The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP048687	Bacillus paranthracis strain MN1F chromosome, complete genome	5687871	1543661	1552034	5687871		Synechococcus_phage(50.0%)	8	NA	NA
WP_000088580.1|1543661_1544249_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.1	4.5e-27
WP_001262449.1|1544245_1545286_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	45.9	1.6e-67
WP_000879038.1|1545388_1546804_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.4	4.3e-55
WP_000055586.1|1546788_1549008_-	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	41.2	1.3e-162
WP_000666779.1|1548991_1549675_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_000278826.1|1549671_1549926_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_001170542.1|1549918_1550638_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	44.3	5.2e-49
WP_000625677.1|1550726_1552034_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.5	4.9e-21
>prophage 2
NZ_CP048687	Bacillus paranthracis strain MN1F chromosome, complete genome	5687871	1590374	1598323	5687871		Bacillus_phage(33.33%)	6	NA	NA
WP_000719191.1|1590374_1591880_-	aminopeptidase AmpS	NA	W8CYF6	Bacillus_phage	31.3	2.4e-32
WP_001262951.1|1591863_1592565_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	7.3e-40
WP_000833093.1|1592709_1594035_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	29.5	5.4e-44
WP_000743925.1|1594419_1595958_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.2	6.8e-22
WP_001029999.1|1596365_1598000_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	58.2	2.0e-157
WP_000917306.1|1598038_1598323_-	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	53.8	1.2e-20
>prophage 3
NZ_CP048687	Bacillus paranthracis strain MN1F chromosome, complete genome	5687871	2359706	2411805	5687871	protease,tRNA,coat,transposase	uncultured_Caudovirales_phage(21.43%)	51	NA	NA
WP_014298040.1|2359706_2361356_+|protease	neutral protease NprB	protease	NA	NA	NA	NA
WP_000082521.1|2361398_2361716_-	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_000008427.1|2361834_2363526_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.5	3.7e-13
WP_000878467.1|2363750_2365445_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	27.4	2.2e-10
WP_001072271.1|2365858_2366677_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000021549.1|2367112_2368747_+|tRNA	methionine--tRNA ligase	tRNA	H2EDI7	Moumouvirus	32.6	5.2e-73
WP_000154156.1|2368788_2369043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000410507.1|2369115_2370018_-	DMT family transporter	NA	NA	NA	NA	NA
WP_154982093.1|2370157_2371600_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	25.2	2.6e-15
WP_000148833.1|2371577_2372243_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.5	1.8e-35
WP_000734935.1|2372607_2373069_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000388756.1|2373099_2373543_-	DUF3978 domain-containing protein	NA	NA	NA	NA	NA
WP_000454760.1|2373947_2374562_+	DedA family protein	NA	NA	NA	NA	NA
WP_000776168.1|2374760_2374982_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000837709.1|2374971_2375679_+	DUF3169 family protein	NA	NA	NA	NA	NA
WP_014298038.1|2375721_2376774_+	M50 family metallopeptidase	NA	NA	NA	NA	NA
WP_000404782.1|2376875_2377016_+	DUF3985 domain-containing protein	NA	NA	NA	NA	NA
WP_001077770.1|2377211_2377598_-	DUF3938 domain-containing protein	NA	NA	NA	NA	NA
WP_000397312.1|2378060_2378582_+	GNAT family N-acetyltransferase	NA	D0R097	Streptococcus_phage	57.2	3.9e-54
WP_000530034.1|2378681_2379575_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	32.6	3.8e-25
