The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	0	9488	5441077		Trichoplusia_ni_ascovirus(50.0%)	11	NA	NA
WP_004200032.1|1024_1711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020802104.1|1707_2403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163589059.1|2586_4284_-	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_002906122.1|4340_4469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004143727.1|4465_4606_-	stationary-phase-induced ribosome-associated protein	NA	NA	NA	NA	NA
WP_004189881.1|4783_5635_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_004184171.1|5748_6642_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002906114.1|6709_6955_-	DUF2543 family protein	NA	NA	NA	NA	NA
WP_004151242.1|7151_8066_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	58.6	1.4e-83
WP_004143718.1|8721_8907_+	general stress protein	NA	NA	NA	NA	NA
WP_004143717.1|9272_9488_+	hypothetical protein	NA	H9NCK9	Mycobacterium_phage	48.0	9.4e-07
>prophage 2
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	14295	14700	5441077		Stx_converting_phage(100.0%)	1	NA	NA
WP_002906035.1|14295_14700_+	YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	41.6	2.0e-10
>prophage 3
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	25284	25965	5441077		Bacillus_virus(100.0%)	1	NA	NA
WP_002906011.1|25284_25965_+	MgtC family protein	NA	G3MA03	Bacillus_virus	41.9	2.1e-15
>prophage 4
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	42485	47530	5441077	transposase	Bacillus_phage(100.0%)	4	NA	NA
WP_004180014.1|42485_43226_+	response regulator	NA	W8CYM9	Bacillus_phage	37.6	1.5e-30
WP_004212073.1|43222_44566_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	24.3	1.0e-10
WP_163570413.1|44668_45859_+	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_085955203.1|46166_47530_-|transposase	IS3-like element ISKpn1 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.5	1.4e-74
>prophage 5
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	50667	54785	5441077		Klosneuvirus(50.0%)	4	NA	NA
WP_002905540.1|50667_52053_-	diaminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.0	7.4e-28
WP_004212078.1|52359_53295_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004180004.1|53319_54060_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004180001.1|54056_54785_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	9.6e-19
>prophage 6
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	60784	62041	5441077		Bacillus_phage(100.0%)	1	NA	NA
WP_117096842.1|60784_62041_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.5	4.0e-20
>prophage 7
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	89777	90515	5441077		Planktothrix_phage(100.0%)	1	NA	NA
WP_004179947.1|89777_90515_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.9	3.0e-36
>prophage 8
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	107316	108369	5441077		Enterobacteria_phage(100.0%)	1	NA	NA
WP_004151868.1|107316_108369_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	23.6	1.2e-14
>prophage 9
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	114304	153353	5441077	transposase	Shigella_phage(33.33%)	34	NA	NA
WP_087785717.1|114304_115451_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	93.0	1.9e-146
WP_004224871.1|115515_116724_-	MFS transporter	NA	NA	NA	NA	NA
WP_004190055.1|116827_117730_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021462539.1|117771_118659_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020325045.1|118819_119614_+	N-acyl homoserine lactonase family protein	NA	NA	NA	NA	NA
WP_004179900.1|119718_120147_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_117096377.1|120259_121402_-	M20 family metallopeptidase	NA	NA	NA	NA	NA
WP_117096376.1|121401_122157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032411068.1|122171_123251_-	phosphotriesterase-related protein	NA	NA	NA	NA	NA
WP_002904978.1|123254_124256_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004198552.1|124274_125021_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.0	2.3e-15
WP_004176158.1|125401_126424_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004151648.1|126769_127723_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_117096375.1|127724_128597_-	ribokinase	NA	NA	NA	NA	NA
WP_004176161.1|128623_129469_+	BtpA/SgcQ family protein	NA	NA	NA	NA	NA
WP_023316868.1|130165_131038_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_002904908.1|131484_131934_+	peptidoglycan-binding protein LysM	NA	NA	NA	NA	NA
WP_004184088.1|132070_133462_-	phosphoglycerate transporter PgtP	NA	NA	NA	NA	NA
WP_163589400.1|133867_135088_+	phosphoglycerate transport regulator PgtC	NA	NA	NA	NA	NA
WP_023302620.1|135099_137094_+	two-component system sensor histidine kinase PgtB	NA	NA	NA	NA	NA
WP_002904899.1|137083_138334_+	two-component system response regulator PgtA	NA	NA	NA	NA	NA
WP_023313190.1|138461_138980_+	GrpB family protein	NA	A0A2K5B2B6	Erysipelothrix_phage	37.6	1.3e-25
WP_163589069.1|139161_140070_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_040210104.1|142144_142555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032676095.1|142842_143415_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	47.2	7.8e-40
WP_072041693.1|143423_144242_+	abortive infection family protein	NA	NA	NA	NA	NA
WP_077255859.1|145129_145984_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	54.2	6.7e-80
WP_000537151.1|145980_146265_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_009309985.1|146355_146940_-	helix-turn-helix domain containing protein	NA	NA	NA	NA	NA
WP_031591821.1|147204_147909_-	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
WP_077251107.1|148068_149415_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_001567369.1|149644_150277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001567368.1|150305_151709_-|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_009310015.1|151820_153353_+|transposase	IS3-like element ISKpn38 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.8	4.1e-51
>prophage 10
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	159555	160329	5441077		Escherichia_phage(100.0%)	1	NA	NA
WP_002904861.1|159555_160329_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	29.6	2.0e-22
>prophage 11
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	167608	169165	5441077		Catovirus(100.0%)	1	NA	NA
WP_117096370.1|167608_169165_+	acyl--CoA ligase	NA	A0A1V0SBX8	Catovirus	25.2	2.3e-17
>prophage 12
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	176527	177703	5441077		Streptococcus_phage(100.0%)	1	NA	NA
WP_021314357.1|176527_177703_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	37.1	9.4e-40
>prophage 13
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	184263	185232	5441077	transposase	Salmonella_phage(100.0%)	1	NA	NA
WP_015958259.1|184263_185232_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.6	1.0e-180
>prophage 14
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	204559	205939	5441077		Enterobacteria_phage(100.0%)	1	NA	NA
WP_004184021.1|204559_205939_-	purine permease	NA	Q9KX94	Enterobacteria_phage	26.8	5.3e-18
>prophage 15
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	216441	217233	5441077		Bacillus_virus(100.0%)	1	NA	NA
WP_002904635.1|216441_217233_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	30.0	7.2e-20
>prophage 16
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	230268	231693	5441077		Bacillus_phage(100.0%)	1	NA	NA
WP_004148352.1|230268_231693_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	33.7	3.0e-16
>prophage 17
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	237090	237852	5441077		Escherichia_phage(100.0%)	1	NA	NA
WP_002904489.1|237090_237852_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	36.2	2.7e-32
>prophage 18
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	242375	243326	5441077		Catovirus(100.0%)	1	NA	NA
WP_064146371.1|242375_243326_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	33.8	1.3e-34
>prophage 19
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	248403	248778	5441077		Streptococcus_phage(100.0%)	1	NA	NA
WP_002904397.1|248403_248778_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	2.3e-08
>prophage 20
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	252024	253530	5441077		Staphylococcus_phage(50.0%)	2	NA	NA
WP_004176246.1|252024_252723_-	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	2.1e-15
WP_002904321.1|252732_253530_-	urea ABC transporter ATP-binding protein UrtD	NA	A0A2R8FG22	Brazilian_cedratvirus	26.9	2.4e-10
