The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	0	33081	4945561	capsid,tail,head,portal,holin,lysis,plate,tRNA,terminase	Escherichia_phage(52.94%)	39	NA	NA
WP_163424894.1|0_2289_+	replication endonuclease	NA	M1SV59	Escherichia_phage	97.5	0.0e+00
WP_001310277.1|2898_3207_+	helix-turn-helix transcriptional regulator	NA	E5E3S9	Burkholderia_phage	40.2	1.7e-12
WP_059253627.1|3184_4135_+	RNA-directed DNA polymerase	NA	E5E3S8	Burkholderia_phage	40.4	2.9e-39
WP_000042038.1|4258_4696_-	hypothetical protein	NA	S4TUD6	Salmonella_phage	92.3	1.6e-69
WP_023241486.1|5401_6436_-|portal	phage portal protein	portal	M1SV64	Escherichia_phage	99.7	3.2e-201
WP_163424895.1|6435_8208_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.7	0.0e+00
WP_095844240.1|8381_9236_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MH0	Enterobacteria_phage	97.5	1.7e-131
WP_001541413.1|9294_10368_+|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	99.2	5.7e-201
WP_000203446.1|10371_11115_+|terminase	terminase endonuclease subunit	terminase	Q94MH3	Enterobacteria_phage	100.0	1.2e-122
WP_000988633.1|11214_11724_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846409.1|11723_11927_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000123123.1|11930_12212_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_163424896.1|12211_12709_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	98.8	5.8e-92
WP_163424897.1|12723_12975_+	hypothetical protein	NA	U5N096	Enterobacteria_phage	55.3	2.5e-19
WP_163424898.1|12962_13406_+|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	96.5	2.9e-66
WP_000917152.1|13495_13963_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	99.4	2.3e-82
WP_097569266.1|13955_14408_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	98.7	6.9e-76
WP_024245775.1|14479_15265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163424899.1|15348_15984_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	97.2	3.8e-112
WP_163424900.1|15980_16328_+|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	98.3	1.6e-56
WP_121863741.1|16332_17241_+|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	99.3	5.7e-162
WP_163424901.1|17233_17764_+|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	99.4	6.6e-102
WP_163424902.1|17774_19796_+|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	64.2	1.0e-259
WP_163424903.1|19797_20325_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	92.6	1.4e-88
WP_052903804.1|20493_21003_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_163424904.1|21303_22494_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	6.2e-225
WP_001251408.1|22506_23025_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|23081_23357_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|23389_23509_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_163424905.1|23501_25949_+|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	96.4	0.0e+00
WP_025693440.1|25963_26443_+|tail	phage tail protein	tail	M1TAU1	Escherichia_phage	98.7	3.3e-84
WP_163424906.1|26442_27606_+	phage late control D family protein	NA	M1SV93	Escherichia_phage	97.9	5.0e-203
WP_000468308.1|27687_27906_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000476014.1|28178_29540_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
WP_001220181.1|29642_29939_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000124651.1|29940_30192_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_000929408.1|30435_30768_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137877.1|30958_31681_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_040072287.1|31677_33081_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	1.2e-33
>prophage 2
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	46523	47876	4945561		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_000469713.1|46523_47876_-	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	21.1	2.4e-07
>prophage 3
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	52601	63170	4945561		Catovirus(20.0%)	8	NA	NA
WP_001295424.1|52601_53243_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
WP_001234777.1|53334_53916_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.8e-31
WP_001252336.1|53937_55791_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_163425548.1|56242_57826_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	1.6e-34
WP_000978094.1|58484_59624_+	polysaccharide export protein Wza	NA	NA	NA	NA	NA
WP_000482901.1|59629_60073_+	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_000137152.1|60075_62238_+	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	2.4e-17
WP_000654494.1|62330_63170_+	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	7.5e-07
>prophage 4
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	67489	74283	4945561		Synechococcus_phage(25.0%)	6	NA	NA
WP_000048190.1|67489_68611_+	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
WP_086260112.1|68613_69579_+	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.8	1.7e-87
WP_000479836.1|69581_70061_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_094281781.1|70057_71281_+	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_049592693.1|71283_72720_+	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.2	5.7e-47
WP_094281777.1|72912_74283_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.8	4.9e-32
>prophage 5
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	79995	82458	4945561		Klebsiella_phage(50.0%)	2	NA	NA
WP_163424916.1|79995_81390_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	1.7e-19
WP_047615134.1|81564_82458_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	6.0e-47
>prophage 6
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	88299	92168	4945561		Chrysochromulina_ericina_virus(33.33%)	3	NA	NA
WP_047615163.1|88299_89121_+	glycosyltransferase family 2 protein	NA	A0A0N9QZR6	Chrysochromulina_ericina_virus	28.4	2.6e-12
WP_163424917.1|89346_90753_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.1e-37
WP_163424918.1|91001_92168_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.0	2.0e-114
>prophage 7
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	99537	100437	4945561		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131782.1|99537_100437_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 8
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	107640	108807	4945561		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000830156.1|107640_108807_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.2	2.9e-227
>prophage 9
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	119206	119962	4945561		Escherichia_phage(100.0%)	1	NA	NA
WP_163424925.1|119206_119962_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	26.9	1.7e-18
>prophage 10
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	144824	145355	4945561		Escherichia_phage(100.0%)	1	NA	NA
WP_001079066.1|144824_145355_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	98.1	7.2e-56
>prophage 11
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	148899	161469	4945561		Bacillus_phage(28.57%)	12	NA	NA
WP_024221659.1|148899_149571_+	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	1.2e-31
WP_000826790.1|149570_150929_+	two-component system sensor histidine kinase HprS	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.5	2.3e-05
WP_163424929.1|151036_151888_-	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000824349.1|152480_153668_-	porin	NA	Q1MVN1	Enterobacteria_phage	53.2	1.7e-97
WP_078164536.1|154234_154600_+	permease	NA	NA	NA	NA	NA
WP_000365572.1|154639_155335_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	3.6e-07
WP_001157243.1|155401_156820_+	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.9	4.0e-101
WP_000786004.1|156800_157271_+	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	1.5e-33
WP_001212226.1|157259_158180_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000922683.1|158353_159271_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_047623677.1|159349_159532_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_001537201.1|159774_161469_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
>prophage 12
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	177307	177976	4945561		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_163424932.1|177307_177976_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.3	4.3e-82
>prophage 13
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	189763	190516	4945561		Bacillus_virus(100.0%)	1	NA	NA
WP_001272991.1|189763_190516_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
>prophage 14
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	200798	201929	4945561	integrase	Ralstonia_phage(100.0%)	1	194276:194289	212192:212205
194276:194289	attL	AAAGGCCAGCTTGC	NA	NA	NA	NA
WP_078164716.1|200798_201929_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A221SAN4	Ralstonia_phage	28.2	1.8e-16
WP_078164716.1|200798_201929_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A221SAN4	Ralstonia_phage	28.2	1.8e-16
212192:212205	attR	AAAGGCCAGCTTGC	NA	NA	NA	NA
>prophage 15
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	205143	206667	4945561		Staphylococcus_phage(100.0%)	1	NA	NA
WP_163424939.1|205143_206667_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	39.1	1.1e-88
>prophage 16
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	210427	213712	4945561		Liberibacter_phage(100.0%)	1	NA	NA
WP_025653378.1|210427_213712_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.6	3.3e-66
>prophage 17
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	224104	225619	4945561		Cedratvirus(100.0%)	1	NA	NA
WP_001187819.1|224104_225619_+	arabinose ABC transporter ATP binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.7	1.3e-12
>prophage 18
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	235706	241350	4945561		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_001297437.1|235706_237368_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_127678837.1|237413_239015_+	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.7	3.2e-14
WP_000204337.1|239033_239894_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_061348489.1|239896_240946_+	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000763867.1|240960_241350_+	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
>prophage 19
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	246603	248337	4945561	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001025322.1|246603_248337_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.5	3.4e-86
>prophage 20
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	254952	257003	4945561		Synechococcus_phage(50.0%)	3	NA	NA
WP_000019590.1|254952_255696_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	3.5e-24
WP_000252980.1|255736_256132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023568423.1|256184_257003_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
>prophage 21
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	261021	268184	4945561		Bacillus_virus(50.0%)	9	NA	NA
WP_001295503.1|261021_261543_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_032281036.1|261544_262147_-	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_010723105.1|262217_262283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580323.1|262421_263033_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_000568519.1|263041_264052_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000571478.1|264297_265083_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000202996.1|265079_265835_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_001342995.1|265913_266846_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_001184045.1|266861_268184_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
>prophage 22
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	272182	273658	4945561		Cyanophage(100.0%)	1	NA	NA
WP_000301720.1|272182_273658_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.3	9.9e-79
>prophage 23
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	283158	286184	4945561		Pectobacterium_phage(50.0%)	5	NA	NA
WP_000916763.1|283158_283389_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000168747.1|283527_283902_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000879298.1|283905_284778_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000976472.1|284790_285132_+	YebY family protein	NA	NA	NA	NA	NA
WP_000812739.1|285527_286184_+	protein-serine/threonine phosphatase	NA	A0A2D1GLI5	Escherichia_phage	50.0	1.2e-55
>prophage 24
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	293680	295729	4945561		Moraxella_phage(100.0%)	1	NA	NA
WP_001055791.1|293680_295729_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
>prophage 25
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	301064	301274	4945561		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|301064_301274_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 26
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	306915	308472	4945561		Moraxella_phage(100.0%)	1	NA	NA
WP_000394983.1|306915_308472_+	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 27
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	312334	320440	4945561	tRNA	Pandoravirus(33.33%)	8	NA	NA
WP_163424948.1|312334_313696_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	39.6	2.4e-39
WP_000457334.1|313769_313949_+	YoaH family protein	NA	NA	NA	NA	NA
WP_001307845.1|314068_314428_-	DUF1889 family protein	NA	NA	NA	NA	NA
WP_001295493.1|314789_315134_-	RidA family protein	NA	NA	NA	NA	NA
WP_016244699.1|315265_317176_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	5.9e-92
WP_001220953.1|317233_317929_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000290579.1|317968_318550_+	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_000758422.1|318754_320440_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
>prophage 28
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	335194	339771	4945561		Bacillus_phage(100.0%)	3	NA	NA
WP_000766132.1|335194_336685_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	6.4e-09
WP_000616433.1|336865_338341_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000219686.1|338487_339771_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
>prophage 29
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	343089	343944	4945561		Indivirus(100.0%)	1	NA	NA
WP_001186335.1|343089_343944_+	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.6	3.3e-10
>prophage 30
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	352756	356842	4945561		Staphylococcus_phage(50.0%)	4	NA	NA
WP_163424953.1|352756_353737_+	NADH-dependent methylglyoxal reductase	NA	A0A2H4PQR8	Staphylococcus_phage	22.0	1.3e-07
WP_000719088.1|353873_354632_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_001299574.1|354749_356108_+	MFS transporter	NA	NA	NA	NA	NA
WP_001135075.1|356200_356842_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	34.9	2.9e-19
>prophage 31
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	361755	363717	4945561		Streptococcus_phage(100.0%)	1	NA	NA
WP_163424954.1|361755_363717_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.7	5.4e-40
>prophage 32
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	369314	369968	4945561		Bacillus_phage(100.0%)	1	NA	NA
WP_001302822.1|369314_369968_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.0	3.3e-10
>prophage 33
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	376732	377953	4945561		Klosneuvirus(100.0%)	1	NA	NA
WP_000082006.1|376732_377953_+	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.6	2.5e-27
>prophage 34
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	385429	386257	4945561		Bacillus_virus(100.0%)	1	NA	NA
WP_000175050.1|385429_386257_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	1.2e-73
>prophage 35
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	392384	394646	4945561		Tupanvirus(100.0%)	1	NA	NA
WP_000077848.1|392384_394646_-	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	1.8e-143
>prophage 36
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	405943	425536	4945561	tRNA	Tupanvirus(22.22%)	19	NA	NA
WP_001144202.1|405943_407872_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	9.4e-130
WP_001700733.1|407875_408418_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001124225.1|408514_408712_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124850.1|408764_409121_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|409243_409288_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000018588.1|409570_410554_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_000672327.1|410568_412956_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_001229265.1|412960_413260_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000956517.1|413360_414341_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001154187.1|414403_414955_+	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000029466.1|414954_415704_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001209785.1|415781_416246_+	endopeptidase	NA	S5MM68	Bacillus_phage	36.9	2.1e-11
WP_097489804.1|416492_417206_+	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_077039212.1|417268_418705_+	YdiU family protein	NA	NA	NA	NA	NA
WP_021577553.1|418708_418900_-	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_001082229.1|419031_420078_-	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
WP_000368046.1|420234_421068_-	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_000069375.1|421400_423779_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	9.4e-172
WP_123007778.1|423835_425536_-	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.7	4.7e-32
>prophage 37
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	444130	449214	4945561		Lake_Baikal_phage(33.33%)	5	NA	NA
WP_000367171.1|444130_444499_+	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	5.6e-15
WP_023308023.1|444507_445995_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000948875.1|446004_446751_+	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	24.0	3.9e-07
WP_000908027.1|446725_447997_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_078164932.1|447993_449214_+	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.2	4.4e-93
>prophage 38
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	457503	459770	4945561		Escherichia_phage(50.0%)	3	NA	NA
WP_001349911.1|457503_458172_+	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.2	1.0e-22
WP_028132273.1|458168_458954_+	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_000587573.1|458957_459770_+	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	6.5e-08
>prophage 39
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	465274	474078	4945561		Orpheovirus(20.0%)	9	NA	NA
WP_000493947.1|465274_465916_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
WP_000098896.1|465955_467104_-	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	9.3e-85
WP_001182361.1|467394_468606_-	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000269493.1|468718_469651_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000190982.1|469647_470673_-	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
WP_000102278.1|470971_471061_+	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000701040.1|471226_472396_+	MFS transporter	NA	NA	NA	NA	NA
WP_000007283.1|472541_473123_-	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_163424965.1|473250_474078_-	endopeptidase	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
>prophage 40
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	482881	484380	4945561		Indivirus(50.0%)	2	NA	NA
WP_000250656.1|482881_483778_+	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	4.7e-07
WP_001296937.1|483858_484380_+	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	7.8e-47
>prophage 41
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	491291	492566	4945561	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001295400.1|491291_492566_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 42
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	512452	514264	4945561		Vaccinia_virus(100.0%)	1	NA	NA
WP_023308011.1|512452_514264_+	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.5	0.0e+00
>prophage 43
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	524159	525461	4945561		Bacillus_phage(100.0%)	1	NA	NA
WP_000732491.1|524159_525461_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.9	3.2e-17
>prophage 44
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	543223	558661	4945561		Escherichia_phage(44.44%)	15	NA	NA
WP_163424972.1|543223_543838_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	1.5e-28
WP_000526477.1|543880_544735_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_083575880.1|544736_545354_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_163425552.1|545364_547788_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.8	7.5e-209