WP_000394930.1|2379852_2380137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000920532.1|2380165_2380948_+	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_085962608.1|2381003_2382160_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	44.7	3.4e-34
WP_000730859.1|2382368_2383184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000562242.1|2383265_2383493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000859063.1|2384065_2385613_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	D5GVD8	Campylobacter_virus	26.6	3.2e-11
WP_000546319.1|2385861_2387175_+	amino acid permease	NA	NA	NA	NA	NA
WP_000788581.1|2387299_2388514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000736812.1|2388581_2389289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002028752.1|2389687_2390872_+	MFS transporter	NA	NA	NA	NA	NA
WP_000823839.1|2391392_2393276_+	TQXA domain-containing protein	NA	NA	NA	NA	NA
WP_000939490.1|2393306_2394065_-	TrmB family transcriptional regulator	NA	NA	NA	NA	NA
WP_000599349.1|2394877_2396008_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	D2XQ03	Bacillus_virus	43.2	4.7e-73
WP_000946343.1|2396166_2398167_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	51.1	6.3e-12
WP_001018862.1|2398244_2398547_+	MTH1187 family thiamine-binding protein	NA	NA	NA	NA	NA
WP_001290594.1|2398594_2398840_+	YusU family protein	NA	NA	NA	NA	NA
WP_000436772.1|2399150_2400068_+	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	43.9	1.0e-65
WP_000831479.1|2400090_2400930_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_001096348.1|2401180_2401315_-	YuzL family protein	NA	NA	NA	NA	NA
WP_000486345.1|2401550_2403932_+	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_001206325.1|2403953_2405126_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_002028756.1|2405257_2405440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000416296.1|2405513_2407298_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_001242590.1|2407436_2408159_+	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	31.4	2.5e-11
WP_000074903.1|2408162_2408720_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000457312.1|2408818_2409385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000813827.1|2409566_2409794_+	helix-turn-helix transcriptional regulator	NA	A0A1V0E021	Clostridioides_phage	45.6	3.4e-07
WP_000029292.1|2409790_2410078_+	DUF2178 domain-containing protein	NA	NA	NA	NA	NA
WP_000005487.1|2410497_2411211_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001180555.1|2411357_2411543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001002987.1|2411556_2411805_+|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 4
NZ_CP048687	Bacillus paranthracis strain MN1F chromosome, complete genome	5687871	3902394	3909664	5687871	transposase	Enterobacteria_phage(33.33%)	9	NA	NA
WP_001226074.1|3902394_3902970_+	recombinase family protein	NA	A0A222YWP5	Escherichia_phage	29.8	1.6e-13
WP_000383881.1|3903082_3903928_+	AraC family transcriptional regulator	NA	A0A1B0RXG1	Streptococcus_phage	42.9	4.4e-23
WP_033656251.1|3904055_3904631_+	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	31.3	3.1e-12
WP_000701227.1|3904885_3905338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000475617.1|3905701_3906400_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0N6W8I1	Bacillus_phage	47.4	5.2e-46
WP_000957215.1|3906772_3907342_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_014315595.1|3907367_3907541_-	HIT family protein	NA	NA	NA	NA	NA
WP_000588560.1|3907655_3908909_+|transposase	IS21-like element ISBce16 family transposase	transposase	U5N3F9	Enterobacteria_phage	33.2	2.5e-51