>prophage 21
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	257681	273577	5441077		Escherichia_phage(70.0%)	16	NA	NA
WP_002904248.1|257681_258785_-	cobalamin-independent methionine synthase II family protein	NA	A0A218MNE0	uncultured_virus	48.9	3.1e-101
WP_020805005.1|258933_259332_-	rhodanese-like protein	NA	NA	NA	NA	NA
WP_004176251.1|259399_260497_+	transcriptional regulator FtrA	NA	NA	NA	NA	NA
WP_004205985.1|260465_260681_+	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
WP_117096352.1|260733_261174_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014343051.1|261312_261432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004183956.1|261428_262493_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	44.5	2.0e-65
WP_160333886.1|264162_265797_+	DUF4981 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	55.8	3.1e-182
WP_004176258.1|265851_267117_+	MFS transporter	NA	NA	NA	NA	NA
WP_117096350.1|267147_268236_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	99.7	1.5e-209
WP_004176262.1|268322_268583_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_001620095.1|268880_269741_+	class A broad-spectrum beta-lactamase SHV-1	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
WP_002210513.1|269761_270523_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_040146162.1|270784_271687_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	4.5e-159
WP_117096349.1|271698_272964_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	98.8	3.3e-232
WP_002210516.1|272956_273577_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 22
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	282721	292717	5441077		uncultured_Caudovirales_phage(20.0%)	10	NA	NA
WP_004176282.1|282721_283396_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	62.5	1.1e-82
WP_004176283.1|283446_284289_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002903735.1|284316_284703_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_004179736.1|284780_286826_-	peptidyl-dipeptidase Dcp	NA	A0A1V0SIU1	Klosneuvirus	20.7	3.5e-18
WP_002903733.1|286956_287706_+	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_002903730.1|287797_288484_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004176285.1|288534_288966_-	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	40.7	2.7e-21
WP_102011963.1|289230_290694_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	31.8	1.3e-43
WP_002903724.1|290957_292241_-	MFS transporter	NA	NA	NA	NA	NA
WP_004219442.1|292354_292717_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.9	1.6e-22
>prophage 23
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	297476	299603	5441077		Escherichia_phage(100.0%)	3	NA	NA
WP_004152235.1|297476_298094_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.1	2.6e-73
WP_002903710.1|298095_298953_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	35.9	9.0e-24
WP_004209765.1|298994_299603_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	35.3	8.3e-24
>prophage 24
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	316727	317687	5441077		Salmonella_phage(100.0%)	1	NA	NA
WP_004148291.1|316727_317687_+	AEC family transporter	NA	A0A0U2C0Y4	Salmonella_phage	90.3	2.7e-53
>prophage 25
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	327131	329909	5441077		Lactobacillus_phage(100.0%)	1	NA	NA
WP_004179710.1|327131_329909_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	31.2	1.1e-65
>prophage 26
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	349801	350317	5441077		Streptococcus_phage(100.0%)	1	NA	NA
WP_004224598.1|349801_350317_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	53.5	4.6e-23
>prophage 27
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	361560	362862	5441077		Bacillus_phage(100.0%)	1	NA	NA
WP_004151564.1|361560_362862_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.0	2.9e-18
>prophage 28
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	372746	374516	5441077		Burkholderia_virus(100.0%)	1	NA	NA
WP_013096884.1|372746_374516_+	recombinase family protein	NA	Q6V7T7	Burkholderia_virus	30.0	4.0e-34
>prophage 29
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	378970	385178	5441077	transposase	Salmonella_phage(50.0%)	6	NA	NA
WP_015958259.1|378970_379939_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.6	1.0e-180
WP_163589085.1|380191_380665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001198019.1|380683_381622_-	cation transporter	NA	NA	NA	NA	NA
WP_016151349.1|382291_383260_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.3	5.0e-180
WP_163589086.1|383383_383998_+	recombinase family protein	NA	A0A0S2SXR4	Bacillus_phage	39.8	7.9e-06
WP_097732520.1|384057_385178_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	4.6e-52
>prophage 30
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	390104	393632	5441077		Salmonella_phage(50.0%)	6	NA	NA
WP_004151566.1|390104_390308_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	73.1	2.6e-22
WP_004179667.1|390377_390857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002903236.1|391093_391447_+	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_117096487.1|391550_392759_+	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_002903233.1|392755_392989_+	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_004179661.1|393239_393632_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	37.6	1.5e-18
>prophage 31
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	405810	407016	5441077		Klosneuvirus(100.0%)	1	NA	NA
WP_004176366.1|405810_407016_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.0	6.9e-22
>prophage 32
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	415702	420340	5441077		Bacillus_phage(50.0%)	2	NA	NA
WP_019704213.1|415702_416377_+	O-methyltransferase	NA	W8CYT3	Bacillus_phage	52.5	6.0e-31
WP_115657623.1|416437_420340_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.0	6.5e-53
>prophage 33
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	444807	446328	5441077		Planktothrix_phage(100.0%)	1	NA	NA
WP_004190429.1|444807_446328_+	amino acid ABC transporter permease/ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.8	3.5e-31
>prophage 34
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	456495	457485	5441077		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_002902515.1|456495_457485_+	2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	45.9	2.5e-70
>prophage 35
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	462603	469720	5441077	tRNA	Escherichia_phage(40.0%)	7	NA	NA
WP_004176397.1|462603_463728_+	porin OmpK37	NA	Q1MVN1	Enterobacteria_phage	59.8	3.8e-115
WP_002902432.1|463871_464084_+	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_004140161.1|464165_464600_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	50.7	3.2e-30
WP_002902422.1|464833_465769_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	93.0	3.5e-138
WP_004176400.1|465814_467188_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.3	6.6e-53
WP_004148192.1|467713_468697_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_023316286.1|468976_469720_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.5	4.6e-16
>prophage 36
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	477328	478342	5441077		Planktothrix_phage(100.0%)	1	NA	NA
WP_008805160.1|477328_478342_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	39.1	1.7e-29
>prophage 37
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	505471	510497	5441077		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_163589402.1|505471_507841_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	34.3	2.4e-18
WP_163589094.1|507842_510497_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.3	1.4e-96
>prophage 38
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	518742	524987	5441077	transposase	Salmonella_phage(33.33%)	6	NA	NA
WP_016809156.1|518742_519711_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	3.9e-185
WP_004176437.1|521298_522060_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	6.3e-21
WP_004176438.1|522167_523082_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004176439.1|523382_523571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004176440.1|523641_523932_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_004152141.1|524117_524987_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.1	5.7e-50
>prophage 39
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	561062	561281	5441077		Morganella_phage(100.0%)	1	NA	NA
