The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040863	Rodentibacter heylii strain G1 chromosome, complete genome	2607636	15745	24506	2607636		Erysipelothrix_phage(16.67%)	7	NA	NA
WP_059365419.1|15745_17170_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.5	1.7e-43
WP_059365418.1|17338_17890_+	endopeptidase	NA	S5MM68	Bacillus_phage	37.2	1.7e-12
WP_077582336.1|18077_18620_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	43.2	1.9e-24
WP_164027400.1|18632_20711_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	34.7	7.0e-46
WP_059365415.1|20908_22429_+	catalase	NA	A0A2K9L0T1	Tupanvirus	47.7	1.8e-99
WP_164027401.1|22541_23195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059365413.1|23252_24506_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	45.0	5.2e-89
>prophage 2
NZ_CP040863	Rodentibacter heylii strain G1 chromosome, complete genome	2607636	214435	236759	2607636	capsid,terminase,integrase,tRNA	Escherichia_phage(25.0%)	24	209866:209884	243984:244002
209866:209884	attL	TTTGACCGCACTTTTTTAA	NA	NA	NA	NA
WP_135969225.1|214435_215230_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_059365265.1|215315_216221_+	acetyl-CoA carboxylase, carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_059365264.1|216222_217527_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_164027480.1|218042_220562_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_135969227.1|221128_221626_+	ci repressor-like protein	NA	NA	NA	NA	NA
WP_135969256.1|221973_222732_-	Fic family protein	NA	D7RWK9	Brochothrix_phage	27.0	2.1e-08
WP_164027481.1|222838_224089_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B5FPC6	Escherichia_phage	39.7	6.2e-82
WP_164027482.1|224947_226315_-	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	34.1	1.8e-63
WP_164027483.1|226357_226660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164027484.1|226669_227674_-|integrase	tyrosine-type recombinase/integrase	integrase	Q19US1	Mannheimia_phage	55.9	5.1e-95
WP_164027485.1|227683_227881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164027486.1|227877_228192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164027487.1|228181_228406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164027488.1|228468_228780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164027489.1|228772_229333_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_136126130.1|229478_229781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164027490.1|229773_229962_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_164027491.1|230153_231338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164027492.1|231450_232095_-|terminase	terminase	terminase	Q19US0	Mannheimia_phage	44.1	6.5e-43
WP_164027493.1|232097_233120_-|capsid	phage major capsid protein, P2 family	capsid	A0A077KEQ8	Ralstonia_phage	58.0	4.2e-105
WP_164027494.1|233112_233850_-|capsid	GPO family capsid scaffolding protein	capsid	A4PE29	Ralstonia_virus	62.5	5.0e-47
WP_164027495.1|233914_234583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164027496.1|234572_234785_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_164027497.1|235565_236759_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	32.3	3.9e-49
243984:244002	attR	TTTGACCGCACTTTTTTAA	NA	NA	NA	NA
>prophage 3
NZ_CP040863	Rodentibacter heylii strain G1 chromosome, complete genome	2607636	310775	320380	2607636	integrase	Mannheimia_phage(55.56%)	16	300251:300267	312680:312696
300251:300267	attL	AAAACCGACCGCACTTT	NA	NA	NA	NA
WP_059366175.1|310775_311867_-|integrase	site-specific integrase	integrase	K4PAZ9	Burkholderia_phage	35.6	2.4e-53
WP_059366176.1|312260_312449_-	DUF551 domain-containing protein	NA	A0A0M3LS47	Mannheimia_phage	45.2	8.2e-07
WP_164027538.1|312705_313347_-	hypothetical protein	NA	D0UIM5	Aggregatibacter_phage	42.3	8.4e-35
312680:312696	attR	AAAGTGCGGTCGGTTTT	NA	NA	NA	NA
WP_164027539.1|313840_314044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164027540.1|314062_314245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164027541.1|314246_314441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059366179.1|314619_314856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_018356020.1|314867_315050_+	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
WP_059366180.1|315110_315428_-	hypothetical protein	NA	Q6J1P1	Burkholderia_virus	44.7	2.7e-10
WP_164027542.1|315451_315910_-	hypothetical protein	NA	A0A0M3LPL3	Mannheimia_phage	58.8	1.8e-39
