The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP048617	Caloranaerobacter azorensis strain T3-1 chromosome, complete genome	2539490	14282	65152	2539490	tRNA,integrase,transposase	Streptococcus_phage(27.27%)	42	29449:29508	65321:65548
WP_163236059.1|14282_16076_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_163234105.1|16252_17488_-|integrase	tyrosine-type recombinase/integrase	integrase	A8ATX2	Listeria_phage	25.0	2.1e-10
WP_163234106.1|17735_18734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035164193.1|18705_19815_+	CoA protein activase	NA	NA	NA	NA	NA
WP_163234107.1|19789_20770_+	2-hydroxyglutaryl-CoA dehydratase	NA	NA	NA	NA	NA
WP_035164195.1|21222_21630_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_163234108.1|21757_23650_+	anaerobic carbon-monoxide dehydrogenase catalytic subunit	NA	NA	NA	NA	NA
WP_163236061.1|23737_24151_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_163234109.1|24152_25346_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_163234110.1|25624_26668_+	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_163234111.1|28436_29426_-	asparaginase	NA	NA	NA	NA	NA
29449:29508	attL	TCGTAGTGTCAAAAGTTTAGAGTAAATTTGACACCCAAACATTAAAATTTGAATAATTTA	NA	NA	NA	NA
WP_163236063.1|29676_31044_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1X9I6E7	Streptococcus_phage	32.5	5.5e-07
WP_163234112.1|31381_31555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163234113.1|32975_34160_+|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_163234114.1|34259_34850_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_035164380.1|34979_36317_+	radical SAM protein	NA	NA	NA	NA	NA
WP_163234115.1|36371_37181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163234116.1|37580_38363_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_163236065.1|38369_38855_+|transposase	IS110 family transposase	transposase	A0A1B1P7S0	Bacillus_phage	33.3	7.6e-12
WP_163236067.1|39276_40644_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1X9I6E7	Streptococcus_phage	32.5	3.2e-07
WP_163234117.1|40894_41743_+	DMT family transporter	NA	NA	NA	NA	NA
WP_035164386.1|41810_42458_-	beta-phosphoglucomutase	NA	A0A1D8KPI1	Synechococcus_phage	29.0	1.2e-15
WP_163234118.1|42610_43615_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_163234119.1|43979_45311_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_163234120.1|45375_46305_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_035165063.1|46315_47137_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_163234121.1|48545_50288_+	sugar phosphorylase	NA	NA	NA	NA	NA
WP_035163335.1|50658_51798_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_163234122.1|51810_52593_+	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_163236065.1|52736_53222_-|transposase	IS110 family transposase	transposase	A0A1B1P7S0	Bacillus_phage	33.3	7.6e-12
WP_163234116.1|53228_54011_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_163234123.1|54411_55425_+	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_163234124.1|55913_57614_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_163234125.1|57662_58307_-	di-trans,poly-cis-decaprenylcistransferase	NA	A0A076FI83	Aureococcus_anophage	28.6	6.7e-16
WP_163234126.1|58470_59343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163234127.1|59339_59948_+	J domain-containing protein	NA	A0A2H4UVL7	Bodo_saltans_virus	43.5	1.4e-07
WP_163234128.1|59962_60484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163234129.1|60544_61540_+	2-hydroxyacyl-CoA dehydratase	NA	NA	NA	NA	NA
WP_163234130.1|61542_62310_+	2-hydroxyglutaryl-CoA dehydratase	NA	NA	NA	NA	NA
WP_163236069.1|62367_63405_+	MBL fold metallo-hydrolase	NA	Q332B9	Clostridium_botulinum_C_phage	47.1	1.8e-71
WP_163236071.1|63416_63638_+	DUF3006 domain-containing protein	NA	Q0H256	Geobacillus_phage	42.9	1.7e-06
WP_163236067.1|63784_65152_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1X9I6E7	Streptococcus_phage	32.5	3.2e-07
65321:65548	attR	TAAATTATTCAAATTTTAATGTTTGGGTGTCAAATTTACTCTAAACTTTTGACACTACGAATTAGAAAAGGAGGGGAATTTTATGTTAAAAAAATTTAAATTAAGGAATAACTTCATTATTCCTGTATTAATATTTTTGACTTTGATATTAAATTTTTCAACAGCAAGTGCTCAATCTAGTAATACTGGAGTTGTTACATGGATAAATAATCAAGATAAGATAATCGT	NA	NA	NA	NA
>prophage 2
NZ_CP048617	Caloranaerobacter azorensis strain T3-1 chromosome, complete genome	2539490	229249	239760	2539490		Clostridium_phage(33.33%)	17	NA	NA
WP_163236098.1|229249_230944_-	recombinase family protein	NA	A0A0A7RUB1	Clostridium_phage	56.0	2.0e-176
WP_163234242.1|231138_231492_-	helix-turn-helix transcriptional regulator	NA	A0A139ZPI6	Marinitoga_camini_virus	53.6	7.5e-09