WP_023279058.1|561062_561281_-	cold shock domain-containing protein	NA	A0A1W6JNX5	Morganella_phage	64.7	1.2e-20
>prophage 40
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	570945	632270	5441077	terminase,holin,integrase,transposase	Klebsiella_phage(22.22%)	71	558588:558603	630070:630085
558588:558603	attL	TCTGGCTGGCGCTGCT	NA	NA	NA	NA
WP_004196907.1|570945_572484_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.2	7.4e-295
WP_004196919.1|572532_572880_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	3.3e-62
WP_003031976.1|572876_573281_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	98.5	4.3e-69
WP_163589101.1|573309_573492_-	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	74.4	8.2e-12
WP_071003228.1|574004_574235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023322469.1|574375_575284_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	51.9	3.8e-73
WP_071003226.1|575415_576015_-	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	96.7	9.2e-92
WP_163589102.1|576105_578052_+	flagellar biosynthesis protein	NA	A0A286S1P0	Klebsiella_phage	85.2	7.2e-53
WP_163589403.1|578293_578893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_117096956.1|579117_579849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_117096955.1|579852_582807_-	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	68.3	4.2e-44
WP_117096954.1|582886_585955_-	kinase	NA	A0A286S259	Klebsiella_phage	97.5	0.0e+00
WP_004152651.1|585951_586332_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	99.2	1.8e-72
WP_117057861.1|586341_586824_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	98.1	1.9e-84
WP_048968368.1|586810_587284_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	69.2	5.1e-61
WP_015958316.1|587598_587934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000537151.1|589939_590224_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_077255859.1|590220_591075_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	54.2	6.7e-80
WP_087785717.1|591137_592284_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	93.0	1.9e-146
WP_077271292.1|593211_593694_-	zinc ribbon domain-containing protein	NA	I6PDJ9	Cronobacter_phage	42.9	1.9e-18
WP_071003330.1|593690_594047_-	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	75.0	6.5e-45
WP_008807842.1|594123_594330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038992558.1|594467_594950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071003328.1|595003_596176_-	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.3	4.2e-24
WP_117055941.1|596199_596592_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_023307384.1|596588_597140_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.9	7.8e-29
WP_071003326.1|597141_597525_-	glutamate 5-kinase	NA	A0A0S2SYG4	Pseudomonas_phage	44.4	4.6e-20
WP_071003323.1|597526_597937_-	protein singed	NA	A0A0H5AUF0	Pseudomonas_phage	38.2	2.3e-09
WP_071003320.1|597940_598153_-	hypothetical protein	NA	G8C7P8	Escherichia_phage	53.7	3.4e-09
WP_004184463.1|598192_599329_-	hypothetical protein	NA	G8C7P7	Escherichia_phage	76.5	2.8e-158
WP_012967904.1|599416_600181_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	59.1	1.5e-75
WP_115656858.1|600285_601398_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.1	5.3e-109
WP_110212146.1|601381_602806_-	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	71.7	9.8e-193
WP_072045687.1|602810_604115_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	60.0	2.2e-146
WP_117055943.1|604092_605085_-|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	33.3	5.3e-28
WP_004146211.1|605335_605572_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	64.1	1.7e-17
WP_023279088.1|606528_606804_-	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	71.4	2.2e-08
WP_023279089.1|606800_607148_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.0	2.3e-39
WP_163589103.1|607144_607684_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	96.6	1.2e-98
WP_024176410.1|607680_607980_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	83.8	4.5e-39
WP_071003305.1|609341_610151_-	antitermination protein	NA	M9NZB0	Enterobacteria_phage	75.8	2.9e-117
WP_117055945.1|610147_610288_-	YlcG family protein	NA	NA	NA	NA	NA
WP_117096949.1|610284_610866_-	recombination protein NinG	NA	G0ZNC4	Cronobacter_phage	49.0	3.2e-41
WP_117048943.1|611074_611674_-	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	79.4	3.8e-90
WP_022631486.1|611731_611953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_117048941.1|612030_612264_-	DinI-like family protein	NA	K7PM44	Enterobacteria_phage	70.1	4.4e-26
WP_077257689.1|612454_613423_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.8	2.5e-184
WP_163589104.1|613448_615632_-	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	52.2	2.3e-201
WP_057774672.1|615628_615886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023286281.1|616623_616845_-	hypothetical protein	NA	A9YWV3	Burkholderia_phage	49.4	2.2e-11
WP_020804604.1|616841_617096_-	hypothetical protein	NA	S5MQM0	Escherichia_phage	50.6	1.4e-09
WP_020804603.1|617088_617292_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	84.8	3.8e-26
WP_047670661.1|617288_618074_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	53.7	4.3e-65
WP_050888111.1|618066_618402_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	43.0	7.6e-11
WP_050888110.1|618394_619138_-	Replication protein P	NA	A0A0K2FIT1	Enterobacteria_phage	56.4	8.2e-66
WP_117055838.1|619134_620055_-	hypothetical protein	NA	K7PGZ0	Enterobacteria_phage	61.3	9.8e-93
WP_153676843.1|620132_620396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_117055837.1|620407_620944_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	69.4	2.8e-60
WP_071526640.1|620946_621210_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_050888108.1|621306_621663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_117055836.1|622091_622283_+	YebW family protein	NA	NA	NA	NA	NA
WP_117022175.1|622291_622447_+	hypothetical protein	NA	K7P7H7	Enterobacteria_phage	69.2	1.3e-13
WP_163589105.1|622584_625620_+	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	57.0	5.7e-291
WP_080917077.1|625632_626721_+	recombinase RecT	NA	H6WRX0	Salmonella_phage	56.5	7.4e-108
WP_043906915.1|626755_627094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_117055840.1|627101_627572_+	hypothetical protein	NA	A0A076G835	Escherichia_phage	47.8	1.1e-26
WP_004892750.1|627752_627992_+	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	70.1	8.0e-23
WP_012542039.1|628212_629430_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	51.6	3.3e-120
WP_004151901.1|629576_630467_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
630070:630085	attR	TCTGGCTGGCGCTGCT	NA	NA	NA	NA
WP_004140266.1|630466_631459_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004140269.1|631460_632270_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
>prophage 41
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	636900	638835	5441077		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_117096395.1|636900_638835_+	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	24.6	5.4e-08
>prophage 42
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	644425	645028	5441077		Staphylococcus_phage(100.0%)	1	NA	NA
WP_002901778.1|644425_645028_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	49.5	1.2e-43
>prophage 43
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	649868	655234	5441077	protease	Tupanvirus(50.0%)	5	NA	NA
WP_117096398.1|649868_652466_-	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	35.6	2.9e-89
WP_002901761.1|652872_653124_+	YciN family protein	NA	NA	NA	NA	NA
WP_002901758.1|653171_654218_-|protease	protease SohB	protease	NA	NA	NA	NA
WP_004225168.1|654262_654463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196459.1|654472_655234_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.2	1.2e-08
>prophage 44
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	662353	665311	5441077		Acinetobacter_phage(100.0%)	2	NA	NA
WP_004148109.1|662353_663949_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	36.5	2.8e-47
WP_014907770.1|663952_665311_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.4	3.3e-36
>prophage 45
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	677554	678232	5441077		Cyanophage(100.0%)	1	NA	NA
WP_004140326.1|677554_678232_+	PKHD-type hydroxylase YbiX	NA	A0A127KM56	Cyanophage	33.8	3.3e-21
>prophage 46
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	689000	691259	5441077		Tupanvirus(100.0%)	1	NA	NA
