The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	0	36144	4703889	holin,plate,capsid,head,tail,lysis,tRNA,portal,terminase	Escherichia_phage(52.94%)	39	NA	NA
WP_163388196.1|0_2277_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	98.2	0.0e+00
WP_087889730.1|2764_4309_-	RNA-directed DNA polymerase	NA	Q2P9X0	Enterobacteria_phage	100.0	3.4e-292
WP_050490232.1|4823_6050_+	RNA-directed DNA polymerase	NA	A0A0F7LDS3	Escherichia_phage	99.5	7.3e-221
WP_000993280.1|6046_6754_+	hypothetical protein	NA	A0A0F7LBP9	Escherichia_phage	100.0	2.5e-128
WP_061892879.1|6796_7816_-|portal	phage portal protein	portal	A0A0F7L9Y5	Escherichia_phage	99.7	4.7e-197
WP_061892878.1|7815_9588_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.7	0.0e+00
WP_001085975.1|9761_10616_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MI4	Enterobacteria_phage	98.6	3.5e-137
WP_001248558.1|10674_11748_+|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	100.0	6.7e-202
WP_061892877.1|11751_12495_+|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	98.0	1.5e-123
WP_061892876.1|12594_13104_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	98.8	9.5e-90
WP_000846409.1|13103_13307_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000123123.1|13310_13592_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144101.1|13591_14089_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_053289240.1|14103_14529_+	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	94.3	5.2e-57
WP_053289239.1|14516_14942_+|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	97.2	1.6e-66
WP_021541102.1|15049_15517_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.1	2.5e-81
WP_001001787.1|15509_15962_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	99.3	2.4e-76
WP_021541101.1|16033_16819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061892874.1|16902_17538_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	97.2	2.5e-111
WP_000127164.1|17534_17882_+|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
WP_163388197.1|17886_18795_+|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.7	1.3e-161
WP_001285325.1|18787_19318_+|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	100.0	2.3e-102
WP_163388198.1|19328_21446_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	59.6	6.2e-143
WP_021541096.1|21449_21977_+|tail	tail fiber assembly protein	tail	U5N0T1	Enterobacteria_phage	93.7	2.9e-89
WP_061892872.1|22771_23830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021541093.1|24355_25546_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.2	1.8e-224
WP_001251408.1|25558_26077_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|26133_26409_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001496926.1|26441_26561_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	97.4	1.4e-15
WP_061892870.1|26553_29001_+|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	95.0	0.0e+00
WP_000978909.1|29015_29495_+|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	98.1	5.6e-84
WP_061892869.1|29494_30658_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.2	7.0e-205
WP_000468308.1|30739_30958_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000476011.1|31231_32593_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	100.0	1.1e-217
WP_001220181.1|32695_32992_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001307279.1|32993_33290_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_000929408.1|33498_33831_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137877.1|34021_34744_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000675150.1|34740_36144_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
>prophage 2
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	49585	50938	4703889		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_000469692.1|49585_50938_-	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	20.9	1.6e-06
>prophage 3
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	55601	66077	4703889		Catovirus(20.0%)	8	NA	NA
WP_001295424.1|55601_56243_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
WP_001234767.1|56334_56916_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.3e-31
WP_001252331.1|56937_58791_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001300971.1|59064_60648_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_000978094.1|61306_62446_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000482901.1|62451_62895_+	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_000137112.1|62897_65060_+	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	2.4e-17
WP_000654492.1|65237_66077_+	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	1.7e-06
>prophage 4
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	70320	77114	4703889		Synechococcus_phage(25.0%)	6	NA	NA
WP_000048188.1|70320_71442_+	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	65.2	9.0e-133
WP_000043623.1|71444_72410_+	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.8	9.9e-88
WP_000479826.1|72412_72892_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000699714.1|72888_74112_+	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_000079285.1|74114_75551_+	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.2	1.3e-46
WP_001313977.1|75743_77114_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.7	2.2e-32
>prophage 5
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	82730	87892	4703889		Klebsiella_phage(33.33%)	4	NA	NA
WP_033560992.1|82730_84125_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	6.3e-19
WP_033560993.1|84299_85193_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_033560994.1|85526_86774_+	O170 family O-antigen flippase	NA	NA	NA	NA	NA
WP_033560995.1|86785_87892_+	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	66.4	2.3e-141
>prophage 6
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	92601	95423	4703889		Ostreococcus_lucimarinus_virus(50.0%)	2	NA	NA
WP_000043458.1|92601_94008_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.4e-37
WP_000704798.1|94256_95423_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.2	3.3e-114
>prophage 7
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	102778	103678	4703889		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131782.1|102778_103678_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 8
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	111322	112489	4703889		Stx2-converting_phage(100.0%)	1	NA	NA
WP_001296209.1|111322_112489_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.5	5.9e-228
>prophage 9
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	129980	130790	4703889		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_001000035.1|129980_130790_+	propanediol diffusion facilitator PduF	NA	A0A1J0F964	Only_Syngen_Nebraska_virus	26.1	2.6e-09
>prophage 10
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	147214	148081	4703889	transposase	Acinetobacter_phage(100.0%)	1	NA	NA
WP_001614812.1|147214_148081_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
>prophage 11
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	156744	157275	4703889		Escherichia_phage(100.0%)	1	NA	NA
WP_001079074.1|156744_157275_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
>prophage 12
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	160819	173357	4703889		Bacillus_phage(33.33%)	12	NA	NA
WP_001339045.1|160819_161491_+	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000826738.1|161490_162849_+	two-component system sensor histidine kinase HprS	NA	NA	NA	NA	NA
WP_000218214.1|162956_163808_-	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000824375.1|164398_165562_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	56.2	7.2e-109
WP_001313057.1|166128_166494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000365564.1|166533_167229_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.5	7.3e-08
WP_001157239.1|167295_168714_+	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	54.8	3.0e-101
WP_000786004.1|168694_169165_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	1.5e-33
WP_001212248.1|169153_170074_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000922682.1|170246_171164_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_000009306.1|171242_171425_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_077817799.1|171662_173357_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.7e-18
>prophage 13
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	190562	192382	4703889	transposase	Escherichia_phage(50.0%)	2	NA	NA
WP_042815209.1|190562_191726_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	92.8	1.7e-198
WP_000334586.1|191710_192382_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.8	5.6e-82
>prophage 14
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	204630	205383	4703889		Bacillus_virus(100.0%)	1	NA	NA
WP_001272986.1|204630_205383_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	4.9e-26
>prophage 15
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	217367	218882	4703889		Cedratvirus(100.0%)	1	NA	NA
WP_001187810.1|217367_218882_+	arabinose ABC transporter ATP binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.7	1.3e-12
>prophage 16
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	228969	234613	4703889		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_001297437.1|228969_230631_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_040072073.1|230676_232278_+	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.4	6.4e-15
WP_000204335.1|232296_233157_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000036378.1|233159_234209_+	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000763867.1|234223_234613_+	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
>prophage 17
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	239865	241599	4703889	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_163388204.1|239865_241599_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
>prophage 18
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	248215	250266	4703889		Synechococcus_phage(50.0%)	3	NA	NA
WP_000019584.1|248215_248959_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000252979.1|248999_249395_-	membrane protein	NA	NA	NA	NA	NA
WP_000639271.1|249447_250266_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	4.9e-72
>prophage 19
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	254284	261348	4703889		Bacillus_virus(50.0%)	9	NA	NA
WP_001295503.1|254284_254806_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_001024917.1|254807_255410_-	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001386853.1|255480_255546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580323.1|255684_256296_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_000568519.1|256304_257315_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000571465.1|257461_258247_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000202996.1|258243_258999_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_001342995.1|259077_260010_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_001184045.1|260025_261348_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
>prophage 20
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	268811	269939	4703889		Planktothrix_phage(100.0%)	1	NA	NA
WP_000741723.1|268811_269939_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	30.5	3.6e-20
>prophage 21
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	283523	284999	4703889		Cyanophage(100.0%)	1	NA	NA
WP_000301727.1|283523_284999_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
>prophage 22
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	293055	297525	4703889		Klebsiella_phage(33.33%)	7	NA	NA
WP_000944256.1|293055_293718_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_000011658.1|293741_294398_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000916763.1|294499_294730_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000204699.1|294868_295243_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000879280.1|295246_296119_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000976492.1|296131_296473_+	YebY family protein	NA	NA	NA	NA	NA
WP_000812724.1|296868_297525_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	3.1e-56
>prophage 23
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	305021	307070	4703889		Moraxella_phage(100.0%)	1	NA	NA
WP_001055778.1|305021_307070_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	1.2e-85
>prophage 24
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	312400	312610	4703889		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|312400_312610_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 25
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	318250	319807	4703889		Moraxella_phage(100.0%)	1	NA	NA
WP_000394983.1|318250_319807_+	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 26
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	323669	331775	4703889	tRNA	Pandoravirus(33.33%)	8	NA	NA
WP_000854972.1|323669_325031_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	3.4e-41
WP_000457334.1|325104_325284_+	YoaH family protein	NA	NA	NA	NA	NA
WP_001300615.1|325403_325763_-	DUF1889 family protein	NA	NA	NA	NA	NA
WP_001295493.1|326124_326469_-	RidA family protein	NA	NA	NA	NA	NA
WP_000128858.1|326600_328511_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_001220981.1|328568_329264_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000290576.1|329303_329885_+	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_000758422.1|330089_331775_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
>prophage 27
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	340679	342327	4703889	transposase	Helicobacter_phage(50.0%)	2	NA	NA
WP_024203870.1|340679_341111_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.1	1.6e-42
WP_000826418.1|341118_342327_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	1.3e-206
>prophage 28
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	348277	352854	4703889		Bacillus_phage(100.0%)	3	NA	NA
WP_001299318.1|348277_349768_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	6.4e-09
WP_000616433.1|349948_351424_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000219686.1|351570_352854_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
>prophage 29
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	356172	357027	4703889		Indivirus(100.0%)	1	NA	NA
WP_038977152.1|356172_357027_+	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.5	8.7e-11
>prophage 30
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	365840	369925	4703889		Staphylococcus_phage(50.0%)	4	NA	NA
WP_000723724.1|365840_366821_+	NADH-dependent methylglyoxal reductase	NA	A0A2H4PQR8	Staphylococcus_phage	22.0	7.9e-08
WP_000719088.1|366957_367716_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000438810.1|367832_369191_+	MFS transporter	NA	NA	NA	NA	NA
WP_001120527.1|369283_369925_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	34.9	2.9e-19
>prophage 31
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	374851	376813	4703889		Streptococcus_phage(100.0%)	1	NA	NA
WP_001235796.1|374851_376813_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	4.1e-40
>prophage 32
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	382412	383066	4703889		Bacillus_phage(100.0%)	1	NA	NA
WP_001299207.1|382412_383066_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.1	9.6e-10
>prophage 33
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	389830	391051	4703889		Klosneuvirus(100.0%)	1	NA	NA
WP_032299037.1|389830_391051_+	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	5.5e-27
>prophage 34
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	398527	399355	4703889		Bacillus_virus(100.0%)	1	NA	NA
WP_000175009.1|398527_399355_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.6	5.9e-73
>prophage 35
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	405482	407744	4703889		Tupanvirus(100.0%)	1	NA	NA
WP_000077848.1|405482_407744_-	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	1.8e-143
>prophage 36
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	419044	438638	4703889	tRNA	Tupanvirus(22.22%)	19	NA	NA
WP_001144192.1|419044_420973_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.4	3.2e-130
WP_001700733.1|420976_421519_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001124225.1|421615_421813_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124850.1|421865_422222_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|422344_422389_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000018596.1|422672_423656_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_163388211.1|423670_426058_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_001229265.1|426062_426362_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000956519.1|426462_427443_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001154187.1|427505_428057_+	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000029466.1|428056_428806_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001209780.1|428883_429348_+	lipoprotein	NA	S5MM68	Bacillus_phage	37.7	9.5e-12
WP_001315654.1|429594_430308_+	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_000175695.1|430370_431807_+	YdiU family protein	NA	NA	NA	NA	NA
WP_001270809.1|431810_432002_-	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_001082226.1|432133_433180_-	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
WP_000368046.1|433336_434170_-	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_000069375.1|434502_436881_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	9.4e-172
WP_000553715.1|436937_438638_-	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.3	8.0e-32
>prophage 37
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	457054	462138	4703889		Lake_Baikal_phage(33.33%)	5	NA	NA
WP_000367160.1|457054_457423_+	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	4.3e-15
WP_000089364.1|457431_458919_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000948872.1|458928_459675_+	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	24.0	5.1e-07
WP_000908012.1|459649_460921_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_053289027.1|460917_462138_+	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.4	5.8e-93
>prophage 38
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	470428	472695	4703889		Escherichia_phage(50.0%)	3	NA	NA
WP_001310861.1|470428_471097_+	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.2	1.0e-22
WP_001069997.1|471093_471879_+	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_000587560.1|471882_472695_+	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
>prophage 39
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	478199	486991	4703889		Orpheovirus(20.0%)	9	NA	NA
WP_000493947.1|478199_478841_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
WP_000098911.1|478880_480029_-	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.7	4.2e-85
WP_001182363.1|480319_481531_-	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000269501.1|481643_482576_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000190982.1|482572_483598_-	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
WP_000102278.1|483896_483986_+	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000701040.1|484151_485321_+	MFS transporter	NA	NA	NA	NA	NA
WP_000007283.1|485466_486048_-	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000101193.1|486175_486991_-	peptidoglycan DD-endopeptidase MepH	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
>prophage 40
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	495793	497292	4703889		Indivirus(50.0%)	2	NA	NA
WP_000250661.1|495793_496690_+	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	3.6e-07
WP_001296937.1|496770_497292_+	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	7.8e-47
>prophage 41
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	504203	505478	4703889	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001295400.1|504203_505478_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 42
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	525168	526980	4703889		Vaccinia_virus(100.0%)	1	NA	NA