WP_163424973.1|547848_550275_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	4.5e-214
WP_001295396.1|550472_550778_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_137567117.1|550885_551596_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|551598_552159_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705197.1|552193_552535_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|552669_552996_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|553201_554416_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_137567116.1|554427_555447_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.5	1.1e-17
WP_000151243.1|555504_556872_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_032224032.1|556961_558422_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	8.6e-43
WP_000214712.1|558457_558661_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 45
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	564026	564917	4945561		Bacillus_phage(100.0%)	1	NA	NA
WP_023307999.1|564026_564917_+	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	1.1e-19
>prophage 46
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	569402	569786	4945561		Streptococcus_phage(100.0%)	1	NA	NA
WP_089527332.1|569402_569786_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
>prophage 47
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	577534	578953	4945561		Bacillus_phage(100.0%)	1	NA	NA
WP_123003724.1|577534_578953_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
>prophage 48
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	586823	588359	4945561		Staphylococcus_phage(100.0%)	1	NA	NA
WP_137537908.1|586823_588359_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	24.0	2.5e-16
>prophage 49
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	591762	597183	4945561		Escherichia_phage(100.0%)	1	NA	NA
WP_163424975.1|591762_597183_+	autotransporter barrel domain-containing lipoprotein	NA	A0A2L1IV18	Escherichia_phage	38.7	3.2e-143
>prophage 50
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	613794	620732	4945561		Bacillus_phage(50.0%)	3	NA	NA
WP_024248341.1|613794_615480_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	23.3	2.2e-10
WP_163424980.1|615517_617890_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_163424981.1|617936_620732_+	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	24.0	5.7e-19
>prophage 51
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	626011	629818	4945561		Bacillus_virus(50.0%)	2	NA	NA
WP_000426292.1|626011_627394_+	diguanylate cyclase DosC	NA	G3MA91	Bacillus_virus	31.5	2.0e-17
WP_072148463.1|627418_629818_+	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.6e-09
>prophage 52
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	634134	636040	4945561		Planktothrix_phage(100.0%)	2	NA	NA
WP_023307982.1|634134_635121_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.7	8.5e-18
WP_023307981.1|635113_636040_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.5	2.4e-14
>prophage 53
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	639334	640775	4945561		Tupanvirus(50.0%)	2	NA	NA
WP_000642407.1|639334_640345_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.3	9.6e-25
WP_000781369.1|640490_640775_+	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
>prophage 54
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	646964	648065	4945561		Enterobacteria_phage(100.0%)	1	NA	NA
WP_163424984.1|646964_648065_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	65.1	7.0e-138
>prophage 55
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	656337	657882	4945561		Escherichia_phage(100.0%)	1	NA	NA
WP_000702535.1|656337_657882_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 56
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	675540	677643	4945561		Salmonella_phage(100.0%)	1	NA	NA
WP_163424995.1|675540_677643_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.3	3.1e-134
>prophage 57
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	684775	691825	4945561		Mycoplasma_phage(25.0%)	7	NA	NA
WP_000220411.1|684775_685789_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	2.1e-27
WP_001773579.1|685806_686952_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_163424996.1|687196_688603_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_001270286.1|688681_689098_-	type II toxin-antitoxin system antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
WP_000813794.1|689143_689320_-	type II toxin-antitoxin system mRNA interferase toxin HicA	NA	A0A0M3LQ86	Mannheimia_phage	57.9	3.6e-12
WP_072058135.1|689541_689772_+	YncJ family protein	NA	NA	NA	NA	NA
WP_163424997.1|689863_691825_-	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.3	2.7e-23
>prophage 58
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	705000	705949	4945561		Moraxella_phage(50.0%)	2	NA	NA
WP_000731833.1|705000_705174_-	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_000428998.1|705418_705949_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
>prophage 59
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	709888	713791	4945561		Klosneuvirus(100.0%)	1	NA	NA
WP_163425007.1|709888_713791_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.2	5.0e-53
>prophage 60
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	732482	733472	4945561		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762229.1|732482_733472_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
>prophage 61
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	738431	745701	4945561	tRNA	Enterobacteria_phage(20.0%)	6	NA	NA
WP_000837924.1|738431_739565_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
WP_001295593.1|739705_740140_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_000081418.1|740315_741251_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.7	1.1e-144
WP_000123737.1|741379_742753_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|743230_744214_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_137567309.1|744468_745701_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 62
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	750474	750990	4945561		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945010.1|750474_750990_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.1	2.4e-24
>prophage 63
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	769152	770235	4945561		Indivirus(100.0%)	1	NA	NA
WP_163425016.1|769152_770235_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.9	3.1e-13
>prophage 64
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	784248	785514	4945561		Klosneuvirus(100.0%)	1	NA	NA
WP_000069231.1|784248_785514_-	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.0	1.2e-24
>prophage 65
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	798304	800325	4945561		Bacillus_virus(50.0%)	2	NA	NA
WP_000573412.1|798304_799111_+	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
WP_028131797.1|799161_800325_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.1	6.2e-28
>prophage 66
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	809258	811193	4945561		Lactococcus_phage(100.0%)	1	NA	NA
WP_163425025.1|809258_811193_+	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.2	5.3e-32
>prophage 67
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	819008	819599	4945561		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176295.1|819008_819599_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 68
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	824523	829815	4945561	protease	Tupanvirus(33.33%)	4	NA	NA
WP_001295576.1|824523_827121_-	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.5	7.0e-88
WP_001031530.1|827500_827752_+	YciN family protein	NA	NA	NA	NA	NA
WP_047669156.1|827787_828837_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_077039405.1|829056_829815_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	4.4e-06
>prophage 69
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	836786	839744	4945561		Acinetobacter_phage(100.0%)	2	NA	NA
WP_000763524.1|836786_838382_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	1.7e-52
WP_155061070.1|838385_839744_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.0e-37
>prophage 70
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	851402	853417	4945561		Bacillus_virus(50.0%)	2	NA	NA
WP_000994905.1|851402_852407_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
WP_086259644.1|852403_853417_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
>prophage 71
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	861826	871835	4945561		Citrobacter_phage(25.0%)	10	NA	NA
WP_000068079.1|861826_862444_-	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.3e-53
WP_001287378.1|863047_863461_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000718995.1|863604_864513_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_000193447.1|864714_865728_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_001226476.1|865819_866725_-	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_001362540.1|866837_867296_+	YchJ family protein	NA	NA	NA	NA	NA
WP_000555853.1|867345_868188_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	3.7e-14
WP_001160110.1|868912_869590_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000571687.1|869589_870300_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_000702660.1|870296_871835_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
>prophage 72
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	882967	889236	4945561		Spodoptera_litura_granulovirus(33.33%)	8	NA	NA
WP_001146444.1|882967_883198_-	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	8.5e-06
WP_000063608.1|883467_884568_+	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_000170955.1|884973_885081_+	small toxic polypeptide LdrA/LdrC	NA	NA	NA	NA	NA
WP_000811065.1|885228_886083_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
WP_001257044.1|886118_886928_-	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000200374.1|886931_887324_-	SirB family protein	NA	NA	NA	NA	NA
WP_021556728.1|887320_888154_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000804726.1|888153_889236_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
>prophage 73
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	892372	895124	4945561		Tupanvirus(50.0%)	2	NA	NA
WP_001298109.1|892372_893320_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001033352.1|893444_895124_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
>prophage 74
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	910992	911751	4945561		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_137427620.1|910992_911751_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.7	1.5e-14
>prophage 75
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	929837	931525	4945561		Salmonella_phage(50.0%)	2	NA	NA
WP_000457620.1|929837_931106_-	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	83.2	1.8e-209
WP_000897378.1|931105_931525_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
>prophage 76
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	943059	945723	4945561		Escherichia_phage(100.0%)	1	NA	NA
WP_163425035.1|943059_945723_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	42.5	1.5e-85
>prophage 77
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	951268	954996	4945561		Enterobacteria_phage(66.67%)	5	NA	NA
WP_163425037.1|951268_952000_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	50.0	7.8e-53
WP_000373101.1|952220_952625_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_163425038.1|952677_952788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163425039.1|953319_953643_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	64.5	8.8e-41
WP_038339330.1|953745_954996_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
>prophage 78
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	959649	961020	4945561		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_000423729.1|959649_961020_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
>prophage 79
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	966040	973730	4945561		Mycoplasma_phage(50.0%)	8	NA	NA
WP_000531594.1|966040_967177_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799401.1|967160_968018_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_163425041.1|968014_968809_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_127678827.1|968805_969852_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000952736.1|970007_970829_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
WP_163425042.1|970844_971756_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_062883705.1|971784_973029_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_001033695.1|973028_973730_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.9e-35
>prophage 80
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	981018	981276	4945561		Erwinia_phage(100.0%)	1	NA	NA
WP_000800153.1|981018_981276_-	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 81
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	993600	995243	4945561		Streptococcus_virus(50.0%)	2	NA	NA
WP_044865247.1|993600_994605_-	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	30.9	8.4e-05
WP_001257000.1|994601_995243_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
>prophage 82
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	998515	999697	4945561		Ralstonia_phage(50.0%)	2	NA	NA
WP_000103754.1|998515_998752_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
WP_001008535.1|998962_999697_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
>prophage 83
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1012053	1012995	4945561		Brevibacillus_phage(100.0%)	1	NA	NA
WP_044865244.1|1012053_1012995_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	2.8e-10
>prophage 84
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1028844	1029090	4945561		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|1028844_1029090_+	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 85
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1033751	1034672	4945561		Morganella_phage(100.0%)	1	NA	NA
WP_000183364.1|1033751_1034672_+	kdo(2)-lipid IV(A) lauroyltransferase	NA	A0A1W6JP29	Morganella_phage	41.5	8.6e-57
>prophage 86
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1043980	1044514	4945561		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000857405.1|1043980_1044514_-	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	5.9e-26
>prophage 87
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1048647	1052446	4945561		Pelagibacter_phage(50.0%)	5	NA	NA
WP_001189321.1|1048647_1049481_+	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
WP_001300785.1|1049544_1050036_-	DUF1097 domain-containing protein	NA	NA	NA	NA	NA
WP_001001917.1|1050137_1050692_-	molecular chaperone YcdY	NA	NA	NA	NA	NA
WP_000283664.1|1050715_1051453_-	zinc-binding phosphatase	NA	NA	NA	NA	NA
WP_000351319.1|1051507_1052446_-	glyoxylate/hydroxypyruvate reductase GhrA	NA	M1I636	Acanthocystis_turfacea_Chlorella_virus	28.7	7.8e-05
>prophage 88
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1056241	1059382	4945561		Pseudomonas_phage(33.33%)	4	NA	NA
WP_001383022.1|1056241_1056721_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.7	2.3e-13
WP_137525578.1|1057059_1057878_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.0	2.7e-46
WP_000060628.1|1057967_1058906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000642912.1|1058971_1059382_-	hypothetical protein	NA	G5DES5	Salmonella_phage	41.2	9.2e-27
>prophage 89
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1083934	1085148	4945561	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_096098543.1|1083934_1085148_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	58.4	1.8e-102
>prophage 90
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1091944	1092652	4945561		Pithovirus(100.0%)	1	NA	NA
WP_001192027.1|1091944_1092652_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	29.4	8.5e-12
>prophage 91
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1102390	1106203	4945561		Moraxella_phage(100.0%)	1	NA	NA
WP_001240833.1|1102390_1106203_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	34.7	1.1e-23
>prophage 92
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1114362	1115145	4945561		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_163425054.1|1114362_1115145_-	SDR family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	22.4	6.5e-13
>prophage 93
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1118947	1120306	4945561		Bacillus_phage(100.0%)	1	NA	NA
WP_163425055.1|1118947_1120306_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.0	1.5e-20
>prophage 94
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1127125	1128190	4945561		Cronobacter_phage(100.0%)	1	NA	NA
WP_163425056.1|1127125_1128190_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.2	1.1e-90
>prophage 95
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1144960	1147060	4945561		Enterobacteria_phage(100.0%)	3	NA	NA
WP_001028095.1|1144960_1145455_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
WP_114006982.1|1145475_1146804_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.4	2.0e-232
WP_024244782.1|1146886_1147060_-	general stress protein	NA	Q9KX95	Enterobacteria_phage	100.0	6.4e-06
>prophage 96
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1151365	1163679	4945561		Klosneuvirus(20.0%)	13	NA	NA
WP_045177120.1|1151365_1152286_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
WP_000024560.1|1152285_1152591_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000209881.1|1152742_1153342_-	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_114006980.1|1153338_1155885_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	30.7	1.7e-70
WP_001230236.1|1155884_1157057_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001120120.1|1157186_1157879_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_114006979.1|1157851_1158880_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_163425059.1|1158962_1161707_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	32.0	4.6e-37
WP_114006977.1|1161778_1162852_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001019197.1|1162899_1163073_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001323678.1|1163062_1163293_-	protein YmcE	NA	NA	NA	NA	NA
WP_071524879.1|1163267_1163456_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066490.1|1163466_1163679_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
>prophage 97
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1182948	1183608	4945561	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000375136.1|1182948_1183608_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
>prophage 98
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1187841	1189896	4945561		Bacillus_phage(100.0%)	1	NA	NA
WP_072671849.1|1187841_1189896_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	1.3e-20
>prophage 99
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1202510	1204418	4945561		Tupanvirus(100.0%)	1	NA	NA
WP_000053083.1|1202510_1204418_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	1.1e-53
>prophage 100
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1220338	1231291	4945561	tRNA	Bacillus_virus(20.0%)	8	NA	NA
WP_163425065.1|1220338_1221106_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	7.5e-30
WP_000193850.1|1221302_1223915_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	9.1e-19
WP_001307697.1|1224180_1225383_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000117881.1|1225552_1226953_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_000977914.1|1227554_1228643_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.0	1.1e-98
WP_000462687.1|1228827_1230018_+	aspartate transaminase	NA	NA	NA	NA	NA
WP_001109453.1|1230068_1230716_-	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_001295932.1|1230742_1231291_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
>prophage 101
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1245996	1250537	4945561		Bacillus_phage(100.0%)	3	NA	NA
WP_000551270.1|1245996_1247745_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
WP_163425067.1|1247781_1250046_-	ComEC family protein	NA	NA	NA	NA	NA
WP_000167336.1|1250252_1250537_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
>prophage 102
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1255623	1256712	4945561		Streptococcus_phage(100.0%)	1	NA	NA
WP_000057154.1|1255623_1256712_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
>prophage 103
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1260810	1264025	4945561		Tetraselmis_virus(100.0%)	2	NA	NA
WP_001292812.1|1260810_1263093_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.4	1.3e-162
WP_000111043.1|1263284_1264025_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