WP_002901554.1|689000_691259_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.4	1.0e-143
>prophage 47
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	697523	698351	5441077		Bacillus_virus(100.0%)	1	NA	NA
WP_004151921.1|697523_698351_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	53.5	2.7e-70
>prophage 48
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	705035	706256	5441077		Klosneuvirus(100.0%)	1	NA	NA
WP_002901489.1|705035_706256_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.2	8.0e-26
>prophage 49
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	712313	712946	5441077		Bacillus_phage(100.0%)	1	NA	NA
WP_004148072.1|712313_712946_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.3	7.8e-09
>prophage 50
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	718248	719157	5441077		Streptococcus_phage(100.0%)	1	NA	NA
WP_160333892.1|718248_719157_-	hypothetical protein	NA	A0A1X9I6W8	Streptococcus_phage	30.6	1.8e-30
>prophage 51
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	726689	731814	5441077	transposase	Tupanvirus(33.33%)	5	NA	NA
WP_023302055.1|726689_727331_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	37.1	1.9e-18
WP_163589404.1|727368_728730_-	MFS transporter	NA	NA	NA	NA	NA
WP_016809156.1|728769_729738_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	3.9e-185
WP_002901274.1|729934_730693_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_002901272.1|730830_731814_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	21.1	1.5e-06
>prophage 52
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	737506	738760	5441077		Artogeia_rapae_granulovirus(100.0%)	1	NA	NA
WP_002901255.1|737506_738760_+	glycoside hydrolase family 18 protein	NA	D2J4H7	Artogeia_rapae_granulovirus	25.6	2.6e-24
>prophage 53
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	742368	743298	5441077		Indivirus(100.0%)	1	NA	NA
WP_163589110.1|742368_743298_-	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	26.0	3.0e-17
>prophage 54
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	746572	756096	5441077		Bacillus_phage(16.67%)	12	NA	NA
WP_004152363.1|746572_747856_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	1.7e-10
WP_002901231.1|747901_748465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002901230.1|748623_749106_+	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	39.1	1.6e-17
WP_004140435.1|749227_749539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004220356.1|749606_749726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004176540.1|749796_750678_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_071004922.1|750853_752071_+	MFS transporter	NA	NA	NA	NA	NA
WP_004213132.1|752067_752817_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	29.1	7.3e-14
WP_004140447.1|752983_753889_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004183665.1|753895_755161_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	79.4	2.9e-196
WP_002901192.1|755163_755583_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	5.5e-35
WP_002901096.1|755853_756096_+	DinI family protein	NA	Q6UAW0	Klebsiella_phage	72.2	4.1e-27
>prophage 55
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	763027	766613	5441077		Bacillus_virus(50.0%)	7	NA	NA
WP_117096450.1|763027_764041_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	34.4	6.4e-13
WP_004150782.1|764098_764200_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_004213093.1|764199_764274_+	protein YoaJ	NA	NA	NA	NA	NA
WP_004140488.1|764391_764517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140489.1|764576_764840_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004150783.1|764970_765609_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_117063371.1|765698_766613_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
>prophage 56
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	769902	771687	5441077		Bacillus_phage(100.0%)	1	NA	NA
WP_032432901.1|769902_771687_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
>prophage 57
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	786310	787561	5441077		Phage_21(100.0%)	1	NA	NA
WP_004150800.1|786310_787561_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
>prophage 58
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	790789	792160	5441077		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_004176557.1|790789_792160_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.3	1.2e-107
>prophage 59
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	798724	799861	5441077		Bacillus_virus(100.0%)	1	NA	NA
WP_004150811.1|798724_799861_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	G3M9Y6	Bacillus_virus	36.0	2.6e-31
>prophage 60
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	804293	809133	5441077		Staphylococcus_phage(50.0%)	3	NA	NA
WP_163589113.1|804293_805922_-	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.5	7.4e-27
WP_163589114.1|806159_808163_-	transketolase	NA	NA	NA	NA	NA
WP_032434318.1|808182_809133_-	transaldolase	NA	A0A0E3G6C9	Synechococcus_phage	38.3	3.5e-13
>prophage 61
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	816394	820145	5441077		Vibrio_phage(50.0%)	4	NA	NA
WP_004176563.1|816394_817225_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	34.0	5.3e-21
WP_015958185.1|817239_818151_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_002900801.1|818199_819444_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_002900798.1|819443_820145_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.4	7.8e-34
>prophage 62
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	839869	840511	5441077		Pseudomonas_phage(100.0%)	1	NA	NA
WP_002900674.1|839869_840511_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	37.0	3.8e-27
>prophage 63
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	843790	844972	5441077		Ralstonia_phage(50.0%)	2	NA	NA
WP_000103754.1|843790_844027_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
WP_002899294.1|844237_844972_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.0e-15
>prophage 64
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	864128	864380	5441077		Salmonella_phage(100.0%)	1	NA	NA
WP_002898994.1|864128_864380_+	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	5.1e-12
>prophage 65
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	867621	868542	5441077		Morganella_phage(100.0%)	1	NA	NA
WP_080893463.1|867621_868542_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	42.6	1.1e-56
>prophage 66
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	876893	877421	5441077		Infectious_spleen_and_kidney_necrosis_virus(100.0%)	1	NA	NA
WP_004176593.1|876893_877421_-	O-acetyl-ADP-ribose deacetylase	NA	A0A140G0J9	Infectious_spleen_and_kidney_necrosis_virus	45.3	1.3e-28
>prophage 67
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	884580	885639	5441077		Cronobacter_phage(100.0%)	1	NA	NA
WP_004147894.1|884580_885639_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	77.6	8.6e-93
>prophage 68
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	902203	905723	5441077		Enterobacteria_phage(100.0%)	4	NA	NA
WP_117095994.1|902203_902698_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	75.0	6.9e-37
WP_004211313.1|902719_904042_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	87.8	8.2e-202
WP_163589409.1|904448_905339_-	DMT family transporter	NA	NA	NA	NA	NA
WP_002898708.1|905549_905723_-	general stress protein	NA	Q9KX95	Enterobacteria_phage	92.6	1.4e-05
>prophage 69
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	929861	930521	5441077	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_002898458.1|929861_930521_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	46.6	3.2e-37
>prophage 70
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	935463	937518	5441077		Bacillus_phage(100.0%)	1	NA	NA
WP_117095998.1|935463_937518_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	25.4	5.3e-14
>prophage 71
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	950217	952125	5441077		Tupanvirus(100.0%)	1	NA	NA
WP_004147848.1|950217_952125_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.3	1.2e-49
>prophage 72
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	960891	966014	5441077		Bacillus_virus(33.33%)	3	NA	NA
WP_004150838.1|960891_961665_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.5	2.9e-29
WP_002898220.1|961869_964485_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.4	1.7e-20
WP_002898217.1|964811_966014_+	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	31.5	5.1e-41
>prophage 73