WP_164028793.1|315967_316618_-	translocation protein TolB precursor	NA	A0A0M3LP90	Mannheimia_phage	75.1	7.1e-90
WP_164027543.1|316817_317450_-	hypothetical protein	NA	D0UIM5	Aggregatibacter_phage	36.2	3.6e-30
WP_164027392.1|317702_318200_-	hypothetical protein	NA	A0A0M3LR66	Mannheimia_phage	68.9	1.4e-08
WP_059366185.1|318356_318767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059367746.1|318766_319324_-	SocA family protein	NA	NA	NA	NA	NA
WP_136125908.1|319399_320380_-	recombinase	NA	A0A0M3LNU3	Mannheimia_phage	71.9	2.8e-114
>prophage 4
NZ_CP040863	Rodentibacter heylii strain G1 chromosome, complete genome	2607636	325917	396252	2607636	tRNA,tail,capsid,plate,lysis,terminase	Mannheimia_phage(26.32%)	82	NA	NA
WP_164027550.1|325917_326511_+	sce7726 family protein	NA	A0A0U2RXY7	Escherichia_phage	43.2	1.8e-39
WP_164027551.1|326467_327502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059366202.1|327593_328253_-	helix-turn-helix domain-containing protein	NA	A0A0M3LSL8	Mannheimia_phage	61.8	1.1e-69
WP_059366203.1|328384_328591_+	helix-turn-helix transcriptional regulator	NA	A0A0M3LSY2	Mannheimia_phage	69.1	1.2e-19
WP_164027552.1|328639_329083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157888085.1|329128_329296_+	hypothetical protein	NA	A0A0M3LPV5	Mannheimia_phage	51.1	6.8e-05
WP_164028795.1|329288_330155_+	replication protein	NA	A0A0M3LQL8	Mannheimia_phage	55.7	1.4e-77
WP_164027553.1|330154_331615_+	AAA family ATPase	NA	Q7Y5V9	Haemophilus_phage	68.1	4.2e-191
WP_164027554.1|331614_331830_+	hypothetical protein	NA	A0A0M3LR43	Mannheimia_phage	70.6	2.6e-25
WP_164028796.1|331837_332275_+	DUF1367 family protein	NA	A0A0M3LR84	Mannheimia_phage	73.8	1.5e-59
WP_164027555.1|332285_332861_+	recombination protein NinG	NA	Q7Y5V6	Haemophilus_phage	80.1	4.0e-84
WP_164027556.1|332844_333489_+	HNH endonuclease	NA	A0A2H4JH74	uncultured_Caudovirales_phage	43.2	1.5e-39
WP_164028797.1|333566_333932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136126486.1|334051_335206_+	type I restriction endonuclease subunit R	NA	A0A1S5SAB0	Streptococcus_phage	32.8	3.0e-38
WP_164028798.1|335875_336358_+	hypothetical protein	NA	D0UIK6	Aggregatibacter_phage	58.5	5.5e-39
WP_164027557.1|336467_336626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164027558.1|336858_337218_+	hypothetical protein	NA	E7C9U7	Salmonella_phage	41.9	1.2e-22
WP_164027559.1|337240_337429_-	hypothetical protein	NA	B8K1I9	Salmonella_phage	73.2	9.4e-19
WP_164027560.1|337764_338154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164027561.1|338258_338507_+	hypothetical protein	NA	A0A0M3LR95	Mannheimia_phage	57.0	2.0e-16
WP_164027562.1|338499_339048_+	glycoside hydrolase family protein	NA	A0A0M3LQY4	Mannheimia_phage	54.3	3.6e-50
WP_164027563.1|339020_339359_+	DUF2570 family protein	NA	NA	NA	NA	NA
WP_167514390.1|339261_339546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164027565.1|339564_340095_+|terminase	terminase small subunit	terminase	A0A0M3LSU1	Mannheimia_phage	65.5	2.0e-53
WP_164027566.1|340075_341296_+|terminase	PBSX family phage terminase large subunit	terminase	A0A0M3LTA2	Mannheimia_phage	75.2	1.8e-179
WP_164027567.1|341301_342816_+	DUF1073 domain-containing protein	NA	I7B6L5	Escherichia_phage	49.3	1.2e-116
WP_164027568.1|342808_343636_+|capsid	minor capsid protein	capsid	NA	NA	NA	NA
WP_164027569.1|344404_345658_+	DUF2213 domain-containing protein	NA	Q6IWU4	Burkholderia_phage	45.4	3.3e-43
WP_164027570.1|345670_346177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164027571.1|346193_347318_+	DUF2184 domain-containing protein	NA	A0A2H4P6S2	Pseudomonas_phage	47.0	1.2e-87
WP_164027572.1|347399_347780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164027573.1|347779_348199_+	DUF4054 domain-containing protein	NA	I7ATP1	Escherichia_phage	44.6	6.7e-25
WP_164027574.1|348700_349081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164027575.1|349065_349566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164027576.1|349573_351052_+	DUF3383 family protein	NA	A0A1V0DZ75	Acinetobacter_phage	40.9	1.1e-98
WP_164027577.1|351088_351532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164027578.1|351679_352198_+	hypothetical protein	NA	A0A0M4REH5	Salmonella_phage	48.1	1.1e-32
WP_164027579.1|352271_352676_+	hypothetical protein	NA	A0A068CGG2	Acinetobacter_phage	38.8	5.5e-16
WP_164027580.1|352870_353098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164027581.1|353030_355283_+	glycoside hydrolase family 19 protein	NA	A0A190XCB3	Acinetobacter_phage	39.2	8.5e-74