>prophage 104
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1268864	1292663	4945561	protease,tRNA	Escherichia_phage(16.67%)	16	NA	NA
WP_000213098.1|1268864_1269482_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_163425069.1|1269492_1271937_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.6	6.6e-221
WP_000886683.1|1272175_1273468_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_163425070.1|1273558_1274902_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.6	1.4e-79
WP_001295343.1|1274912_1275524_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_163425071.1|1275678_1279785_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|1279919_1280414_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|1280958_1281924_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_001043577.1|1282046_1283813_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	7.0e-23
WP_163425072.1|1283813_1285535_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.4	7.6e-22
WP_032308576.1|1285576_1286281_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|1286565_1286784_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|1287469_1289746_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|1289776_1290097_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|1290419_1290644_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_047645766.1|1290716_1292663_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
>prophage 105
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1301923	1303642	4945561		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_163425075.1|1301923_1303642_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	4.0e-31
>prophage 106
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1307229	1308060	4945561		Roseobacter_phage(100.0%)	1	NA	NA
WP_001255167.1|1307229_1308060_-	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
>prophage 107
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1311749	1312478	4945561		Planktothrix_phage(100.0%)	1	NA	NA
WP_000027205.1|1311749_1312478_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
>prophage 108
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1319148	1328298	4945561		Streptococcus_phage(25.0%)	11	NA	NA
WP_047623948.1|1319148_1320276_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	6.0e-28
WP_000389260.1|1320316_1320805_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061658.1|1320864_1321710_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_163425079.1|1321706_1322660_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000996007.1|1322669_1323803_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000126069.1|1323897_1325010_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|1325360_1325837_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|1325924_1326827_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000189169.1|1326887_1327610_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201576.1|1327593_1327881_-	YbjC family protein	NA	NA	NA	NA	NA
WP_047623945.1|1328040_1328298_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	3.0e-23
>prophage 109
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1337633	1338836	4945561		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000195961.1|1337633_1338836_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
>prophage 110
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1350171	1352043	4945561		Planktothrix_phage(100.0%)	1	NA	NA
WP_001400536.1|1350171_1352043_-	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	4.0e-16
>prophage 111
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1355361	1363703	4945561		Synechococcus_phage(33.33%)	6	NA	NA
WP_000424894.1|1355361_1356024_-	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	33.6	4.3e-26
WP_069906733.1|1356154_1357054_+	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_163425082.1|1357059_1359492_+	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
WP_000114286.1|1359637_1360453_+	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
WP_000168801.1|1360604_1361870_+	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_000961458.1|1362110_1363703_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
>prophage 112
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1368699	1373924	4945561		Escherichia_phage(33.33%)	7	NA	NA
WP_163425085.1|1368699_1369215_-	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.4e-16
WP_120795379.1|1369267_1369333_-	protein YliM	NA	NA	NA	NA	NA
WP_001295297.1|1369567_1370455_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_000100800.1|1370753_1371257_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_000843866.1|1371660_1372407_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_001159065.1|1372545_1373205_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000569080.1|1373201_1373924_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
>prophage 113
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1377608	1386594	4945561		Erwinia_phage(25.0%)	8	NA	NA
WP_000710619.1|1377608_1377869_+	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
WP_163425086.1|1378133_1380416_+	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_001312689.1|1380421_1381135_+	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	29.7	1.6e-18
WP_000146355.1|1381208_1381475_+	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	3.1e-07
WP_000849301.1|1381739_1382000_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_163425087.1|1382227_1383313_-	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000386540.1|1383453_1384416_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_001307685.1|1384443_1386594_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.0	1.4e-41
>prophage 114
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1390983	1395975	4945561		Catovirus(50.0%)	4	NA	NA
WP_001717923.1|1390983_1392348_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001296991.1|1392576_1393248_+	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000976701.1|1393247_1394246_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_001362463.1|1394238_1395975_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
>prophage 115
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1406573	1407482	4945561		Streptococcus_phage(100.0%)	1	NA	NA
WP_001301716.1|1406573_1407482_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	8.3e-28
>prophage 116
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1413962	1415252	4945561		Klosneuvirus(100.0%)	1	NA	NA
WP_163425091.1|1413962_1415252_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.6	6.5e-18
>prophage 117
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1425514	1432089	4945561		Planktothrix_phage(33.33%)	7	NA	NA
WP_028132433.1|1425514_1426573_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.9	3.3e-20
WP_000604034.1|1426575_1427265_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000101994.1|1427264_1428038_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000891515.1|1428204_1428354_-	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_001147439.1|1428482_1429271_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000096880.1|1429338_1430811_+	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.3	7.2e-13
WP_001265443.1|1431072_1432089_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	1.0e-79
>prophage 118
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1436450	1439970	4945561		Klebsiella_phage(33.33%)	4	NA	NA
WP_089629293.1|1436450_1437503_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.4	5.7e-81
WP_000784348.1|1437818_1438199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000951276.1|1438312_1439254_+	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	27.9	2.9e-23
WP_000345419.1|1439250_1439970_-	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	31.8	1.6e-21
>prophage 119
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1484147	1484939	4945561		Kaumoebavirus(100.0%)	1	NA	NA
WP_163425101.1|1484147_1484939_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	27.8	4.9e-08
>prophage 120
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1488317	1491367	4945561		Acinetobacter_phage(50.0%)	2	NA	NA
WP_163425102.1|1488317_1489799_+	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	27.8	9.3e-45
WP_163425103.1|1489948_1491367_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.2	1.4e-61
>prophage 121
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1503235	1509216	4945561		Paramecium_bursaria_Chlorella_virus(33.33%)	4	NA	NA
WP_163425105.1|1503235_1505284_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.0	3.2e-27
WP_163425106.1|1505292_1505865_+	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_001624875.1|1505857_1508542_+	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.8	3.8e-12
WP_163425107.1|1508538_1509216_+	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	31.1	6.8e-27
>prophage 122
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1515870	1516635	4945561		Mycobacterium_phage(100.0%)	1	NA	NA
WP_163425108.1|1515870_1516635_+	esterase	NA	A0A1J0GVH7	Mycobacterium_phage	35.4	5.8e-06
>prophage 123
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1520917	1524796	4945561	tRNA	Escherichia_phage(50.0%)	2	NA	NA
WP_001287134.1|1520917_1522582_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	98.7	0.0e+00
WP_032280505.1|1522849_1524796_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.6e-07
>prophage 124
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1529562	1531227	4945561		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337066.1|1529562_1531227_+	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.3	6.1e-85
>prophage 125
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1535212	1536292	4945561		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000490838.1|1535212_1536292_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.3e-47
>prophage 126
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1542175	1545708	4945561		Planktothrix_phage(50.0%)	3	NA	NA
WP_000631384.1|1542175_1542901_+	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
WP_062892950.1|1543018_1543954_+	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_163425110.1|1544037_1545708_+	molecular chaperone HscC	NA	E5ESM6	Bathycoccus_sp._RCC1105_virus	32.6	2.3e-76
>prophage 127
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1552645	1555228	4945561	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_129949109.1|1552645_1555228_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.3	8.9e-184
>prophage 128
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1562238	1564678	4945561		Synechococcus_phage(50.0%)	2	NA	NA
WP_163425114.1|1562238_1563327_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
WP_001092082.1|1563466_1564678_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
>prophage 129
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1569493	1570140	4945561		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_000939738.1|1569493_1569877_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
WP_000034825.1|1569930_1570140_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
>prophage 130
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1585564	1587679	4945561		Morganella_phage(50.0%)	2	NA	NA
WP_000278505.1|1585564_1585993_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.1e-19
WP_000887629.1|1586113_1587679_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
>prophage 131
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1590746	1592569	4945561		Streptococcus_phage(50.0%)	2	NA	NA
WP_000029813.1|1590746_1591967_+	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.8	3.6e-58
WP_160406971.1|1591939_1592569_+	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.7	1.1e-55
>prophage 132
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1606929	1612972	4945561		Klosneuvirus(50.0%)	3	NA	NA
WP_000140647.1|1606929_1607745_+	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
WP_000096698.1|1607741_1608875_-	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_163425119.1|1609090_1612972_-	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.4	2.2e-61
>prophage 133
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1623909	1627053	4945561		Leptospira_phage(100.0%)	1	NA	NA
WP_021553422.1|1623909_1627053_-	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.4	1.7e-59
>prophage 134
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1630198	1630882	4945561		Bacillus_phage(100.0%)	1	NA	NA
WP_000770953.1|1630198_1630882_+	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
>prophage 135
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1640007	1689420	4945561	capsid,protease,tail,head,integrase,portal,lysis,terminase	Enterobacteria_phage(67.27%)	66	1639539:1639585	1689434:1689480
1639539:1639585	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001201826.1|1640007_1640961_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_163425124.1|1641191_1641860_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000134810.1|1642364_1642547_+	general stress protein	NA	NA	NA	NA	NA
WP_001166090.1|1642625_1643126_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079482.1|1643162_1643669_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000488336.1|1643687_1644578_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_163425125.1|1644697_1645279_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	1.0e-100
WP_163425126.1|1645278_1648305_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	80.0	2.3e-66
WP_163425127.1|1648369_1648969_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	4.8e-109
WP_163425128.1|1649035_1652434_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.0	0.0e+00
WP_071961355.1|1652494_1653127_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.9e-96
WP_000194781.1|1653063_1653807_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.3e-148
WP_001152639.1|1653812_1654511_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_000847401.1|1654510_1654840_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	92.7	6.0e-53
WP_032361402.1|1654836_1657398_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	98.7	0.0e+00
WP_000459457.1|1657390_1657825_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479153.1|1657806_1658229_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_001345558.1|1658244_1658985_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	96.7	2.0e-128
WP_065225533.1|1658992_1659388_-|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	1.7e-70
WP_065225532.1|1659384_1659963_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.4	3.9e-79
WP_001204540.1|1659974_1660328_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	65.0	3.4e-38
WP_000522651.1|1660746_1661775_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.6	2.7e-115
WP_024237999.1|1661832_1662180_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	59.1	6.8e-23
WP_163425129.1|1662216_1663722_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	52.9	3.9e-99
WP_000831760.1|1663711_1665304_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	6.5e-185
WP_000259002.1|1665300_1665507_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001349605.1|1665490_1667419_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.9	2.5e-260
WP_000867568.1|1667390_1667939_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_158128252.1|1668326_1668521_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	4.3e-27
WP_001031427.1|1668685_1668892_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_000079503.1|1669177_1669588_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
WP_163425130.1|1669878_1670172_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	95.9	8.3e-46
WP_001228695.1|1670262_1670445_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001135280.1|1670661_1671159_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.6	1.1e-90
WP_000839596.1|1671158_1671374_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737283.1|1671962_1673060_+	porin	NA	Q1MVN1	Enterobacteria_phage	76.3	4.8e-155
WP_001204780.1|1673249_1673633_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
WP_000971055.1|1673718_1673859_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001099712.1|1673855_1674218_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000774488.1|1674214_1674505_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	4.3e-47
WP_000224916.1|1674497_1674668_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	1.5e-12
WP_001054341.1|1674667_1675123_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	1.1e-60
WP_163425131.1|1675119_1675221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000881075.1|1675337_1676135_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001302427.1|1676144_1676696_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000709082.1|1677160_1678687_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_032102575.1|1678744_1678852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070451.1|1678943_1679276_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|1679343_1679646_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788813.1|1679642_1680344_-	hypothetical protein	NA	M1FJ72	Enterobacteria_phage	99.1	3.8e-129
WP_001362420.1|1680340_1681270_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.8	1.4e-110
WP_001400028.1|1681356_1681896_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.7	1.5e-61
WP_000184665.1|1681926_1682154_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
WP_000712396.1|1682264_1682957_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	85.3	2.5e-109
WP_059327837.1|1683023_1683887_+	hypothetical protein	NA	M9NYX6	Enterobacteria_phage	62.1	1.8e-93
WP_000233576.1|1684367_1684574_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995419.1|1684650_1684947_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	6.8e-48
WP_000100847.1|1684952_1685738_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000611720.1|1685734_1686415_+	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	6.7e-131
WP_097769594.1|1686411_1686573_+	DUF1317 family protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.0	1.6e-22
WP_053883315.1|1686565_1687123_+	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	62.3	2.7e-61
WP_001386642.1|1687133_1687415_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000763385.1|1687513_1687732_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
WP_000488407.1|1687779_1688058_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000446905.1|1688029_1688401_+	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
WP_000051902.1|1688256_1689420_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
1689434:1689480	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
>prophage 136
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1696508	1699639	4945561	tRNA	Enterococcus_phage(50.0%)	4	NA	NA
WP_000729155.1|1696508_1697375_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_032182329.1|1697376_1697589_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_032223933.1|1697696_1698218_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_001402080.1|1698253_1699639_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
>prophage 137
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1711159	1712305	4945561		Streptococcus_phage(100.0%)	1	NA	NA
WP_000706356.1|1711159_1712305_-	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	1.1e-48
>prophage 138
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1718496	1720278	4945561		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_001096881.1|1718496_1720278_-	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	3.5e-38
>prophage 139
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1727385	1728072	4945561		Planktothrix_phage(100.0%)	1	NA	NA
WP_001110573.1|1727385_1728072_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
>prophage 140
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1731208	1731886	4945561		Bacillus_virus(100.0%)	1	NA	NA
WP_001157540.1|1731208_1731886_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	1.4e-27
>prophage 141
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1739619	1741782	4945561		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_089628784.1|1739619_1741782_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	31.5	4.1e-17
>prophage 142
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1766847	1770211	4945561		uncultured_virus(50.0%)	2	NA	NA
WP_053273880.1|1766847_1769352_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.4	1.3e-115
WP_001370330.1|1769869_1770211_-	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	74.5	9.3e-41
>prophage 143
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1778452	1786909	4945561		Acanthamoeba_polyphaga_moumouvirus(25.0%)	8	NA	NA