WP_163388213.1|525168_526980_+	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.8	0.0e+00
>prophage 43
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	536875	538177	4703889		Bacillus_phage(100.0%)	1	NA	NA
WP_000732508.1|536875_538177_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.9	7.2e-17
>prophage 44
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	555938	571376	4703889		Escherichia_phage(44.44%)	15	NA	NA
WP_000148710.1|555938_556553_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526492.1|556595_557450_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_001676570.1|557451_558069_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.1	2.8e-75
WP_001340362.1|558079_560503_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
WP_000041690.1|560563_562990_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.3	2.7e-214
WP_001295396.1|563188_563494_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|563601_564312_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|564314_564875_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705214.1|564909_565251_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|565385_565712_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|565917_567132_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836079.1|567143_568163_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
WP_000151243.1|568220_569588_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527797.1|569676_571137_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.8	1.1e-42
WP_000214712.1|571172_571376_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 45
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	576742	577633	4703889		Bacillus_phage(100.0%)	1	NA	NA
WP_000592826.1|576742_577633_+	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	1.1e-19
>prophage 46
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	586882	587266	4703889		Streptococcus_phage(100.0%)	1	NA	NA
WP_163388214.1|586882_587266_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	33.3	2.8e-09
>prophage 47
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	595011	596430	4703889		Bacillus_phage(100.0%)	1	NA	NA
WP_163388215.1|595011_596430_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
>prophage 48
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	604311	605847	4703889		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001194889.1|604311_605847_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	23.6	2.1e-15
>prophage 49
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	609250	614671	4703889		Escherichia_phage(100.0%)	1	NA	NA
WP_001597842.1|609250_614671_+	autotransporter barrel domain-containing lipoprotein	NA	A0A2L1IV18	Escherichia_phage	38.2	3.0e-141
>prophage 50
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	631258	638194	4703889		Bacillus_phage(50.0%)	3	NA	NA
WP_000628544.1|631258_632944_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	24.1	1.0e-10
WP_163388216.1|632981_635354_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_072133797.1|635398_638194_+	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	23.8	5.7e-19
>prophage 51
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	643468	647275	4703889		Bacillus_virus(50.0%)	2	NA	NA
WP_000426265.1|643468_644851_+	diguanylate cyclase DosC	NA	G3MA91	Bacillus_virus	31.5	2.0e-17
WP_163388217.1|644875_647275_+	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	21.5	1.0e-08
>prophage 52
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	651591	653497	4703889		Planktothrix_phage(100.0%)	2	NA	NA
WP_000193559.1|651591_652578_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	5.0e-18
WP_001285536.1|652570_653497_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	4.1e-14
>prophage 53
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	656770	658212	4703889		Tupanvirus(50.0%)	2	NA	NA
WP_000642407.1|656770_657781_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.3	9.6e-25
WP_000781370.1|657927_658212_+	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
>prophage 54
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	664224	664515	4703889		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000768384.1|664224_664515_+	lipoprotein	NA	Q1MVN1	Enterobacteria_phage	65.1	2.1e-25
>prophage 55
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	671399	672944	4703889		Escherichia_phage(100.0%)	1	NA	NA
WP_000702560.1|671399_672944_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 56
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	678747	692239	4703889	transposase	uncultured_Caudovirales_phage(66.67%)	8	NA	NA
WP_163388219.1|678747_683010_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	44.2	3.2e-21
WP_071524591.1|683090_683333_-	DUF3969 family protein	NA	NA	NA	NA	NA
WP_000960005.1|683550_684003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_126716684.1|684032_684941_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001001073.1|685448_685658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000759878.1|685657_685843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014852.1|685854_690063_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.3	4.1e-21
WP_047675373.1|690130_692239_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.2	6.2e-26
>prophage 57
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	697146	699249	4703889		Salmonella_phage(100.0%)	1	NA	NA
WP_000689355.1|697146_699249_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.6	1.1e-134
>prophage 58
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	703514	704324	4703889		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000867987.1|703514_704324_-	CatB-related O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	41.0	7.7e-17
>prophage 59
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	707705	717857	4703889	transposase	Mycoplasma_phage(25.0%)	9	NA	NA
WP_000220396.1|707705_708719_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	2.1e-27
WP_000047456.1|708736_709882_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000760615.1|710126_711533_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_001270286.1|711611_712028_-	type II toxin-antitoxin system antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
WP_000494244.1|712449_712680_+	YncJ family protein	NA	NA	NA	NA	NA
WP_001307191.1|712771_714733_-	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.9	7.1e-24
WP_000429155.1|714805_715342_-	DNA-binding transcriptional regulator SutR	NA	NA	NA	NA	NA
WP_001307190.1|715394_716609_+	BenE family transporter YdcO	NA	NA	NA	NA	NA
WP_000826402.1|716648_717857_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	92.8	7.8e-207
>prophage 60
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	729659	730608	4703889		Moraxella_phage(50.0%)	2	NA	NA
WP_000731833.1|729659_729833_-	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_001307188.1|730077_730608_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
>prophage 61
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	734547	738450	4703889		Klosneuvirus(100.0%)	1	NA	NA
WP_000139565.1|734547_738450_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
>prophage 62
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	769737	770727	4703889		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762229.1|769737_770727_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
>prophage 63
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	775687	817086	4703889	terminase,lysis,tail	Enterobacteria_phage(34.38%)	42	NA	NA
WP_000837924.1|775687_776821_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
WP_001082294.1|776961_777396_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.0e-28
WP_113328759.1|778004_778895_+	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_000983718.1|778894_779722_+	iron/manganese ABC transporter ATP-binding protein SitB	NA	M1HV27	Acanthocystis_turfacea_Chlorella_virus	28.0	8.7e-08
WP_001101728.1|779718_780576_+	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000968125.1|780572_781430_+	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_032252927.1|781885_783217_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	1.1e-20
WP_021565092.1|783290_783875_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.8	2.3e-103
WP_163388222.1|783874_787273_-	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	36.4	8.2e-12
WP_047661541.1|787337_787937_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q6H9T1	Enterobacteria_phage	99.5	3.3e-110
WP_038994240.1|788003_791402_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.4	0.0e+00
WP_000090943.1|791462_792065_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	84.7	4.0e-87
WP_032155200.1|792001_792745_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.3	1.4e-145
WP_001152432.1|792750_793449_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	93.5	1.1e-125
WP_000024051.1|793448_793787_-|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
WP_032182067.1|793779_797013_-|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	34.5	1.1e-111
WP_012565075.1|797484_797844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000094292.1|797994_798957_-	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	39.2	4.5e-56
WP_000673077.1|798983_799376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001029815.1|799372_799753_-	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	44.4	1.1e-18
WP_000524260.1|799753_800137_-	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	39.4	2.2e-14
WP_000634214.1|800136_800532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000918487.1|800754_801894_-	hypothetical protein	NA	G8C7P7	Escherichia_phage	75.0	7.4e-159
WP_000770038.1|801992_802757_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	66.5	3.9e-87
WP_001317036.1|802861_803974_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.8	6.0e-113
WP_000763708.1|803957_805364_-	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	68.8	6.7e-186
WP_163388223.1|805366_806668_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.6	6.7e-148
WP_000089446.1|806648_807743_-	hypothetical protein	NA	A0A0U2RXW9	Escherichia_phage	80.2	4.5e-113
WP_000126788.1|807746_807956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204033.1|807933_808866_-	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.5	4.2e-83
WP_016245936.1|808858_809653_-	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.7	7.5e-49
WP_024235095.1|809790_811248_-	potassium transporter TrkG	NA	NA	NA	NA	NA
WP_001228691.1|811444_811630_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	75.4	8.9e-14
WP_001135310.1|811846_812344_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	96.4	9.3e-90
WP_000839565.1|812343_812559_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.3e-32
WP_001348108.1|812810_813185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000506936.1|813356_813785_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_000640161.1|814829_815372_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	75.7	2.9e-76
WP_163388224.1|815368_815659_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	86.5	2.4e-45
WP_000940319.1|815658_816258_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
WP_032291366.1|816721_816934_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	67.7	1.3e-13
WP_122083109.1|816978_817086_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
>prophage 64
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	821850	840151	4703889	integrase,tRNA	Escherichia_phage(52.94%)	20	823187:823200	837574:837587
WP_001676522.1|821850_823848_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	26.2	3.3e-21
823187:823200	attL	GCATTCACCTGCAA	NA	NA	NA	NA
WP_001151151.1|824188_824611_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	4.8e-63
WP_001262352.1|824651_825722_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	64.6	4.7e-62
WP_000693836.1|825793_826219_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000391949.1|826202_826484_-	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
WP_000362155.1|826584_827004_+	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_001169151.1|827403_827559_+	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001312793.1|827555_828044_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_000560225.1|828485_828707_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001352098.1|828706_828877_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_163388225.1|829327_831928_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.4	2.6e-247
WP_000166319.1|831920_832730_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_001317028.1|832786_832981_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_021565074.1|832973_833183_+	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	96.8	8.8e-26
WP_000079604.1|833261_833477_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040858.1|833478_834714_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.5	1.6e-239
WP_163388226.1|834765_835701_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	2.2e-145
WP_000123738.1|835829_837203_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|837680_838664_-	zinc transporter ZntB	NA	NA	NA	NA	NA
837574:837587	attR	GCATTCACCTGCAA	NA	NA	NA	NA
WP_000628065.1|838918_840151_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 65
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	846477	846993	4703889		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945005.1|846477_846993_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	2.4e-24
>prophage 66
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	865174	866257	4703889		Indivirus(100.0%)	1	NA	NA
WP_000057977.1|865174_866257_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.4	4.0e-13
>prophage 67
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	880261	881527	4703889		Klosneuvirus(100.0%)	1	NA	NA
WP_000069228.1|880261_881527_-	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.0	4.6e-24
>prophage 68
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	894441	900099	4703889		Bacillus_virus(50.0%)	5	NA	NA
WP_000573407.1|894441_895248_+	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
WP_000968853.1|895315_895669_+	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_000506490.1|896036_896825_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_001356195.1|896969_898097_+	CMD domain-containing protein	NA	NA	NA	NA	NA
WP_000484984.1|898164_900099_+	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.9	3.1e-32
>prophage 69
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	907915	908506	4703889		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176295.1|907915_908506_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 70
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	913429	918721	4703889	protease	Tupanvirus(33.33%)	4	NA	NA
WP_163388228.1|913429_916027_-	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.7	2.3e-86
WP_001031530.1|916406_916658_+	YciN family protein	NA	NA	NA	NA	NA
WP_000422045.1|916693_917743_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559283.1|917962_918721_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	8.8e-07
>prophage 71
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	923654	926612	4703889		Acinetobacter_phage(100.0%)	2	NA	NA
WP_000763511.1|923654_925250_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001344826.1|925253_926612_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
>prophage 72
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	938270	940285	4703889		Bacillus_virus(50.0%)	2	NA	NA
WP_000994905.1|938270_939275_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
WP_000110945.1|939271_940285_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
>prophage 73
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	949699	959592	4703889		Citrobacter_phage(25.0%)	10	NA	NA
WP_000068079.1|949699_950317_-	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.3e-53
WP_001287378.1|950922_951336_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000718995.1|951479_952388_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_000193437.1|952589_953603_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_001226476.1|953694_954600_-	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_001307143.1|954712_955171_+	YchJ family protein	NA	NA	NA	NA	NA
WP_000555849.1|955220_956063_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001160110.1|956669_957347_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000571699.1|957346_958057_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_000702660.1|958053_959592_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
>prophage 74
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	970845	971076	4703889		Spodoptera_litura_granulovirus(100.0%)	1	NA	NA
WP_001146442.1|970845_971076_-	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	6.5e-06
>prophage 75
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	974177	978185	4703889		Cafeteria_roenbergensis_virus(50.0%)	5	NA	NA
WP_000811065.1|974177_975032_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
WP_001257044.1|975067_975877_-	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000200378.1|975880_976273_-	SirB family protein	NA	NA	NA	NA	NA
WP_000456469.1|976269_977103_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000804726.1|977102_978185_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
>prophage 76
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	981321	984073	4703889		Tupanvirus(50.0%)	2	NA	NA
WP_001298109.1|981321_982269_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001033346.1|982393_984073_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.0e-23
>prophage 77
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1010833	1012521	4703889		Salmonella_phage(50.0%)	2	NA	NA
WP_163388230.1|1010833_1012102_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	83.4	4.6e-210
WP_000897378.1|1012101_1012521_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
>prophage 78
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1021055	1023377	4703889		Escherichia_phage(100.0%)	1	NA	NA
WP_001307136.1|1021055_1023377_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	42.8	1.5e-89
>prophage 79
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1029243	1086066	4703889	capsid,head,tail,lysis,tRNA,integrase,portal,terminase	Enterobacteria_phage(71.43%)	70	1066755:1066769	1089919:1089933
WP_000332319.1|1029243_1029975_+	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	3.5e-53
WP_000373101.1|1030195_1030600_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_032141808.1|1030652_1030763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001307134.1|1031295_1031619_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	8.0e-42
WP_000539892.1|1031721_1031874_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	1.6e-21
WP_000207931.1|1032586_1033708_-	5-methylcytosine-specific restriction endonuclease system specificity protein McrC	NA	NA	NA	NA	NA
WP_021558813.1|1033704_1035660_-	AAA domain-containing protein	NA	K4I1H4	Acidithiobacillus_phage	28.6	9.8e-26
WP_088550200.1|1036020_1036605_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.4	2.7e-104
WP_088550201.1|1036604_1039964_-	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
WP_001230386.1|1040028_1040628_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.0	4.4e-110
WP_088550202.1|1040694_1044093_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	89.9	0.0e+00
WP_000090917.1|1044153_1044786_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_087906052.1|1044722_1045466_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	8.6e-148
WP_163388231.1|1045471_1046170_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	8.9e-131
WP_000847333.1|1046169_1046499_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	97.2	3.1e-57
WP_000840254.1|1046495_1049057_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	89.6	0.0e+00
WP_000459457.1|1049049_1049484_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479153.1|1049465_1049888_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_001349920.1|1049903_1050644_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	7.8e-133
