633.1|1471904_1472120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008537632.1|1472265_1473627_-	DEAD/DEAH box helicase	NA	S5MA26	Brevibacillus_phage	52.1	9.6e-137
WP_008537631.1|1473627_1473918_-	VRR-NUC domain-containing protein	NA	A0A1S7FZ22	Listeria_phage	46.7	1.4e-13
WP_008537630.1|1474112_1476545_-	hypothetical protein	NA	A0A0A7RTG3	Clostridium_phage	51.3	1.1e-239
WP_008537629.1|1476560_1478222_-	PcfJ domain-containing protein	NA	NA	NA	NA	NA
WP_008537628.1|1478232_1478577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008537626.1|1478619_1480596_-	DNA polymerase	NA	A0A0A7RTL3	Clostridium_phage	52.8	1.6e-188
WP_008537625.1|1480617_1481202_-	DUF2815 family protein	NA	A0A0A7RVM4	Clostridium_phage	52.3	1.8e-44
WP_008537624.1|1481216_1482374_-	DUF2800 domain-containing protein	NA	A0A0A7S066	Clostridium_phage	46.6	3.9e-91
WP_008537623.1|1482370_1482790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008537622.1|1482846_1483008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008537621.1|1483012_1483333_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_008537620.1|1483512_1483893_+	DUF2513 domain-containing protein	NA	Q3HQY9	Burkholderia_phage	30.1	1.4e-05
WP_008537619.1|1483895_1484102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008537618.1|1484114_1484471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039881372.1|1484513_1484717_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_008537616.1|1484856_1485483_+	helix-turn-helix domain-containing protein	NA	A0A139ZPI6	Marinitoga_camini_virus	39.2	5.9e-33
WP_008537615.1|1485502_1486114_+	helix-turn-helix domain-containing protein	NA	Q4ZD53	Staphylococcus_phage	33.8	3.5e-22
WP_008537614.1|1486125_1487058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008537612.1|1487285_1488092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008537611.1|1488093_1488963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008537610.1|1489037_1490222_+|integrase	site-specific integrase	integrase	S5MNZ2	Brevibacillus_phage	28.5	2.5e-32
WP_008537609.1|1490576_1491056_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
1490227:1490247	attR	ATGGTACCAAAATGGTACCTC	NA	NA	NA	NA
WP_008537608.1|1491104_1491554_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_008537607.1|1491694_1495237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_117464125.1|1495955_1496447_+	biotin transporter BioY	NA	NA	NA	NA	NA
WP_008537605.1|1496460_1497894_+	serine hydrolase	NA	NA	NA	NA	NA
WP_008537604.1|1498589_1500047_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	48.4	9.9e-124
WP_163604696.1|1500471_1500867_+|transposase	IS200/IS605 family transposase	transposase	G9CU69	Helicobacter_phage	60.2	8.8e-43
WP_163604698.1|1500895_1502002_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	G9CU70	Helicobacter_phage	49.5	2.4e-77
WP_075555423.1|1502011_1502266_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_008537602.1|1502711_1504034_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_008537601.1|1504037_1506776_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	23.6	4.4e-40
WP_008537600.1|1506780_1508724_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.8	5.6e-74
WP_163604700.1|1508797_1509673_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP048627	Megamonas funiformis strain JCM 14723 chromosome, complete genome	2522577	2237189	2243695	2522577		Enterobacteria_phage(50.0%)	7	NA	NA
WP_008539588.1|2237189_2237783_+	hypothetical protein	NA	A0A1U9WQS3	Geobacillus_phage	26.6	6.4e-05
WP_008539587.1|2237836_2238682_-	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	34.8	1.0e-32
WP_008539586.1|2238729_2239749_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	47.6	1.0e-82
WP_008539585.1|2239748_2240312_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	46.2	1.7e-39
WP_008539584.1|2240299_2241190_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	62.3	1.3e-102