WP_112027669.1|1778452_1779412_+	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.7	1.0e-15
WP_001250105.1|1779408_1780371_-	ferrochelatase	NA	NA	NA	NA	NA
WP_001220233.1|1780502_1781147_-	adenylate kinase	NA	NA	NA	NA	NA
WP_000678201.1|1781326_1783201_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
WP_001195025.1|1783310_1783916_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_000467098.1|1783915_1784245_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_163425141.1|1784297_1786229_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000127356.1|1786357_1786909_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
>prophage 144
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1793917	1797067	4945561		Leptospira_phage(100.0%)	1	NA	NA
WP_001132469.1|1793917_1797067_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	6.2e-54
>prophage 145
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1805903	1809450	4945561		Bacillus_phage(100.0%)	2	NA	NA
WP_001256201.1|1805903_1807685_-	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	2.3e-42
WP_001235611.1|1807677_1809450_-	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	2.6e-49
>prophage 146
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1812773	1813469	4945561		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_053291338.1|1812773_1813469_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	67.6	4.2e-88
>prophage 147
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1816609	1821656	4945561	protease	Bacillus_phage(25.0%)	4	NA	NA
WP_001043542.1|1816609_1816882_-	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
WP_001295325.1|1817090_1819445_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_000130305.1|1819632_1820907_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_163425145.1|1821032_1821656_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
>prophage 148
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1847287	1856129	4945561	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_001021161.1|1847287_1847758_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
WP_163425148.1|1847846_1848950_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.5	2.4e-53
WP_000543535.1|1848953_1849403_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001382892.1|1849553_1850093_+	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_001295328.1|1850391_1851276_+	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_000974813.1|1851313_1851661_-	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_000046637.1|1851789_1852761_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000934822.1|1852771_1854619_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000007629.1|1854646_1854979_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000667319.1|1855001_1856129_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
>prophage 149
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1864752	1874724	4945561		Bacillus_phage(60.0%)	7	NA	NA
WP_000893603.1|1864752_1866048_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	1.3e-26
WP_096841062.1|1866105_1866795_-	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	3.3e-37
WP_163425150.1|1866984_1868187_+	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	1.8e-06
WP_163425151.1|1868183_1871327_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	27.4	2.6e-12
WP_001306939.1|1871452_1872637_+	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_001612495.1|1872779_1873688_-	fructokinase	NA	NA	NA	NA	NA
WP_001298537.1|1873812_1874724_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
>prophage 150
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1881319	1882435	4945561		Bacillus_phage(100.0%)	1	NA	NA
WP_000484048.1|1881319_1882435_-	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.1e-18
>prophage 151
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1889850	1891008	4945561		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000830741.1|1889850_1891008_+	OXA-12 family class D beta-lactamase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	5.1e-06
>prophage 152
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1897940	1898708	4945561		Planktothrix_phage(100.0%)	1	NA	NA
WP_163425154.1|1897940_1898708_-	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	40.3	8.6e-26
>prophage 153
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1906731	1909357	4945561		Bacillus_virus(50.0%)	3	NA	NA
WP_000078831.1|1906731_1907778_+	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.7	3.6e-35
WP_001141271.1|1907937_1908213_+	formaldehyde-responsive transcriptional repressor FrmR	NA	NA	NA	NA	NA
WP_000842102.1|1908247_1909357_+	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	1.2e-31
>prophage 154
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1912940	1914901	4945561		Micromonas_sp._RCC1109_virus(50.0%)	2	NA	NA
WP_001013503.1|1912940_1913954_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	4.1e-44
WP_163425158.1|1913950_1914901_-	acetaldehyde dehydrogenase (acetylating)	NA	G9E526	Ostreococcus_lucimarinus_virus	34.9	4.3e-35
>prophage 155
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1922135	1926415	4945561		Enterobacteria_phage(50.0%)	2	NA	NA
WP_000805884.1|1922135_1923218_+	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	99.4	2.4e-191
WP_163425159.1|1923340_1926415_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	97.5	0.0e+00
>prophage 156
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1930956	1931856	4945561		Lactobacillus_phage(100.0%)	1	NA	NA
WP_163425562.1|1930956_1931856_+	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	4.2e-16
>prophage 157
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1935789	1937676	4945561		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000010274.1|1935789_1937676_-	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	2.4e-53
>prophage 158
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1946171	1950709	4945561		Tupanvirus(50.0%)	4	NA	NA
WP_000692744.1|1946171_1947221_-	NADPH-dependent aldehyde reductase YahK	NA	A0A2K9L339	Tupanvirus	45.0	1.4e-71
WP_096132919.1|1947307_1948264_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_089621544.1|1948260_1949232_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_072686387.1|1949224_1950709_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.7	1.0e-11
>prophage 159
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1962888	1975011	4945561	integrase,holin	Escherichia_phage(50.0%)	6	1957137:1957150	1975767:1975780
1957137:1957150	attL	TTGCCGTTGGTGAA	NA	NA	NA	NA
WP_163425166.1|1962888_1966872_-	autotransporter adhesin EhaA	NA	A0A2L1IV18	Escherichia_phage	38.1	1.1e-124
WP_000131044.1|1967446_1969480_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001301903.1|1969608_1970196_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_163425167.1|1970209_1971682_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_163425168.1|1971695_1973366_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	8.0e-61
WP_001362381.1|1974447_1975011_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	52.7	1.8e-52
1975767:1975780	attR	TTGCCGTTGGTGAA	NA	NA	NA	NA
>prophage 160
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1984661	1987966	4945561		Erysipelothrix_phage(50.0%)	4	NA	NA
WP_163425172.1|1984661_1985987_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	7.2e-113
WP_000474077.1|1986095_1986332_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001306921.1|1986343_1986937_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_033814815.1|1987096_1987966_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.4	1.6e-52
>prophage 161
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	1994004	1994856	4945561		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001174462.1|1994004_1994856_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.7	4.4e-47
>prophage 162
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	2013158	2015357	4945561		Acinetobacter_phage(100.0%)	1	NA	NA
WP_163425176.1|2013158_2015357_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.8	1.1e-38
>prophage 163
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	2023160	2026872	4945561		Streptococcus_phage(66.67%)	3	NA	NA
WP_163425179.1|2023160_2024414_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
WP_001285288.1|2024425_2025529_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|2025816_2026872_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
>prophage 164
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	2036788	2151867	4945561	transposase,integrase,plate,tRNA	Acinetobacter_phage(12.5%)	104	2080036:2080052	2132648:2132664
WP_163425181.1|2036788_2037286_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_024191992.1|2037461_2038211_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_000729709.1|2038420_2038681_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000615980.1|2038683_2038962_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|2039117_2039858_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000333379.1|2039828_2040596_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_163425182.1|2040801_2041380_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.5	6.7e-15
WP_000973082.1|2041619_2044064_+	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000532698.1|2044106_2044580_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_033802989.1|2044733_2045504_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_032225710.1|2045543_2046680_-|transposase	ISAs1-like element ISEc1 family transposase	transposase	NA	NA	NA	NA
WP_089558415.1|2047548_2047857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163425183.1|2049621_2049777_+	type I addiction module toxin, SymE family	NA	NA	NA	NA	NA
WP_047670951.1|2049883_2050327_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_163425184.1|2053271_2053736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163425185.1|2053825_2054446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000203114.1|2058592_2059036_-	DcrB-related protein	NA	NA	NA	NA	NA
WP_163425186.1|2059059_2061273_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_089621605.1|2061298_2061685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163425565.1|2061681_2062167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089558414.1|2063396_2063768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097315889.1|2063764_2064499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089522469.1|2064829_2065303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089522471.1|2065287_2065758_-	glucosaminidase domain-containing protein	NA	NA	NA	NA	NA
WP_163425566.1|2065785_2066556_-	DUF2094 domain-containing protein	NA	NA	NA	NA	NA
WP_163425187.1|2066555_2070422_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_077782713.1|2070421_2070667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112912441.1|2070717_2071392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163425188.1|2071397_2072714_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_047670859.1|2072710_2074054_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_089522479.1|2074057_2074591_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000119441.1|2074658_2075144_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_163425189.1|2075257_2075629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000533466.1|2075625_2076111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163425190.1|2076163_2077678_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000996814.1|2077702_2078248_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000144225.1|2078309_2078600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163425191.1|2078602_2079166_-	peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001542643.1|2079178_2081812_-	type VI secretion system ATPase TssH	NA	A0A2I7SAX5	Vibrio_phage	32.8	2.5e-80
2080036:2080052	attL	CAATCTGCGCCAGCGCG	NA	NA	NA	NA
WP_045178071.1|2082144_2083059_+	type VI secretion system-associated protein TagK	NA	NA	NA	NA	NA
WP_045178072.1|2083045_2083876_+	impE family protein	NA	NA	NA	NA	NA
WP_163425192.1|2083872_2084367_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_097488633.1|2084382_2086266_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_089522221.1|2086262_2087258_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_137567009.1|2087268_2088315_+	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_163425193.1|2088635_2089844_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A077KET4	Ralstonia_phage	37.5	4.0e-54
WP_163425194.1|2089908_2090382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163425195.1|2090433_2091132_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_163425196.1|2091487_2093011_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_001614372.1|2093035_2093260_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_163425197.1|2093363_2095208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000169527.1|2097094_2097394_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001547438.1|2097390_2098257_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.0e-51
WP_163425198.1|2098675_2099152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163425199.1|2099148_2099859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163425200.1|2100158_2101091_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_163425201.1|2101791_2102064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163425202.1|2102141_2103083_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_163425203.1|2103159_2105700_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_163425204.1|2105706_2106387_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_163425205.1|2106476_2107016_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_053919685.1|2107610_2107910_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_001547438.1|2107906_2108773_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.0e-51
WP_163425206.1|2108977_2109553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163425207.1|2109729_2110086_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_163425208.1|2110147_2110687_-	outer membrane beta-barrel protein	NA	A0A0P0ZBV0	Stx2-converting_phage	28.2	7.1e-11
WP_163425209.1|2110973_2111462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163425210.1|2111434_2112175_-	response regulator	NA	NA	NA	NA	NA
WP_163425211.1|2112373_2112880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163425212.1|2112852_2113602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163425213.1|2114015_2118227_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	37.2	6.0e-137
WP_163425214.1|2118781_2120329_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_163425215.1|2122880_2123456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163425216.1|2123680_2124556_+	GTPase family protein	NA	NA	NA	NA	NA
WP_163425217.1|2124816_2125530_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_000772020.1|2125526_2126162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163425218.1|2126197_2126650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163425219.1|2126646_2127099_+	hypothetical protein	NA	J7KKK1	Erwinia_phage	50.0	9.5e-33
WP_001104018.1|2127161_2127704_+	DUF4339 domain-containing protein	NA	NA	NA	NA	NA
WP_020837115.1|2127763_2128216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001114682.1|2128292_2128526_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_001234406.1|2128645_2129464_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	37.2	9.7e-44
WP_163425220.1|2129731_2130202_+	antirestriction protein	NA	A0A1S5R3R9	Pseudomonas_phage	35.8	2.8e-11
WP_000437750.1|2130213_2130693_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_000691981.1|2130713_2130935_+	DUF987 domain-containing protein	NA	NA	NA	NA	NA
WP_163425221.1|2130958_2131318_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_001194695.1|2131368_2131746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000777682.1|2131742_2132234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000413747.1|2132265_2132469_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001366128.1|2133735_2134467_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	7.6e-40
2132648:2132664	attR	CGCGCTGGCGCAGATTG	NA	NA	NA	NA
WP_000917883.1|2134531_2134999_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001307587.1|2134995_2135718_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_137427674.1|2135751_2136507_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|2136578_2137937_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_163425222.1|2137984_2138755_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|2138832_2139633_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648556.1|2139873_2140788_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997059.1|2140784_2141588_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	2.4e-39
WP_001140187.1|2147345_2147921_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_137566781.1|2148108_2149140_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.7	3.6e-35
WP_001294600.1|2149132_2149786_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874224.1|2149825_2150641_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_032237026.1|2150758_2151163_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094004.1|2151159_2151867_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
>prophage 165
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	2162143	2166259	4945561		Saccharomonospora_phage(50.0%)	2	NA	NA
WP_001294774.1|2162143_2165626_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_163425227.1|2165662_2166259_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.9	2.3e-26
>prophage 166
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	2175087	2175846	4945561		Flavobacterium_phage(100.0%)	1	NA	NA
WP_001295562.1|2175087_2175846_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
>prophage 167
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	2187587	2189012	4945561	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_096293050.1|2187587_2189012_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
>prophage 168
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	2192941	2193286	4945561		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|2192941_2193286_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 169
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	2199197	2199995	4945561		Planktothrix_phage(100.0%)	1	NA	NA
WP_001158929.1|2199197_2199995_-	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	6.0e-14
>prophage 170
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	2205232	2212038	4945561	tRNA	Acanthamoeba_polyphaga_mimivirus(50.0%)	6	NA	NA
WP_130065362.1|2205232_2207662_-	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.6	2.3e-40
WP_001283249.1|2207735_2208266_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_000396036.1|2208280_2208985_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001155227.1|2209162_2209618_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_163425229.1|2209654_2210581_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_000174643.1|2210619_2212038_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
>prophage 171
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	2221993	2222866	4945561		Sodalis_phage(100.0%)	1	NA	NA
WP_000339964.1|2221993_2222866_-	recombination-promoting nuclease RpnC	NA	Q2A0A7	Sodalis_phage	49.6	3.2e-61
>prophage 172
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	2226128	2232751	4945561		Anomala_cuprea_entomopoxvirus(33.33%)	5	NA	NA
WP_000150637.1|2226128_2227055_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
WP_000651599.1|2227163_2227826_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000683335.1|2227866_2228403_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_001624564.1|2228608_2230999_+	quinoprotein glucose dehydrogenase	NA	NA	NA	NA	NA
WP_001189610.1|2231200_2232751_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.7e-18
>prophage 173
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	2240490	2241915	4945561		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102485.1|2240490_2241915_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 174
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	2250425	2250977	4945561		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923722.1|2250425_2250977_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	31.6	1.1e-11
>prophage 175
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	2255222	2256266	4945561		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_130204936.1|2255222_2256266_-	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	8.2e-104
>prophage 176