WP_163234243.1|231681_231876_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_163234244.1|231956_232127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163234245.1|232107_232389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163234246.1|232391_232562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163234247.1|232552_232810_+	hypothetical protein	NA	A0A0A7RTW4	Clostridium_phage	40.0	1.6e-05
WP_163234248.1|232846_233092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163234249.1|233085_235026_+	AAA family ATPase	NA	A0A1L2K2K3	Aeribacillus_phage	36.9	1.4e-104
WP_163234250.1|235026_235356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163234251.1|236097_236835_+	MBL fold metallo-hydrolase	NA	A0A1L2JY21	Aeribacillus_phage	50.2	3.1e-65
WP_163234252.1|236865_237351_+	replication protein	NA	A0A290FZL4	Caldibacillus_phage	51.3	6.0e-25
WP_163234253.1|237530_237860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163234254.1|237801_238701_+	ATP-binding protein	NA	A0A1Y0T033	Pseudomonas_phage	33.5	3.3e-21
WP_163234255.1|238719_238971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163234256.1|238970_239483_+	Holliday junction resolvase RecU	NA	A0A2H4J2G2	uncultured_Caudovirales_phage	46.6	7.7e-31
WP_163234257.1|239487_239760_+	hypothetical protein	NA	A0A0A7RUP4	Clostridium_phage	50.6	1.5e-12
>prophage 3
NZ_CP048617	Caloranaerobacter azorensis strain T3-1 chromosome, complete genome	2539490	243483	270768	2539490	plate,portal,tail,capsid	Clostridium_phage(35.71%)	37	NA	NA
WP_163234266.1|243483_244038_+	hypothetical protein	NA	A0A097BY45	Enterococcus_phage	31.9	4.5e-08
WP_163236100.1|244190_245426_+	ParB N-terminal domain-containing protein	NA	E4ZFL4	Streptococcus_phage	44.2	1.6e-90
WP_163234267.1|245468_246194_+	helix-turn-helix domain-containing protein	NA	A0A2H4J6P5	uncultured_Caudovirales_phage	39.3	1.1e-25
WP_163236102.1|246186_247587_+	DEAD/DEAH box helicase family protein	NA	H7BVB2	unidentified_phage	57.3	1.7e-157
WP_163234268.1|247599_248943_+|portal	phage portal protein	portal	H7BVB1	unidentified_phage	62.2	5.5e-153
WP_163234269.1|248948_249134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163234270.1|249133_250021_+	hypothetical protein	NA	A0A1L6BY01	Clostridium_phage	43.1	1.5e-58
WP_163234271.1|250129_250663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163234272.1|250720_251251_+	hypothetical protein	NA	A0A249XXA2	Clostridium_phage	54.4	3.3e-45
WP_163234273.1|251247_251982_+	hypothetical protein	NA	H7BVA7	unidentified_phage	49.1	3.2e-22
WP_163234274.1|252010_252994_+|capsid	phage major capsid protein	capsid	A5GYL9	Lactococcus_phage	31.0	3.1e-36
WP_163234275.1|253019_253343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163234276.1|253345_253747_+	DUF3199 family protein	NA	NA	NA	NA	NA
WP_163234277.1|253743_254106_+	DUF3599 family protein	NA	A0A249XXE9	Clostridium_phage	44.3	1.1e-20
WP_163234278.1|254105_254621_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	53.8	6.3e-49
WP_163234279.1|254640_255096_+	hypothetical protein	NA	A0A249XXB2	Clostridium_phage	37.6	1.1e-15
WP_163234280.1|255096_255294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163234281.1|255296_256625_+|tail	phage tail sheath protein	tail	A0A0A7RTT5	Clostridium_phage	38.0	3.2e-68
WP_163234282.1|256638_257067_+	hypothetical protein	NA	A0A249XXC5	Clostridium_phage	51.4	3.5e-37
WP_163234283.1|257087_257555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163234284.1|257833_258142_+	hypothetical protein	NA	A0A249XXB4	Clostridium_phage	53.0	4.6e-15
WP_163236104.1|258087_259419_+|tail	phage tail tape measure protein	tail	A0A1L6BY19	Clostridium_phage	56.8	2.0e-70
WP_163234285.1|259394_260597_+	hypothetical protein	NA	Q0H230	Geobacillus_phage	67.1	1.2e-18
WP_163234286.1|260586_261240_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A090DBR9	Clostridium_phage	27.1	8.1e-17
WP_163234287.1|261251_262220_+	hypothetical protein	NA	H7BV96	unidentified_phage	49.8	1.0e-84
WP_163234288.1|262228_262657_+	DUF2577 domain-containing protein	NA	NA	NA	NA	NA
WP_163234289.1|262659_263064_+	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	40.9	2.9e-17
WP_163234290.1|263065_264115_+|plate	baseplate J/gp47 family protein	plate	H7BV95	unidentified_phage	50.5	4.8e-96
WP_163234291.1|264118_264973_+	DUF2313 domain-containing protein	NA	H7BV94	unidentified_phage	35.4	1.5e-26
WP_163234292.1|264986_265295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163234293.1|265298_265745_+	hypothetical protein	NA	A0A2K9V2S0	Faecalibacterium_phage	49.3	2.0e-27
WP_163234294.1|265741_266065_+	hypothetical protein	NA	A0A0N7ACI4	Bacillus_phage	47.3	9.2e-22