WP_164027582.1|355303_355936_+	SHOCT domain-containing protein	NA	NA	NA	NA	NA
WP_164027583.1|356154_356367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164027584.1|356350_356863_+	DUF2335 domain-containing protein	NA	NA	NA	NA	NA
WP_164027585.1|356957_357575_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_164027586.1|357696_357855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164027587.1|357930_358836_+	phage repressor protein/antirepressor Ant	NA	D0UIK6	Aggregatibacter_phage	45.3	1.7e-52
WP_164027588.1|358967_359486_+	hypothetical protein	NA	A0A1B1P9D9	Acinetobacter_phage	39.1	1.5e-26
WP_164027589.1|360194_360491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164027590.1|360493_361387_+	hypothetical protein	NA	E2GM20	Acinetobacter_phage	37.7	1.7e-49
WP_164027591.1|361386_362046_+|plate	phage baseplate protein	plate	H9C0X6	Aeromonas_phage	42.6	2.9e-38
WP_164027592.1|362109_362817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164027593.1|362813_363164_+	hypothetical protein	NA	A0A2R3UAP1	Myoviridae_environmental_samples	39.5	2.2e-13
WP_164027594.1|363160_364348_+	hypothetical protein	NA	K4I3B4	Acinetobacter_phage	33.9	3.1e-51
WP_164027595.1|364344_364962_+	DUF2612 domain-containing protein	NA	A0A220NQG4	Acinetobacter_phage	41.1	5.4e-39
WP_164027596.1|365009_366707_+	hypothetical protein	NA	D0UIH3	Aggregatibacter_phage	27.1	5.9e-27
WP_164027597.1|366697_367300_+|tail	phage tail protein	tail	Q7Y5S1	Haemophilus_phage	54.0	5.7e-25
WP_059366240.1|367284_367557_+	hypothetical protein	NA	Q776W9	Haemophilus_phage	74.4	7.7e-30
WP_069029799.1|367549_367897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164027598.1|368312_370586_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_164027599.1|370884_371775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164027600.1|371865_372225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164027601.1|372458_373334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164027602.1|373404_373734_-	TusE/DsrC/DsvC family sulfur relay protein	NA	NA	NA	NA	NA
WP_164027603.1|373735_374668_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	80.9	1.6e-122
WP_059366247.1|374816_376151_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_077494552.1|376220_376979_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_164027604.1|376978_381496_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_135968565.1|381590_382463_+	DMT family transporter	NA	NA	NA	NA	NA
WP_164027605.1|382477_383902_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_135968567.1|384758_385244_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_135968568.1|385261_385762_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_164027606.1|385803_386256_-	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
WP_135968570.1|386260_386506_-	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
WP_135968571.1|386509_386989_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_164027607.1|387028_388042_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_164027608.1|388321_389257_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	27.3	1.5e-24
WP_164027609.1|389303_390755_-|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_059366283.1|390924_391164_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_059366284.1|391165_392056_+	(2E,6E)-farnesyl diphosphate synthase	NA	NA	NA	NA	NA
WP_164027610.1|392123_393977_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_135968575.1|394202_395555_-	deoxyguanosinetriphosphate triphosphohydrolase family protein	NA	NA	NA	NA	NA
WP_135968576.1|395559_396252_-|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
>prophage 5
NZ_CP040863	Rodentibacter heylii strain G1 chromosome, complete genome	2607636	438631	493102	2607636	protease,tRNA,transposase	Enterobacteria_phage(15.38%)	51	NA	NA
WP_059366322.1|438631_439081_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	50.4	7.0e-28
WP_059366323.1|439080_439719_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_059366324.1|439902_440295_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_018355584.1|440311_440740_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_059366325.1|441050_441935_+	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_164027624.1|441975_442467_-	endopeptidase	NA	S5MM68	Bacillus_phage	34.6	5.0e-11
WP_059366327.1|442517_442814_-	integration host factor subunit alpha	NA	Q2A099	Sodalis_phage	40.4	5.1e-11