WP_000683105.1|1050651_1051047_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975070.1|1051043_1051622_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	100.0	2.7e-80
WP_000752979.1|1051633_1051987_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	100.0	2.0e-62
WP_000158905.1|1051998_1052397_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	99.2	1.2e-63
WP_000063280.1|1052438_1053464_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	100.0	7.1e-193
WP_001297109.1|1053519_1053852_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	100.0	2.2e-55
WP_087906123.1|1053861_1055181_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.3	3.3e-235
WP_087906124.1|1055161_1056763_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	3.6e-308
WP_087906125.1|1056961_1058887_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000453587.1|1058861_1059407_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_000738423.1|1060071_1060365_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001228695.1|1060455_1060638_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001135280.1|1060854_1061352_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.6	1.1e-90
WP_000839596.1|1061351_1061567_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737283.1|1062155_1063253_+	porin	NA	Q1MVN1	Enterobacteria_phage	76.3	4.8e-155
WP_062893049.1|1063442_1063826_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
WP_000971095.1|1063911_1064052_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	72.1	1.7e-09
WP_032236357.1|1064048_1064411_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	93.2	5.2e-58
WP_000774498.1|1064407_1064698_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	95.8	6.7e-48
WP_000224914.1|1064690_1064861_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_087906133.1|1064860_1065316_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	65.6	1.3e-58
WP_087906132.1|1065506_1065773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052011678.1|1065917_1066286_-	hypothetical protein	NA	K7P7P8	Enterobacteria_phage	63.2	4.2e-23
WP_087906131.1|1066396_1066558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000709083.1|1066711_1068238_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
1066755:1066769	attL	ATCGCCTGCTGGGCG	NA	NA	NA	NA
WP_001299444.1|1068295_1068445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070442.1|1068492_1068825_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145900.1|1068892_1069195_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788886.1|1069191_1069893_-	Replication protein P	NA	M1FJ72	Enterobacteria_phage	99.6	9.9e-130
WP_163388323.1|1069889_1070819_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.8	1.0e-110
WP_001400028.1|1070905_1071445_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.7	1.5e-61
WP_000184665.1|1071475_1071703_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
WP_000712396.1|1071813_1072506_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	85.3	2.5e-109
WP_000741702.1|1072635_1073775_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_016244337.1|1073771_1074284_+	DUF4411 family protein	NA	NA	NA	NA	NA
WP_016244336.1|1074765_1074972_+	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	83.8	9.3e-28
WP_016244335.1|1075047_1075344_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	95.9	2.6e-47
WP_000100847.1|1075349_1076135_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000611716.1|1076131_1076812_+	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	3.0e-131
WP_000149533.1|1076808_1076967_+	DUF1317 family protein	NA	M1FJ61	Enterobacteria_phage	88.5	6.4e-21
WP_021557045.1|1076963_1078028_+	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	65.1	2.0e-134
WP_087906181.1|1078181_1078400_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	97.2	8.3e-35
WP_000488406.1|1078447_1078687_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	94.9	3.9e-38
WP_000088653.1|1078826_1079063_+	excisionase	NA	NA	NA	NA	NA
WP_094259447.1|1079052_1080195_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	99.7	6.2e-206
WP_000444492.1|1080308_1081559_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	98.1	1.4e-22
WP_001248691.1|1081730_1082384_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|1082393_1082855_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001297484.1|1082908_1084015_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001297479.1|1084050_1084692_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423750.1|1084695_1086066_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	5.5e-108
1089919:1089933	attR	ATCGCCTGCTGGGCG	NA	NA	NA	NA
>prophage 80
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1091203	1093163	4703889		Mycoplasma_phage(100.0%)	2	NA	NA
WP_001343892.1|1091203_1092322_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.4e-29
WP_000799401.1|1092305_1093163_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
>prophage 81
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1096435	1100158	4703889		Vibrio_phage(50.0%)	4	NA	NA
WP_000952736.1|1096435_1097257_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
WP_000291270.1|1097272_1098184_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_001251348.1|1098212_1099457_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_001033694.1|1099456_1100158_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.1e-35
>prophage 82
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1107447	1107705	4703889		Erwinia_phage(100.0%)	1	NA	NA
WP_000800153.1|1107447_1107705_-	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 83
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1120019	1121662	4703889		Streptococcus_virus(50.0%)	2	NA	NA
WP_001267931.1|1120019_1121024_-	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	30.9	8.4e-05
WP_001257000.1|1121020_1121662_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
>prophage 84
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1124934	1126116	4703889		Ralstonia_phage(50.0%)	2	NA	NA
WP_000103754.1|1124934_1125171_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
WP_001008535.1|1125381_1126116_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
>prophage 85
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1138474	1139416	4703889		Brevibacillus_phage(100.0%)	1	NA	NA
WP_001323587.1|1138474_1139416_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 86
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1155262	1155508	4703889		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|1155262_1155508_+	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 87
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1160170	1161091	4703889		Morganella_phage(100.0%)	1	NA	NA
WP_000183364.1|1160170_1161091_+	kdo(2)-lipid IV(A) lauroyltransferase	NA	A0A1W6JP29	Morganella_phage	41.5	8.6e-57
>prophage 88
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1170399	1170933	4703889		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000857399.1|1170399_1170933_-	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	7.8e-26
>prophage 89
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1175067	1175901	4703889		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001189321.1|1175067_1175901_+	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 90
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1181247	1183513	4703889	transposase	Acinetobacter_phage(50.0%)	2	NA	NA
WP_000878218.1|1181247_1182114_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_163388235.1|1182154_1183513_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.0	1.9e-20
>prophage 91
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1190332	1191256	4703889		Cronobacter_phage(100.0%)	1	NA	NA
WP_001307105.1|1190332_1191256_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	9.2e-91
>prophage 92
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1206032	1208140	4703889		Enterobacteria_phage(100.0%)	3	NA	NA
WP_001028095.1|1206032_1206527_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
WP_001442428.1|1206547_1207876_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.4	5.3e-233
WP_001273658.1|1207966_1208140_-	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
>prophage 93
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1212443	1224757	4703889		Klosneuvirus(20.0%)	13	NA	NA
WP_000420643.1|1212443_1213364_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	2.5e-11
WP_000024560.1|1213363_1213669_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000209919.1|1213820_1214420_-	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_001062098.1|1214416_1216963_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.2	1.3e-70
WP_001230242.1|1216962_1218135_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001120112.1|1218264_1218957_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001264955.1|1218929_1219958_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_163388236.1|1220040_1222785_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	32.2	7.8e-37
WP_000829654.1|1222856_1223930_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001019197.1|1223977_1224151_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_021292990.1|1224140_1224371_-	protein YmcE	NA	NA	NA	NA	NA
WP_071528578.1|1224345_1224534_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066490.1|1224544_1224757_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
>prophage 94
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1244022	1244682	4703889	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000375136.1|1244022_1244682_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
>prophage 95
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1248915	1250970	4703889		Bacillus_phage(100.0%)	1	NA	NA
WP_047675448.1|1248915_1250970_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	7.7e-21
>prophage 96
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1263569	1265477	4703889		Tupanvirus(100.0%)	1	NA	NA
WP_000053089.1|1263569_1265477_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	1.4e-53
>prophage 97
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1281398	1289712	4703889	tRNA	Bacillus_virus(25.0%)	5	NA	NA
WP_001090508.1|1281398_1282166_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	5.7e-30
WP_000193844.1|1282372_1284985_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	7.0e-19
WP_001297200.1|1285250_1286453_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000117881.1|1286621_1288022_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_000977920.1|1288623_1289712_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
>prophage 98
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1293261	1293810	4703889		Rhodobacter_phage(100.0%)	1	NA	NA
WP_001295932.1|1293261_1293810_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
>prophage 99
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1308515	1313056	4703889		Bacillus_phage(100.0%)	3	NA	NA
WP_000551270.1|1308515_1310264_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
WP_000705713.1|1310300_1312565_-	ComEC family protein	NA	NA	NA	NA	NA
WP_000167336.1|1312771_1313056_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
>prophage 100
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1318142	1319231	4703889		Streptococcus_phage(100.0%)	1	NA	NA
WP_000057149.1|1318142_1319231_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
>prophage 101
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1323329	1326544	4703889		Tetraselmis_virus(100.0%)	2	NA	NA
WP_001292822.1|1323329_1325612_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_000111043.1|1325803_1326544_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
>prophage 102
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1332854	1356656	4703889	protease,tRNA	Escherichia_phage(16.67%)	16	NA	NA
WP_000213098.1|1332854_1333472_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000850313.1|1333482_1335927_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.9	3.0e-221
WP_000886683.1|1336165_1337458_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067751.1|1337548_1338892_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	4.8e-80
WP_001295343.1|1338902_1339514_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_163388240.1|1339672_1343779_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|1343913_1344408_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|1344952_1345918_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_024243447.1|1346040_1347807_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_001202188.1|1347807_1349529_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	1.9e-20
WP_001241678.1|1349570_1350275_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|1350559_1350778_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|1351462_1353739_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|1353769_1354090_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|1354412_1354637_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188180.1|1354709_1356656_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
>prophage 103
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1365915	1367634	4703889		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000815350.1|1365915_1367634_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	4.0e-31
>prophage 104
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1371221	1373959	4703889		Roseobacter_phage(50.0%)	4	NA	NA
WP_001255144.1|1371221_1372052_-	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001160737.1|1372048_1372372_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001270735.1|1372497_1373013_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027195.1|1373230_1373959_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	2.3e-28
>prophage 105
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1377296	1386446	4703889		Streptococcus_phage(25.0%)	11	NA	NA
WP_001149732.1|1377296_1378424_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	3.5e-28
WP_000389260.1|1378464_1378953_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061657.1|1379012_1379858_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000105438.1|1379854_1380808_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000996024.1|1380817_1381951_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.4	5.0e-30
WP_000126097.1|1382045_1383158_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|1383508_1383985_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|1384072_1384975_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000189159.1|1385035_1385758_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201576.1|1385741_1386029_-	YbjC family protein	NA	NA	NA	NA	NA
WP_001195231.1|1386188_1386446_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	63.1	7.8e-24
>prophage 106
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1395012	1396215	4703889		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000195961.1|1395012_1396215_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
>prophage 107
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1407550	1409422	4703889		Planktothrix_phage(100.0%)	1	NA	NA
WP_001315369.1|1407550_1409422_-	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	4.0e-16
>prophage 108
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1412637	1416768	4703889		Synechococcus_phage(50.0%)	3	NA	NA
WP_000424893.1|1412637_1413300_-	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	34.6	5.7e-26
WP_001442269.1|1413430_1414330_+	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_000209304.1|1414335_1416768_+	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
>prophage 109
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1420660	1422253	4703889		Tupanvirus(100.0%)	1	NA	NA
WP_000961458.1|1420660_1422253_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
>prophage 110
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1427250	1432475	4703889		Escherichia_phage(33.33%)	7	NA	NA
WP_001295296.1|1427250_1427766_-	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
WP_120795379.1|1427818_1427884_-	protein YliM	NA	NA	NA	NA	NA
WP_163388241.1|1428118_1429006_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_000100800.1|1429304_1429808_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_000843866.1|1430211_1430958_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_001159065.1|1431096_1431756_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000569080.1|1431752_1432475_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
>prophage 111
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1436015	1450827	4703889		Erwinia_phage(14.29%)	13	NA	NA
WP_001307070.1|1436015_1436276_+	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
WP_000430036.1|1436540_1438823_+	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_000990177.1|1438864_1439542_+	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	1.2e-18
WP_000146343.1|1439615_1439882_+	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	6.9e-07
WP_000849301.1|1440146_1440407_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000443508.1|1440635_1441721_-	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000386551.1|1441861_1442824_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_001307069.1|1442851_1445002_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.3	5.7e-43
WP_001145128.1|1445121_1445604_+	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.7	1.5e-36
WP_000007102.1|1445835_1447200_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001296991.1|1447428_1448100_+	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000976401.1|1448099_1449098_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_000996099.1|1449090_1450827_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
>prophage 112
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1462138	1463047	4703889		Streptococcus_phage(100.0%)	1	NA	NA
WP_001295302.1|1462138_1463047_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
>prophage 113
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1469528	1470818	4703889		Klosneuvirus(100.0%)	1	NA	NA
WP_001389241.1|1469528_1470818_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.9	3.8e-18
>prophage 114
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1481173	1487747	4703889		Planktothrix_phage(33.33%)	7	NA	NA
WP_000891685.1|1481173_1482232_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.7	2.6e-20
WP_000604034.1|1482234_1482924_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000101994.1|1482923_1483697_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000891515.1|1483863_1484013_-	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_001147439.1|1484141_1484930_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000096869.1|1484997_1486470_+	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.3	7.2e-13
WP_001265443.1|1486730_1487747_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	1.0e-79
>prophage 115
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1492100	1495620	4703889		Klebsiella_phage(33.33%)	4	NA	NA
WP_001109196.1|1492100_1493153_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.4	3.4e-81
WP_000784351.1|1493468_1493849_+	periplasmic protein	NA	NA	NA	NA	NA
WP_000951292.1|1493962_1494904_+	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.2	2.2e-23
WP_000345410.1|1494900_1495620_-	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	9.2e-22
>prophage 116
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1531503	1532295	4703889		Kaumoebavirus(100.0%)	1	NA	NA
WP_001114036.1|1531503_1532295_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	25.8	3.7e-08
>prophage 117
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1535673	1538615	4703889		Acinetobacter_phage(50.0%)	2	NA	NA
WP_001032694.1|1535673_1537155_+	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	2.5e-45
WP_000207157.1|1537196_1538615_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.0	3.1e-61