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	2282587	2284312	4945561		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_000425668.1|2282587_2284312_-	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	1.9e-36
>prophage 177
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	2295791	2296490	4945561		Planktothrix_phage(100.0%)	1	NA	NA
WP_000916287.1|2295791_2296490_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	37.2	2.8e-23
>prophage 178
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	2302795	2308217	4945561		Yellowstone_lake_phycodnavirus(50.0%)	2	NA	NA
WP_163425241.1|2302795_2305147_+	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.3	1.1e-36
WP_001117011.1|2305310_2308217_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
>prophage 179
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	2315961	2317922	4945561		Microcystis_phage(50.0%)	4	NA	NA
WP_160412351.1|2315961_2316810_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.1e-08
WP_001160974.1|2316806_2317121_-	CcdB family protein	NA	NA	NA	NA	NA
WP_000125566.1|2317123_2317357_-	antitoxin	NA	NA	NA	NA	NA
WP_000624375.1|2317442_2317922_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
>prophage 180
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	2325816	2331477	4945561		Vibrio_phage(50.0%)	4	NA	NA
WP_000787110.1|2325816_2327331_+	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
WP_000347117.1|2327361_2328504_+	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000349922.1|2328632_2329850_+	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_001352635.1|2329923_2331477_+	crotonobetaine/carnitine-CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.3	5.4e-35
>prophage 181
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	2336980	2338129	4945561		Halovirus(100.0%)	1	NA	NA
WP_088375720.1|2336980_2338129_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.7e-49
>prophage 182
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	2342535	2345352	4945561	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001286889.1|2342535_2345352_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	2.1e-77
>prophage 183
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	2354838	2363908	4945561		uncultured_Caudovirales_phage(20.0%)	9	NA	NA
WP_000681368.1|2354838_2356005_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	53.8	9.2e-88
WP_001181672.1|2356533_2356743_+	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	72.5	5.2e-18
WP_001118464.1|2356846_2357977_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_000516135.1|2358065_2359982_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_000843568.1|2360359_2360764_+	DUF2541 family protein	NA	NA	NA	NA	NA
WP_001102367.1|2360789_2361503_+	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000528538.1|2361651_2362218_+	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001295414.1|2362252_2362840_-	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000130185.1|2362954_2363908_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.5	1.7e-10
>prophage 184
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	2377100	2377790	4945561		Bacillus_phage(100.0%)	1	NA	NA
WP_001188664.1|2377100_2377790_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	1.1e-29
>prophage 185
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	2381126	2386481	4945561		Bacillus_phage(33.33%)	3	NA	NA
WP_000409457.1|2381126_2383064_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000046749.1|2383274_2384942_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000093814.1|2385248_2386481_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	3.6e-82
>prophage 186
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	2393224	2394547	4945561		Geobacillus_virus(100.0%)	1	NA	NA
WP_163425247.1|2393224_2394547_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.5	1.5e-78
>prophage 187
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	2400589	2403465	4945561		Salmonella_phage(50.0%)	3	NA	NA
WP_000490275.1|2400589_2400751_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001295748.1|2400877_2401483_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000175940.1|2401875_2403465_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
>prophage 188
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	2411126	2412406	4945561		Salmonella_phage(50.0%)	2	NA	NA
WP_000098818.1|2411126_2411666_+	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
WP_000799911.1|2411668_2412406_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
>prophage 189
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	2415631	2420996	4945561		Tupanvirus(50.0%)	4	NA	NA
WP_000106033.1|2415631_2416654_-	L-galactonate oxidoreductase	NA	A0A2K9L7I1	Tupanvirus	26.3	2.7e-11
WP_000091572.1|2416792_2417707_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000410140.1|2417921_2419283_+	MFS transporter	NA	NA	NA	NA	NA
WP_000919571.1|2419331_2420996_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
>prophage 190
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	2440062	2442408	4945561		Liberibacter_phage(100.0%)	1	NA	NA
WP_163425250.1|2440062_2442408_+	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	26.1	6.7e-29
>prophage 191
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	2449856	2450801	4945561	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000181175.1|2449856_2450801_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	52.5	1.8e-62
>prophage 192
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	2466466	2467153	4945561		Clostridioides_phage(100.0%)	1	NA	NA
WP_163425257.1|2466466_2467153_-	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	43.0	7.4e-37
>prophage 193
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	2473618	2475079	4945561		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208194.1|2473618_2475079_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	9.5e-50
>prophage 194
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	2485276	2486953	4945561		Escherichia_phage(100.0%)	2	NA	NA
WP_000044711.1|2485276_2485873_-	type 1 fimbria regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
WP_000790583.1|2486350_2486953_-	type 1 fimbria regulatory protein FimB	NA	A0A2L1IV36	Escherichia_phage	52.3	3.1e-55
>prophage 195
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	2490322	2515552	4945561		uncultured_Mediterranean_phage(66.67%)	6	NA	NA
WP_163425260.1|2490322_2491303_+	sialate O-acetylesterase	NA	H6WZJ9	Escherichia_phage	55.4	1.2e-101
WP_163425261.1|2492796_2494911_-	ATP-dependent helicase	NA	G3MA40	Bacillus_virus	24.1	5.9e-08
WP_163425262.1|2494907_2501249_-	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	22.1	8.3e-58
WP_088172283.1|2501248_2506153_-	class I SAM-dependent DNA methyltransferase	NA	A0A1B1IUC6	uncultured_Mediterranean_phage	21.2	7.4e-30
WP_001041504.1|2506155_2509014_-	DEAD/DEAH box helicase	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	24.9	3.8e-42
WP_047670525.1|2509237_2515552_-	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	21.7	1.2e-35
>prophage 196
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	2527636	2528656	4945561		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_155061509.1|2527636_2528656_+	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	1.9e-44
>prophage 197
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	2533782	2543058	4945561	tRNA	Klebsiella_phage(33.33%)	6	NA	NA
WP_163425264.1|2533782_2535285_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	2.7e-84
WP_001295681.1|2535445_2536528_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_000584114.1|2536527_2537628_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_000397144.1|2537894_2539406_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000786399.1|2539759_2540203_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_163425265.1|2540202_2543058_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
>prophage 198
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	2551550	2557647	4945561		Paramecium_bursaria_Chlorella_virus(66.67%)	6	NA	NA
WP_059327941.1|2551550_2552486_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.9	1.1e-51
WP_000148581.1|2552498_2552960_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000047539.1|2553032_2553419_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000471866.1|2553624_2556321_-	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_001387276.1|2556461_2556515_-	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_001181324.1|2556699_2557647_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
>prophage 199
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	2561285	2564046	4945561		Vibrio_phage(50.0%)	2	NA	NA
WP_000187778.1|2561285_2563424_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
WP_001106233.1|2563581_2564046_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.7	3.8e-53
>prophage 200
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	2568362	2574850	4945561		Klosneuvirus(33.33%)	6	NA	NA
WP_000853753.1|2568362_2569361_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_000596015.1|2569393_2570389_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_088375740.1|2570375_2571398_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000205805.1|2571411_2572914_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.8e-11
WP_000265933.1|2573053_2574010_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055075.1|2574319_2574850_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
>prophage 201
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	2596016	2597658	4945561	transposase	Escherichia_phage(50.0%)	2	NA	NA
WP_000826434.1|2596016_2597225_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.3	1.8e-208
WP_044804197.1|2597232_2597658_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	58.7	1.6e-42
>prophage 202
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	2611510	2612674	4945561		Ralstonia_phage(100.0%)	1	NA	NA
WP_163425270.1|2611510_2612674_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	44.0	8.3e-81
>prophage 203
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	2616607	2629639	4945561	protease,tRNA	Lactococcus_phage(20.0%)	11	NA	NA
WP_000076316.1|2616607_2619049_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
WP_001177639.1|2619087_2619513_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|2619717_2621016_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|2621119_2621317_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|2621398_2622403_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|2622405_2623665_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_000460360.1|2623750_2625031_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051883.1|2625107_2625416_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001280339.1|2625501_2626452_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001672293.1|2626444_2628292_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	7.5e-60
WP_044192279.1|2628301_2629639_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
>prophage 204
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	2633554	2634100	4945561		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001295188.1|2633554_2634100_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
>prophage 205
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	2641818	2642796	4945561		Tupanvirus(100.0%)	1	NA	NA
WP_000004771.1|2641818_2642796_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
>prophage 206
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	2647716	2648250	4945561		Morganella_phage(100.0%)	1	NA	NA
WP_001238378.1|2647716_2648250_+	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
>prophage 207
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	2652757	2654741	4945561		Vibrio_phage(50.0%)	2	NA	NA
WP_000729117.1|2652757_2654404_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_001026276.1|2654447_2654741_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
>prophage 208
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	2669018	2672230	4945561	tRNA	Acinetobacter_phage(50.0%)	2	NA	NA
WP_000856829.1|2669018_2670476_+	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.4	6.8e-48
WP_001295074.1|2670712_2672230_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
>prophage 209
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	2693426	2694929	4945561		Burkholderia_virus(100.0%)	1	NA	NA
WP_012311661.1|2693426_2694929_-	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.2	6.3e-57
>prophage 210
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	2700166	2700955	4945561		Cedratvirus(100.0%)	1	NA	NA
WP_053883866.1|2700166_2700955_+	phosphonate ABC transporter ATP-binding protein	NA	A0A1M7XV31	Cedratvirus	30.7	6.5e-13
>prophage 211
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	2706559	2708109	4945561		Bacillus_virus(50.0%)	2	NA	NA
WP_001075518.1|2706559_2707318_+	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.2	4.7e-16
WP_000611403.1|2707428_2708109_+	phosphonate C-P lyase system protein PhnL	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.5	9.3e-08
>prophage 212
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	2712027	2714013	4945561		Tetraselmis_virus(100.0%)	1	NA	NA
WP_163425280.1|2712027_2714013_+	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.6	3.8e-150
>prophage 213
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	2719258	2721406	4945561		Escherichia_phage(100.0%)	1	NA	NA
WP_001300547.1|2719258_2721406_+	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.9	7.0e-33
>prophage 214
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	2730914	2732873	4945561		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078209.1|2730914_2732873_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.4	1.9e-90
>prophage 215
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	2738457	2739807	4945561		Moraxella_phage(100.0%)	1	NA	NA
WP_000106882.1|2738457_2739807_-	guanine/hypoxanthine transporter GhxP	NA	A0A0R6PHV4	Moraxella_phage	71.6	1.8e-159
>prophage 216
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	2743623	2747237	4945561		Enterobacteria_phage(50.0%)	2	NA	NA
WP_000168305.1|2743623_2744160_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
WP_000357763.1|2744414_2747237_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.2	0.0e+00
>prophage 217
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	2751459	2754007	4945561		Yellowstone_lake_mimivirus(50.0%)	2	NA	NA
WP_001147332.1|2751459_2752539_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.2	4.0e-29
WP_000918363.1|2752591_2754007_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
>prophage 218
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	2760569	2761178	4945561		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|2760569_2761178_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 219
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	2770393	2771509	4945561		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|2770393_2771509_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 220
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	2787529	2788321	4945561		Pseudomonas_phage(100.0%)	1	NA	NA
WP_032151409.1|2787529_2788321_-	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	45.5	3.7e-48
>prophage 221
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	2804691	2808375	4945561		Dickeya_phage(100.0%)	1	NA	NA
WP_000096041.1|2804691_2808375_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 222
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	2824672	2826262	4945561		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_163425290.1|2824672_2826262_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	1.3e-68
>prophage 223
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	2831630	2833394	4945561		Bacillus_phage(50.0%)	3	NA	NA
WP_001044513.1|2831630_2831903_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
WP_000940106.1|2832089_2832680_-	YjaG family protein	NA	NA	NA	NA	NA
WP_000362388.1|2832722_2833394_-	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
>prophage 224
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	2842611	2850940	4945561		Vibrio_phage(50.0%)	2	NA	NA
WP_000653944.1|2842611_2846835_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	2.5e-66
WP_000263098.1|2846911_2850940_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
>prophage 225
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	2855056	2858109	4945561		Tupanvirus(50.0%)	2	NA	NA
WP_000031784.1|2855056_2856241_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000023081.1|2857158_2858109_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
>prophage 226
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	2866448	2872231	4945561	tRNA	Acinetobacter_phage(50.0%)	5	NA	NA
WP_160399478.1|2866448_2868293_-	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.0	7.1e-10
WP_163425292.1|2868661_2869762_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_000806411.1|2869801_2870161_-	YijD family membrane protein	NA	NA	NA	NA	NA
WP_001309117.1|2870160_2870811_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_163425293.1|2870914_2872231_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	35.9	1.2e-59
>prophage 227
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	2888147	2895394	4945561		Serratia_phage(33.33%)	5	NA	NA
WP_000184850.1|2888147_2890445_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
WP_000161265.1|2890495_2890816_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_001004446.1|2890830_2891910_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_163425296.1|2892218_2894720_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.6	7.9e-12
WP_000424845.1|2894731_2895394_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
>prophage 228
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	2912692	2914024	4945561		Erwinia_phage(100.0%)	1	NA	NA
WP_001293341.1|2912692_2914024_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
>prophage 229
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	2917787	2918633	4945561		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000084268.1|2917787_2918633_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
>prophage 230
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	2930301	2935162	4945561		Feldmannia_irregularis_virus(33.33%)	5	NA	NA
WP_001033722.1|2930301_2931000_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580424.1|2930996_2932370_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	26.2	3.8e-16
WP_001270249.1|2932475_2933150_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_001166063.1|2933298_2934282_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001297064.1|2934541_2935162_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
>prophage 231
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	2951813	2954864	4945561		Escherichia_phage(100.0%)	1	NA	NA
WP_011310337.1|2951813_2954864_+	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
>prophage 232
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	2971837	2974308	4945561		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_000190577.1|2971837_2972887_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
WP_001188777.1|2972898_2974308_+	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
>prophage 233
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	2978383	2981170	4945561		uncultured_virus(100.0%)	1	NA	NA
WP_000250006.1|2978383_2981170_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	1.7e-71
>prophage 234
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	2994856	2995471	4945561		Streptococcus_phage(100.0%)	1	NA	NA
WP_001296979.1|2994856_2995471_-	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	1.6e-19
>prophage 235
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	3004261	3007548	4945561		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000109943.1|3004261_3005038_-	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
WP_000459594.1|3005040_3005556_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_001295260.1|3005559_3005829_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000187543.1|3005907_3007548_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	4.8e-42
>prophage 236
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	3020079	3021909	4945561		Catovirus(100.0%)	1	NA	NA
WP_000035581.1|3020079_3021909_-	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	7.4e-84
>prophage 237
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	3028510	3032369	4945561		Bacillus_phage(100.0%)	3	NA	NA
WP_163425305.1|3028510_3030673_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
WP_001213584.1|3030756_3031473_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000130686.1|3031472_3032369_-	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	1.1e-24