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	972076	975148	5441077	tRNA	Bandra_megavirus(50.0%)	2	NA	NA
WP_004211425.1|972076_973477_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.6	2.2e-80
WP_004141771.1|974068_975148_+	porin OmpK35	NA	Q1MVN1	Enterobacteria_phage	53.0	1.9e-100
>prophage 74
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	992511	997054	5441077		Bacillus_phage(100.0%)	3	NA	NA
WP_002898170.1|992511_994260_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.7	4.6e-59
WP_163589124.1|994296_996561_-	ComEC family protein	NA	NA	NA	NA	NA
WP_002898165.1|996766_997054_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	4.2e-10
>prophage 75
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1001227	1002316	5441077		Streptococcus_phage(100.0%)	1	NA	NA
WP_002898155.1|1001227_1002316_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	1.0e-80
>prophage 76
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1006367	1036452	5441077	tRNA,protease	Tetraselmis_virus(13.33%)	23	NA	NA
WP_002898148.1|1006367_1008650_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.8	8.4e-162
WP_117096007.1|1008841_1009582_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	27.0	4.7e-21
WP_004150843.1|1009744_1010893_-	MFS transporter	NA	NA	NA	NA	NA
WP_004147798.1|1011009_1011156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004183542.1|1011167_1012031_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_004150845.1|1012032_1012650_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.1	2.6e-73
WP_004147794.1|1012660_1015099_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.2	2.8e-219
WP_002898139.1|1015299_1016592_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
WP_163589125.1|1016682_1018026_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	1.3e-80
WP_002898132.1|1018034_1018646_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_163589126.1|1018768_1022977_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.1e-88
WP_000228469.1|1023112_1023607_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_004147787.1|1023890_1024022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002898019.1|1024139_1025108_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.2e-62
WP_002898017.1|1025222_1026989_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
WP_117096010.1|1026989_1028711_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	22.9	4.0e-15
WP_004141853.1|1028737_1029457_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|1029810_1030029_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|1030148_1032428_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|1032458_1032776_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|1033101_1033323_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|1033399_1035340_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|1035336_1036452_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 77
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1049268	1053619	5441077		Roseobacter_phage(50.0%)	4	NA	NA
WP_004209681.1|1049268_1050099_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
WP_025368307.1|1050130_1051270_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_002896394.1|1052148_1052664_+	lipoprotein	NA	NA	NA	NA	NA
WP_002896392.1|1052890_1053619_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
>prophage 78
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1056763	1068351	5441077		Bacillus_phage(33.33%)	13	NA	NA
WP_002896382.1|1056763_1058236_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
WP_002896380.1|1058232_1058949_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
WP_002896378.1|1059027_1060155_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
WP_002896376.1|1060196_1060685_-	DUF2593 family protein	NA	NA	NA	NA	NA
WP_002896372.1|1060742_1061588_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_002896371.1|1061584_1062538_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_004176719.1|1062548_1063715_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.3e-30
WP_002896368.1|1063845_1064958_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896365.1|1065306_1065786_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_009484278.1|1065874_1066777_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	34.9	7.7e-34
WP_117096013.1|1066891_1067614_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_002896354.1|1067597_1067885_-	YbjC family protein	NA	NA	NA	NA	NA
WP_002896352.1|1068087_1068351_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
>prophage 79
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1075823	1079662	5441077	transposase	Escherichia_phage(33.33%)	4	NA	NA
WP_004151717.1|1075823_1076582_+	DNA-binding transcriptional repressor DeoR	NA	A0A077SK06	Escherichia_phage	27.6	2.4e-12
WP_117096014.1|1076620_1077823_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	49.6	8.5e-97
WP_032409999.1|1078461_1078590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015958259.1|1078693_1079662_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.6	1.0e-180
>prophage 80
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1090741	1092601	5441077		Planktothrix_phage(100.0%)	1	NA	NA
WP_016947478.1|1090741_1092601_-	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.2	6.3e-14
>prophage 81
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1096844	1099277	5441077		Bacteriophage(100.0%)	1	NA	NA
WP_040145967.1|1096844_1099277_+	formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme	NA	A0A2K8HAT8	Bacteriophage	47.4	8.0e-09
>prophage 82
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1106777	1108370	5441077		Tupanvirus(100.0%)	1	NA	NA
WP_002895876.1|1106777_1108370_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	5.0e-60
>prophage 83
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1111379	1112756	5441077		Pandoravirus(100.0%)	1	NA	NA
WP_004176762.1|1111379_1112756_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	23.8	7.2e-23
>prophage 84
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1116758	1121910	5441077		Escherichia_phage(33.33%)	7	NA	NA
WP_002895845.1|1116758_1117271_-	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.7e-14
WP_048987300.1|1117478_1117604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002895842.1|1117622_1118510_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_002895841.1|1118747_1119251_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222Z0F3	Streptomyces_phage	47.6	9.3e-05
WP_002895839.1|1119659_1120406_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_002895837.1|1120531_1121191_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_004142040.1|1121187_1121910_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	42.7	3.3e-35
>prophage 85
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1125984	1133937	5441077		Erwinia_phage(20.0%)	8	NA	NA
WP_004223802.1|1125984_1126245_+	DUF1471 domain-containing protein	NA	A0A1B2IB27	Erwinia_phage	47.9	1.6e-05
WP_002895824.1|1126265_1126532_+	DksA/TraR family C4-type zinc finger protein	NA	A0A1S6UBD1	Serratia_phage	52.3	1.6e-16
WP_004176772.1|1126817_1127078_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_004179105.1|1127187_1128156_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_004147693.1|1128185_1130342_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.3	1.5e-43
WP_004151702.1|1130529_1131885_-	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.8	8.3e-48
WP_002895757.1|1132099_1133092_-	transketolase family protein	NA	NA	NA	NA	NA
WP_002895753.1|1133091_1133937_-	transketolase	NA	G9E5U1	Micromonas_pusilla_virus	30.3	3.1e-08
>prophage 86
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1139142	1140882	5441077		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_064153583.1|1139142_1140882_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.5	4.3e-17
>prophage 87
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1151049	1151955	5441077		Streptococcus_phage(100.0%)	1	NA	NA
WP_117096026.1|1151049_1151955_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	29.8	2.8e-28
>prophage 88
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1158452	1159175	5441077		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_004152853.1|1158452_1159175_+	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.9	2.9e-07
>prophage 89
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1162978	1168540	5441077		Klosneuvirus(50.0%)	4	NA	NA
WP_004191247.1|1162978_1164268_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.8	3.8e-18