WP_000993737.1|3908905_3909664_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	46.6	1.3e-61
>prophage 5
NZ_CP048687	Bacillus paranthracis strain MN1F chromosome, complete genome	5687871	4109265	4163053	5687871	transposase,integrase	Bacillus_phage(40.0%)	52	4113229:4113288	4149307:4150370
WP_000118206.1|4109265_4110189_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	A0A1B2LRR6	Wolbachia_phage	34.0	2.6e-21
WP_163073089.1|4110734_4111154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001233525.1|4111220_4111571_+	PrgI family protein	NA	NA	NA	NA	NA
WP_000892014.1|4111571_4112486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155016833.1|4112488_4112653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053964.1|4112727_4114164_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
4113229:4113288	attL	AACTTTCAGATAGGTCCAGGAAAAAATAATGATAAGACCTTTGGAACAGAATGCTTAGAC	NA	NA	NA	NA
WP_001186867.1|4114860_4116006_-	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_001045583.1|4116045_4116528_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_000617609.1|4118060_4119299_+|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	34.3	5.4e-54
WP_000980839.1|4119295_4120060_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	47.6	2.3e-63
WP_000540345.1|4120548_4120749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001043958.1|4121179_4121452_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	67.8	1.4e-23
WP_000162599.1|4121563_4121833_-	ribbon-helix-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155016834.1|4122021_4122324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001058761.1|4122354_4122564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001193818.1|4122678_4123089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163073090.1|4123752_4124193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000021286.1|4124217_4124445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001123650.1|4124472_4124676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000843050.1|4124690_4124969_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	47.8	2.7e-14
WP_033656436.1|4125142_4125355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001045035.1|4126611_4126878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000475304.1|4127211_4127589_+	peptide transporter	NA	NA	NA	NA	NA
WP_001067598.1|4127598_4128852_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001021536.1|4130641_4131685_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1D6X8B0	Bacillus_phage	21.4	6.4e-08
WP_000202840.1|4131918_4132269_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_000386112.1|4132290_4132803_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000751950.1|4133975_4134578_-	hypothetical protein	NA	A0A1B0T6B1	Bacillus_phage	41.3	1.5e-12
WP_000491739.1|4134678_4134921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000107160.1|4135291_4136524_+	WXG100 family type VII secretion target	NA	A0A2H4J389	uncultured_Caudovirales_phage	58.0	3.0e-65
WP_001015690.1|4136538_4136991_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_000790845.1|4137032_4137413_-	DUF4878 domain-containing protein	NA	NA	NA	NA	NA
WP_000531859.1|4137974_4139288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200275.1|4140143_4140443_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002073795.1|4140679_4141168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061184285.1|4141741_4143178_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_000215801.1|4143761_4143968_+	DUF1657 domain-containing protein	NA	NA	NA	NA	NA