WP_008539583.1|2241211_2242657_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_008539582.1|2242678_2243695_-	glycosyltransferase family 8 protein	NA	A0A2P0VP84	Tetraselmis_virus	25.7	2.1e-11
>prophage 10
NZ_CP048627	Megamonas funiformis strain JCM 14723 chromosome, complete genome	2522577	2284023	2349086	2522577	tRNA,transposase	Helicobacter_phage(23.08%)	59	NA	NA
WP_163604716.1|2284023_2285130_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	G9CU70	Helicobacter_phage	47.8	1.7e-83
WP_163604718.1|2285158_2285554_-|transposase	IS200/IS605 family transposase	transposase	G9CU69	Helicobacter_phage	60.2	1.2e-42
WP_008539521.1|2285740_2286571_-	pyridoxamine kinase	NA	NA	NA	NA	NA
WP_008539522.1|2286571_2288224_-	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_008539523.1|2288313_2289975_-	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_008539524.1|2290347_2290923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008539525.1|2291247_2292510_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_008539526.1|2292511_2293006_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_008539527.1|2293014_2294082_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_008539528.1|2294234_2295068_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_008539529.1|2295292_2295670_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_008539531.1|2295693_2296689_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_163604719.1|2296853_2297960_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	G9CU70	Helicobacter_phage	49.8	3.7e-78
WP_008539508.1|2298291_2299185_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	55.2	3.3e-77
WP_163604721.1|2299139_2299652_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_008539505.1|2299731_2300625_-	4-deoxy-4-formamido-L-arabinose- phosphoundecaprenol deformylase	NA	NA	NA	NA	NA
WP_008539503.1|2300712_2301744_-	bifunctional UDP-4-keto-pentose/UDP-xylose synthase	NA	A0A2K9KZK0	Tupanvirus	28.1	6.5e-21
WP_008539501.1|2301781_2302699_-	formyltransferase	NA	NA	NA	NA	NA
WP_008539499.1|2302691_2303645_-	glycosyltransferase	NA	U5P087	Shigella_phage	30.0	1.3e-34
WP_008539498.1|2303655_2304822_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L0G1	Tupanvirus	33.2	1.4e-43
WP_008539497.1|2304854_2306504_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_008539496.1|2306756_2307122_+	EamA family transporter	NA	NA	NA	NA	NA
WP_154645571.1|2307162_2307918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008539494.1|2307978_2309664_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_008539493.1|2309749_2311039_-	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	28.2	3.7e-13
WP_008539492.1|2311040_2311718_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_008539491.1|2312025_2313291_+	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
WP_008539489.1|2313392_2314955_+	metallophosphoesterase family protein	NA	NA	NA	NA	NA
WP_008539488.1|2315148_2316708_+	metallophosphoesterase family protein	NA	NA	NA	NA	NA
WP_008539486.1|2316810_2317944_+	YibE/F family protein	NA	NA	NA	NA	NA
WP_008539483.1|2318025_2318886_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_008539481.1|2319010_2319715_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_008539479.1|2319820_2321107_+	MFS transporter	NA	NA	NA	NA	NA
WP_008539477.1|2321142_2321859_-	HAD family phosphatase	NA	G3MA51	Bacillus_virus	46.7	2.4e-06
WP_008539476.1|2322089_2322356_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_008539474.1|2322474_2324544_+	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_008539473.1|2324562_2325045_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_008539472.1|2325059_2325977_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_008539471.1|2326068_2326686_+	LysE family transporter	NA	NA	NA	NA	NA
WP_008539470.1|2326783_2327386_+	DUF1847 domain-containing protein	NA	NA	NA	NA	NA
WP_008539469.1|2327749_2328964_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_008539468.1|2329126_2329726_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_008539467.1|2329913_2330375_+	HPP family protein	NA	NA	NA	NA	NA