>prophage 118
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1543078	1555799	4703889		uncultured_Caudovirales_phage(25.0%)	8	NA	NA
WP_163388244.1|1543078_1547272_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.9	2.5e-26
WP_000424924.1|1547514_1547721_-	YbfA family protein	NA	NA	NA	NA	NA
WP_001272653.1|1548033_1548123_+	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_000741137.1|1548122_1549796_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_000087967.1|1549818_1551867_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	22.8	4.2e-27
WP_001297248.1|1551875_1552448_+	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_001306984.1|1552440_1555125_+	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.5	1.4e-11
WP_000186103.1|1555121_1555799_+	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	31.1	8.9e-27
>prophage 119
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1562454	1563219	4703889		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000773296.1|1562454_1563219_+	esterase	NA	A0A1J0GVH7	Mycobacterium_phage	35.4	5.8e-06
>prophage 120
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1567369	1571183	4703889	tRNA	Escherichia_phage(50.0%)	2	NA	NA
WP_001287154.1|1567369_1569034_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	99.1	0.0e+00
WP_001023104.1|1569236_1571183_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.6e-07
>prophage 121
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1575809	1577474	4703889		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337066.1|1575809_1577474_+	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.3	6.1e-85
>prophage 122
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1581570	1582650	4703889		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000490838.1|1581570_1582650_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.3e-47
>prophage 123
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1590546	1594079	4703889		Planktothrix_phage(50.0%)	3	NA	NA
WP_000631384.1|1590546_1591272_+	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
WP_001207503.1|1591389_1592325_+	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_000367854.1|1592408_1594079_+	molecular chaperone HscC	NA	E5EQT9	Bathycoccus_sp._RCC1105_virus	35.5	5.2e-76
>prophage 124
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1601018	1603601	4703889	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001157890.1|1601018_1603601_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.3	5.2e-184
>prophage 125
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1610611	1613051	4703889		Synechococcus_phage(50.0%)	2	NA	NA
WP_001231428.1|1610611_1611700_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
WP_001092082.1|1611839_1613051_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
>prophage 126
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1617866	1618514	4703889		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_000939738.1|1617866_1618250_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
WP_000034825.1|1618304_1618514_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
>prophage 127
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1633939	1636054	4703889		Morganella_phage(50.0%)	2	NA	NA
WP_000278505.1|1633939_1634368_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.1e-19
WP_000887629.1|1634488_1636054_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
>prophage 128
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1639121	1640944	4703889		Streptococcus_phage(50.0%)	2	NA	NA
WP_000029802.1|1639121_1640342_+	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	33.0	1.2e-58
WP_000502941.1|1640314_1640944_+	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.8	2.9e-56
>prophage 129
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1655304	1661347	4703889		Klosneuvirus(50.0%)	3	NA	NA
WP_000140647.1|1655304_1656120_+	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
WP_021293416.1|1656116_1657250_-	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_000077701.1|1657465_1661347_-	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.4	5.8e-62
>prophage 130
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1672776	1675920	4703889		Leptospira_phage(100.0%)	1	NA	NA
WP_000573943.1|1672776_1675920_-	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.2	5.7e-60
>prophage 131
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1679065	1683825	4703889		Bacillus_phage(50.0%)	3	NA	NA
WP_000770941.1|1679065_1679749_+	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	34.7	2.3e-30
WP_000253830.1|1679738_1681187_+	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	NA	NA	NA	NA
WP_163388250.1|1681923_1683825_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.1e-26
>prophage 132
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1710575	1713706	4703889	tRNA	Enterococcus_phage(50.0%)	4	NA	NA
WP_000729154.1|1710575_1711442_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000190288.1|1711443_1711656_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001143552.1|1711763_1712285_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000912345.1|1712320_1713706_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
>prophage 133
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1725126	1726272	4703889		Streptococcus_phage(100.0%)	1	NA	NA
WP_000706355.1|1725126_1726272_-	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	1.8e-48
>prophage 134
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1732463	1734245	4703889		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_001433183.1|1732463_1734245_-	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	6.0e-38
>prophage 135
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1741152	1741839	4703889		Planktothrix_phage(100.0%)	1	NA	NA
WP_001110573.1|1741152_1741839_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
>prophage 136
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1744975	1745653	4703889		Bacillus_virus(100.0%)	1	NA	NA
WP_001157535.1|1744975_1745653_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	2.4e-27
>prophage 137
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1750192	1753152	4703889		uncultured_virus(50.0%)	2	NA	NA
WP_000078266.1|1750192_1752697_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.2	2.9e-115
WP_001361120.1|1752810_1753152_-	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	73.6	3.9e-39
>prophage 138
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1761396	1769958	4703889		Acanthamoeba_polyphaga_moumouvirus(25.0%)	8	NA	NA
WP_000801832.1|1761396_1762356_+	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.3	1.1e-14
WP_163388254.1|1762352_1763315_-	ferrochelatase	NA	NA	NA	NA	NA
WP_001220233.1|1763550_1764195_-	adenylate kinase	NA	NA	NA	NA	NA
WP_000678208.1|1764375_1766250_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
WP_001195025.1|1766359_1766965_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_000467098.1|1766964_1767294_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_000122008.1|1767346_1769278_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000127356.1|1769406_1769958_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
>prophage 139
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1776966	1780116	4703889		Leptospira_phage(100.0%)	1	NA	NA
WP_001132469.1|1776966_1780116_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	6.2e-54
>prophage 140
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1788952	1792499	4703889		Bacillus_phage(100.0%)	2	NA	NA
WP_053289006.1|1788952_1790734_-	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	1.1e-42
WP_001235599.1|1790726_1792499_-	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	8.8e-50
>prophage 141
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1795822	1796518	4703889		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817229.1|1795822_1796518_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.9e-88
>prophage 142
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1799646	1804693	4703889	protease	Bacillus_phage(25.0%)	4	NA	NA
WP_001043542.1|1799646_1799919_-	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
WP_001295325.1|1800127_1802482_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_000130305.1|1802669_1803944_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_000122253.1|1804069_1804693_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
>prophage 143
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1828524	1837505	4703889	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_001021161.1|1828524_1828995_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
WP_001150472.1|1829083_1830187_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.5	5.3e-53
WP_000543535.1|1830190_1830640_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001295327.1|1830790_1831330_+	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_001295328.1|1831628_1832513_+	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_000974813.1|1832689_1833037_-	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_000046637.1|1833165_1834137_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000934822.1|1834147_1835995_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000007629.1|1836022_1836355_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000667319.1|1836377_1837505_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
>prophage 144
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1844457	1854429	4703889		Bacillus_phage(60.0%)	7	NA	NA
WP_000893578.1|1844457_1845753_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	1.3e-26
WP_000113933.1|1845810_1846500_-	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_001221319.1|1846689_1847892_+	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
WP_000698883.1|1847888_1851032_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_001345723.1|1851157_1852342_+	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_001219320.1|1852484_1853393_-	fructokinase	NA	NA	NA	NA	NA
WP_001298537.1|1853517_1854429_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
>prophage 145
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1858718	1859834	4703889		Bacillus_phage(100.0%)	1	NA	NA
WP_000484055.1|1858718_1859834_-	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.5e-18
>prophage 146
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1867248	1868406	4703889		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000830741.1|1867248_1868406_+	OXA-12 family class D beta-lactamase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	5.1e-06
>prophage 147
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1875395	1876163	4703889		Planktothrix_phage(100.0%)	1	NA	NA
WP_163388256.1|1875395_1876163_-	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	40.9	8.6e-26
>prophage 148
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1881460	1882570	4703889		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000842102.1|1881460_1882570_+	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	1.2e-31
>prophage 149
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1885648	1887609	4703889		Micromonas_sp._RCC1109_virus(50.0%)	2	NA	NA
WP_163388257.1|1885648_1886662_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.4	1.9e-44
WP_000044314.1|1886658_1887609_-	acetaldehyde dehydrogenase	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	8.7e-36
>prophage 150
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1893019	1897299	4703889		Enterobacteria_phage(50.0%)	2	NA	NA
WP_000805910.1|1893019_1894102_+	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	99.4	1.1e-191
WP_096931310.1|1894224_1897299_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	99.1	0.0e+00
>prophage 151
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1901139	1906923	4703889		Lactobacillus_phage(50.0%)	4	NA	NA
WP_000952482.1|1901139_1902039_+	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	3.2e-16
WP_001295686.1|1902078_1903362_-	cytosine/isoguanine deaminase	NA	NA	NA	NA	NA
WP_000076233.1|1903351_1904611_-	cytosine permease	NA	NA	NA	NA	NA
WP_000010270.1|1905036_1906923_-	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	3.1e-53
>prophage 152
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1915415	1919953	4703889		Acanthamoeba_polyphaga_mimivirus(50.0%)	4	NA	NA
WP_000692754.1|1915415_1916465_-	NADPH-dependent aldehyde reductase YahK	NA	A0A0G2YAX3	Acanthamoeba_polyphaga_mimivirus	42.6	2.8e-72
WP_000750340.1|1916551_1917508_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000818900.1|1917504_1918476_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000447335.1|1918468_1919953_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.7	8.0e-12
>prophage 153
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1932679	1938599	4703889	holin	Vibrio_phage(50.0%)	4	NA	NA
WP_000131044.1|1932679_1934713_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001295527.1|1934841_1935429_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089102.1|1935442_1936915_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159102.1|1936928_1938599_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
>prophage 154
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1944174	1945500	4703889		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_001542682.1|1944174_1945500_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.4	3.2e-113
>prophage 155
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1965709	1973291	4703889		Streptococcus_phage(50.0%)	6	NA	NA
WP_000667026.1|1965709_1967908_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
WP_000121356.1|1967917_1968874_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001111349.1|1968852_1969263_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000893255.1|1969579_1970833_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
WP_001285288.1|1970844_1971948_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749865.1|1972235_1973291_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	2.0e-118
>prophage 156
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1977968	1979108	4703889		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000528869.1|1977968_1979108_-	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	31.7	2.0e-31
>prophage 157
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1984186	1988105	4703889		Clostridioides_phage(50.0%)	6	NA	NA
WP_000543895.1|1984186_1984960_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_000729704.1|1985145_1985406_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000615976.1|1985408_1985687_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|1985842_1986583_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000333380.1|1986553_1987321_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|1987526_1988105_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
>prophage 158
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	1999593	2001735	4703889		Ralstonia_phage(100.0%)	1	NA	NA
WP_000103361.1|1999593_2001735_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	8.2e-26
>prophage 159
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2005450	2069388	4703889	protease,plate,transposase,tRNA	Cronobacter_phage(11.11%)	54	NA	NA
WP_000611742.1|2005450_2005864_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393845.1|2005867_2007718_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348806.1|2007681_2008764_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113725.1|2008788_2010069_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|2010065_2010590_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246437.1|2010592_2011924_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000343298.1|2011928_2012690_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000614339.1|2012698_2015458_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.7	9.4e-83
WP_000088873.1|2015454_2016198_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_163388263.1|2016202_2017618_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_122985538.1|2017726_2021161_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001087745.1|2021171_2022524_+	membrane protein	NA	NA	NA	NA	NA
WP_001284199.1|2022547_2023030_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000908052.1|2023073_2023988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001236649.1|2023997_2024477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086142.1|2024613_2025399_-	aminopeptidase	NA	NA	NA	NA	NA
WP_001297205.1|2025938_2026670_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_000917883.1|2026734_2027202_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001295200.1|2027198_2027921_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052707.1|2027954_2028710_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|2028781_2030140_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000211729.1|2030187_2030958_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|2031035_2031836_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648572.1|2032076_2032991_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997043.1|2032987_2033791_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	3.2e-39
WP_001140187.1|2039653_2040229_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000593994.1|2040416_2041448_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001294600.1|2041440_2042094_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874224.1|2042133_2042949_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202329.1|2043066_2043471_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094011.1|2043467_2044175_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260712.1|2044286_2046005_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001346133.1|2046057_2046882_+	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000399648.1|2047084_2048065_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000239192.1|2048314_2049025_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000635545.1|2049038_2049461_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001185293.1|2049457_2050003_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_000417058.1|2050168_2050369_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062312.1|2050355_2050616_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000176573.1|2050664_2051963_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000901098.1|2052027_2052417_-	VOC family protein	NA	NA	NA	NA	NA
WP_001021030.1|2052473_2054615_-	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000055741.1|2054713_2055673_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001294757.1|2055685_2059168_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000569430.1|2059204_2059801_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_000139659.1|2059797_2060946_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000565966.1|2060945_2061734_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|2061737_2062193_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_001139279.1|2062297_2063323_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000758956.1|2063326_2063812_-	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001240896.1|2063933_2066366_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_001295561.1|2066395_2067748_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_000922446.1|2067759_2068617_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_001295562.1|2068629_2069388_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
>prophage 160
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2081272	2082697	4703889	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000753945.1|2081272_2082697_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
>prophage 161
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2086626	2086971	4703889		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|2086626_2086971_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 162
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2092882	2093680	4703889		Planktothrix_phage(100.0%)	1	NA	NA