>prophage 238
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	3042660	3044316	4945561		Tetraselmis_virus(100.0%)	1	NA	NA
WP_163425307.1|3042660_3044316_+	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	29.7	1.4e-44
>prophage 239
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	3052400	3058544	4945561		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000612044.1|3052400_3053531_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
WP_001145198.1|3053535_3054210_-	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000676056.1|3054187_3055069_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
WP_001226601.1|3055087_3056155_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.4	2.3e-101
WP_000006621.1|3056154_3057417_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.0e-23
WP_163425309.1|3057413_3058544_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	32.6	1.0e-27
>prophage 240
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	3062586	3067998	4945561		Indivirus(33.33%)	4	NA	NA
WP_001280776.1|3062586_3062916_-	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
WP_000047499.1|3063046_3064312_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
WP_001295254.1|3064445_3065930_+	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_163425310.1|3065976_3067998_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.8	2.9e-113
>prophage 241
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	3076372	3078019	4945561		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_163425312.1|3076372_3078019_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.3	1.2e-64
>prophage 242
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	3091397	3097250	4945561		Enterobacteria_phage(33.33%)	5	NA	NA
WP_001056273.1|3091397_3092288_-	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
WP_000211858.1|3092312_3093278_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_000387771.1|3093282_3094788_-	ribose ABC transporter ATP-binding protein RbsA	NA	G3M9Y6	Bacillus_virus	27.7	5.1e-14
WP_000715936.1|3094795_3095215_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_163425314.1|3095381_3097250_-	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	4.6e-65
>prophage 243
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	3100418	3101411	4945561		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845104.1|3100418_3101411_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	2.2e-50
>prophage 244
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	3113365	3116727	4945561		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_000933736.1|3113365_3114736_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	3.1e-34
WP_000334099.1|3114897_3116727_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.4	1.9e-132
>prophage 245
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	3123798	3127638	4945561		Cyanophage(50.0%)	4	NA	NA
WP_000867143.1|3123798_3124839_+	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
WP_089629520.1|3124924_3125884_+	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_001251991.1|3125883_3126774_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000063125.1|3126864_3127638_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
>prophage 246
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	3136653	3137991	4945561		Moraxella_phage(100.0%)	1	NA	NA
WP_000082693.1|3136653_3137991_+	adenine permease AdeP	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
>prophage 247
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	3150674	3158043	4945561		Staphylococcus_phage(33.33%)	8	NA	NA
WP_001307474.1|3150674_3150932_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
WP_000239730.1|3150895_3151255_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_000831330.1|3151271_3151412_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_122134670.1|3151641_3151722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000059111.1|3152018_3153422_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_000673464.1|3153426_3154527_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000060112.1|3154526_3155600_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000072067.1|3155628_3158043_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
>prophage 248
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	3162749	3163898	4945561		Oenococcus_phage(100.0%)	1	NA	NA
WP_000705012.1|3162749_3163898_+	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	2.7e-52
>prophage 249
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	3168325	3169279	4945561		Cyanophage(50.0%)	2	NA	NA
WP_001243437.1|3168325_3168739_+	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
WP_001243431.1|3168850_3169279_+	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
>prophage 250
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	3176139	3185161	4945561		Aeromonas_phage(25.0%)	10	NA	NA
WP_001087117.1|3176139_3177855_+	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.4	5.6e-41
WP_163425328.1|3177851_3179345_+	sulfatase-like hydrolase/transferase	NA	A0A2K9L1A5	Tupanvirus	25.4	1.1e-29
WP_000511299.1|3179391_3179841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000703959.1|3179949_3180297_+	YidH family protein	NA	NA	NA	NA	NA
WP_001113432.1|3180286_3180649_+	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_097714604.1|3180645_3181143_+	radical SAM protein	NA	NA	NA	NA	NA
WP_001306726.1|3181150_3182335_-	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	6.8e-14
WP_000060506.1|3182614_3182704_-	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_001312198.1|3183268_3183367_+	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_097398480.1|3183472_3185161_+	acetolactate synthase large subunit	NA	G9E4W7	Ostreococcus_lucimarinus_virus	28.8	3.1e-20
>prophage 251
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	3196300	3197698	4945561		Pandoravirus(100.0%)	1	NA	NA
WP_044866138.1|3196300_3197698_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	27.4	9.7e-44
>prophage 252
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	3202798	3204133	4945561		Moraxella_phage(100.0%)	1	NA	NA
WP_001362489.1|3202798_3204133_+	adenine permease AdeQ	NA	A0A0R6PHV4	Moraxella_phage	36.9	8.6e-66
>prophage 253
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	3235349	3236741	4945561		environmental_Halophage(100.0%)	1	NA	NA
WP_001295238.1|3235349_3236741_-	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 254
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	3241184	3246205	4945561		Bordetella_phage(33.33%)	4	NA	NA
WP_088129457.1|3241184_3243293_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
WP_000135058.1|3243311_3243587_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_001295237.1|3243641_3244265_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_000870058.1|3244522_3246205_+	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	21.7	4.3e-22
>prophage 255
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	3251306	3255869	4945561		Xanthomonas_phage(25.0%)	7	NA	NA
WP_000976070.1|3251306_3251765_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	9.6e-49
WP_000050160.1|3251742_3252963_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.6	3.8e-44
WP_001297375.1|3253134_3253803_+	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_000091955.1|3254019_3254256_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001051798.1|3254276_3254444_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_001114533.1|3254541_3255351_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
WP_001171873.1|3255389_3255869_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.6	6.3e-27
>prophage 256
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	3263307	3265401	4945561		Archaeal_BJ1_virus(50.0%)	2	NA	NA
WP_000364790.1|3263307_3264333_+	UDP-galactose--(galactosyl) LPS alpha1,2-galactosyltransferase	NA	A0ZYL4	Archaeal_BJ1_virus	25.9	1.2e-11
WP_163425338.1|3264417_3265401_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	38.5	2.4e-12
>prophage 257
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	3268809	3278316	4945561		Synechococcus_phage(16.67%)	9	NA	NA
WP_000587764.1|3268809_3269742_-	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	1.1e-35
WP_001213834.1|3269955_3271152_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	4.9e-36
WP_000646014.1|3271161_3272187_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_000982091.1|3272425_3273460_+	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	5.8e-09
WP_000483860.1|3273446_3274406_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_116349405.1|3274409_3275693_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_163425340.1|3275702_3277247_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001368341.1|3277491_3277923_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000024392.1|3278064_3278316_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
>prophage 258
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	3300345	3304956	4945561		Tupanvirus(50.0%)	3	NA	NA
WP_163425343.1|3300345_3302190_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.2	1.5e-15
WP_075842789.1|3302379_3303531_+	L-threonine dehydrogenase	NA	NA	NA	NA	NA
WP_000985736.1|3303660_3304956_+	Fic family protein	NA	A0A1V0E025	Clostridioides_phage	30.9	2.8e-21
>prophage 259
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	3322881	3324423	4945561		Staphylococcus_phage(100.0%)	1	NA	NA
WP_047624230.1|3322881_3324423_-	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	1.1e-16
>prophage 260
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	3329741	3330737	4945561		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182644.1|3329741_3330737_-	O-acetyltransferase WecH	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	27.1	1.6e-11
>prophage 261
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	3334960	3335173	4945561		Morganella_phage(100.0%)	1	NA	NA
WP_000014594.1|3334960_3335173_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 262
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	3338827	3341161	4945561		Escherichia_phage(100.0%)	1	NA	NA
WP_163425349.1|3338827_3341161_+	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	A0A077SK27	Escherichia_phage	29.5	1.7e-72
>prophage 263
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	3356973	3358958	4945561		Planktothrix_phage(50.0%)	2	NA	NA
WP_001196496.1|3356973_3357957_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	8.7e-15
WP_000107036.1|3357953_3358958_+	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	8.6e-18
>prophage 264
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	3405872	3407342	4945561		Bacillus_virus(50.0%)	2	NA	NA
WP_163425353.1|3405872_3406520_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.5	8.0e-17
WP_137567189.1|3406571_3407342_-	heme ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	30.0	2.3e-18
>prophage 265
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	3418929	3419355	4945561		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000065796.1|3418929_3419355_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.0	7.3e-51
>prophage 266
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	3422494	3424537	4945561		Indivirus(100.0%)	1	NA	NA
WP_001308122.1|3422494_3424537_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.1	6.8e-46
>prophage 267
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	3437948	3442156	4945561		Staphylococcus_phage(50.0%)	3	NA	NA
WP_000149129.1|3437948_3440684_+	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	4.1e-22
WP_001314210.1|3440683_3441808_+	ABC-2 transporter permease	NA	NA	NA	NA	NA
WP_001259387.1|3441880_3442156_+	type II toxin-antitoxin system HicA family toxin	NA	R4JMD3	Burkholderia_phage	48.8	1.9e-15
>prophage 268
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	3448776	3449583	4945561		Bacillus_virus(100.0%)	1	NA	NA
WP_000173673.1|3448776_3449583_-	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	5.9e-17
>prophage 269
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	3472831	3476963	4945561		Dickeya_phage(50.0%)	4	NA	NA
WP_001100467.1|3472831_3473497_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.6	5.6e-58
WP_000130621.1|3473717_3473963_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_028132010.1|3474064_3476263_-	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.3	8.5e-119
WP_000964718.1|3476336_3476963_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
>prophage 270
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	3479969	3482788	4945561		Staphylococcus_phage(50.0%)	3	NA	NA
WP_000617723.1|3479969_3480638_+	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
WP_001042003.1|3480630_3481689_+	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000130217.1|3481933_3482788_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
>prophage 271
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	3489269	3490752	4945561		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
WP_000082101.1|3489269_3490037_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
WP_000416895.1|3490038_3490752_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	9.1e-14
>prophage 272
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	3495121	3496932	4945561		Planktothrix_phage(50.0%)	2	NA	NA
WP_000907798.1|3495121_3496192_+	sn-glycerol 3-phosphate ABC transporter ATP binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
WP_163425367.1|3496188_3496932_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	24.5	1.4e-09
>prophage 273
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	3505331	3507428	4945561		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_137426813.1|3505331_3507428_+	RecQ family ATP-dependent DNA helicase	NA	F2NZ48	Diadromus_pulchellus_ascovirus	33.8	6.1e-42
>prophage 274
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	3517757	3520205	4945561		Dickeya_phage(100.0%)	1	NA	NA
WP_000993449.1|3517757_3520205_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 275
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	3529111	3530338	4945561		Ralstonia_phage(100.0%)	1	NA	NA
WP_163425368.1|3529111_3530338_+	RtcB family protein	NA	A0A1L7N133	Ralstonia_phage	60.2	5.2e-134
>prophage 276
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	3535557	3537951	4945561		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_000081903.1|3535557_3537951_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 277
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	3543918	3544797	4945561		Sodalis_phage(100.0%)	1	NA	NA
WP_000039087.1|3543918_3544797_-	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	52.8	1.9e-69
>prophage 278
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	3551361	3555128	4945561		Bacillus_phage(66.67%)	3	NA	NA
WP_001157751.1|3551361_3552081_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
WP_001253696.1|3552077_3553430_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
WP_001298201.1|3553505_3555128_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	5.3e-142
>prophage 279
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	3572030	3572867	4945561		Vibrio_phage(100.0%)	1	NA	NA
WP_000742141.1|3572030_3572867_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	2.9e-67
>prophage 280
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	3589404	3598945	4945561		Acinetobacter_phage(25.0%)	9	NA	NA
WP_000601850.1|3589404_3589968_+	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	55.8	3.5e-61
WP_087900998.1|3590053_3591274_+	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_001295162.1|3591340_3593431_-	membrane protein	NA	H9YQA8	environmental_Halophage	100.0	1.7e-76
WP_000242755.1|3593481_3594114_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001148908.1|3594415_3594820_+	OsmC family protein	NA	NA	NA	NA	NA
WP_001274680.1|3594874_3595744_-	phosphoribulokinase	NA	NA	NA	NA	NA
WP_000907085.1|3595797_3596016_-	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_000057379.1|3596009_3597032_-	hydrolase	NA	NA	NA	NA	NA
WP_000634798.1|3597031_3598945_-	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	4.3e-74
>prophage 281
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	3604514	3610088	4945561		uncultured_Caudovirales_phage(50.0%)	7	NA	NA
WP_001209707.1|3604514_3604901_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.1	7.4e-18
WP_000820736.1|3604900_3605260_+	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	30.2	3.1e-10
WP_000903375.1|3605267_3605555_+	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000246815.1|3605680_3606055_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_001138043.1|3606151_3606622_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000124700.1|3606718_3608833_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_000031783.1|3608903_3610088_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 282
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	3629965	3631437	4945561	tRNA	Prochlorococcus_phage(50.0%)	2	NA	NA
WP_000004458.1|3629965_3630913_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
WP_000114984.1|3630927_3631437_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
>prophage 283
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	3641772	3645926	4945561		Bacillus_virus(50.0%)	4	NA	NA
WP_000078338.1|3641772_3642531_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.2e-19
WP_163425573.1|3642538_3643642_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000019652.1|3643651_3644833_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000738568.1|3644900_3645926_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	1.8e-71
>prophage 284
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	3652430	3653315	4945561		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_163425373.1|3652430_3653315_-	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.2	2.4e-24
>prophage 285
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	3663880	3664924	4945561		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|3663880_3664924_+	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 286
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	3681603	3684128	4945561	protease	uncultured_archaeal_virus(50.0%)	2	NA	NA
WP_000497723.1|3681603_3682671_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
WP_001295271.1|3682760_3684128_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
>prophage 287
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	3688094	3688592	4945561	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_000366126.1|3688094_3688592_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	2.5e-26
>prophage 288
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	3692295	3697043	4945561		Burkholderia_virus(50.0%)	5	NA	NA
WP_000108459.1|3692295_3693786_+	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.6	4.9e-09
WP_000054239.1|3693833_3694523_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_163425376.1|3694519_3695395_+	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_053883066.1|3695391_3695856_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_163425377.1|3695915_3697043_-	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	87.8	2.3e-72
>prophage 289
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	3703792	3718587	4945561		Staphylococcus_phage(25.0%)	17	NA	NA
WP_001299745.1|3703792_3704722_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
WP_000809774.1|3704817_3707154_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_001302019.1|3707383_3708037_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_038339230.1|3708033_3708762_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_053273571.1|3708758_3709391_-	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000216791.1|3709604_3709877_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000243741.1|3709873_3710728_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000183676.1|3710773_3711265_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_001176599.1|3711382_3711670_-	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000809051.1|3711692_3713126_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_000224099.1|3713173_3713899_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000669785.1|3713905_3714463_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000030537.1|3714431_3715007_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000030005.1|3715003_3715570_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
WP_001295557.1|3715590_3716577_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_105517638.1|3716590_3717568_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_000438245.1|3717777_3718587_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
>prophage 290
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	3722655	3724132	4945561		Vibrio_phage(50.0%)	2	NA	NA