WP_163234295.1|266068_267217_+	formylglycine-generating enzyme family protein	NA	H7BVP1	unidentified_phage	49.0	3.6e-84
WP_163234296.1|267309_267651_+	diversity-generating retroelement protein Avd	NA	A0A0N7ACE0	Bacillus_phage	59.3	2.7e-32
WP_163234297.1|267977_269072_+	RNA-dependent DNA polymerase	NA	A0A0N7AE80	Bacillus_phage	62.6	4.4e-132
WP_163234298.1|269104_269398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163234299.1|269409_270768_+	hypothetical protein	NA	A0A2R2ZGL8	Clostridioides_phage	35.1	2.5e-28
>prophage 4
NZ_CP048617	Caloranaerobacter azorensis strain T3-1 chromosome, complete genome	2539490	357921	400732	2539490	tRNA,protease,transposase	Bacillus_phage(23.08%)	42	NA	NA
WP_163234347.1|357921_359316_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	29.3	2.5e-47
WP_035162819.1|359330_359861_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_163234348.1|359908_361231_-|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
WP_163234349.1|361242_363327_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	40.8	1.0e-113
WP_163234350.1|363391_364486_-	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	35.7	1.8e-29
WP_163234351.1|364517_366047_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_081943502.1|366249_366612_-	YraN family protein	NA	NA	NA	NA	NA
WP_163234352.1|366592_366874_-	flagellar biogenesis protein	NA	NA	NA	NA	NA
WP_163234353.1|366879_368256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163234354.1|368242_368896_-	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	43.7	1.9e-29
WP_163234355.1|368995_369844_-	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_035162832.1|369950_370298_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_035162834.1|370398_371136_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_035162835.1|371132_371627_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_035162837.1|371729_371960_-	KH domain-containing protein	NA	NA	NA	NA	NA
WP_035162839.1|371984_372254_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_035162841.1|372280_373621_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_073194858.1|373620_374001_-	YlxM family DNA-binding protein	NA	NA	NA	NA	NA
WP_163234356.1|374080_375130_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_163234357.1|375148_378730_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_163234358.1|378846_379938_-	radical SAM protein	NA	A0A0N7G7K6	Chrysochromulina_ericina_virus	32.0	1.4e-08
WP_035162061.1|379927_380650_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	35.5	1.6e-34
WP_163234359.1|380793_382032_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_163234360.1|382381_383557_+|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	28.5	6.7e-30
WP_035162057.1|383747_383978_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.3	2.7e-07
WP_163234361.1|384011_384755_-	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.2	3.5e-24
WP_163234362.1|384767_385712_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_163234363.1|385724_386654_-	enoyl-[acyl-carrier-protein] reductase FabK	NA	NA	NA	NA	NA
WP_163234364.1|386655_387669_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_163234365.1|387655_388684_-	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_035162049.1|388683_389244_-	transcription factor FapR	NA	NA	NA	NA	NA
WP_035162047.1|389413_389593_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_163234366.1|389611_390121_-	DUF177 domain-containing protein	NA	NA	NA	NA	NA
WP_163234367.1|390230_391421_-	acetate kinase	NA	NA	NA	NA	NA
WP_163234368.1|391769_392945_+|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	28.5	5.2e-30
WP_163236080.1|393176_393962_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_163234369.1|394845_396105_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_163234370.1|396112_396889_-	patatin family protein	NA	A0A2K9R803	Dishui_lake_phycodnavirus	30.7	3.3e-09
WP_163234371.1|396978_398238_+	sporulation integral membrane protein YlbJ	NA	NA	NA	NA	NA
WP_163234372.1|398277_398724_-	ATPase	NA	NA	NA	NA	NA
WP_035162037.1|398727_399207_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	46.5	6.1e-30
WP_163234360.1|399556_400732_+|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	28.5	6.7e-30
>prophage 5
NZ_CP048617	Caloranaerobacter azorensis strain T3-1 chromosome, complete genome	2539490	1035023	1083316	2539490	head,transposase	Bacillus_virus(30.0%)	39	NA	NA
WP_163236080.1|1035023_1035809_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_163234797.1|1036004_1037447_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	G3MB42	Bacillus_virus	30.9	3.6e-25