WP_164027625.1|442818_445206_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_164027626.1|445270_446260_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.9	6.1e-32
WP_164027627.1|446614_447475_-	OmpA family protein	NA	NA	NA	NA	NA
WP_164027628.1|447668_448727_-|protease	protease SohB	protease	NA	NA	NA	NA
WP_059366332.1|448865_450269_+|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	37.5	9.7e-84
WP_059366333.1|450338_451022_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_135968600.1|451192_451459_-	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_164027629.1|451528_452095_-	histone	NA	NA	NA	NA	NA
WP_059366336.1|452340_452826_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_164027630.1|452884_454219_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_164027631.1|454255_455083_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	24.9	9.0e-13
WP_059366339.1|455194_457096_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	A0A0P0BXI2	Ostreococcus_lucimarinus_virus	42.0	1.2e-113
WP_077587352.1|457176_457815_-	23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE	NA	NA	NA	NA	NA
WP_059366341.1|457968_458268_+	ribosome assembly RNA-binding protein YhbY	NA	NA	NA	NA	NA
WP_059366342.1|458312_458789_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_164027632.1|458953_460393_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	NA	NA	NA	NA
WP_164028799.1|460502_461837_-	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_059366345.1|462053_462803_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_164027633.1|462936_463320_-	DUF2255 family protein	NA	NA	NA	NA	NA
WP_164027634.1|463408_464305_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_157888084.1|464768_464936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059366348.1|464963_465899_+	KpsF/GutQ family sugar isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	34.4	1.3e-39
WP_059366349.1|465908_466451_+	HAD family hydrolase	NA	A0A140XBD6	Dickeya_phage	43.0	1.8e-22
WP_164028800.1|466546_466831_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_164027635.1|466944_467652_-	NAD-dependent deacylase	NA	A0A097EY61	Escherichia_phage	30.2	2.5e-16
WP_164027636.1|467828_468857_-	adenosine deaminase	NA	NA	NA	NA	NA
WP_164027637.1|468957_470070_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_164027638.1|470224_472273_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0S905	Catovirus	23.5	7.9e-26
WP_164027639.1|473474_474335_+	SAM-dependent methyltransferase TehB	NA	NA	NA	NA	NA
WP_164027640.1|474409_475237_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_164027641.1|475603_476620_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	32.6	2.3e-34
WP_135968612.1|476793_479433_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_059366361.1|481227_481698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164027642.1|481851_482235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157888087.1|482327_482498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077664009.1|482529_483111_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_059366364.1|483353_483788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059366365.1|483787_484822_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_059366366.1|484928_485264_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_164027643.1|485299_485488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059366367.1|485551_487171_+	site-specific DNA-methyltransferase	NA	Q1MVP0	Enterobacteria_phage	34.8	3.9e-52
WP_135968614.1|487181_489797_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_059366368.1|490780_491905_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_059366369.1|492085_493102_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP040863	Rodentibacter heylii strain G1 chromosome, complete genome	2607636	855529	916262	2607636	tRNA,tail,capsid,terminase,bacteriocin	Mannheimia_phage(47.92%)	75	NA	NA
WP_059365634.1|855529_856264_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_059365635.1|856703_857171_-	peptidoglycan-associated lipoprotein Pal	NA	NA	NA	NA	NA
WP_164027779.1|857192_858476_-	Tol-Pal system protein TolB	NA	NA	NA	NA	NA
WP_164027780.1|858520_859687_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_164027781.1|859702_860122_-	colicin uptake protein TolR	NA	NA	NA	NA	NA
WP_164027782.1|860188_860881_-	protein TolQ	NA	NA	NA	NA	NA