WP_002081459.1|4145071_4145482_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_000454745.1|4145834_4147328_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_046648576.1|4149460_4149811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048536305.1|4150002_4150245_+	sublancin family glycopeptide	NA	NA	NA	NA	NA
WP_046648584.1|4150337_4152443_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	25.6	9.2e-30
4149307:4150370	attR	GTCTAAGCATTCTGTTCCAAAGGTCTTATCATTATTTTTTCCTGGACCTATCTGAAAGTTATGATACATAAAAATTTAGAGGAATTAAAAAATCCAATTTCTACATTTTTGAGAAATTGGATTTTTATTGACAAGATTAAATTGTAGAGTCTATTTATTCATTGGTTATTTTCTCTCTAATTATCTGTACAAATTCATTAAGATTTTTGCTTTGAATATTTTTGATGCCTACTCTTTCGTTTTTATTCCAAAAAAGTATACTAGGTACACCAAATAAATTCTTTTTCTCCTTCAGCTTTGATATATTTTCATAAAAATATTCATTAACCCATGCATCACCAACTAAATCAGGGCCGTAAAAGAATAATCTTTTATTTGTAGCAATTAATACTCCAGGGCGTACAGGATGCCTAAATTCAAAAACGTCTAAAGATCCATGTAAAAAATCTAGAACTTTTTCATCTGAAGATAATATTGTCTTGGCTTGGTCTAATATATTTTGCATTGTAGGACTCCTTTATTATCTAATATCAATTATTATATCAGAAAATTCATAGAATTTTAAATCGAATATACATAATATGCAATTTTGCATATTATGTATATTTTTTACAGAAAGTAATTGAAAGAATATTCATTATCGTTATATAATTCGAAATGTAACAACAATAAATCAATTTATATGGAGGAATAATTATGAAAGACTTAATCAAAGAATTAAACTTGGAAGAATTAGAGACTTTTGAAGGTGGACATGATGGAGTAAATTATATGCATCAACATGATGGTGGCGGCGCTGGTGGCGGTAGCGGTATCGGAACTGCTCAATGTGCATACTTTAAAGCACTGTGTTATTCAGGAGGTAGTGAATGGCTTGGTGGTTATGGTGGATGCGGTTCAACTCAAAATAATTGTGAATTAGCAAGAAAATACTGTTAATAATCTTCAGAAAATAAAGAAAAAATTTCGTTGTATAACGAGATTTTTTCTTTATTTTCACGAAATCAACAATCTAAGGAAGCGATAAATATATGAAATATATACATACAAAACAACACGGCGAA	NA	NA	NA	NA
WP_046648572.1|4152627_4153041_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_048536307.1|4153059_4154334_+	SunS family peptide S-glycosyltransferase	NA	NA	NA	NA	NA
WP_076872728.1|4154348_4154738_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_002073965.1|4154916_4155501_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_076875110.1|4155517_4156216_+	HAD family hydrolase	NA	A0A2H4UUK2	Bodo_saltans_virus	29.9	7.1e-19
WP_000957125.1|4156336_4157137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001040755.1|4157513_4158182_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000974627.1|4158266_4158497_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000820334.1|4158506_4158983_-	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_061130348.1|4160005_4163053_+|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP048687	Bacillus paranthracis strain MN1F chromosome, complete genome	5687871	4932388	4940731	5687871		Geobacillus_phage(28.57%)	10	NA	NA
WP_000820162.1|4932388_4932601_-	DUF3006 domain-containing protein	NA	Q0H256	Geobacillus_phage	54.4	1.1e-12
WP_000714650.1|4932603_4933989_-	MBL fold metallo-hydrolase	NA	Q0H255	Geobacillus_phage	59.9	2.7e-78
WP_000288952.1|4934419_4934827_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000648514.1|4934840_4935194_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000655489.1|4935215_4935923_+	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	26.5	2.0e-16
WP_001093431.1|4935988_4936375_+	DUF2809 domain-containing protein	NA	NA	NA	NA	NA
WP_000720544.1|4936396_4936900_+	DNA topology modulation protein	NA	A0A097BYE2	Leuconostoc_phage	45.5	4.3e-42
WP_001058134.1|4937046_4937727_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BUR2	Microcystis_phage	38.2	1.7e-30
WP_000124904.1|4937812_4939006_+	glycosyl transferase family 1	NA	Q0IKX4	Leucania_separata_nucleopolyhedrovirus	26.8	4.8e-07
WP_046952019.1|4939363_4940731_+	chitin-binding protein	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	38.6	2.8e-19