WP_117096032.1|1164338_1164815_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_163589131.1|1165532_1166915_-	amino acid permease	NA	NA	NA	NA	NA
WP_012737677.1|1167013_1168540_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	38.0	3.7e-81
>prophage 90
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1176486	1184342	5441077		Acanthocystis_turfacea_Chlorella_virus(33.33%)	4	NA	NA
WP_085903161.1|1176486_1179174_-	cation-transporting P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	26.2	1.4e-67
WP_004183465.1|1179225_1179657_-	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	41.4	1.3e-23
WP_163589133.1|1180190_1181276_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_117096034.1|1181276_1184342_+	efflux RND transporter permease subunit	NA	S5VL66	Leptospira_phage	20.8	1.3e-21
>prophage 91
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1187452	1188187	5441077		Enterobacteria_phage(100.0%)	1	NA	NA
WP_117096035.1|1187452_1188187_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	50.3	1.8e-49
>prophage 92
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1193033	1194092	5441077		Planktothrix_phage(100.0%)	1	NA	NA
WP_004179075.1|1193033_1194092_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	34.8	5.3e-18
>prophage 93
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1197639	1199555	5441077		Pithovirus(50.0%)	2	NA	NA
WP_072093152.1|1197639_1198329_+	molybdate ABC transporter ATP-binding protein ModF	NA	W5SAS9	Pithovirus	29.5	1.3e-09
WP_040215839.1|1198538_1199555_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	45.7	5.2e-79
>prophage 94
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1203916	1207427	5441077		Edwardsiella_phage(33.33%)	4	NA	NA
WP_002895086.1|1203916_1204969_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A0B6VT43	Edwardsiella_phage	48.0	1.2e-81
WP_002895084.1|1205283_1205649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004147641.1|1205766_1206711_+	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.4	3.4e-24
WP_004151689.1|1206707_1207427_-	nicotinamide riboside transporter PnuC	NA	I6W764	Vibriophage	34.6	2.0e-24
>prophage 95
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1231645	1232437	5441077		Kaumoebavirus(100.0%)	1	NA	NA
WP_048978573.1|1231645_1232437_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	26.2	7.3e-12
>prophage 96
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1238246	1245676	5441077		Acinetobacter_phage(33.33%)	6	NA	NA
WP_004142240.1|1238246_1239725_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	29.3	4.9e-46
WP_117096040.1|1239696_1241139_-	deoxyribodipyrimidine photo-lyase	NA	F2Y1V1	Organic_Lake_phycodnavirus	33.1	6.7e-56
WP_004142243.1|1241322_1241532_-	DUF2517 family protein	NA	NA	NA	NA	NA
WP_020323459.1|1241838_1241928_+	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_163589137.1|1241927_1243607_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_004147607.1|1243627_1245676_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	24.3	6.0e-26
>prophage 97
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1252502	1253276	5441077		Mycobacterium_phage(100.0%)	1	NA	NA
WP_004152229.1|1252502_1253276_+	esterase	NA	A0A286MQ79	Mycobacterium_phage	29.7	2.9e-05
>prophage 98
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1257964	1261766	5441077	tRNA	Escherichia_phage(50.0%)	2	NA	NA
WP_023283434.1|1257964_1259632_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	93.3	0.0e+00
WP_004147599.1|1259810_1261766_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	48.6	6.4e-09
>prophage 99
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1266519	1268184	5441077		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_002894734.1|1266519_1268184_+	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.7	7.2e-86
>prophage 100
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1272224	1273271	5441077		Pseudomonas_phage(100.0%)	1	NA	NA
WP_004176871.1|1272224_1273271_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	3.2e-47
>prophage 101
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1279275	1280001	5441077		Planktothrix_phage(100.0%)	1	NA	NA
WP_002894706.1|1279275_1280001_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.6	1.2e-29
>prophage 102
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1284657	1287240	5441077	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_004176877.1|1284657_1287240_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.6	8.0e-185
>prophage 103
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1294284	1296771	5441077		Synechococcus_phage(50.0%)	2	NA	NA
WP_004176882.1|1294284_1295433_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	51.6	1.1e-08
WP_002894539.1|1295571_1296771_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	49.0	6.5e-105
>prophage 104
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1301649	1302309	5441077		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_004223642.1|1301649_1302033_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	49.1	8.9e-24
WP_002439184.1|1302099_1302309_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	79.7	1.2e-22
>prophage 105
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1306398	1308469	5441077		Morganella_phage(50.0%)	2	NA	NA
WP_002894401.1|1306398_1306827_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	40.0	7.4e-19
WP_004142378.1|1306903_1308469_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.6	6.4e-44
>prophage 106
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1311604	1325319	5441077		Streptococcus_phage(20.0%)	12	NA	NA
WP_004176886.1|1311604_1312828_+	DUF3440 domain-containing protein	NA	A0A220GKF8	Streptococcus_phage	33.9	3.4e-61
WP_004176887.1|1312812_1313439_+	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	48.7	3.9e-53
WP_074193501.1|1313439_1314585_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_002894359.1|1314726_1315416_+	acireductone synthase	NA	NA	NA	NA	NA
WP_002894357.1|1315412_1315955_+	1,2-dihydroxy-3-keto-5-methylthiopentene dioxygenase	NA	NA	NA	NA	NA
WP_163589138.1|1316062_1318372_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	33.5	3.5e-83
WP_002894353.1|1318780_1319761_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_074428413.1|1319805_1321308_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.1	7.1e-16
WP_004147555.1|1321304_1322294_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_087637935.1|1322290_1323295_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004147553.1|1323306_1324248_+	sugar kinase	NA	NA	NA	NA	NA
WP_117096046.1|1324290_1325319_-	2-hydroxyacid dehydrogenase	NA	A0A2R8FCS0	Cedratvirus	33.7	4.7e-27
>prophage 107
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1338937	1340300	5441077	transposase	Bacillus_phage(100.0%)	1	NA	NA
WP_085955203.1|1338937_1340300_+|transposase	IS3-like element ISKpn1 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.5	1.4e-74
>prophage 108
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1344042	1348463	5441077		Staphylococcus_phage(50.0%)	5	NA	NA
WP_023279184.1|1344042_1345545_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	1.1e-16
WP_004191385.1|1345708_1346797_+	oxidoreductase	NA	NA	NA	NA	NA
WP_002893908.1|1346854_1347598_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_004147534.1|1347781_1348084_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_040166680.1|1348058_1348463_+	helix-turn-helix transcriptional regulator	NA	A0A1S5NNJ5	Burkholderia_phage	33.3	1.8e-06
>prophage 109
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1361153	1365894	5441077		Acanthocystis_turfacea_Chlorella_virus(50.0%)	2	NA	NA
WP_002893737.1|1361153_1361948_+	iron-enterobactin ABC transporter ATP-binding protein	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	25.7	1.5e-09
WP_163589141.1|1362012_1365894_-	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	27.6	9.0e-55
>prophage 110
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1377287	1378832	5441077		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004176928.1|1377287_1378832_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.6	4.6e-18
>prophage 111
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1385536	1391450	5441077	holin	Vibrio_phage(50.0%)	4	NA	NA
WP_048977668.1|1385536_1387570_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.7	5.8e-21
WP_004151671.1|1387698_1388286_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_004147503.1|1388299_1389772_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004142489.1|1389785_1391450_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	6.1e-61