WP_163388264.1|2092882_2093680_-	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	27.8	5.4e-15
>prophage 163
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2098923	2105729	4703889	tRNA	Acanthamoeba_polyphaga_mimivirus(50.0%)	6	NA	NA
WP_001367042.1|2098923_2101353_-	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.6	6.7e-40
WP_001294700.1|2101426_2101957_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_000396036.1|2101971_2102676_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001155227.1|2102853_2103309_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_000937432.1|2103345_2104272_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_000174643.1|2104310_2105729_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
>prophage 164
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2115635	2116538	4703889		Sodalis_phage(100.0%)	1	NA	NA
WP_000339946.1|2115635_2116538_-	recombination-promoting nuclease RpnC	NA	Q2A0A7	Sodalis_phage	49.2	5.7e-61
>prophage 165
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2119800	2126268	4703889		Anomala_cuprea_entomopoxvirus(33.33%)	5	NA	NA
WP_000150637.1|2119800_2120727_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
WP_000651599.1|2120835_2121498_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_001609215.1|2121538_2122075_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_001331234.1|2122280_2124671_+	quinoprotein glucose dehydrogenase	NA	NA	NA	NA	NA
WP_001189662.1|2124717_2126268_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	7.8e-18
>prophage 166
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2133917	2135342	4703889		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102485.1|2133917_2135342_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 167
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2143969	2144521	4703889		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923721.1|2143969_2144521_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	32.3	3.0e-12
>prophage 168
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2148766	2149810	4703889		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217338.1|2148766_2149810_-	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 169
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2175783	2177508	4703889		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_000425665.1|2175783_2177508_-	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	2.4e-36
>prophage 170
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2190210	2190909	4703889		Planktothrix_phage(100.0%)	1	NA	NA
WP_163388266.1|2190210_2190909_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	37.2	2.8e-23
>prophage 171
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2197241	2202664	4703889		Yellowstone_lake_phycodnavirus(50.0%)	2	NA	NA
WP_163388267.1|2197241_2199593_+	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.5	1.0e-37
WP_001117010.1|2199757_2202664_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
>prophage 172
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2210408	2211808	4703889		Microcystis_phage(50.0%)	2	NA	NA
WP_000257186.1|2210408_2211251_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.0e-08
WP_000624375.1|2211328_2211808_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
>prophage 173
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2219702	2225363	4703889		Vibrio_phage(50.0%)	4	NA	NA
WP_000787111.1|2219702_2221217_+	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
WP_000347117.1|2221247_2222390_+	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000349938.1|2222518_2223736_+	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_001297614.1|2223809_2225363_+	crotonobetaine/carnitine-CoA ligase	NA	Q75ZG1	Hepacivirus	25.4	4.7e-31
>prophage 174
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2230833	2231982	4703889		Halovirus(100.0%)	1	NA	NA
WP_000597260.1|2230833_2231982_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.7e-49
>prophage 175
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2236388	2239205	4703889	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001286857.1|2236388_2239205_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	2.7e-77
>prophage 176
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2246239	2255308	4703889		uncultured_Caudovirales_phage(20.0%)	9	NA	NA
WP_000681360.1|2246239_2247406_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.3	7.5e-90
WP_001331242.1|2247934_2248144_+	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	72.5	2.3e-18
WP_163388269.1|2248247_2249378_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_000516135.1|2249466_2251383_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_000843558.1|2251759_2252164_+	DUF2541 family protein	NA	NA	NA	NA	NA
WP_001102385.1|2252189_2252903_+	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000528538.1|2253051_2253618_+	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001295414.1|2253652_2254240_-	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000130185.1|2254354_2255308_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.5	1.7e-10
>prophage 177
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2268356	2270470	4703889		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_001219604.1|2268356_2269781_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	21.7	1.2e-09
WP_001188659.1|2269780_2270470_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
>prophage 178
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2273702	2279057	4703889		Bacillus_phage(33.33%)	3	NA	NA
WP_000409451.1|2273702_2275640_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000046749.1|2275850_2277518_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000093810.1|2277824_2279057_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.6e-82
>prophage 179
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2285800	2287123	4703889		Geobacillus_virus(100.0%)	1	NA	NA
WP_000477811.1|2285800_2287123_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
>prophage 180
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2292758	2295634	4703889		Salmonella_phage(50.0%)	3	NA	NA
WP_000490275.1|2292758_2292920_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001295748.1|2293046_2293652_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000175943.1|2294044_2295634_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
>prophage 181
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2303328	2304608	4703889		Salmonella_phage(50.0%)	2	NA	NA
WP_000098819.1|2303328_2303868_+	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	61.7	8.4e-28
WP_000799911.1|2303870_2304608_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
>prophage 182
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2307834	2313199	4703889		Tupanvirus(50.0%)	4	NA	NA
WP_000106035.1|2307834_2308857_-	L-galactonate oxidoreductase	NA	A0A2K9L7I1	Tupanvirus	26.3	2.7e-11
WP_000091572.1|2308995_2309910_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000410129.1|2310124_2311486_+	MFS transporter	NA	NA	NA	NA	NA
WP_000919567.1|2311534_2313199_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
>prophage 183
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2333213	2334158	4703889	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000181170.1|2333213_2334158_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.7	5.9e-61
>prophage 184
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2341659	2342214	4703889		Clostridioides_phage(100.0%)	1	NA	NA
WP_001151854.1|2341659_2342214_-	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.7e-37
>prophage 185
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2348782	2350243	4703889		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208180.1|2348782_2350243_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	1.6e-49
>prophage 186
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2360509	2362186	4703889		Escherichia_phage(100.0%)	2	NA	NA
WP_000044711.1|2360509_2361106_-	type 1 fimbria regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
WP_000790583.1|2361583_2362186_-	type 1 fimbria regulatory protein FimB	NA	A0A2L1IV36	Escherichia_phage	52.3	3.1e-55
>prophage 187
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2365549	2386629	4703889	transposase,tRNA	Streptococcus_phage(25.0%)	15	NA	NA
WP_000991444.1|2365549_2366530_+	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	Q08JA2	Stx2-converting_phage	55.9	2.5e-102
WP_001597599.1|2367682_2367958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050488440.1|2367982_2368363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101781968.1|2368633_2369866_-	DNA cytosine methyltransferase	NA	Q6DMX0	Streptococcus_phage	53.2	1.3e-103
WP_001597595.1|2370031_2371435_+	AAA domain-containing protein	NA	M1NSM1	Streptococcus_phage	31.2	3.8e-48
WP_001597594.1|2371460_2372732_+	LlaJI family restriction endonuclease	NA	NA	NA	NA	NA
WP_000878196.1|2374358_2375225_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_000169527.1|2375221_2375521_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001597592.1|2376466_2377486_+	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	5.4e-44
WP_089596832.1|2377615_2379118_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.0	8.8e-83
WP_001295681.1|2379236_2380319_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_000584114.1|2380318_2381419_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_000397144.1|2381685_2383197_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000786399.1|2383330_2383774_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000416392.1|2383773_2386629_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.8e-140
>prophage 188
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2394906	2401363	4703889	transposase	Paramecium_bursaria_Chlorella_virus(66.67%)	7	NA	NA
WP_000013046.1|2394906_2395842_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_000148581.1|2395854_2396316_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000047539.1|2396388_2396775_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_001118337.1|2396840_2397296_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000471866.1|2397340_2400037_-	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_001387276.1|2400177_2400231_-	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_001181332.1|2400415_2401363_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	6.0e-13
>prophage 189
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2405001	2407762	4703889		Vibrio_phage(100.0%)	2	NA	NA
WP_000187798.1|2405001_2407140_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
WP_001106222.1|2407297_2407762_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	H6WXC9	Vibrio_phage	59.7	1.1e-52
>prophage 190
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2412072	2418560	4703889		Klosneuvirus(33.33%)	6	NA	NA
WP_000853753.1|2412072_2413071_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_000595986.1|2413103_2414099_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001367906.1|2414085_2415108_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000205794.1|2415121_2416624_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.1e-11
WP_000265912.1|2416763_2417720_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055072.1|2418029_2418560_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
>prophage 191
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2460692	2461856	4703889		Ralstonia_phage(100.0%)	1	NA	NA
WP_000943987.1|2460692_2461856_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.5	1.7e-81
>prophage 192
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2465788	2478819	4703889	protease,tRNA	Lactococcus_phage(20.0%)	11	NA	NA
WP_000076316.1|2465788_2468230_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
WP_001177644.1|2468268_2468694_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|2468898_2470197_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|2470300_2470498_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|2470579_2471584_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|2471586_2472846_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_000460360.1|2472931_2474212_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051883.1|2474287_2474596_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001280345.1|2474681_2475632_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001122507.1|2475624_2477472_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.4e-60
WP_000990312.1|2477481_2478819_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
>prophage 193
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2482734	2483280	4703889		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001295188.1|2482734_2483280_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
>prophage 194
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2490708	2491686	4703889		Tupanvirus(100.0%)	1	NA	NA
WP_000004771.1|2490708_2491686_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
>prophage 195
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2496606	2497140	4703889		Morganella_phage(100.0%)	1	NA	NA
WP_001238378.1|2496606_2497140_+	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
>prophage 196
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2502937	2504921	4703889		Vibrio_phage(50.0%)	2	NA	NA
WP_000729117.1|2502937_2504584_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_001026276.1|2504627_2504921_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
>prophage 197
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2519197	2522409	4703889	tRNA	Acinetobacter_phage(50.0%)	2	NA	NA
WP_000856841.1|2519197_2520655_+	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.4	8.9e-48
WP_001295087.1|2520891_2522409_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.0e-87
>prophage 198
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2543604	2545107	4703889		Burkholderia_virus(100.0%)	1	NA	NA
WP_001296882.1|2543604_2545107_-	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.0	7.0e-56
>prophage 199
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2549944	2550733	4703889		Cedratvirus(100.0%)	1	NA	NA
WP_001193391.1|2549944_2550733_+	phosphonate ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	30.1	8.5e-13
>prophage 200
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2556292	2557842	4703889		Bacillus_virus(50.0%)	2	NA	NA
WP_001075526.1|2556292_2557051_+	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	27.8	1.0e-15
WP_000611404.1|2557161_2557842_+	phosphonate C-P lyase system protein PhnL	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.5	7.1e-08
>prophage 201
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2561827	2563813	4703889		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001307516.1|2561827_2563813_+	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.5	5.5e-149
>prophage 202
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2569058	2571206	4703889		Escherichia_phage(100.0%)	1	NA	NA
WP_001300547.1|2569058_2571206_+	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.9	7.0e-33
>prophage 203
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2580488	2582447	4703889		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078239.1|2580488_2582447_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.4	1.9e-90
>prophage 204
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2588030	2589380	4703889		Moraxella_phage(100.0%)	1	NA	NA
WP_000106882.1|2588030_2589380_-	guanine/hypoxanthine transporter GhxP	NA	A0A0R6PHV4	Moraxella_phage	71.6	1.8e-159
>prophage 205
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2593197	2596810	4703889		Enterobacteria_phage(50.0%)	2	NA	NA
WP_000168305.1|2593197_2593734_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
WP_000357740.1|2593987_2596810_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
>prophage 206
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2600998	2603546	4703889		Yellowstone_lake_mimivirus(50.0%)	2	NA	NA
WP_063087927.1|2600998_2602078_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.6	6.8e-29
WP_000918363.1|2602130_2603546_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
>prophage 207
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2610136	2610745	4703889		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|2610136_2610745_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 208
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2619869	2620985	4703889		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|2619869_2620985_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 209
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2636792	2637584	4703889		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001130529.1|2636792_2637584_-	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	44.2	1.0e-45
>prophage 210
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2643234	2646918	4703889		Dickeya_phage(100.0%)	1	NA	NA
WP_047675773.1|2643234_2646918_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 211
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2662291	2663881	4703889		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187566.1|2662291_2663881_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	1.3e-68
>prophage 212
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2669249	2671013	4703889		Bacillus_phage(50.0%)	3	NA	NA
WP_001044513.1|2669249_2669522_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
WP_000940106.1|2669708_2670299_-	YjaG family protein	NA	NA	NA	NA	NA
WP_000362388.1|2670341_2671013_-	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
>prophage 213
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2680229	2688558	4703889		Vibrio_phage(50.0%)	2	NA	NA
WP_000653944.1|2680229_2684453_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	2.5e-66
WP_000263098.1|2684529_2688558_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
>prophage 214
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2692674	2695727	4703889		Tupanvirus(50.0%)	2	NA	NA
WP_000031784.1|2692674_2693859_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000023081.1|2694776_2695727_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
>prophage 215
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2704022	2705867	4703889		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000591355.1|2704022_2705867_-	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.0	7.1e-10
>prophage 216
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2712617	2713832	4703889		Oenococcus_phage(100.0%)	1	NA	NA
WP_000690934.1|2712617_2713832_-	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	28.6	5.9e-45
>prophage 217
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2725950	2733197	4703889		Serratia_phage(33.33%)	5	NA	NA
WP_000184824.1|2725950_2728248_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
WP_000161265.1|2728298_2728619_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_001004454.1|2728633_2729713_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001174093.1|2730021_2732523_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_000424845.1|2732534_2733197_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
>prophage 218
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2746189	2750374	4703889		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_163388275.1|2746189_2750374_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.5	3.6e-25
>prophage 219
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2756011	2760515	4703889		Erwinia_phage(50.0%)	5	NA	NA
WP_001293343.1|2756011_2757343_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000139496.1|2757409_2758336_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872908.1|2758428_2758914_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001296623.1|2758998_2759244_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084268.1|2759669_2760515_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
>prophage 220
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2773367	2778228	4703889		Feldmannia_irregularis_virus(33.33%)	5	NA	NA