WP_163234798.1|1037811_1039467_+	ABC-F type ribosomal protection protein	NA	Q6DMX7	Streptococcus_phage	30.0	2.2e-58
WP_163236188.1|1039651_1040557_+	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_035165263.1|1042679_1043243_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_035165264.1|1043324_1044122_-	ABC transporter permease	NA	G3M9Y4	Bacillus_virus	25.6	2.6e-17
WP_163234799.1|1044108_1044888_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.3	1.1e-33
WP_163234800.1|1045913_1047227_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_163234801.1|1047446_1048265_+	radical SAM protein	NA	NA	NA	NA	NA
WP_163234802.1|1048364_1048925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163234803.1|1049221_1050403_+	MFS transporter	NA	NA	NA	NA	NA
WP_163236190.1|1050642_1050705_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_163234804.1|1052198_1052504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163234805.1|1052738_1053233_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_163234806.1|1053242_1053662_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_163236193.1|1053899_1054103_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_163234807.1|1054525_1055506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163234808.1|1055492_1057478_+	ATP-dependent DNA helicase RecQ	NA	J2YAJ8	Acanthamoeba_polyphaga_lentillevirus	30.6	2.7e-39
WP_163234809.1|1059557_1059743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163234810.1|1059794_1060886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163234811.1|1061352_1062588_+	MFS transporter	NA	NA	NA	NA	NA
WP_163234812.1|1062808_1063249_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_163234813.1|1063664_1065395_+	S8 family serine peptidase	NA	A0A218KC60	Bacillus_phage	33.7	8.7e-18
WP_163236080.1|1065502_1066288_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_163234449.1|1066542_1066884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163234814.1|1067153_1067768_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_163234815.1|1067793_1070019_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.7	3.7e-37
WP_163234816.1|1070015_1071875_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	8.1e-54
WP_163236195.1|1071997_1073095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163234817.1|1074588_1075131_-	DUF4358 domain-containing protein	NA	NA	NA	NA	NA
WP_163236197.1|1076097_1076661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052045298.1|1076843_1077416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163234818.1|1077624_1078002_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_163234819.1|1078142_1078499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083599448.1|1079378_1079744_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_163234820.1|1079849_1080245_+	membrane protein FxsA	NA	NA	NA	NA	NA
WP_163234821.1|1080257_1081274_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_163234822.1|1081396_1082758_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	43.5	2.3e-106
WP_163236199.1|1083064_1083316_+|head	phage head closure protein	head	A0A0A7RUH8	Clostridium_phage	50.6	2.1e-18
>prophage 6
NZ_CP048617	Caloranaerobacter azorensis strain T3-1 chromosome, complete genome	2539490	1160103	1212445	2539490	protease,transposase	Bacillus_phage(33.33%)	48	NA	NA
WP_163234875.1|1160103_1161363_+|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	28.9	1.5e-30
WP_163234876.1|1163653_1166038_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_163234877.1|1166234_1167320_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A7NU10	Lactobacillus_phage	29.5	1.9e-07
WP_035163625.1|1167431_1167872_-|protease	protease complex subunit PrcB family protein	protease	NA	NA	NA	NA
WP_163234878.1|1168050_1169334_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A2P1CIG4	Microbacterium_phage	40.7	1.0e-10
WP_163236207.1|1169411_1170845_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	38.5	1.3e-38
WP_163234879.1|1170831_1171536_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.0	8.4e-36
WP_163234880.1|1171600_1172956_-	VCBS repeat-containing protein	NA	NA	NA	NA	NA
WP_163234881.1|1173167_1173806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163234882.1|1173948_1174155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163234883.1|1174422_1175370_-	transketolase family protein	NA	NA	NA	NA	NA
WP_163234884.1|1175369_1176191_-	transketolase	NA	NA	NA	NA	NA
WP_163234885.1|1176203_1177070_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	39.6	5.8e-47
WP_163236209.1|1177095_1177836_-	WecB/TagA/CpsF family glycosyltransferase	NA	NA	NA	NA	NA