WP_059365640.1|860899_861310_-	tol-pal system-associated acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_059365641.1|861399_861684_-	cyd operon protein YbgE	NA	NA	NA	NA	NA
WP_135969329.1|861794_862931_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_059365643.1|862945_864511_-	cytochrome d terminal oxidase subunit 1	NA	NA	NA	NA	NA
WP_059365644.1|864921_865227_+	DUF5339 domain-containing protein	NA	NA	NA	NA	NA
WP_059365645.1|865292_866300_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.1	2.4e-07
WP_059365646.1|866310_866925_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_059365647.1|866985_867558_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	33.3	2.4e-09
WP_059365648.1|867621_868149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059365649.1|868170_868911_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_059365650.1|868938_869409_-	dihydroneopterin triphosphate diphosphatase	NA	H6X3M3	Enterobacteria_phage	30.5	2.3e-05
WP_059365651.1|869409_869970_-	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	38.3	1.4e-22
WP_135969325.1|869966_870290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164027783.1|870375_872142_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	28.4	4.3e-12
WP_077550882.1|872285_873011_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	S5VMD2	Pseudomonas_phage	29.3	2.7e-21
WP_164027784.1|873078_874410_-	MFS transporter	NA	NA	NA	NA	NA
WP_059365656.1|874681_875089_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_164027785.1|875163_875814_+	ribonuclease T	NA	L0N5X9	Acaryochloris_phage	24.0	6.8e-08
WP_059365658.1|876149_877502_+	Na+/H+ antiporter family protein	NA	NA	NA	NA	NA
WP_164027786.1|877537_878119_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_164027787.1|878439_879057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164027788.1|879182_879530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077582188.1|879569_879863_-	hypothetical protein	NA	A0A0M3LS64	Mannheimia_phage	78.4	7.0e-37
WP_164027789.1|884368_885013_-|tail	tail assembly protein	tail	A0A0M3LQC4	Mannheimia_phage	58.5	4.3e-55
WP_164028807.1|885070_885553_-	hypothetical protein	NA	D0UIK6	Aggregatibacter_phage	57.1	3.0e-37
WP_164027790.1|886258_886684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077582646.1|886838_887024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160193526.1|887166_887328_-	hypothetical protein	NA	A0A0M3LPX2	Mannheimia_phage	64.0	5.2e-10
WP_164027791.1|887573_888311_-|tail	phage tail protein	tail	A0A0M3LQI5	Mannheimia_phage	66.2	1.8e-89
WP_164027792.1|888316_889030_-|tail	phage minor tail protein L	tail	A0A0M3LSQ5	Mannheimia_phage	64.3	1.2e-85
WP_167367158.1|889033_889186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164027793.1|889313_892631_-	tape measure protein	NA	A0A0M3LS69	Mannheimia_phage	55.3	3.8e-78
WP_164027794.1|892646_892976_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	39.8	4.1e-17
WP_164028808.1|893045_893408_-	hypothetical protein	NA	A0A0M3LQT0	Mannheimia_phage	57.3	1.1e-26
WP_164027795.1|893383_893788_-	hypothetical protein	NA	A0A0M3LPJ3	Mannheimia_phage	44.1	1.0e-25
WP_164027796.1|893854_894865_-	hypothetical protein	NA	A0A0M3LQ19	Mannheimia_phage	68.5	3.8e-130
WP_164027797.1|894874_895267_-	hypothetical protein	NA	A0A0M3LQB6	Mannheimia_phage	50.8	3.3e-34
WP_164027798.1|895266_895665_-	HK97 gp10 family phage protein	NA	A0A0M3LPJ5	Mannheimia_phage	56.2	5.8e-34
WP_164027799.1|895664_896048_-	hypothetical protein	NA	A0A0M3LT14	Mannheimia_phage	44.0	4.0e-24
WP_164027800.1|896049_896490_-	hypothetical protein	NA	A0A0M3LSP7	Mannheimia_phage	53.5	6.6e-31
WP_164027801.1|896467_896824_-	hypothetical protein	NA	A0A0M3LS62	Mannheimia_phage	61.7	1.0e-29
WP_164027802.1|896875_897823_-	hypothetical protein	NA	A0A0M3LQL5	Mannheimia_phage	78.4	4.0e-142
WP_164027803.1|897856_898594_-	hypothetical protein	NA	A0A0M3LQV7	Mannheimia_phage	53.7	2.1e-66
WP_164027804.1|898708_899131_-	HD domain-containing protein	NA	D0UIJ3	Aggregatibacter_phage	59.7	2.0e-37
WP_136126539.1|899131_899350_-	hypothetical protein	NA	A0A0M3LPI7	Mannheimia_phage	76.4	5.8e-28
WP_164027805.1|899349_901002_-|capsid	minor capsid protein	capsid	A0A0M3LQ07	Mannheimia_phage	65.6	9.3e-203
WP_164027806.1|900967_902353_-	DUF4055 domain-containing protein	NA	A0A0M3LQA1	Mannheimia_phage	59.6	5.9e-150
WP_164027807.1|902362_903721_-|terminase	PBSX family phage terminase large subunit	terminase	A0A220NQL3	Acinetobacter_phage	55.1	5.6e-129