>prophage 7
NZ_CP048687	Bacillus paranthracis strain MN1F chromosome, complete genome	5687871	5479675	5522876	5687871	protease,integrase,tail,capsid,portal,terminase,head	Bacillus_phage(96.3%)	57	5474350:5474365	5523353:5523368
5474350:5474365	attL	ATGATTTTGATTTACA	NA	NA	NA	NA
WP_000473087.1|5479675_5480269_+	hypothetical protein	NA	A0A0U3TZ58	Bacillus_phage	100.0	5.9e-99
WP_001287580.1|5480321_5480537_-	hypothetical protein	NA	A0A0U3TKC9	Bacillus_phage	100.0	4.1e-34
WP_012580673.1|5480557_5481193_-	hypothetical protein	NA	A0A0U3J2H0	Bacillus_phage	99.5	4.2e-119
WP_002027563.1|5481197_5482355_-	DNA translocase FtsK	NA	A0A1B1P7T5	Bacillus_phage	100.0	6.3e-222
WP_000488699.1|5482364_5482691_-	hypothetical protein	NA	A0A1B1P7T1	Bacillus_phage	100.0	2.7e-53
WP_000427397.1|5482703_5483096_-	hypothetical protein	NA	A0A1B1P7T3	Bacillus_phage	100.0	6.9e-72
WP_000340446.1|5483400_5483607_+	helix-turn-helix domain-containing protein	NA	A0A1B1P7S8	Bacillus_phage	100.0	8.4e-29
WP_000542512.1|5483662_5484472_-	N-acetylmuramoyl-L-alanine amidase	NA	D2XR33	Bacillus_phage	100.0	5.4e-164
WP_000159644.1|5484471_5484678_-	hypothetical protein	NA	D2XR32	Bacillus_phage	98.5	1.6e-32
WP_000151211.1|5484680_5484962_-	hypothetical protein	NA	D2XR31	Bacillus_phage	100.0	1.2e-41
WP_000822837.1|5484976_5485936_-|integrase	tyrosine-type recombinase/integrase	integrase	D2XR30	Bacillus_phage	93.1	5.5e-171
WP_000434602.1|5486143_5486839_-	hypothetical protein	NA	D2XR29	Bacillus_phage	99.6	1.8e-123
WP_001260175.1|5486964_5490990_-	hypothetical protein	NA	H0USX5	Bacillus_phage	85.8	0.0e+00
WP_163073105.1|5490986_5492402_-|tail	phage tail family protein	tail	H0USX4	Bacillus_phage	79.6	2.7e-227
WP_000896623.1|5492494_5497510_-|tail	phage tail tape measure protein	tail	A0A1B1P7S6	Bacillus_phage	99.4	0.0e+00
WP_000938712.1|5497525_5497666_-	hypothetical protein	NA	A0A1B1P7R9	Bacillus_phage	100.0	1.5e-18
WP_001157384.1|5497683_5498079_-	hypothetical protein	NA	A0A1B1P7S9	Bacillus_phage	100.0	3.9e-59
WP_000952020.1|5498138_5498723_-|tail	tail protein	tail	A0A1B1P7S4	Bacillus_phage	100.0	5.2e-108
WP_001211423.1|5498736_5499096_-	hypothetical protein	NA	A0A1B1P7S7	Bacillus_phage	99.2	2.8e-64
WP_000852722.1|5499092_5499530_-	HK97 gp10 family phage protein	NA	A0A1B1P7R6	Bacillus_phage	100.0	1.2e-77
WP_001069940.1|5499517_5499865_-|head	phage head closure protein	head	A0A1B1P7T4	Bacillus_phage	99.1	8.2e-61
WP_000891191.1|5499851_5500127_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B1P7Q8	Bacillus_phage	98.9	8.0e-43
WP_033701765.1|5500135_5500354_-	fibronectin type III domain-containing protein	NA	NA	NA	NA	NA
WP_000782636.1|5500412_5501600_-|capsid	phage major capsid protein	capsid	A0A1B1P7R4	Bacillus_phage	100.0	1.8e-216
WP_001107318.1|5501596_5502352_-|protease	Clp protease ClpP	protease	A0A0U3U021	Bacillus_phage	99.6	9.6e-139
WP_000767176.1|5502329_5503544_-|portal	phage portal protein	portal	A0A0U3SQF0	Bacillus_phage	100.0	4.7e-236
WP_000633618.1|5503559_5505332_-|terminase	terminase large subunit	terminase	A0A1B1P7R3	Bacillus_phage	99.5	0.0e+00
WP_000357495.1|5505312_5505693_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B1P7R2	Bacillus_phage	100.0	2.2e-67
WP_048548534.1|5505854_5506217_-	HNH endonuclease	NA	A0A1B1P8D2	Bacillus_phage	96.7	9.2e-63
WP_048548537.1|5506517_5506730_-	hypothetical protein	NA	A0A1B1P8F3	Bacillus_phage	98.6	6.0e-30
WP_048548539.1|5506716_5507034_-	hypothetical protein	NA	A0A288WG64	Bacillus_phage	86.6	1.6e-39
WP_001055139.1|5507742_5508285_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P7Y2	Bacillus_phage	100.0	5.5e-96