WP_163234886.1|1177865_1178966_-	polysaccharide pyruvyl transferase CsaB	NA	NA	NA	NA	NA
WP_163234887.1|1178982_1180245_-	polymerase	NA	NA	NA	NA	NA
WP_163234888.1|1180235_1180661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073196014.1|1180675_1181170_-	DUF4330 domain-containing protein	NA	NA	NA	NA	NA
WP_163234889.1|1181171_1182293_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_073196011.1|1182456_1183041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035163157.1|1183522_1183798_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_163234890.1|1183964_1185140_-	alanine racemase	NA	NA	NA	NA	NA
WP_163234891.1|1185252_1185882_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
WP_163234892.1|1185904_1187188_-	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_035163161.1|1187246_1187507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035163162.1|1187550_1188150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163234893.1|1188329_1190051_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A141HSE6	Bacillus_phage	54.5	6.4e-05
WP_163234894.1|1190349_1190922_-	ANTAR domain-containing protein	NA	NA	NA	NA	NA
WP_073196003.1|1191008_1192343_-	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_163234895.1|1192521_1194051_-	response regulator	NA	A0A2R2ZGH8	Clostridioides_phage	32.7	6.5e-09
WP_073196000.1|1194043_1195456_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_035163166.1|1195445_1196402_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_163234896.1|1196491_1197670_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_163234897.1|1197635_1199174_-	xylose ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.3	7.5e-13
WP_073197463.1|1199274_1200366_-	D-xylose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_163234898.1|1200631_1200928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163234899.1|1201488_1202304_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_163236211.1|1202365_1202854_-|transposase	transposase	transposase	Q6J1X2	Lactobacillus_phage	31.7	2.1e-09
WP_163236213.1|1202929_1203196_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_163234900.1|1203464_1204724_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_163234901.1|1204846_1205680_-	response regulator	NA	NA	NA	NA	NA
WP_035163175.1|1205827_1206058_+	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
WP_052045209.1|1206143_1206392_-	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_163234902.1|1206384_1206567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163234903.1|1208775_1209441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163234904.1|1209433_1210090_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.1	3.2e-29
WP_163234905.1|1210110_1210833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163234906.1|1211005_1212445_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	G3MB42	Bacillus_virus	30.0	6.8e-24
>prophage 7
NZ_CP048617	Caloranaerobacter azorensis strain T3-1 chromosome, complete genome	2539490	1301910	1341110	2539490	protease,coat,transposase	uncultured_Caudovirales_phage(25.0%)	38	NA	NA
WP_163234978.1|1301910_1303311_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	G3MB42	Bacillus_virus	30.4	5.4e-26
WP_163234979.1|1304060_1305887_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	42.5	2.5e-116
WP_163234980.1|1306314_1307661_-	phosphoglucosamine mutase	NA	A0A127AWJ1	Bacillus_phage	25.5	3.1e-23
WP_163236223.1|1307786_1308626_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	37.0	1.0e-40
WP_163234981.1|1308814_1309354_-	2-oxoacid:ferredoxin oxidoreductase subunit gamma	NA	NA	NA	NA	NA
WP_163234982.1|1309355_1310102_-	2-oxoglutarate oxidoreductase	NA	NA	NA	NA	NA
WP_163234983.1|1310101_1311163_-	3-methyl-2-oxobutanoate dehydrogenase subunit VorB	NA	NA	NA	NA	NA
WP_035164795.1|1311183_1311414_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_163234984.1|1311535_1312210_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_163234985.1|1313311_1314217_-	phosphate butyryltransferase	NA	NA	NA	NA	NA
WP_156099414.1|1314209_1315301_-	butyrate kinase	NA	NA	NA	NA	NA
WP_163234986.1|1315528_1317262_-	sigma-54-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_163234987.1|1317264_1318503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035163890.1|1318483_1319317_-	TIGR00159 family protein	NA	NA	NA	NA	NA
WP_163234988.1|1319411_1320413_-	CapA family protein	NA	A0A2H4JC87	uncultured_Caudovirales_phage	36.4	1.0e-39
WP_035163888.1|1320662_1321397_-|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_035163887.1|1321500_1322109_-	DUF5317 domain-containing protein	NA	NA	NA	NA	NA