WP_164027808.1|903713_904217_-|terminase	terminase small subunit	terminase	A0A0M3LSU1	Mannheimia_phage	61.5	1.2e-41
WP_164027809.1|904234_905635_-	site-specific DNA-methyltransferase	NA	Q1MVP0	Enterobacteria_phage	40.2	6.5e-88
WP_164027810.1|905837_906176_-	DUF2570 family protein	NA	Q7Y5U9	Haemophilus_phage	32.6	1.6e-05
WP_164027811.1|906148_906697_-	glycoside hydrolase family protein	NA	A0A0M3LPQ1	Mannheimia_phage	58.5	3.2e-51
WP_164027812.1|906689_906935_-	hypothetical protein	NA	A0A0M3LR95	Mannheimia_phage	60.5	9.4e-19
WP_164027813.1|907040_907601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152634407.1|907654_907924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164027814.1|908287_908587_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	45.3	4.7e-20
WP_077493439.1|908583_908877_+	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	46.6	6.4e-14
WP_164027815.1|908916_909285_-	antitermination protein	NA	Q7Y5V5	Haemophilus_phage	62.6	8.8e-37
WP_164027816.1|909274_909835_-	recombination protein NinG	NA	D0UIK8	Aggregatibacter_phage	67.4	8.6e-68
WP_135968557.1|909921_910104_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	46.7	2.0e-05
WP_135968556.1|910132_910588_+	CopG family transcriptional regulator	NA	A0A0R6PJ17	Moraxella_phage	35.5	2.1e-16
WP_164027817.1|910869_911529_+|bacteriocin	bacteriocin	bacteriocin	A0A0P0ZCS0	Stx2-converting_phage	50.0	4.0e-16
WP_164028809.1|911565_911973_-	recombination protein NinB	NA	Q7Y5V7	Haemophilus_phage	53.0	1.1e-35
WP_164027818.1|911983_912526_-	adenine methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	64.4	1.3e-68
WP_167514392.1|912522_913158_-	replication P	NA	D0UIL4	Aggregatibacter_phage	50.5	2.8e-38
WP_164027819.1|914029_914698_-	hypothetical protein	NA	D0UIL6	Aggregatibacter_phage	54.7	1.3e-57
WP_164027820.1|914748_915192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_136125112.1|915240_915444_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	50.0	1.9e-09
WP_136126898.1|915566_916262_+	LexA family transcriptional regulator	NA	E7C9R0	Salmonella_phage	35.1	8.9e-30
>prophage 7
NZ_CP040863	Rodentibacter heylii strain G1 chromosome, complete genome	2607636	920171	968033	2607636	head,tRNA,portal,tail,capsid,integrase,terminase,protease	uncultured_Caudovirales_phage(30.43%)	55	926792:926813	963384:963405
WP_164027824.1|920171_920786_+	polymer-forming cytoskeletal protein	NA	A0A0M3LPL3	Mannheimia_phage	85.2	5.6e-44
WP_164027548.1|920763_921051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164027547.1|921051_921234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164027825.1|921589_922255_+	hypothetical protein	NA	Q7Y5X0	Haemophilus_phage	56.5	1.9e-58
WP_059366191.1|922374_922590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059366190.1|922558_922747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164028794.1|922939_923236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059366188.1|923222_923432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164027826.1|923453_923750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136125908.1|923762_924743_+	recombinase	NA	A0A0M3LNU3	Mannheimia_phage	71.9	2.8e-114
WP_059367746.1|924818_925376_+	SocA family protein	NA	NA	NA	NA	NA
WP_059366185.1|925375_925786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164027827.1|926138_926786_+	hypothetical protein	NA	Q7Y5X0	Haemophilus_phage	58.4	5.7e-63
926792:926813	attL	AATCAAAACCGACCGCACTTTT	NA	NA	NA	NA
WP_167514393.1|926991_927636_+	translocation protein TolB precursor	NA	A0A0M3LP90	Mannheimia_phage	75.1	5.4e-90
WP_164027828.1|927693_928404_+	polymer-forming cytoskeletal protein	NA	A0A0M3LPL3	Mannheimia_phage	72.2	1.3e-33
WP_164027829.1|928433_928751_+	hypothetical protein	NA	Q6J1P1	Burkholderia_virus	44.7	2.7e-10
WP_164027830.1|929299_929434_+	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_164027831.1|929482_930157_+	hypothetical protein	NA	Q7Y5X4	Haemophilus_phage	28.6	1.7e-09
WP_164027832.1|930969_931176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164027833.1|931397_932489_+|integrase	tyrosine-type recombinase/integrase	integrase	G8C7S0	Escherichia_phage	37.8	4.2e-58
WP_164027834.1|932753_935546_-	ribonuclease E	NA	NA	NA	NA	NA
WP_059365661.1|935948_936917_+	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_059365662.1|937007_937286_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_164027835.1|937294_938650_+	GTPase HflX	NA	NA	NA	NA	NA