WP_000445413.1|3722655_3722934_-	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
WP_001047336.1|3723160_3724132_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
>prophage 291
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	3730760	3733633	4945561	protease	Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_001107467.1|3730760_3732695_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
WP_000764731.1|3732784_3733633_+	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
>prophage 292
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	3737715	3744354	4945561		Dickeya_phage(50.0%)	4	NA	NA
WP_000207678.1|3737715_3739059_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
WP_001300397.1|3739689_3740142_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_001031057.1|3740169_3741657_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000133044.1|3741681_3744354_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	2.5e-24
>prophage 293
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	3749836	3751726	4945561		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001301504.1|3749836_3751726_+	ATP-dependent RNA helicase DeaD	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 294
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	3757428	3765225	4945561		Diadromus_pulchellus_ascovirus(25.0%)	10	NA	NA
WP_000189314.1|3757428_3757731_-	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	3.9e-14
WP_072686004.1|3757781_3758225_+	YhbP family protein	NA	NA	NA	NA	NA
WP_000037608.1|3758204_3758723_-	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	4.4e-10
WP_000084526.1|3758850_3759486_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_000147620.1|3759558_3760599_+	permease	NA	NA	NA	NA	NA
WP_000646033.1|3760712_3761288_-	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_001158034.1|3761297_3761888_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000246855.1|3761907_3762303_-	YraN family protein	NA	NA	NA	NA	NA
WP_022581511.1|3762260_3764297_-	penicillin-binding protein activator LpoA	NA	NA	NA	NA	NA
WP_163425379.1|3764361_3765225_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	7.3e-50
>prophage 295
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	3785212	3786358	4945561		Streptococcus_phage(100.0%)	1	NA	NA
WP_001301934.1|3785212_3786358_+	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.3	1.7e-49
>prophage 296
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	3794334	3796629	4945561		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861734.1|3794334_3796629_+	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	7.4e-158
>prophage 297
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	3817353	3818319	4945561		Escherichia_phage(100.0%)	1	NA	NA
WP_001098805.1|3817353_3818319_-	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 298
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	3832561	3848756	4945561	tRNA	Herpes_simplex_virus(16.67%)	12	NA	NA
WP_129949129.1|3832561_3835654_-	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.1	1.0e-157
WP_000212458.1|3835837_3836821_-	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_000450589.1|3837039_3837372_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_000633381.1|3837413_3838904_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	4.8e-33
WP_163425392.1|3839210_3840731_+	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	51.5	3.1e-35
WP_000018005.1|3840884_3841508_-	DNA-binding transcriptional regulator NfeR	NA	NA	NA	NA	NA
WP_001065900.1|3841795_3842560_+	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_032281621.1|3842812_3843319_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_000437371.1|3843397_3845239_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_047644940.1|3845433_3847179_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.2	5.4e-76
WP_001144069.1|3847289_3847505_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_163425393.1|3847742_3848756_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	6.3e-109
>prophage 299
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	3855157	3856396	4945561	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_163425394.1|3855157_3856396_-|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.6	1.0e-92
>prophage 300
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	3861533	3862967	4945561		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869178.1|3861533_3862967_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 301
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	3867254	3882585	4945561		Staphylococcus_phage(14.29%)	15	NA	NA
WP_001076997.1|3867254_3867908_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
WP_000469270.1|3868169_3868340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295627.1|3868397_3869171_-	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_163425397.1|3869286_3870102_+	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_032281612.1|3870139_3871300_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	4.5e-87
WP_000831543.1|3871305_3871977_-	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000735278.1|3872124_3873606_-	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000917117.1|3873810_3874440_+	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
WP_000833393.1|3874440_3874863_+	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000444747.1|3874887_3875715_+	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000105733.1|3875714_3876296_+	esterase YqiA	NA	NA	NA	NA	NA
WP_000195296.1|3876324_3878217_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.1	3.4e-92
WP_053883108.1|3878280_3880422_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_032222393.1|3880795_3881605_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.4	2.7e-14
WP_000986441.1|3881601_3882585_+	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.6	8.5e-10
>prophage 302
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	3888710	3900840	4945561		Stx_converting_phage(25.0%)	10	NA	NA
WP_000712658.1|3888710_3889103_+	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
WP_000183494.1|3889155_3889638_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_137537819.1|3889746_3891354_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001281881.1|3891491_3893750_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	1.4e-84
WP_000965712.1|3893982_3894720_+	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_000059395.1|3894794_3896207_+	cell division protein FtsP	NA	NA	NA	NA	NA
WP_000095187.1|3896317_3898537_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_085008324.1|3898581_3898839_-	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_059321711.1|3898886_3899813_-	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000013135.1|3900012_3900840_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	44.9	1.6e-62
>prophage 303
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	3906916	3907801	4945561		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_089618776.1|3906916_3907801_-	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	46.8	3.7e-65
>prophage 304
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	3930013	3931186	4945561		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_097470226.1|3930013_3931186_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	31.0	1.2e-39
>prophage 305
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	3966871	4031946	4945561	protease,plate,tRNA	Cronobacter_phage(20.0%)	61	NA	NA
WP_160406781.1|3966871_3968209_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_089560111.1|3968205_3968859_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_137526054.1|3968958_3970587_+	OmpA family protein	NA	NA	NA	NA	NA
WP_017457535.1|3970592_3971084_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_160406784.1|3971258_3973895_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	32.2	1.8e-94
WP_097315767.1|3973887_3974442_+	type IV secretion protein Rhs	NA	NA	NA	NA	NA
WP_105463250.1|3974438_3974903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163425408.1|3975214_3977755_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_163425409.1|3977756_3979778_+	lipase family protein	NA	A0A1B1IT35	uncultured_Mediterranean_phage	30.9	4.7e-07
WP_163425410.1|3979770_3980541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163425411.1|3980543_3981317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163425412.1|3981428_3982208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163425413.1|3982311_3983085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137567447.1|3983088_3983862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137567446.1|3984084_3984444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137427079.1|3984541_3984889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137567445.1|3985150_3985417_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_163425414.1|3985420_3986581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163425415.1|3986567_3989981_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_163425416.1|3989980_3991579_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_105463241.1|3991648_3992122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163425417.1|3992185_3993949_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_163425418.1|3993903_3995007_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_114007209.1|3994981_3995524_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_114007208.1|3995516_3995987_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_089521512.1|3996024_3996564_+	GIY-YIG nuclease family protein	NA	Q9MC01	Enterobacteria_phage	64.6	8.9e-54
WP_089521505.1|3996610_3997996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163425577.1|3998070_3998697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047623531.1|3999227_3999935_-	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_107183043.1|4000333_4002469_+	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_001049791.1|4002518_4003775_-	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_000760323.1|4003976_4005056_-	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_000091700.1|4005120_4005396_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_001301529.1|4005423_4006476_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000786908.1|4006636_4007356_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_163425419.1|4007355_4007682_+	DUF469 domain-containing protein	NA	NA	NA	NA	NA
WP_163425420.1|4007865_4008585_+	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_000394107.1|4008760_4009807_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_047623533.1|4009923_4010931_+	DUF1202 family protein	NA	NA	NA	NA	NA
WP_001625906.1|4011173_4012310_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_001174747.1|4012302_4012896_-	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_001277222.1|4012903_4013194_-	YggU family protein	NA	NA	NA	NA	NA
WP_001094831.1|4013190_4013757_-	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_000997795.1|4013774_4014479_-	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001625905.1|4014496_4015477_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000017109.1|4015660_4016077_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_000126441.1|4016076_4016712_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000593273.1|4016748_4017699_-	glutathione synthase	NA	NA	NA	NA	NA
WP_001222509.1|4017711_4018443_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_098031165.1|4018522_4019230_-	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_000858396.1|4019324_4019822_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_001112301.1|4019898_4021293_-	galactose/proton symporter	NA	NA	NA	NA	NA
WP_001062128.1|4021727_4022882_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_001303650.1|4023185_4023401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001297406.1|4023536_4023668_+	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001295380.1|4023676_4025653_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_000758915.1|4025798_4026530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000105566.1|4026665_4027586_+	agmatinase	NA	NA	NA	NA	NA
WP_000701842.1|4027791_4028550_-|protease	metalloprotease LoiP	protease	NA	NA	NA	NA
WP_163425421.1|4028827_4030819_+	transketolase	NA	NA	NA	NA	NA
WP_000646940.1|4031037_4031946_-	prohibitin family protein	NA	A0A2C9D0H9	Yersinia_phage	56.1	5.2e-54
>prophage 306
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	4058383	4059616	4945561		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|4058383_4059616_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 307
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	4068143	4072614	4945561		Prochlorococcus_phage(50.0%)	2	NA	NA
WP_001613771.1|4068143_4071017_+	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.1	6.3e-263
WP_163425429.1|4071180_4072614_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.5	1.1e-31
>prophage 308
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	4076419	4091811	4945561	tRNA	Brevibacillus_phage(14.29%)	14	NA	NA
WP_000806638.1|4076419_4077316_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
WP_000715214.1|4077340_4078051_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000813202.1|4078056_4079790_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.7	1.4e-60
WP_001701073.1|4079880_4080978_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000003068.1|4080988_4082506_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_097487936.1|4082548_4083097_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_120795390.1|4083151_4083223_+	protein YqfH	NA	NA	NA	NA	NA
WP_001488323.1|4083219_4083345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001356278.1|4083346_4084795_-	urate/proton symporter UacT	NA	Q9KX94	Enterobacteria_phage	26.8	7.3e-26
WP_047623551.1|4085230_4087150_+	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_000838411.1|4087149_4087638_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_163425432.1|4087673_4089041_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	73.1	2.1e-160
WP_001313239.1|4089076_4090393_-	guanine deaminase	NA	NA	NA	NA	NA
WP_001280208.1|4090410_4091811_-	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	9.8e-20
>prophage 309
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	4116091	4116847	4945561		Clostridium_phage(100.0%)	1	NA	NA
WP_001272558.1|4116091_4116847_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 310
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	4148655	4151150	4945561		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_097470190.1|4148655_4149417_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.9	2.5e-17
WP_000256438.1|4149731_4151150_+	arabinose-proton symporter AraE	NA	O13311	Aichi_virus	26.9	1.8e-24
>prophage 311
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	4160782	4167555	4945561		Moraxella_phage(33.33%)	6	NA	NA
WP_000895624.1|4160782_4161496_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
WP_069913205.1|4161564_4162254_-	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000564489.1|4162938_4163469_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000957914.1|4163481_4165728_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000204658.1|4165878_4166754_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000816232.1|4166760_4167555_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
>prophage 312
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	4173031	4188470	4945561	tRNA	Klosneuvirus(16.67%)	9	NA	NA
WP_163425442.1|4173031_4175920_+	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.7	1.8e-68
WP_163425443.1|4175912_4179455_+	exodeoxyribonuclease V subunit beta	NA	G3MA40	Bacillus_virus	21.4	2.0e-08
WP_032281525.1|4179454_4181281_+	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.6	7.8e-25
WP_000237947.1|4181342_4182674_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000016907.1|4182905_4184159_+	N-acetylmuramoyl-L-alanine amidase AmiC	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_000678646.1|4184628_4185726_+	murein transglycosylase A	NA	NA	NA	NA	NA
WP_000117722.1|4185964_4186771_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.7	3.8e-16
WP_000184261.1|4186821_4187265_-	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_001307370.1|4187264_4188470_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.8	2.3e-73
>prophage 313
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	4199996	4200842	4945561		Bacillus_phage(100.0%)	1	NA	NA
WP_001214587.1|4199996_4200842_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	5.6e-10
>prophage 314
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	4205610	4206459	4945561		Vibrio_phage(100.0%)	1	NA	NA
WP_163425444.1|4205610_4206459_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	3.6e-41
>prophage 315
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	4213994	4218109	4945561		Hokovirus(50.0%)	2	NA	NA
WP_000186450.1|4213994_4216751_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
WP_021557151.1|4216807_4218109_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.4	5.7e-38
>prophage 316
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	4222141	4225165	4945561		Only_Syngen_Nebraska_virus(50.0%)	2	NA	NA
WP_000210878.1|4222141_4223779_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
WP_000036723.1|4223866_4225165_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
>prophage 317
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	4228968	4229640	4945561		Vibrio_phage(100.0%)	1	NA	NA
WP_001199973.1|4228968_4229640_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.7e-14
>prophage 318
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	4234416	4235202	4945561		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_163425447.1|4234416_4235202_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.9	5.0e-21
>prophage 319
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	4249851	4251884	4945561		Hokovirus(50.0%)	2	NA	NA
WP_001090361.1|4249851_4251279_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.4	9.7e-31
WP_001173673.1|4251278_4251884_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	4.2e-28
>prophage 320
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	4254996	4265018	4945561		uncultured_Mediterranean_phage(33.33%)	10	NA	NA
WP_001295182.1|4254996_4255758_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|4255751_4256378_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_163425451.1|4256517_4257657_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	36.5	7.8e-07
WP_000081550.1|4257719_4258712_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001208062.1|4258832_4259240_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_069913230.1|4259386_4259980_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_000863205.1|4259979_4261407_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_069913231.1|4261417_4261654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163425452.1|4261694_4262351_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	1.2e-49
WP_097750324.1|4262456_4265018_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.0e-30
>prophage 321
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	4283309	4284323	4945561		Enterobacteria_phage(100.0%)	1	NA	NA
WP_163425458.1|4283309_4284323_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.6	1.0e-26
>prophage 322
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	4291798	4292764	4945561		Tetraselmis_virus(100.0%)	1	NA	NA
WP_163425461.1|4291798_4292764_-	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	34.3	1.4e-36
>prophage 323
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	4298231	4303616	4945561	tRNA	Pseudomonas_phage(25.0%)	5	NA	NA
WP_000132231.1|4298231_4298729_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	4.4e-31
WP_000963143.1|4298808_4299870_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_038339693.1|4299937_4300438_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000047196.1|4300565_4303196_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000906486.1|4303430_4303616_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
>prophage 324
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	4318902	4324198	4945561		Bacillus_virus(20.0%)	5	NA	NA
WP_000985483.1|4318902_4320105_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
WP_163425463.1|4320459_4321419_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	1.6e-133
WP_089621732.1|4321428_4323573_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.4	1.7e-196
WP_089559905.1|4323545_4323956_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	3.5e-18
WP_001223227.1|4323952_4324198_-	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
>prophage 325