>prophage 112
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1396007	1397535	5441077		Planktothrix_phage(100.0%)	2	NA	NA
WP_117096223.1|1396007_1396844_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.4	5.3e-13
WP_004178936.1|1396830_1397535_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.6	2.3e-25
>prophage 113
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1400611	1405291	5441077		Planktothrix_phage(50.0%)	5	NA	NA
WP_004151676.1|1400611_1401373_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.2	1.3e-29
WP_002893189.1|1401365_1402031_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_004223524.1|1402045_1402687_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_022631237.1|1402734_1403586_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_038431977.1|1403827_1405291_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.6	4.8e-17
>prophage 114
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1409124	1411162	5441077		Planktothrix_phage(50.0%)	2	NA	NA
WP_004191439.1|1409124_1410135_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	7.3e-17
WP_009308109.1|1410124_1411162_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.9	9.2e-15
>prophage 115
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1421496	1424220	5441077		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_073900986.1|1421496_1424220_-	cation-transporting P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	27.0	1.4e-65
>prophage 116
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1451107	1452223	5441077		Tupanvirus(100.0%)	1	NA	NA
WP_163589142.1|1451107_1452223_-	class II histone deacetylase	NA	A0A2K9KZC4	Tupanvirus	33.6	1.7e-38
>prophage 117
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1467102	1467900	5441077		Bacillus_virus(100.0%)	1	NA	NA
WP_002892698.1|1467102_1467900_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.7	6.0e-14
>prophage 118
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1474522	1480323	5441077		Bacillus_phage(50.0%)	6	NA	NA
WP_004199626.1|1474522_1475923_+	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	24.5	3.3e-15
WP_014907957.1|1475946_1476957_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_004151798.1|1477004_1477613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004142658.1|1477653_1477791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002892599.1|1477796_1478828_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004142660.1|1478838_1480323_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.2	3.8e-14
>prophage 119
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1488848	1492173	5441077	tRNA	Catovirus(50.0%)	2	NA	NA
WP_002892491.1|1488848_1490366_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.3	9.5e-85
WP_049026126.1|1490697_1492173_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	29.0	6.9e-48
>prophage 120
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1498382	1499303	5441077		Morganella_phage(100.0%)	1	NA	NA
WP_101985271.1|1498382_1499303_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	40.1	1.4e-51
>prophage 121
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1510775	1511093	5441077		Enterobacterial_phage(100.0%)	1	NA	NA
WP_065519322.1|1510775_1511093_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	52.0	8.1e-23
>prophage 122
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1514369	1560881	5441077	tail,integrase,tRNA,terminase,holin,coat	Escherichia_phage(20.69%)	71	1510574:1510620	1557953:1557999
1510574:1510620	attL	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_060415544.1|1514369_1517438_-	kinase	NA	A0A286S259	Klebsiella_phage	97.7	0.0e+00
WP_017880229.1|1517434_1517815_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	100.0	4.6e-73
WP_022631470.1|1517824_1518307_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	96.2	1.1e-82
WP_004190622.1|1518487_1518952_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	68.4	3.0e-58
WP_163589150.1|1518951_1522554_-|tail	phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	28.7	1.2e-77
WP_103214991.1|1522649_1523015_-	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	48.3	1.0e-05
WP_004217333.1|1523062_1523419_-	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	75.0	1.1e-44
WP_016831940.1|1523495_1523702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008807841.1|1523839_1524322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135708410.1|1524375_1525548_-	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.3	1.1e-24
WP_004190640.1|1525571_1525964_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_060415541.1|1525960_1526512_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.9	5.9e-29
WP_060415540.1|1526513_1526897_-	hypothetical protein	NA	A0A0S2SYG4	Pseudomonas_phage	43.7	5.1e-19
WP_048271645.1|1526898_1527309_-	hypothetical protein	NA	A0A0H5AUF0	Pseudomonas_phage	38.2	6.6e-09
WP_060415539.1|1527312_1527570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060415538.1|1527619_1528756_-|coat	P22 coat - protein 5 family protein	coat	G8C7P7	Escherichia_phage	74.3	1.0e-155
WP_048271641.1|1528843_1529608_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	62.2	1.3e-79
WP_043906932.1|1529726_1529966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060415537.1|1530142_1531255_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	53.2	1.2e-108
WP_060415536.1|1531238_1532663_-	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	70.4	7.8e-190
WP_032755201.1|1532667_1533972_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.1	3.1e-145
WP_060415535.1|1533949_1534954_-|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	43.8	5.9e-35
WP_060415534.1|1535204_1535441_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	94.9	1.6e-31
WP_060415533.1|1535776_1536070_-	hypothetical protein	NA	G8C7W3	Escherichia_phage	71.1	9.8e-31
WP_060415532.1|1536237_1536426_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	91.5	4.3e-24
WP_060415531.1|1536376_1536652_-	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	87.9	2.4e-07
WP_029602869.1|1536648_1536996_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	81.7	1.8e-39
WP_004184488.1|1536992_1537532_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	100.0	2.3e-102
WP_024940884.1|1537528_1537828_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	100.0	4.5e-47
WP_060415530.1|1538819_1539509_-	antiterminator	NA	I6PDF8	Cronobacter_phage	56.7	4.3e-61
WP_009483890.1|1539505_1539646_-	YlcG family protein	NA	NA	NA	NA	NA
WP_060415529.1|1539642_1540278_-	NinG family protein	NA	M9NYX8	Enterobacteria_phage	78.4	2.7e-81
WP_060415528.1|1540270_1540945_-	serine/threonine protein phosphatase	NA	M9P0E4	Enterobacteria_phage	73.7	9.6e-98
WP_072269237.1|1540941_1541109_-	NinE family protein	NA	K7P7K0	Enterobacteria_phage	62.5	2.7e-09
WP_060415527.1|1541108_1541564_-	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	70.2	2.8e-56
WP_048980343.1|1541815_1542004_-	hypothetical protein	NA	R9TNE4	Aeromonas_phage	76.7	2.5e-19
WP_032442358.1|1542003_1542264_-	hypothetical protein	NA	A0A077SLR0	Escherichia_phage	66.3	7.1e-25
WP_050597784.1|1542256_1542844_-	hypothetical protein	NA	A0A1X9I9I7	Staphylococcus_phage	44.1	3.0e-31
WP_102949329.1|1542847_1543357_-	DUF551 domain-containing protein	NA	R9TQX3	Aeromonas_phage	55.3	7.6e-47
WP_032442360.1|1544226_1544457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163589151.1|1544453_1544888_-	hypothetical protein	NA	R9TME7	Aeromonas_phage	37.5	2.2e-10
WP_060415525.1|1544884_1545109_-	hypothetical protein	NA	H9C169	Pectobacterium_phage	52.9	1.3e-14
WP_060415524.1|1545105_1545405_-	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	55.8	3.9e-19
WP_060415523.1|1545406_1546273_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	68.7	1.1e-106
WP_060415522.1|1546257_1547112_-	replication protein	NA	K7PGT1	Enterobacteria_phage	54.3	4.8e-62
WP_032700425.1|1547188_1547443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004141720.1|1547442_1547763_-	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	68.9	3.8e-36
WP_004178811.1|1547802_1548036_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	70.4	3.0e-22
WP_072269235.1|1548140_1548830_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	70.2	5.1e-86
WP_032442364.1|1549006_1549291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048980368.1|1549535_1549832_+	hypothetical protein	NA	A4KWR1	Enterobacteria_phage	45.2	9.9e-15