WP_059365663.1|938675_939629_-	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_135969319.1|939978_941424_-	murein DD-endopeptidase MepM	NA	A0A2K9VGT1	Pontimonas_phage	48.7	1.0e-19
WP_059365665.1|941601_942405_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	26.8	2.1e-14
WP_164027836.1|942404_943190_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_059365667.1|943280_944228_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_059368799.1|944411_945278_+	pyridoxal kinase	NA	NA	NA	NA	NA
WP_135969318.1|945277_946567_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_059365669.1|946651_947269_+	MarC family protein	NA	NA	NA	NA	NA
WP_059365670.1|947706_948384_-	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_077664652.1|948380_948920_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	40.1	4.3e-24
WP_059365672.1|950495_950783_+	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_059365673.1|950912_951950_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	M4QRQ6	Synechococcus_phage	42.4	4.5e-70
WP_059365674.1|952008_952647_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	41.1	7.6e-28
WP_164027837.1|952704_953388_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_164027838.1|953667_954414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059365677.1|954414_954975_+	septation protein A	NA	NA	NA	NA	NA
WP_059365678.1|954974_955457_+	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
WP_164027839.1|955468_955765_+	YciI family protein	NA	NA	NA	NA	NA
WP_164027840.1|955897_958078_+	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	35.8	2.7e-16
WP_164027841.1|958110_958416_+	trp operon repressor	NA	NA	NA	NA	NA
WP_059365682.1|958402_959146_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_059365683.1|959191_960613_-	PTS sucrose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_164027842.1|961220_961619_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_164027843.1|961632_962823_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	62.1	1.3e-129
WP_164027844.1|962869_963436_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	64.0	1.8e-49
963384:963405	attR	AATCAAAACCGACCGCACTTTT	NA	NA	NA	NA
WP_164027845.1|963437_964676_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	61.4	3.8e-140
WP_059365688.1|964659_965016_+|head	phage head closure protein	head	A0A2H4JHA9	uncultured_Caudovirales_phage	36.3	3.4e-09
WP_059365689.1|965002_965311_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2D1GNK0	Pseudomonas_phage	36.0	5.9e-10
WP_135969308.1|965320_965683_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	53.6	3.3e-28
WP_135969307.1|966009_966369_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	69.0	3.2e-39
WP_164027846.1|966365_968033_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	70.9	2.9e-244
>prophage 8
NZ_CP040863	Rodentibacter heylii strain G1 chromosome, complete genome	2607636	1144525	1154649	2607636	tRNA	Heterosigma_akashiwo_virus(14.29%)	12	NA	NA
WP_135969032.1|1144525_1145209_-	ribonuclease III	NA	A0A1C9C5A7	Heterosigma_akashiwo_virus	36.1	3.3e-21
WP_059365839.1|1145210_1146260_-	signal peptidase I	NA	NA	NA	NA	NA
WP_077582579.1|1146268_1148065_-	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	42.6	3.8e-24
WP_077582580.1|1148225_1148609_-	autonomous glycyl radical cofactor GrcA	NA	A0A2K9VG12	Escherichia_phage	70.0	1.3e-30
WP_059365842.1|1148857_1149517_+	uracil-DNA glycosylase	NA	A0A0A7D988	Equid_alphaherpesvirus	46.5	7.8e-52
WP_059365843.1|1149596_1149956_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_059368808.1|1150012_1150480_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYZ2	Pandoravirus	28.8	6.6e-05
WP_059365844.1|1150516_1151368_-	thymidylate synthase	NA	H9EB68	Vibrio_phage	78.1	1.2e-134
WP_059365845.1|1151377_1152184_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_164027910.1|1152189_1152987_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_059365847.1|1152990_1153572_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_164027911.1|1154079_1154649_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A076YN96	Rhizobium_phage	30.9	2.9e-10
>prophage 9
NZ_CP040863	Rodentibacter heylii strain G1 chromosome, complete genome	2607636	2062207	2105929	2607636	capsid,integrase,tRNA	Morganella_phage(13.33%)	51	2056835:2056851	2111431:2111447
2056835:2056851	attL	AAATTGACCGCACTTTC	NA	NA	NA	NA
WP_164028429.1|2062207_2065033_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	26.4	5.5e-78