WP_001209121.1|5508281_5508755_-	ArpU family transcriptional regulator	NA	A0A1B1P7X5	Bacillus_phage	100.0	4.0e-82
WP_002028328.1|5508778_5508919_-	hypothetical protein	NA	A0A1B1P735	Bacillus_phage	92.3	2.0e-05
WP_001061241.1|5509052_5509184_-	DUF3983 domain-containing protein	NA	A0A1B1P7V8	Bacillus_phage	97.7	4.8e-14
WP_000033082.1|5509506_5509755_-	helix-turn-helix transcriptional regulator	NA	A0A0U3J7D7	Bacillus_phage	98.8	2.0e-40
WP_000678894.1|5509975_5510239_-	hypothetical protein	NA	A0A0U3K3K8	Bacillus_phage	100.0	1.8e-39
WP_000439567.1|5510272_5510470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000661412.1|5510504_5510732_-	hypothetical protein	NA	A0A218KCK2	Bacillus_phage	65.3	5.3e-24
WP_001216585.1|5510769_5510991_-	hypothetical protein	NA	D2XR53	Bacillus_phage	100.0	2.0e-36
WP_001002761.1|5511307_5511982_-	hypothetical protein	NA	D2XR52	Bacillus_phage	100.0	2.3e-131
WP_001030638.1|5512009_5512555_-	hypothetical protein	NA	A0A2I6UHP6	Bacillus_phage	53.6	1.8e-41
WP_001102009.1|5513079_5513562_-	nucleoside triphosphate pyrophosphohydrolase family protein	NA	A0A0U4IBD0	Bacillus_phage	49.5	8.9e-21
WP_000109486.1|5513581_5513833_-	hypothetical protein	NA	A0A1B1P7W1	Bacillus_phage	51.3	2.6e-16
WP_000717826.1|5513858_5514026_-	DUF3954 domain-containing protein	NA	A0A1B0T6B8	Bacillus_phage	62.3	1.4e-13
WP_001125952.1|5514044_5514404_-	hypothetical protein	NA	A0A1B1P7A1	Bacillus_phage	53.3	1.1e-31
WP_000799086.1|5514396_5514675_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	62.7	7.9e-14
WP_000338031.1|5514691_5514886_-	hypothetical protein	NA	A0A0U3K3J8	Bacillus_phage	82.8	5.9e-24
WP_001171109.1|5514898_5515813_-	AAA family ATPase	NA	A0A0U3U1U1	Bacillus_phage	100.0	2.0e-170
WP_001151930.1|5515827_5516712_-	hypothetical protein	NA	A0A0U3TZZ4	Bacillus_phage	100.0	4.9e-150
WP_033670234.1|5517142_5517418_-	helix-turn-helix domain-containing protein	NA	A0A0U3ULL9	Bacillus_phage	100.0	1.4e-42
WP_000854265.1|5517573_5517759_-	helix-turn-helix transcriptional regulator	NA	A0A0U3SLC2	Bacillus_phage	100.0	3.7e-28
WP_000481767.1|5517960_5518314_+	helix-turn-helix transcriptional regulator	NA	A0A0U3SD25	Bacillus_phage	100.0	3.9e-58
WP_000803132.1|5518722_5519916_-	helix-turn-helix transcriptional regulator	NA	A0A0U3TNF6	Bacillus_phage	100.0	2.6e-215
WP_000675867.1|5520214_5521324_+|integrase	site-specific integrase	integrase	A0A0U3U8Y8	Bacillus_phage	100.0	3.9e-181
WP_000581460.1|5521397_5521583_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_000588613.1|5521706_5522876_-	DEAD/DEAH box helicase	NA	A0A1V0SBR7	Catovirus	29.6	2.2e-41
5523353:5523368	attR	TGTAAATCAAAATCAT	NA	NA	NA	NA
>prophage 8
NZ_CP048687	Bacillus paranthracis strain MN1F chromosome, complete genome	5687871	5651622	5660952	5687871		Bacillus_phage(71.43%)	8	NA	NA
WP_001258509.1|5651622_5652495_-	aminoglycoside 6-adenylyltransferase	NA	A0A1X9I6F2	Streptococcus_phage	42.5	6.5e-62
WP_000061722.1|5652627_5653299_-	O-methyltransferase	NA	W8CYT3	Bacillus_phage	89.8	7.7e-63
WP_000818985.1|5653446_5654166_-	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	100.0	5.9e-61
WP_001254317.1|5654973_5656047_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	90.5	1.3e-176
WP_000937026.1|5656043_5656721_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	94.7	2.6e-119
WP_000453859.1|5656809_5658570_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	96.7	4.2e-270
WP_001194312.1|5658809_5659574_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000755553.1|5659671_5660952_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	31.5	4.5e-11