WP_008539465.1|2330395_2330851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039881467.1|2330883_2331756_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_039881466.1|2331745_2333512_+	DNA helicase RecQ	NA	A0A2K9L3P7	Tupanvirus	40.2	5.3e-87
WP_008539462.1|2333552_2335067_+	phosphoglucomutase	NA	NA	NA	NA	NA
WP_008539461.1|2335275_2336505_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_008539460.1|2336564_2337140_-	pyridoxal 5'-phosphate synthase glutaminase subunit PdxT	NA	NA	NA	NA	NA
WP_008539459.1|2337146_2338025_-	pyridoxal 5'-phosphate synthase lyase subunit PdxS	NA	NA	NA	NA	NA
WP_008539458.1|2338142_2339582_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	26.4	8.5e-35
WP_008539457.1|2339595_2340579_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_008539456.1|2340676_2341252_-	cytidylate kinase-like family protein	NA	NA	NA	NA	NA
WP_008539455.1|2341330_2342818_-	fucose isomerase	NA	NA	NA	NA	NA
WP_008539453.1|2343166_2344693_+	xylulokinase	NA	NA	NA	NA	NA
WP_008539452.1|2344722_2346141_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_008539450.1|2346241_2347258_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_075554812.1|2347348_2347975_+|transposase	IS607 family transposase	transposase	Q331Z3	Clostridium_botulinum_C_phage	57.3	1.4e-58
WP_163604723.1|2347952_2349086_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	D2XQ03	Bacillus_virus	64.3	3.3e-135
>prophage 1
NZ_CP048628	Megamonas funiformis strain JCM 14723 plasmid putative_Mfuni1, complete sequence	46189	0	6824	46189	transposase	Clostridium_phage(50.0%)	11	NA	NA
WP_008540214.1|365_671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008540216.1|1547_2117_+	DUF3990 domain-containing protein	NA	NA	NA	NA	NA
WP_008540217.1|2121_2562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008540218.1|2584_2809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008540219.1|3146_3758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008540220.1|3772_4387_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_008540222.1|4791_5163_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_008540223.1|5238_5385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163604731.1|5560_5953_+	helix-turn-helix domain-containing protein	NA	A0A0A8WJK5	Clostridium_phage	29.7	1.7e-06
WP_008540226.1|5980_6190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039881523.1|6191_6824_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	32.9	3.1e-13
>prophage 2
NZ_CP048628	Megamonas funiformis strain JCM 14723 plasmid putative_Mfuni1, complete sequence	46189	25640	31848	46189		Escherichia_phage(50.0%)	6	NA	NA
WP_008540184.1|25640_27449_+	transglycosylase SLT domain-containing protein	NA	I6ZXX9	Escherichia_phage	41.4	1.6e-14
WP_008540185.1|27435_27966_+	signal peptidase I	NA	NA	NA	NA	NA
WP_008540186.1|27972_28722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008540187.1|28760_29279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163604733.1|29296_29587_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_008540190.1|29751_31848_+	DNA topoisomerase 3	NA	A0A1X9I6W8	Streptococcus_phage	28.5	7.8e-37
>prophage 3
NZ_CP048628	Megamonas funiformis strain JCM 14723 plasmid putative_Mfuni1, complete sequence	46189	37528	42791	46189	transposase	Lactobacillus_phage(20.0%)	7	NA	NA
WP_008540202.1|37528_37858_-	single-stranded DNA-binding protein	NA	B8R683	Lactobacillus_phage	38.5	1.7e-10
WP_008540203.1|37873_38188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008540204.1|38253_38784_-	antirestriction protein ArdA	NA	A0A0A8WIV6	Clostridium_phage	34.4	2.0e-10
WP_008540205.1|39240_39978_+	AAA family ATPase	NA	A0A0K2FLP4	Brevibacillus_phage	25.6	5.9e-16
WP_008540207.1|39979_40324_+	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_008540208.1|40687_41797_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	G9CU70	Helicobacter_phage	46.8	1.3e-83
WP_008540210.1|41948_42791_+	DNA adenine methylase	NA	A0A1S5PRR3	Streptococcus_phage	46.9	1.3e-67