WP_163234989.1|1322098_1323385_-	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_035163881.1|1323605_1324235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163234990.1|1324377_1324929_-	rubrerythrin family protein	NA	NA	NA	NA	NA
WP_163236226.1|1327913_1328198_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_163234991.1|1328415_1330044_+	hypothetical protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	42.4	5.9e-08
WP_073195930.1|1330121_1330694_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_163234992.1|1330708_1330960_-|coat	spore coat protein CotJB	coat	NA	NA	NA	NA
WP_163234993.1|1330979_1331129_-|coat	spore coat associated protein CotJA	coat	NA	NA	NA	NA
WP_035163868.1|1331747_1332089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163234994.1|1332092_1333364_-	DUF1576 domain-containing protein	NA	NA	NA	NA	NA
WP_163234995.1|1335226_1335490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163234996.1|1335633_1336851_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	49.7	2.3e-49
WP_159430380.1|1337127_1337304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163234997.1|1337334_1337529_-	hypothetical protein	NA	A0A0A8WJ56	Clostridium_phage	60.9	6.9e-17
WP_163234998.1|1337579_1337744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163234999.1|1337965_1338268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163235000.1|1338463_1338709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163235001.1|1338836_1338980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163235002.1|1339012_1339192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073198185.1|1339145_1339244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163235003.1|1340792_1341110_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP048617	Caloranaerobacter azorensis strain T3-1 chromosome, complete genome	2539490	1747836	1760278	2539490		Synechococcus_phage(22.22%)	11	NA	NA
WP_163235257.1|1747836_1748463_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.5	7.2e-23
WP_163235258.1|1748450_1749494_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3FC27	Synechococcus_phage	42.3	2.0e-70
WP_163235259.1|1749619_1751008_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.6	2.7e-62
WP_163236246.1|1750992_1753194_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	43.2	2.0e-168
WP_163235260.1|1753193_1753898_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_035163972.1|1753900_1754149_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_035163970.1|1754145_1754853_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	E3SPA9	Prochlorococcus_phage	40.9	1.3e-39
WP_163235261.1|1754864_1755350_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	45.9	6.2e-22
WP_163235262.1|1755460_1756786_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	32.2	3.9e-50
WP_163235263.1|1757195_1758728_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	36.9	4.8e-28
WP_163235264.1|1758823_1760278_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	42.7	5.7e-103
>prophage 10
NZ_CP048617	Caloranaerobacter azorensis strain T3-1 chromosome, complete genome	2539490	1764948	1827089	2539490	tRNA,coat,bacteriocin,transposase	uncultured_virus(14.29%)	58	NA	NA
WP_052045108.1|1764948_1765215_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_163235268.1|1765241_1766870_-	chaperonin GroEL	NA	A0A240F779	uncultured_virus	55.8	1.1e-160
WP_035161790.1|1766979_1767261_-	co-chaperone GroES	NA	A0A221S4A8	uncultured_virus	48.9	1.5e-15
WP_163235269.1|1767576_1768446_-	8-oxoguanine DNA glycosylase	NA	NA	NA	NA	NA
WP_163235270.1|1768514_1769768_-	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_163235271.1|1769954_1770767_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_163235272.1|1770790_1771135_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_163235273.1|1771131_1771527_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_163235274.1|1771605_1772688_-	endospore germination permease	NA	NA	NA	NA	NA
WP_035161784.1|1772693_1772906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163235275.1|1772919_1774098_-	Ger(x)C family spore germination protein	NA	NA	NA	NA	NA
WP_163235276.1|1774099_1775698_-	spore germination protein	NA	NA	NA	NA	NA
WP_163235277.1|1775855_1776122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163235278.1|1776296_1777166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163235279.1|1777178_1777994_-	SagB/ThcOx family dehydrogenase	NA	NA	NA	NA	NA