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	4330097	4334149	4945561		Clostridium_phage(50.0%)	4	NA	NA
WP_000522424.1|4330097_4330547_+	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
WP_023308230.1|4330547_4331210_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_001301367.1|4331230_4332631_-	GABA permease	NA	NA	NA	NA	NA
WP_163425465.1|4332868_4334149_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	9.3e-33
>prophage 326
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	4343656	4343866	4945561		Salmonella_phage(100.0%)	1	NA	NA
WP_077744180.1|4343656_4343866_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	66.0	2.8e-08
>prophage 327
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	4349447	4360604	4945561	integrase	Enterobacteria_phage(77.78%)	12	4342298:4342312	4361475:4361489
4342298:4342312	attL	AAATCAGCGAATAAA	NA	NA	NA	NA
WP_094249961.1|4349447_4351781_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	99.0	0.0e+00
WP_000856729.1|4351795_4352116_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_001613636.1|4352251_4352707_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
WP_001244664.1|4352699_4352987_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	98.9	5.1e-48
WP_000980254.1|4352979_4353570_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	94.8	1.1e-65
WP_001613634.1|4353566_4353833_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	98.9	1.4e-44
WP_001283015.1|4354384_4355119_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.0	5.2e-129
WP_000638634.1|4355115_4355616_+	transactivation protein	NA	NA	NA	NA	NA
WP_047657981.1|4355689_4356262_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.8	1.1e-94
WP_047657979.1|4356533_4358117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047657977.1|4358166_4359360_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	48.5	6.7e-102
WP_000162574.1|4360121_4360604_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
4361475:4361489	attR	AAATCAGCGAATAAA	NA	NA	NA	NA
>prophage 328
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	4374238	4375309	4945561		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001168031.1|4374238_4375309_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.4	9.0e-90
>prophage 329
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	4381215	4383789	4945561		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001235102.1|4381215_4383789_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
>prophage 330
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	4389564	4390863	4945561		Burkholderia_virus(100.0%)	1	NA	NA
WP_000841103.1|4389564_4390863_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
>prophage 331
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	4396156	4402239	4945561	tRNA	Achromobacter_phage(25.0%)	7	NA	NA
WP_001098726.1|4396156_4396576_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997418.1|4396782_4397820_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001262723.1|4397867_4398557_-	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	2.1e-55
WP_000627804.1|4398861_4399245_+	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	4.7e-33
WP_001613622.1|4399300_4399888_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_158121815.1|4399990_4400872_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219193.1|4400904_4402239_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
>prophage 332
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	4408010	4411753	4945561		Tupanvirus(50.0%)	3	NA	NA
WP_000790168.1|4408010_4409810_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
WP_000002542.1|4409825_4410800_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068343.1|4411072_4411753_+	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
>prophage 333
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	4415213	4415474	4945561		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196283.1|4415213_4415474_-	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.1e-17
>prophage 334
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	4419593	4430901	4945561		Bacillus_phage(50.0%)	7	NA	NA
WP_000970087.1|4419593_4423481_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.2	5.9e-131
WP_137567267.1|4424056_4425490_+	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	25.3	6.1e-17
WP_021557091.1|4425648_4426362_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001295369.1|4426351_4427686_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_000717694.1|4427746_4428085_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_163425475.1|4428129_4429320_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000919159.1|4429647_4430901_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
>prophage 335
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	4436659	4438171	4945561		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_088172150.1|4436659_4438171_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	28.4	5.5e-08
>prophage 336
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	4453307	4459831	4945561		Faustovirus(20.0%)	8	NA	NA
WP_001295373.1|4453307_4454522_+	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
WP_000331707.1|4454549_4454936_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_000028953.1|4454952_4455276_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000384413.1|4455371_4455887_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_163425476.1|4455903_4457754_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
WP_001124469.1|4457755_4458091_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_000523616.1|4458102_4458303_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_163425477.1|4458547_4459831_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	2.2e-34
>prophage 337
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	4470437	4475685	4945561		Escherichia_phage(66.67%)	5	NA	NA
WP_163425480.1|4470437_4472819_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	38.8	2.2e-144
WP_163425481.1|4472815_4473445_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	55.4	2.8e-59
WP_163425482.1|4473437_4474259_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000948590.1|4474258_4475113_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_000963837.1|4475253_4475685_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
>prophage 338
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	4494701	4501190	4945561		Escherichia_phage(66.67%)	7	NA	NA
WP_163425485.1|4494701_4496078_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	4.0e-42
WP_001299507.1|4496239_4497706_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_000138282.1|4497774_4499352_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_047668851.1|4499444_4499984_-	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	97.8	1.7e-44
WP_001295476.1|4499999_4500518_-	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	100.0	1.3e-62
WP_000076001.1|4500828_4501020_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_000017552.1|4501037_4501190_+	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
>prophage 339
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	4507436	4511438	4945561		Prochlorococcus_phage(33.33%)	4	NA	NA
WP_001028618.1|4507436_4508075_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	4.0e-29
WP_001295474.1|4508074_4509112_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.1e-71
WP_001295473.1|4509436_4510063_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000198328.1|4510148_4511438_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
>prophage 340
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	4532738	4533452	4945561		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|4532738_4533452_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 341
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	4550711	4551662	4945561		Cyanophage(100.0%)	1	NA	NA
WP_001003709.1|4550711_4551662_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 342
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	4570313	4575397	4945561		Deep-sea_thermophilic_phage(33.33%)	6	NA	NA
WP_000102891.1|4570313_4571183_-	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	4.2e-13
WP_000406000.1|4571396_4571822_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_001300381.1|4571808_4572258_+	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_032224615.1|4572464_4573040_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_163425495.1|4573135_4574035_+	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_053291922.1|4574092_4575397_-	penicillin binding protein PBP4B	NA	A0A0B5A438	Mycobacterium_phage	26.9	5.6e-09
>prophage 343
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	4578875	4594231	4945561		Streptococcus_phage(33.33%)	15	NA	NA
WP_000517430.1|4578875_4579667_+	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.6	2.0e-17
WP_000290222.1|4579824_4580841_+	thiosulfate/sulfate ABC transporter substrate-binding protein CysP	NA	NA	NA	NA	NA
WP_096840230.1|4580840_4581674_+	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_000852696.1|4581673_4582549_+	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_163425496.1|4582538_4583636_+	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G9BWD6	Planktothrix_phage	38.9	3.7e-30
WP_163425497.1|4583755_4584667_+	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.6	2.9e-57
WP_000719943.1|4584669_4585038_-	YfeK family protein	NA	NA	NA	NA	NA
WP_000096670.1|4585142_4585994_+	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000522247.1|4586036_4586546_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000623136.1|4586586_4588314_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
WP_000487600.1|4588358_4588616_-	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000034402.1|4588999_4589971_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000254839.1|4590155_4590917_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_001299866.1|4591146_4592145_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000443684.1|4592215_4594231_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.5	7.7e-151
>prophage 344
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	4615688	4616423	4945561		Clostridioides_phage(100.0%)	1	NA	NA
WP_001295458.1|4615688_4616423_-	two-component system response regulator YpdB	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
>prophage 345
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	4620241	4621162	4945561		Morganella_phage(100.0%)	1	NA	NA
WP_000484408.1|4620241_4621162_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	55.2	1.7e-76
>prophage 346
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	4624855	4632432	4945561		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_001283490.1|4624855_4626550_+	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.4e-23
WP_000955028.1|4626619_4627564_+	transporter YfdV	NA	NA	NA	NA	NA
WP_075331370.1|4627637_4628783_+	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_089618143.1|4628838_4632432_-	acid-sensing system histidine kinase EvgS	NA	W8CYM9	Bacillus_phage	40.0	6.2e-10
>prophage 347
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	4639073	4640507	4945561		Bacillus_phage(100.0%)	1	NA	NA
WP_163425501.1|4639073_4640507_-	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.0	1.2e-28
>prophage 348
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	4643547	4644480	4945561		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000368131.1|4643547_4644480_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
>prophage 349
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	4662510	4663596	4945561		Pandoravirus(100.0%)	1	NA	NA
WP_001297933.1|4662510_4663596_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
>prophage 350
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	4672226	4673363	4945561		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000699114.1|4672226_4673363_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.8	3.1e-24
>prophage 351
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	4680113	4681631	4945561		Mollivirus(100.0%)	1	NA	NA
WP_000334221.1|4680113_4681631_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	4.5e-87
>prophage 352
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	4685841	4687702	4945561		Acanthocystis_turfacea_Chlorella_virus(50.0%)	2	NA	NA
WP_001293612.1|4685841_4686615_+	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
WP_001625563.1|4686811_4687702_+	recombination-promoting nuclease RpnB	NA	Q2A0A7	Sodalis_phage	43.9	1.2e-66
>prophage 353
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	4698261	4701489	4945561		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
WP_001203399.1|4698261_4698912_+	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	27.5	2.8e-09
WP_001012899.1|4698998_4700831_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_000813857.1|4700889_4701489_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
>prophage 354
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	4739858	4744862	4945561		Tupanvirus(50.0%)	4	NA	NA
WP_032288236.1|4739858_4741841_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	1.8e-19
WP_000461637.1|4741840_4742809_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.5	8.8e-36
WP_163425520.1|4742812_4743952_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	29.2	3.2e-29
WP_001302794.1|4744259_4744862_+	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	4.4e-09
>prophage 355
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	4748465	4753036	4945561	transposase	Oenococcus_phage(50.0%)	5	NA	NA
WP_000174592.1|4748465_4749671_+	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.3	1.2e-26
WP_023308119.1|4749727_4751017_+	MFS transporter	NA	NA	NA	NA	NA
WP_028132169.1|4751034_4751838_+	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
WP_000150342.1|4751878_4752100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023308116.1|4752112_4753036_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.8	2.0e-69
>prophage 356
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	4758928	4760005	4945561		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000779084.1|4758928_4760005_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
>prophage 357
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	4764767	4776756	4945561		Pseudomonas_phage(40.0%)	6	NA	NA
WP_000135039.1|4764767_4765022_-	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	74.6	1.5e-24
WP_000332036.1|4765021_4766152_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	2.5e-175
WP_163425522.1|4766385_4768671_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.4	2.5e-283
WP_163425523.1|4769366_4773119_+	AIDA-I family autotransporter adhesin YfaL/EhaC	NA	A0A2L1IV18	Escherichia_phage	26.6	1.3e-18
WP_032224511.1|4773259_4773982_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_001281251.1|4774128_4776756_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	31.4	1.4e-88
>prophage 358
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	4786456	4789306	4945561		Hokovirus(100.0%)	1	NA	NA
WP_112924947.1|4786456_4789306_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
>prophage 359
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	4793583	4799361	4945561		Enterobacteria_phage(25.0%)	5	NA	NA
WP_069906309.1|4793583_4794687_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	59.7	8.0e-118
WP_001613476.1|4794798_4795854_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000786362.1|4795927_4796992_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	49.5	3.1e-18
WP_000884972.1|4796991_4797642_+	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_000422208.1|4797717_4799361_+	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.2	9.5e-14
>prophage 360
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	4808354	4808972	4945561		Bacillus_virus(100.0%)	1	NA	NA
WP_023154626.1|4808354_4808972_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.5e-12
>prophage 361
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	4820845	4828493	4945561		Vibrio_phage(50.0%)	7	NA	NA
WP_000050789.1|4820845_4821853_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	1.5e-83
WP_000494183.1|4821991_4822276_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000578056.1|4822400_4824161_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	42.0	8.4e-101
WP_001234850.1|4824309_4825005_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000213385.1|4825032_4826223_+	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	2.9e-20
WP_000202798.1|4826555_4826900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044865470.1|4826903_4828493_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	33.6	4.2e-19
>prophage 362
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	4834247	4838548	4945561		Clostridioides_phage(50.0%)	4	NA	NA
WP_000241011.1|4834247_4834814_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
WP_001613460.1|4835225_4835939_-	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_001613459.1|4835977_4836964_-	zinc-binding GTPase YeiR	NA	NA	NA	NA	NA
WP_085454065.1|4837081_4838548_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	30.2	1.0e-43
>prophage 363
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	4853041	4853899	4945561		Catovirus(100.0%)	1	NA	NA
WP_000873890.1|4853041_4853899_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	34.0	1.4e-24
>prophage 364
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	4857967	4861741	4945561		Acinetobacter_phage(50.0%)	3	NA	NA
WP_000489254.1|4857967_4859947_+	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	1.9e-13
WP_000425434.1|4859978_4860815_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001139613.1|4861072_4861741_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
>prophage 365
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	4865435	4866956	4945561		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000255032.1|4865435_4866956_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 366
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	4887368	4896813	4945561		Enterobacteria_phage(85.71%)	10	NA	NA
WP_077039563.1|4887368_4888295_+	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.3	3.3e-08
WP_000783120.1|4888299_4889031_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|4889011_4889119_-	protein YohO	NA	NA	NA	NA	NA
WP_001240399.1|4889178_4889910_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001295431.1|4890131_4891817_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|4891813_4892533_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_163425536.1|4892579_4893050_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	3.0e-82
WP_001295429.1|4893090_4893552_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_163425537.1|4893676_4895680_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.8	0.0e+00
WP_112935511.1|4895676_4896813_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	98.4	9.0e-165
>prophage 367
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	4912431	4914465	4945561	tRNA	Indivirus(100.0%)	1	NA	NA
WP_001301615.1|4912431_4914465_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
>prophage 368
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	4927334	4930891	4945561		Paenibacillus_phage(50.0%)	4	NA	NA
WP_089558758.1|4927334_4928153_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	1.7e-24
WP_000434038.1|4928204_4928951_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011976.1|4928924_4929890_-	sugar kinase	NA	NA	NA	NA	NA
WP_089618672.1|4929886_4930891_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	9.9e-14
>prophage 369
NZ_CP048605	Escherichia coli strain PapRG-06-5 chromosome, complete genome	4945561	4940102	4945300	4945561	integrase	Escherichia_phage(50.0%)	9	4941336:4941348	4944084:4944096
WP_028132127.1|4940102_4941002_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	28.6	3.7e-12
4941336:4941348	attL	ATTATAATAATCA	NA	NA	NA	NA
WP_163425547.1|4941407_4941725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985256.1|4941989_4943003_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.1	1.4e-193
WP_001350698.1|4943118_4943418_-	helix-turn-helix transcriptional regulator	NA	Q1JS83	Enterobacteria_phage	100.0	3.3e-50
WP_000043869.1|4943532_4943808_+	hypothetical protein	NA	Q1JS62	Enterobacteria_phage	100.0	1.3e-48
WP_000217681.1|4943985_4944486_+	hypothetical protein	NA	M1SV55	Escherichia_phage	99.4	1.0e-91
4944084:4944096	attR	TGATTATTATAAT	NA	NA	NA	NA
WP_000557703.1|4944549_4944774_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001471828.1|4944773_4945076_+	DUF5405 family protein	NA	A0A0F7LCL4	Escherichia_phage	97.0	2.5e-45
WP_001113269.1|4945075_4945300_+	TraR/DksA family transcriptional regulator	NA	A0A0F7LDG9	Escherichia_phage	98.6	5.0e-35