WP_077581977.1|2065098_2065617_+	signal peptidase II	NA	NA	NA	NA	NA
WP_077586782.1|2065613_2066558_+	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_164028430.1|2066765_2067371_+	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_164028432.1|2067455_2069201_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_164028433.1|2070486_2070846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164028434.1|2070854_2071508_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_059367974.1|2071507_2072443_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_164028436.1|2072673_2074599_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_077466004.1|2074791_2075700_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_164028438.1|2075745_2076393_+	FABP family protein	NA	NA	NA	NA	NA
WP_164028835.1|2076443_2077832_+	restriction endonuclease subunit M	NA	A0A0N9PBJ7	Sulfolobales_virus	31.6	8.3e-19
WP_164028440.1|2077818_2078733_+	CfrBI family restriction endonuclease	NA	NA	NA	NA	NA
WP_164028442.1|2078745_2080815_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_164028444.1|2081175_2082405_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	39.9	6.5e-84
WP_164028446.1|2082603_2083398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164028447.1|2083601_2083814_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_077664860.1|2083823_2084075_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_164028449.1|2084102_2084423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164028451.1|2084419_2084650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164028452.1|2085173_2085467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164028454.1|2085456_2086134_+	hypothetical protein	NA	A0A0H4IQ68	Shigella_phage	37.9	8.9e-27
WP_164028456.1|2086145_2086955_+	phage antirepressor Ant	NA	A0A0P0ZCA2	Stx2-converting_phage	38.2	5.0e-16
WP_164028458.1|2087042_2087231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164028460.1|2087759_2088119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164028462.1|2088105_2088642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164028464.1|2088634_2089012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164028466.1|2088999_2091177_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	40.4	2.3e-124
WP_164028468.1|2091714_2091999_+	BrnT family toxin	NA	NA	NA	NA	NA
WP_077427175.1|2091998_2092211_+	antitoxin	NA	NA	NA	NA	NA
WP_164028470.1|2092914_2094138_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	36.8	2.5e-67
WP_059367958.1|2094165_2094426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164028472.1|2095010_2095229_+	AlpA family phage regulatory protein	NA	Q7M299	Enterobacteria_phage	51.6	3.2e-10
WP_164028474.1|2095231_2095924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164028475.1|2095934_2096507_+|capsid	P2 family phage major capsid protein	capsid	A0A1L5C2B0	Pseudoalteromonas_phage	47.3	2.1e-05
WP_164028836.1|2096543_2096867_+|capsid	P2 family phage major capsid protein	capsid	A0A2H4JCR7	uncultured_Caudovirales_phage	38.8	7.5e-08
WP_164028477.1|2096872_2097094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135969508.1|2097196_2097460_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5NR91	Burkholderia_phage	45.3	2.8e-13
WP_164028479.1|2097471_2097864_+	helix-turn-helix domain-containing protein	NA	A0A1S5NNJ5	Burkholderia_phage	33.9	3.5e-07
WP_164028481.1|2098516_2098786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164028483.1|2098923_2099139_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_164027396.1|2099150_2099576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164028485.1|2099670_2100219_+	ash family protein	NA	NA	NA	NA	NA
WP_164028487.1|2100211_2100382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164028488.1|2100381_2100708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164028490.1|2100707_2101022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164027485.1|2101018_2101216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164028492.1|2101225_2102230_+|integrase	tyrosine-type recombinase/integrase	integrase	Q19US1	Mannheimia_phage	55.3	3.7e-93
WP_164028494.1|2102247_2102544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164028496.1|2102552_2104751_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	35.3	5.2e-92
WP_110890466.1|2105551_2105929_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A0R6PH06	Moraxella_phage	49.4	3.5e-12
2111431:2111447	attR	GAAAGTGCGGTCAATTT	NA	NA	NA	NA