WP_163235280.1|1777999_1778878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163235281.1|1778890_1779304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163235282.1|1779366_1780140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163235283.1|1780307_1780475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163235284.1|1780666_1782157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163235285.1|1782134_1783748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163235286.1|1783744_1784857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163235287.1|1784863_1785478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163235288.1|1785561_1787421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163235289.1|1787531_1788269_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_163235290.1|1788277_1788991_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.0	5.3e-22
WP_163235291.1|1789130_1789310_-|bacteriocin	thiazolylpeptide-type bacteriocin	bacteriocin	NA	NA	NA	NA
WP_163236250.1|1789477_1789777_-	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_163235292.1|1789773_1790073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163235293.1|1790257_1792282_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	75.0	7.8e-10
WP_035161757.1|1792459_1793098_-	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_163235294.1|1793374_1795306_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.7	5.6e-58
WP_163235295.1|1795459_1796011_+	biotin transporter BioY	NA	NA	NA	NA	NA
WP_163236252.1|1796332_1797358_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	42.6	3.2e-68
WP_156099358.1|1797525_1797681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163235296.1|1797705_1797909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163235297.1|1797994_1798744_-	YIP1 family protein	NA	NA	NA	NA	NA
WP_035161746.1|1798785_1800009_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_163235298.1|1800046_1800724_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.3	6.4e-41
WP_163235299.1|1800720_1801977_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_163235300.1|1802123_1802570_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_163235301.1|1802562_1803285_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_163236254.1|1803284_1803746_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_163236080.1|1803817_1804603_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_163235302.1|1805236_1806424_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_035161734.1|1807166_1807769_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_163235303.1|1808101_1809268_-	amidohydrolase	NA	NA	NA	NA	NA
WP_163235304.1|1809254_1811432_-	response regulator	NA	A0A2K9L0Z8	Tupanvirus	24.6	1.7e-10
WP_163235305.1|1811687_1812983_-	MFS transporter	NA	NA	NA	NA	NA
WP_163235306.1|1813118_1815272_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_163235307.1|1815389_1817507_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.1	6.1e-13
WP_163235308.1|1817627_1818732_-	peptide chain release factor 2	NA	W8EDB3	Pseudomonas_phage	42.3	5.8e-07
WP_163235309.1|1818851_1819157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163235310.1|1819187_1821923_-	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_163235311.1|1822154_1823345_+	site-specific DNA-methyltransferase	NA	A0A1D8KJW7	Synechococcus_phage	56.1	5.5e-80
WP_163235312.1|1823444_1824887_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	G3MB42	Bacillus_virus	31.8	2.5e-26
WP_163235313.1|1824879_1825482_-|transposase	IS607 family transposase	transposase	Q331Z3	Clostridium_botulinum_C_phage	53.5	4.9e-53
WP_163234360.1|1825913_1827089_+|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	28.5	6.7e-30
>prophage 11
NZ_CP048617	Caloranaerobacter azorensis strain T3-1 chromosome, complete genome	2539490	2130587	2138848	2539490		Thermus_phage(14.29%)	8	NA	NA
WP_163235539.1|2130587_2132162_-	DUF3794 domain-containing protein	NA	S6BFI4	Thermus_phage	55.6	7.7e-05
WP_163235540.1|2132321_2133506_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_163235542.1|2133646_2134639_-	methyltransferase domain-containing protein	NA	K9MDN9	Sulfolobus_virus	32.4	1.0e-07
WP_163235544.1|2134650_2135556_-	restriction endonuclease	NA	A0A2H4JAL2	uncultured_Caudovirales_phage	30.3	7.0e-27
WP_163235545.1|2135571_2136471_-	DNA adenine methylase	NA	A0A1S5PRR3	Streptococcus_phage	44.0	8.4e-57
WP_035164121.1|2136628_2137486_-	agmatinase	NA	A0A0N9R043	Chrysochromulina_ericina_virus	25.4	1.1e-08
WP_163235547.1|2137472_2138327_-	polyamine aminopropyltransferase	NA	A0A1C9C533	Heterosigma_akashiwo_virus	28.8	7.6e-23
WP_163235549.1|2138419_2138848_-	S-adenosylmethionine decarboxylase proenzyme	NA	A0A1D7SEZ2	Cyanophage	39.4	2.4e-17