WP_001033722.1|2773367_2774066_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|2774062_2775436_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001270263.1|2775541_2776216_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_001166063.1|2776364_2777348_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001297064.1|2777607_2778228_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
>prophage 221
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2793003	2796054	4703889		Escherichia_phage(100.0%)	1	NA	NA
WP_011310337.1|2793003_2796054_+	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
>prophage 222
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2808797	2813528	4703889		Prochlorococcus_phage(33.33%)	5	NA	NA
WP_000357967.1|2808797_2809808_-	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A0K0KVL7	Prochlorococcus_phage	22.2	1.3e-05
WP_000094544.1|2809840_2810728_-	aldolase	NA	NA	NA	NA	NA
WP_001299483.1|2810752_2811631_-	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	73.6	2.7e-47
WP_000160872.1|2811803_2812700_+	sugar kinase	NA	NA	NA	NA	NA
WP_000022286.1|2812739_2813528_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	1.3e-21
>prophage 223
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2820699	2823170	4703889		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_000190577.1|2820699_2821749_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
WP_001188777.1|2821760_2823170_+	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
>prophage 224
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2827248	2830035	4703889		uncultured_virus(100.0%)	1	NA	NA
WP_000250006.1|2827248_2830035_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	1.7e-71
>prophage 225
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2843724	2844339	4703889		Streptococcus_phage(100.0%)	1	NA	NA
WP_001296979.1|2843724_2844339_-	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	1.6e-19
>prophage 226
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2853129	2856416	4703889		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000109943.1|2853129_2853906_-	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
WP_000459594.1|2853908_2854424_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_001295260.1|2854427_2854697_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000187530.1|2854775_2856416_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	8.2e-42
>prophage 227
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2868833	2870663	4703889		Catovirus(100.0%)	1	NA	NA
WP_001346040.1|2868833_2870663_-	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	9.7e-84
>prophage 228
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2878149	2882008	4703889		Bacillus_phage(100.0%)	3	NA	NA
WP_000383406.1|2878149_2880312_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
WP_001213584.1|2880395_2881112_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000130691.1|2881111_2882008_-	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
>prophage 229
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2885014	2887833	4703889		Salmonella_phage(100.0%)	2	NA	NA
WP_001352855.1|2885014_2886523_+	hypothetical protein	NA	A0A0U2C3T4	Salmonella_phage	54.7	1.8e-43
WP_094318541.1|2886519_2887833_+	DKNYY family protein	NA	A0A0U2C3T4	Salmonella_phage	34.1	5.2e-07
>prophage 230
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2904124	2910268	4703889		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000612036.1|2904124_2905255_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.6e-18
WP_001145196.1|2905259_2905934_-	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000676056.1|2905911_2906793_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
WP_001226604.1|2906811_2907879_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.7	3.5e-102
WP_000006625.1|2907878_2909141_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.0e-23
WP_000866670.1|2909137_2910268_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	32.8	3.0e-27
>prophage 231
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2914310	2919722	4703889		Indivirus(33.33%)	4	NA	NA
WP_001280776.1|2914310_2914640_-	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
WP_000047499.1|2914770_2916036_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
WP_001295254.1|2916169_2917654_+	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_163388280.1|2917700_2919722_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	2.9e-113
>prophage 232
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2928195	2929842	4703889		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001012602.1|2928195_2929842_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.6	1.4e-65
>prophage 233
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2943234	2949087	4703889		Enterobacteria_phage(33.33%)	5	NA	NA
WP_097449420.1|2943234_2944125_-	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	5.7e-05
WP_000211858.1|2944149_2945115_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_000387753.1|2945119_2946625_-	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	4.6e-15
WP_000715936.1|2946632_2947052_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000102319.1|2947218_2949087_-	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	6.0e-65
>prophage 234
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2952255	2953248	4703889		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845141.1|2952255_2953248_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	2.2e-50
>prophage 235
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2965200	2968562	4703889		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_000933736.1|2965200_2966571_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	3.1e-34
WP_000334099.1|2966732_2968562_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.4	1.9e-132
>prophage 236
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2974093	2977934	4703889		Cyanophage(50.0%)	4	NA	NA
WP_000867146.1|2974093_2975134_+	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
WP_000741620.1|2975220_2976180_+	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_001251991.1|2976179_2977070_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000063125.1|2977160_2977934_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
>prophage 237
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	2988924	2990262	4703889		Moraxella_phage(100.0%)	1	NA	NA
WP_001299598.1|2988924_2990262_+	adenine permease AdeP	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
>prophage 238
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	3000460	3007829	4703889		Staphylococcus_phage(33.33%)	8	NA	NA
WP_001307474.1|3000460_3000718_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
WP_000239730.1|3000681_3001041_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_000831330.1|3001057_3001198_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_120795392.1|3001427_3001508_-	protein YsdD	NA	NA	NA	NA	NA
WP_000059111.1|3001804_3003208_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_000673464.1|3003212_3004313_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000060118.1|3004312_3005386_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000072067.1|3005414_3007829_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
>prophage 239
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	3012535	3013684	4703889		Oenococcus_phage(100.0%)	1	NA	NA
WP_000705001.1|3012535_3013684_+	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	3.6e-52
>prophage 240
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	3018111	3019065	4703889		Cyanophage(50.0%)	2	NA	NA
WP_001243437.1|3018111_3018525_+	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
WP_001243431.1|3018636_3019065_+	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
>prophage 241
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	3025418	3034579	4703889		Aeromonas_phage(25.0%)	10	NA	NA
WP_001087147.1|3025418_3027134_+	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.6	5.6e-41
WP_000828483.1|3027130_3028624_+	sulfatase-like hydrolase/transferase	NA	A0A2K9L1A5	Tupanvirus	25.4	1.1e-29
WP_000511287.1|3028670_3029120_-	membrane protein	NA	NA	NA	NA	NA
WP_000703959.1|3029229_3029577_+	YidH family protein	NA	NA	NA	NA	NA
WP_001113432.1|3029566_3029929_+	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000148063.1|3029925_3030423_+	radical SAM protein	NA	NA	NA	NA	NA
WP_000828746.1|3030430_3031615_-	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	8.9e-14
WP_000060506.1|3032033_3032123_-	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_001315912.1|3032686_3032785_+	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_000168432.1|3032890_3034579_+	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.7	5.4e-57
>prophage 242
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	3041883	3043218	4703889		Moraxella_phage(100.0%)	1	NA	NA
WP_001349999.1|3041883_3043218_+	adenine permease AdeQ	NA	A0A0R6PHV4	Moraxella_phage	37.2	6.6e-66
>prophage 243
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	3049862	3060208	4703889	integrase	Enterobacteria_phage(100.0%)	12	3049355:3049377	3060369:3060391
3049355:3049377	attL	TTTGGCGGAAGATCACAGGAGTC	NA	NA	NA	NA
WP_097512283.1|3049862_3052196_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.6	0.0e+00
WP_000856729.1|3052210_3052531_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000459294.1|3052666_3053122_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
WP_001244664.1|3053114_3053402_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	98.9	5.1e-48
WP_044686936.1|3053394_3053949_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	79.3	8.9e-41
WP_001356944.1|3053945_3054212_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	98.9	1.4e-44
WP_001356946.1|3054764_3055499_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.8	1.8e-129
WP_163388283.1|3055495_3055996_+	transactivation protein	NA	NA	NA	NA	NA
WP_000446131.1|3056069_3056642_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.8	6.5e-95
WP_063815093.1|3057003_3058116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097512284.1|3058119_3059028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001218986.1|3059032_3060208_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	93.0	1.3e-211
3060369:3060391	attR	TTTGGCGGAAGATCACAGGAGTC	NA	NA	NA	NA
>prophage 244
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	3066350	3067742	4703889		environmental_Halophage(100.0%)	1	NA	NA
WP_001295238.1|3066350_3067742_-	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 245
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	3072863	3079614	4703889		Bordetella_phage(25.0%)	6	NA	NA
WP_000280488.1|3072863_3074972_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
WP_000135058.1|3074990_3075266_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_001295237.1|3075320_3075944_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_000870052.1|3076201_3077884_+	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.3	2.5e-22
WP_000924289.1|3077880_3078498_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_001297374.1|3078789_3079614_-	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	77.0	6.3e-91
>prophage 246
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	3082987	3087550	4703889		Xanthomonas_phage(25.0%)	7	NA	NA
WP_000976070.1|3082987_3083446_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	9.6e-49
WP_000050117.1|3083423_3084644_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	5.0e-44
WP_001298959.1|3084815_3085484_+	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_000091955.1|3085700_3085937_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001051798.1|3085957_3086125_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_001114546.1|3086222_3087032_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.5	1.5e-25
WP_001171866.1|3087070_3087550_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.0	4.8e-27
>prophage 247
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	3099481	3110209	4703889		Synechococcus_phage(16.67%)	10	NA	NA
WP_000587763.1|3099481_3100414_-	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	1.1e-35
WP_000842826.1|3100717_3101575_+	protein YibB	NA	NA	NA	NA	NA
WP_001213834.1|3101849_3103046_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	4.9e-36
WP_000646014.1|3103055_3104081_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_000982091.1|3104319_3105354_+	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	5.8e-09
WP_000483856.1|3105340_3106300_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_163388284.1|3106303_3107587_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_001352773.1|3107596_3109141_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001315904.1|3109385_3109817_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000024392.1|3109957_3110209_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
>prophage 248
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	3132339	3143030	4703889	tRNA	uncultured_Caudovirales_phage(66.67%)	7	NA	NA
WP_001346013.1|3132339_3133173_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	47.0	3.3e-23
WP_000072850.1|3133325_3134168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001271686.1|3134272_3134656_-	protein YhhH	NA	NA	NA	NA	NA
WP_163388285.1|3134627_3138863_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.3	9.6e-26
WP_000779792.1|3139091_3139700_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_000206275.1|3139797_3141189_+|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_000582489.1|3141185_3143030_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.6	1.3e-16
>prophage 249
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	3167215	3168757	4703889		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001146482.1|3167215_3168757_-	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	2.5e-16
>prophage 250
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	3174075	3175071	4703889		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182653.1|3174075_3175071_-	O-acetyltransferase WecH	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.7	9.1e-12
>prophage 251
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	3179295	3179508	4703889		Morganella_phage(100.0%)	1	NA	NA
WP_000014594.1|3179295_3179508_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 252
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	3183162	3185496	4703889		Escherichia_phage(100.0%)	1	NA	NA
WP_000013938.1|3183162_3185496_+	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.4	9.2e-71
>prophage 253
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	3195553	3197538	4703889		Planktothrix_phage(50.0%)	2	NA	NA
WP_001196486.1|3195553_3196537_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	3.9e-15
WP_000107023.1|3196533_3197538_+	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	8.6e-18
>prophage 254
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	3244518	3245166	4703889		Bacillus_virus(100.0%)	1	NA	NA
WP_001296814.1|3244518_3245166_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.5	6.1e-17
>prophage 255
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	3250035	3252170	4703889		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
WP_000065769.1|3250035_3250461_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.5e-51
WP_000922639.1|3250473_3251763_-	arsenite/antimonite:H(+) antiporter ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	4.6e-173
WP_000008957.1|3251816_3252170_-	arsenical resistance operon transcriptional regulator ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	9.7e-25
>prophage 256
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	3255284	3257327	4703889		Indivirus(100.0%)	1	NA	NA
WP_001295214.1|3255284_3257327_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	22.9	3.4e-45
>prophage 257
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	3270741	3276637	4703889		Staphylococcus_phage(50.0%)	5	NA	NA
WP_028132003.1|3270741_3273477_+	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	4.1e-22
WP_163388327.1|3273476_3274601_+	ABC-2 transporter permease	NA	NA	NA	NA	NA
WP_000593555.1|3274944_3275304_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_001190062.1|3275423_3275825_-	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_000173666.1|3275830_3276637_-	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	4.5e-17
>prophage 258
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	3284530	3288662	4703889		Dickeya_phage(50.0%)	4	NA	NA
WP_001100467.1|3284530_3285196_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.6	5.6e-58
WP_000130621.1|3285416_3285662_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_047675648.1|3285763_3287962_-	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.3	5.0e-119
WP_000964718.1|3288035_3288662_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
>prophage 259
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	3291665	3294484	4703889		Staphylococcus_phage(50.0%)	3	NA	NA
WP_000617723.1|3291665_3292334_+	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
WP_001042003.1|3292326_3293385_+	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000130217.1|3293629_3294484_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
>prophage 260
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	3300217	3301700	4703889		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
WP_000082101.1|3300217_3300985_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
WP_000416895.1|3300986_3301700_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	9.1e-14
>prophage 261
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	3305240	3307051	4703889		Planktothrix_phage(50.0%)	2	NA	NA
WP_000907790.1|3305240_3306311_+	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
WP_000073590.1|3306307_3307051_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.0	6.4e-10
>prophage 262
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	3327059	3329507	4703889		Dickeya_phage(100.0%)	1	NA	NA
WP_000993449.1|3327059_3329507_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 263
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	3338736	3339963	4703889		Ralstonia_phage(100.0%)	1	NA	NA
WP_001105504.1|3338736_3339963_+	RNA-splicing ligase RtcB	NA	A0A1L7N133	Ralstonia_phage	60.0	4.0e-134
>prophage 264
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	3344342	3346736	4703889		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_000081909.1|3344342_3346736_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 265
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	3360147	3364658	4703889		Bacillus_phage(66.67%)	5	NA	NA
WP_001157751.1|3360147_3360867_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
WP_163388289.1|3360863_3362216_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
WP_000650976.1|3362246_3362543_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000493758.1|3362601_3362919_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001298201.1|3363035_3364658_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	5.3e-142
>prophage 266
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	3381633	3382470	4703889		Vibrio_phage(100.0%)	1	NA	NA
WP_000742143.1|3381633_3382470_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	4.9e-67
>prophage 267
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	3406697	3416238	4703889		Acinetobacter_phage(25.0%)	9	NA	NA
WP_000601847.1|3406697_3407261_+	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	55.8	1.2e-61
WP_000963785.1|3407346_3408567_+	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_001295162.1|3408633_3410724_-	membrane protein	NA	H9YQA8	environmental_Halophage	100.0	1.7e-76
WP_000242750.1|3410774_3411407_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001148908.1|3411708_3412113_+	OsmC family protein	NA	NA	NA	NA	NA
WP_001275838.1|3412167_3413037_-	phosphoribulokinase	NA	NA	NA	NA	NA
WP_000907085.1|3413090_3413309_-	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_000057405.1|3413302_3414325_-	hydrolase	NA	NA	NA	NA	NA
WP_000634798.1|3414324_3416238_-	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	4.3e-74
>prophage 268
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	3421808	3427382	4703889		uncultured_Caudovirales_phage(33.33%)	7	NA	NA
WP_001209710.1|3421808_3422195_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	38.3	5.6e-18
WP_000820720.1|3422194_3422554_+	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_000903377.1|3422561_3422849_+	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000246815.1|3422974_3423349_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_001138043.1|3423445_3423916_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000124700.1|3424012_3426127_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_000031783.1|3426197_3427382_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 269
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	3447259	3448731	4703889	tRNA	Prochlorococcus_phage(50.0%)	2	NA	NA
WP_000004454.1|3447259_3448207_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
WP_000114984.1|3448221_3448731_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
>prophage 270
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	3459066	3463220	4703889		Bacillus_virus(50.0%)	4	NA	NA
WP_000078332.1|3459066_3459825_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	6.9e-20
WP_001307418.1|3459832_3460936_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000019674.1|3460945_3462127_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000738579.1|3462194_3463220_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	2.4e-71
>prophage 271
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	3469724	3470609	4703889		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001258910.1|3469724_3470609_-	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.2	1.4e-24
>prophage 272
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	3481929	3482973	4703889		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|3481929_3482973_+	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 273
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	3499469	3501994	4703889	protease	uncultured_archaeal_virus(50.0%)	2	NA	NA
WP_000497723.1|3499469_3500537_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
WP_001295271.1|3500626_3501994_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
>prophage 274
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	3505960	3506458	4703889	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_000366129.1|3505960_3506458_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	42.9	3.3e-26
>prophage 275
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	3510162	3514910	4703889		Burkholderia_virus(50.0%)	5	NA	NA
WP_000108459.1|3510162_3511653_+	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.6	4.9e-09
WP_000054239.1|3511700_3512390_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_000209015.1|3512386_3513262_+	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000979882.1|3513258_3513723_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000445144.1|3513782_3514910_-	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	88.5	4.7e-73
>prophage 276
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	3521659	3536454	4703889		Staphylococcus_phage(25.0%)	17	NA	NA
WP_001176896.1|3521659_3522589_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
WP_000809774.1|3522684_3525021_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_001299134.1|3525250_3525904_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000047091.1|3525900_3526629_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_000620405.1|3526625_3527258_-	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000216791.1|3527471_3527744_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000243741.1|3527740_3528595_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000183676.1|3528640_3529132_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_001176599.1|3529249_3529537_-	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000809051.1|3529559_3530993_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_000224099.1|3531040_3531766_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000669785.1|3531772_3532330_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000030537.1|3532298_3532874_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000030016.1|3532870_3533437_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
WP_001295557.1|3533457_3534444_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000922901.1|3534457_3535435_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_000438245.1|3535644_3536454_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
>prophage 277
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	3540522	3542000	4703889		Vibrio_phage(50.0%)	2	NA	NA
WP_000445413.1|3540522_3540801_-	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
WP_001047336.1|3541028_3542000_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
>prophage 278
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	3548628	3551501	4703889	protease	Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_001107467.1|3548628_3550563_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
WP_000764731.1|3550652_3551501_+	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
>prophage 279
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	3554703	3561342	4703889		Dickeya_phage(50.0%)	4	NA	NA
WP_000207684.1|3554703_3556047_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
WP_001300397.1|3556677_3557130_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_001031057.1|3557157_3558645_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000133044.1|3558669_3561342_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	2.5e-24
>prophage 280
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	3566823	3568713	4703889		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001297428.1|3566823_3568713_+	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 281
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	3574540	3582333	4703889		Diadromus_pulchellus_ascovirus(25.0%)	10	NA	NA
WP_001345969.1|3574540_3574843_-	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	1.7e-14
WP_000449451.1|3574893_3575337_+	YhbP family protein	NA	NA	NA	NA	NA
WP_000037608.1|3575316_3575835_-	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	4.4e-10
WP_001315854.1|3575962_3576598_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_000147622.1|3576670_3577711_+	permease	NA	NA	NA	NA	NA
WP_000646043.1|3577824_3578400_-	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_001158034.1|3578409_3579000_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000246852.1|3579019_3579415_-	YraN family protein	NA	NA	NA	NA	NA
WP_000249157.1|3579372_3581409_-	penicillin-binding protein activator LpoA	NA	NA	NA	NA	NA
WP_000809253.1|3581472_3582333_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.3	2.1e-49
>prophage 282
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	3605341	3606487	4703889		Streptococcus_phage(100.0%)	1	NA	NA
WP_001299416.1|3605341_3606487_+	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.3	1.7e-49
>prophage 283
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	3614580	3616875	4703889		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861734.1|3614580_3616875_+	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	7.4e-158
>prophage 284
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	3642891	3643857	4703889		Escherichia_phage(100.0%)	1	NA	NA
WP_001098806.1|3642891_3643857_-	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 285
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	3656278	3672463	4703889	tRNA	Herpes_simplex_virus(16.67%)	12	NA	NA
WP_001082867.1|3656278_3659371_-	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.1	1.3e-157
WP_000212470.1|3659554_3660538_-	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_000450589.1|3660756_3661089_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_000627213.1|3661130_3662621_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	4.8e-33
WP_000094687.1|3662927_3664448_+	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	52.2	1.4e-35
WP_000017987.1|3664601_3665225_-	DNA-binding transcriptional regulator NfeR	NA	NA	NA	NA	NA
WP_001065895.1|3665501_3666266_+	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000228940.1|3666519_3667026_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_000437371.1|3667104_3668946_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000918827.1|3669140_3670886_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
WP_001144069.1|3670996_3671212_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_001264365.1|3671449_3672463_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	4.8e-109
>prophage 286
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	3678846	3680085	4703889	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_000708501.1|3678846_3680085_-|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.6	5.9e-93
>prophage 287
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	3685222	3686656	4703889		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869178.1|3685222_3686656_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 288
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	3696171	3707133	4703889		Staphylococcus_phage(20.0%)	12	NA	NA
WP_001076997.1|3696171_3696825_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
WP_000469266.1|3697085_3697256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295627.1|3697313_3698087_-	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_000188373.1|3698202_3699018_+	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_000442859.1|3699055_3700216_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
WP_000831543.1|3700221_3700893_-	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000735278.1|3701040_3702522_-	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000917117.1|3702726_3703356_+	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
WP_000833393.1|3703356_3703779_+	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000444746.1|3703803_3704631_+	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000105733.1|3704630_3705212_+	esterase YqiA	NA	NA	NA	NA	NA
WP_000195296.1|3705240_3707133_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.1	3.4e-92
>prophage 289
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	3710960	3721783	4703889		Stx_converting_phage(25.0%)	9	NA	NA
WP_000712658.1|3710960_3711353_+	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
WP_000183494.1|3711405_3711888_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001281881.1|3712433_3714692_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	1.4e-84
WP_000965703.1|3714924_3715662_+	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_000059395.1|3715736_3717149_+	cell division protein FtsP	NA	NA	NA	NA	NA
WP_000095187.1|3717259_3719479_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_000848528.1|3719521_3719779_-	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_000691598.1|3719829_3720756_-	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000013149.1|3720955_3721783_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	7.2e-63
>prophage 290
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	3727859	3728744	4703889		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000018758.1|3727859_3728744_-	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 291
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	3750958	3752131	4703889		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000524972.1|3750958_3752131_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	30.7	4.2e-40
>prophage 292
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	3808754	3809909	4703889		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001062128.1|3808754_3809909_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 293
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	3823485	3824163	4703889		Bacillus_virus(100.0%)	1	NA	NA
WP_000956869.1|3823485_3824163_-	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.1	6.4e-09
>prophage 294
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	3842171	3843404	4703889		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|3842171_3843404_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 295
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	3851932	3857306	4703889		Prochlorococcus_phage(50.0%)	3	NA	NA
WP_000195021.1|3851932_3854806_+	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.1	2.8e-263
WP_000951964.1|3855072_3855816_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001336277.1|3855872_3857306_-	6-phospho-beta-glucosidase BglA	NA	A0A0B5JD41	Pandoravirus	26.3	2.0e-31
>prophage 296
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	3862390	3877782	4703889	tRNA	Brevibacillus_phage(14.29%)	14	NA	NA
WP_000806638.1|3862390_3863287_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
WP_000715214.1|3863311_3864022_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000813215.1|3864027_3865761_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.5	3.2e-60
WP_001701073.1|3865851_3866949_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000003068.1|3866959_3868477_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_001192814.1|3868519_3869068_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_120795390.1|3869122_3869194_+	protein YqfH	NA	NA	NA	NA	NA
WP_001010156.1|3869190_3869316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295374.1|3869317_3870766_-	purine permease	NA	Q9KX94	Enterobacteria_phage	26.8	7.3e-26
WP_001355763.1|3871201_3873121_+	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_000838428.1|3873120_3873609_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_000012163.1|3873644_3875012_-	guanine/hypoxanthine transporter GhxQ	NA	A0A0R6PHV4	Moraxella_phage	73.1	2.1e-160
WP_001295158.1|3875047_3876364_-	guanine deaminase	NA	NA	NA	NA	NA
WP_001280215.1|3876381_3877782_-	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
>prophage 297
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	3902061	3902817	4703889		Clostridium_phage(100.0%)	1	NA	NA
WP_001272558.1|3902061_3902817_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 298
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	3925345	3927840	4703889		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_000603508.1|3925345_3926107_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	4.5e-19
WP_000256438.1|3926421_3927840_+	arabinose-proton symporter AraE	NA	O13311	Aichi_virus	26.9	1.8e-24
>prophage 299
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	3937471	3944244	4703889		Moraxella_phage(33.33%)	6	NA	NA
WP_000895624.1|3937471_3938185_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
WP_000082188.1|3938253_3938943_-	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000564489.1|3939627_3940158_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000957914.1|3940170_3942417_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000204658.1|3942567_3943443_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000816237.1|3943449_3944244_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	5.8e-118
>prophage 300
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	3949721	3964887	4703889	tRNA	Klosneuvirus(16.67%)	9	NA	NA
WP_047675402.1|3949721_3952610_+	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.6	3.1e-68
WP_001285985.1|3952602_3956145_+	exodeoxyribonuclease V subunit beta	NA	G3MA40	Bacillus_virus	21.8	1.5e-08
WP_000775946.1|3956144_3957971_+	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.6	7.8e-25
WP_000237948.1|3958032_3959364_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_047675399.1|3959595_3960849_+	N-acetylmuramoyl-L-alanine amidase AmiC	NA	E5DV68	Deep-sea_thermophilic_phage	28.4	9.4e-14
WP_000678646.1|3961207_3962305_+	murein transglycosylase A	NA	NA	NA	NA	NA
WP_000117728.1|3962381_3963188_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	2.2e-16
WP_000184246.1|3963238_3963682_-	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_001543132.1|3963681_3964887_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	37.2	2.3e-73
>prophage 301
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	3973109	3974609	4703889		Bacillus_virus(100.0%)	1	NA	NA
WP_000004946.1|3973109_3974609_+	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.8	3.9e-14
>prophage 302
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	3981326	3982172	4703889		Bacillus_phage(100.0%)	1	NA	NA
WP_001543127.1|3981326_3982172_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	2.5e-10
>prophage 303
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	3986940	3987789	4703889		Vibrio_phage(100.0%)	1	NA	NA
WP_000100430.1|3986940_3987789_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	4.7e-41
>prophage 304
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	3995323	3999438	4703889		Hokovirus(50.0%)	2	NA	NA
WP_000186450.1|3995323_3998080_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
WP_000046785.1|3998136_3999438_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.7	2.0e-38
>prophage 305
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	4003470	4009313	4703889		Only_Syngen_Nebraska_virus(33.33%)	6	NA	NA
WP_163388305.1|4003470_4005108_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.2	2.0e-152
WP_000036723.1|4005195_4006494_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_001543120.1|4006549_4006912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000793004.1|4006947_4007853_-	YgcG family protein	NA	NA	NA	NA	NA
WP_001379137.1|4007866_4008469_-	LemA family protein	NA	NA	NA	NA	NA
WP_001199982.1|4008641_4009313_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.7e-14
>prophage 306
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	4014945	4015731	4703889		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_000021321.1|4014945_4015731_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	6.5e-21
>prophage 307
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	4041655	4043688	4703889		Hokovirus(50.0%)	2	NA	NA
WP_001090383.1|4041655_4043083_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.4	3.7e-30
WP_001173673.1|4043082_4043688_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	4.2e-28
>prophage 308
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	4046800	4050516	4703889		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_001295182.1|4046800_4047562_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|4047555_4048182_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272590.1|4048321_4049461_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|4049523_4050516_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
>prophage 309
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	4055730	4062870	4703889		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|4055730_4056369_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|4056365_4057628_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|4057624_4058533_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001272549.1|4058698_4059496_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	5.9e-70
WP_001141333.1|4059546_4060203_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	2.8e-49
WP_001272898.1|4060308_4062870_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
>prophage 310
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	4081940	4082951	4703889		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001363554.1|4081940_4082951_+	DNA-binding transcriptional regulator AscG	NA	C6ZCU4	Enterobacteria_phage	28.0	2.3e-26
>prophage 311
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	4090524	4091490	4703889		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287420.1|4090524_4091490_-	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	2.3e-36
>prophage 312
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	4096956	4102516	4703889	tRNA	Pseudomonas_phage(25.0%)	5	NA	NA
WP_000132231.1|4096956_4097454_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	4.4e-31
WP_000963143.1|4097533_4098595_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000140506.1|4098837_4099338_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000047176.1|4099465_4102096_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000906486.1|4102330_4102516_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
>prophage 313
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	4115564	4120860	4703889		Bacillus_virus(20.0%)	5	NA	NA
WP_000985494.1|4115564_4116767_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
WP_000777969.1|4117121_4118081_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	3.5e-133
WP_000246536.1|4118090_4120235_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.1	5.4e-195
WP_000080944.1|4120207_4120618_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	2.7e-18
WP_001223227.1|4120614_4120860_-	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
>prophage 314
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	4124795	4128920	4703889		Clostridium_phage(50.0%)	4	NA	NA
WP_000522415.1|4124795_4125245_+	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
WP_000156811.1|4125245_4125908_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_001325764.1|4125928_4127329_-	GABA permease	NA	NA	NA	NA	NA
WP_001087606.1|4127639_4128920_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	2.4e-33
>prophage 315
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	4134474	4141942	4703889	integrase,transposase	Escherichia_phage(66.67%)	6	4125339:4125352	4142252:4142265
4125339:4125352	attL	TACCGCCGCAGTCA	NA	NA	NA	NA
WP_000878196.1|4134474_4135341_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_000577247.1|4135492_4137211_+	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	99.5	5.5e-307
WP_000214996.1|4137212_4138961_+	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	99.7	0.0e+00
WP_000448925.1|4139032_4139449_-	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
WP_163388309.1|4139487_4140717_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	99.8	4.4e-234
WP_000162574.1|4141459_4141942_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
4142252:4142265	attR	TGACTGCGGCGGTA	NA	NA	NA	NA
>prophage 316
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	4155576	4156647	4703889		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001168044.1|4155576_4156647_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
>prophage 317
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	4162553	4165127	4703889		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001235102.1|4162553_4165127_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
>prophage 318
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	4170905	4172204	4703889		Burkholderia_virus(100.0%)	1	NA	NA
WP_000841103.1|4170905_4172204_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
>prophage 319
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	4177497	4183756	4703889	tRNA	Achromobacter_phage(25.0%)	7	NA	NA
WP_001098726.1|4177497_4177917_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997403.1|4178123_4179161_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001262727.1|4179208_4179898_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.4	4.6e-55
WP_000627807.1|4180202_4180586_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_000189207.1|4180641_4181229_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000365855.1|4181331_4182213_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219193.1|4182421_4183756_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
>prophage 320
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	4189527	4193270	4703889		Tupanvirus(50.0%)	3	NA	NA
WP_000790168.1|4189527_4191327_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
WP_000002542.1|4191342_4192317_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068343.1|4192589_4193270_+	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
>prophage 321
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	4196728	4196989	4703889		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196283.1|4196728_4196989_-	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.1e-17
>prophage 322
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	4201109	4212417	4703889		Bacillus_phage(50.0%)	7	NA	NA
WP_000970110.1|4201109_4204997_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.4	2.6e-131
WP_001298980.1|4205572_4207000_+	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	2.3e-16
WP_001215872.1|4207163_4207877_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001298983.1|4207866_4209201_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_000717694.1|4209261_4209600_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000883124.1|4209644_4210835_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000919159.1|4211163_4212417_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
>prophage 323
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	4218175	4219687	4703889		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000493481.1|4218175_4219687_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.0	3.1e-11
>prophage 324
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	4234851	4241308	4703889		Faustovirus(20.0%)	8	NA	NA
WP_001295373.1|4234851_4236066_+	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
WP_000331707.1|4236093_4236480_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_000028953.1|4236496_4236820_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000384411.1|4236915_4237431_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_001196597.1|4237447_4239298_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	7.2e-103
WP_001124469.1|4239299_4239635_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_000523616.1|4239646_4239847_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_000133586.1|4240024_4241308_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	2.2e-34
>prophage 325
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	4251193	4251625	4703889		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963837.1|4251193_4251625_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
>prophage 326
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	4260454	4266939	4703889		Escherichia_phage(66.67%)	7	NA	NA
WP_000937933.1|4260454_4261825_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	4.0e-42
WP_001299507.1|4261986_4263453_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_000138282.1|4263521_4265099_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_000755173.1|4265193_4265733_-	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	100.0	3.4e-45
WP_001317257.1|4265748_4266267_-	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	8.5e-62
WP_000076001.1|4266577_4266769_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_000017552.1|4266786_4266939_+	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
>prophage 327
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	4273185	4277187	4703889		Prochlorococcus_phage(33.33%)	4	NA	NA
WP_001028614.1|4273185_4273824_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
WP_001295474.1|4273823_4274861_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.1e-71
WP_001295473.1|4275185_4275812_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000198328.1|4275897_4277187_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
>prophage 328
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	4298478	4299192	4703889		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|4298478_4299192_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 329
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	4317239	4318190	4703889		Cyanophage(100.0%)	1	NA	NA
WP_001003709.1|4317239_4318190_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 330
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	4336744	4341680	4703889		Deep-sea_thermophilic_phage(33.33%)	6	NA	NA
WP_000102891.1|4336744_4337614_-	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	4.2e-13
WP_000406000.1|4337827_4338253_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_001300381.1|4338239_4338689_+	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000838945.1|4338749_4339325_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_000084590.1|4339420_4340320_+	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_001390282.1|4340375_4341680_-	penicillin binding protein PBP4B	NA	A0A0B5A438	Mycobacterium_phage	26.2	1.6e-08
>prophage 331
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	4345158	4360515	4703889		Streptococcus_phage(33.33%)	15	NA	NA
WP_000517431.1|4345158_4345950_+	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	8.9e-18
WP_000290230.1|4346107_4347124_+	thiosulfate/sulfate ABC transporter substrate-binding protein CysP	NA	NA	NA	NA	NA
WP_000458406.1|4347123_4347957_+	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_000852686.1|4347956_4348832_+	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_000021040.1|4348821_4349919_+	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
WP_001297645.1|4350052_4350964_+	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.9	3.5e-58
WP_000719943.1|4350966_4351335_-	YfeK family protein	NA	NA	NA	NA	NA
WP_000096660.1|4351439_4352291_+	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000522247.1|4352332_4352842_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000623136.1|4352882_4354610_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
WP_000487600.1|4354654_4354912_-	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_062880765.1|4355295_4356267_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	50.6	8.2e-74
WP_000254843.1|4356451_4357213_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_001297862.1|4357442_4358429_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000443665.1|4358499_4360515_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.4	6.5e-150
>prophage 332
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	4382215	4382950	4703889		Clostridioides_phage(100.0%)	1	NA	NA
WP_001295458.1|4382215_4382950_-	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
>prophage 333
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	4386768	4387689	4703889		Morganella_phage(100.0%)	1	NA	NA
WP_000484404.1|4386768_4387689_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	4.9e-76
>prophage 334
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	4391380	4398957	4703889		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_001283499.1|4391380_4393075_+	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.0e-23
WP_000955028.1|4393144_4394089_+	transporter YfdV	NA	NA	NA	NA	NA
WP_163388313.1|4394162_4395308_+	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_001349926.1|4395363_4398957_-	acid-sensing system histidine kinase EvgS	NA	A0A1V0SGX0	Hokovirus	32.1	1.7e-36
>prophage 335
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	4405597	4407031	4703889		Bacillus_phage(100.0%)	1	NA	NA
WP_000194515.1|4405597_4407031_-	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
>prophage 336
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	4410070	4411003	4703889		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000368131.1|4410070_4411003_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
>prophage 337
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	4428874	4429960	4703889		Pandoravirus(100.0%)	1	NA	NA
WP_000918470.1|4428874_4429960_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
>prophage 338
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	4438515	4439652	4703889		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000699121.1|4438515_4439652_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	5.9e-23
>prophage 339
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	4446128	4447646	4703889		Mollivirus(100.0%)	1	NA	NA
WP_000334220.1|4446128_4447646_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.9e-87
>prophage 340
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	4451857	4453730	4703889		Acanthocystis_turfacea_Chlorella_virus(50.0%)	2	NA	NA
WP_001293612.1|4451857_4452631_+	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
WP_000156113.1|4452827_4453730_+	recombination-promoting nuclease RpnB	NA	Q2A0A7	Sodalis_phage	44.5	8.2e-68
>prophage 341
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	4464289	4467517	4703889		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
WP_001203389.1|4464289_4464940_+	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	34.3	5.2e-08
WP_001012899.1|4465026_4466859_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_000813860.1|4466917_4467517_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
>prophage 342
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	4501933	4506937	4703889		Tupanvirus(50.0%)	4	NA	NA
WP_000860259.1|4501933_4503916_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	1.8e-19
WP_000461661.1|4503915_4504884_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.2	2.0e-35
WP_001307305.1|4504887_4506027_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	29.8	1.1e-29
WP_001297077.1|4506334_4506937_+	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	3.4e-09
>prophage 343
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	4510089	4510992	4703889	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000140553.1|4510089_4510992_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.4	9.6e-69
>prophage 344
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	4516885	4522945	4703889		Pseudomonas_phage(50.0%)	5	NA	NA
WP_000779084.1|4516885_4517962_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
WP_000301050.1|4518424_4519075_+	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
WP_000135040.1|4519128_4519383_-	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000332036.1|4519382_4520513_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	2.5e-175
WP_163388317.1|4520659_4522945_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.9e-283
>prophage 345
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	4528395	4531023	4703889		Bacillus_virus(100.0%)	1	NA	NA
WP_001281242.1|4528395_4531023_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
>prophage 346
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	4540723	4543573	4703889		Hokovirus(100.0%)	1	NA	NA
WP_047675329.1|4540723_4543573_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
>prophage 347
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	4547850	4553649	4703889		Enterobacteria_phage(25.0%)	5	NA	NA
WP_000865609.1|4547850_4548975_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.8	2.4e-117
WP_000406098.1|4549086_4550142_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000710368.1|4550215_4551280_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
WP_001543036.1|4551279_4551930_+	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_000422166.1|4552005_4553649_+	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	9.5e-14
>prophage 348
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	4562416	4563034	4703889		Bacillus_virus(100.0%)	1	NA	NA
WP_000888560.1|4562416_4563034_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
>prophage 349
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	4574733	4582382	4703889		Vibrio_phage(50.0%)	7	NA	NA
WP_000050787.1|4574733_4575741_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.6	6.9e-84
WP_000494183.1|4575879_4576164_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000578088.1|4576288_4578049_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	7.1e-100
WP_001234850.1|4578197_4578893_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000213360.1|4578920_4580111_+	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	2.2e-20
WP_000202798.1|4580444_4580789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194938.1|4580792_4582382_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	33.6	3.2e-19
>prophage 350
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	4588136	4592437	4703889		Clostridioides_phage(50.0%)	4	NA	NA
WP_000241011.1|4588136_4588703_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
WP_001296828.1|4589114_4589828_-	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000198822.1|4589866_4590853_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_000848214.1|4590970_4592437_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.3	8.7e-43
>prophage 351
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	4606932	4607790	4703889		Catovirus(100.0%)	1	NA	NA
WP_000873890.1|4606932_4607790_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	34.0	1.4e-24
>prophage 352
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	4611859	4615645	4703889		Acinetobacter_phage(50.0%)	3	NA	NA
WP_000489247.1|4611859_4613851_+	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	2.0e-13
WP_000425438.1|4613882_4614719_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001139613.1|4614976_4615645_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
>prophage 353
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	4619339	4620860	4703889		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000255039.1|4619339_4620860_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 354
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	4641174	4650616	4703889		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569325.1|4641174_4642101_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
WP_000783120.1|4642105_4642837_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216961.1|4642817_4642925_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|4642984_4643716_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|4643937_4645623_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|4645619_4646339_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|4646385_4646856_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|4646896_4647358_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001326004.1|4647482_4649483_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.8	0.0e+00
WP_001292774.1|4649479_4650616_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
>prophage 355
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	4662518	4664552	4703889	tRNA	Indivirus(100.0%)	1	NA	NA
WP_001439138.1|4662518_4664552_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	3.0e-54
>prophage 356
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	4678011	4678587	4703889		Aeromonas_phage(100.0%)	1	NA	NA
WP_001625472.1|4678011_4678587_-	recombinase family protein	NA	A0A219YB42	Aeromonas_phage	41.7	1.5e-22
>prophage 357
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	4685644	4689201	4703889		Paenibacillus_phage(50.0%)	4	NA	NA
WP_001297420.1|4685644_4686463_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	2.3e-24
WP_000434038.1|4686514_4687261_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011957.1|4687234_4688200_-	sugar kinase	NA	NA	NA	NA	NA
WP_000846217.1|4688196_4689201_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
>prophage 358
NZ_CP048604	Escherichia coli strain PapRG-06-3 chromosome, complete genome	4703889	4698421	4703628	4703889	integrase	Salmonella_phage(37.5%)	9	4699664:4699676	4702412:4702424
WP_000807362.1|4698421_4699321_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
4699664:4699676	attL	ATTATAATAATCA	NA	NA	NA	NA
WP_000716757.1|4699735_4700053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001512914.1|4700317_4701331_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.4	3.7e-194
WP_001306384.1|4701446_4701746_-	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	100.0	2.5e-50
WP_000043869.1|4701860_4702136_+	hypothetical protein	NA	Q1JS62	Enterobacteria_phage	100.0	1.3e-48
WP_000217670.1|4702313_4702814_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
4702412:4702424	attR	TGATTATTATAAT	NA	NA	NA	NA
WP_000557698.1|4702877_4703102_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	97.3	5.2e-32
WP_059256928.1|4703101_4703401_+	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	98.0	6.0e-44
WP_001113264.1|4703403_4703628_+	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