WP_048986758.1|1549862_1550066_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	73.1	1.2e-19
WP_072269236.1|1550375_1550501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008807814.1|1550493_1550700_+	phage encoded cell division inhibitor protein	NA	A0A0M4S6W3	Salmonella_phage	94.1	1.4e-31
WP_060415518.1|1550758_1551277_+	hypothetical protein	NA	A0A1W6DY33	Salmonella_phage	44.7	3.7e-33
WP_060415519.1|1551280_1552249_+	hypothetical protein	NA	A0A077KCC0	Edwardsiella_phage	77.7	1.7e-39
WP_008807813.1|1552256_1552541_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	3.8e-40
WP_048983155.1|1552556_1553402_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	9.0e-69
WP_048983156.1|1553398_1554079_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	92.9	1.8e-123
WP_032442370.1|1554075_1554504_+	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	80.3	1.3e-63
WP_163589152.1|1554500_1555157_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.0	4.6e-113
WP_048333097.1|1555153_1555375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102012298.1|1555371_1555644_+	DUF5405 family protein	NA	Q716F1	Shigella_phage	65.9	4.8e-24
WP_102012299.1|1555640_1555865_+	hypothetical protein	NA	G8C7U9	Escherichia_phage	73.2	2.0e-20
WP_102012300.1|1555861_1556347_+	hypothetical protein	NA	A0A076G835	Escherichia_phage	61.9	1.2e-30
WP_163589153.1|1556343_1556562_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	52.2	4.4e-12
WP_071531921.1|1556563_1556899_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004191604.1|1556775_1557939_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	87.1	5.0e-203
WP_004143017.1|1558369_1559236_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
1557953:1557999	attR	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_110233300.1|1559237_1559450_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_117096238.1|1559495_1560881_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
>prophage 123
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1573295	1578501	5441077		Bacillus_virus(50.0%)	5	NA	NA
WP_004177224.1|1573295_1573973_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	33.0	1.3e-22
WP_002892258.1|1574113_1575031_+	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_004151325.1|1575027_1575486_+	NfeD family protein	NA	NA	NA	NA	NA
WP_002892208.1|1575482_1575893_-	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_163589155.1|1575945_1578501_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.0	2.8e-113
>prophage 124
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1588620	1596431	5441077	transposase	uncultured_Mediterranean_phage(25.0%)	9	NA	NA
WP_004177228.1|1588620_1590495_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.8	4.9e-115
WP_002892177.1|1590606_1591212_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_002892173.1|1591211_1591544_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_004177229.1|1591601_1593509_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	38.2	3.0e-43
WP_002892145.1|1593601_1594153_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	44.5	3.9e-28
WP_002892144.1|1594303_1594681_-	DUF454 family protein	NA	NA	NA	NA	NA
WP_117096242.1|1594750_1595278_+	primosomal replication protein N''	NA	NA	NA	NA	NA
WP_002892136.1|1595290_1595464_+	pleiotropic regulatory protein RsmS	NA	NA	NA	NA	NA
WP_004183208.1|1595531_1596431_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.6	4.2e-64
>prophage 125
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1601952	1611343	5441077		Leptospira_phage(33.33%)	11	NA	NA
WP_002892069.1|1601952_1605099_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.7	1.1e-47
WP_002892066.1|1605584_1605959_+	Hha toxicity modulator TomB	NA	NA	NA	NA	NA
WP_002892050.1|1605985_1606204_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_163589157.1|1606362_1606929_+	maltose O-acetyltransferase	NA	NA	NA	NA	NA
WP_004147370.1|1606900_1607041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002892026.1|1607061_1607532_+	membrane protein	NA	NA	NA	NA	NA
WP_002892023.1|1607506_1608958_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	25.1	4.6e-12
WP_040220001.1|1609058_1609757_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_040219999.1|1609753_1609894_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_002892011.1|1609893_1610157_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_002892007.1|1610272_1611343_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	42.8	6.1e-70
>prophage 126
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1620517	1621627	5441077		Planktothrix_phage(100.0%)	1	NA	NA
WP_004213738.1|1620517_1621627_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	35.5	1.1e-26
>prophage 127
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1632532	1636076	5441077		Bacillus_phage(100.0%)	2	NA	NA
WP_049000019.1|1632532_1634311_-	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.7	8.6e-37
WP_117096245.1|1634303_1636076_-	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.7	7.0e-47
>prophage 128
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1640503	1641205	5441077		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_002891863.1|1640503_1641205_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.4	1.1e-88
>prophage 129
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1644435	1649604	5441077	protease	Sodalis_phage(25.0%)	4	NA	NA
WP_002444653.1|1644435_1644708_-	DNA-binding protein HU-beta	NA	A3E2K9	Sodalis_phage	61.8	8.5e-21
WP_004151336.1|1644917_1647272_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.2	2.7e-224
WP_002891807.1|1647455_1648730_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	7.3e-131
WP_002891804.1|1648980_1649604_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	3.8e-64
>prophage 130
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1663908	1665597	5441077		Lactobacillus_phage(100.0%)	1	NA	NA
WP_129073926.1|1663908_1665597_+	FAD-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	25.9	2.9e-18
>prophage 131
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1678393	1683053	5441077		Klosneuvirus(33.33%)	6	NA	NA
WP_004147313.1|1678393_1679368_+	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	21.2	1.6e-08
WP_004177266.1|1679413_1679917_-	phosphatidylglycerophosphatase A	NA	NA	NA	NA	NA
WP_004178737.1|1679909_1680881_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_163589158.1|1680952_1681372_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_001021161.1|1681391_1681862_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
WP_117096250.1|1681949_1683053_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.2	5.0e-51
>prophage 132
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1686652	1690991	5441077	tRNA	uncultured_Mediterranean_phage(100.0%)	4	NA	NA
WP_002890403.1|1686652_1687624_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	39.1	3.6e-45
WP_002890400.1|1687634_1689482_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_002890398.1|1689508_1689841_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	4.9e-10
WP_002890395.1|1689863_1690991_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	1.6e-89
>prophage 133
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1707796	1716316	5441077		Bacillus_phage(60.0%)	6	NA	NA
WP_002890344.1|1707796_1709092_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.0	2.2e-26
WP_002890343.1|1709113_1709803_-	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	37.6	3.7e-36
WP_032419646.1|1709985_1711191_+	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	35.5	1.4e-06
WP_004151346.1|1711187_1714325_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	24.9	1.0e-08
WP_117096252.1|1714398_1715313_-	fructokinase	NA	NA	NA	NA	NA
WP_002890285.1|1715404_1716316_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	5.5e-104
>prophage 134
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1737570	1738338	5441077		Planktothrix_phage(100.0%)	1	NA	NA
WP_004183141.1|1737570_1738338_-	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	38.6	2.5e-25
>prophage 135
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1749341	1753051	5441077		Anomala_cuprea_entomopoxvirus(66.67%)	4	NA	NA
WP_004151354.1|1749341_1750124_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.8	8.8e-10
WP_002890126.1|1750116_1750812_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	23.9	1.1e-06
WP_002890106.1|1751421_1752231_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004151355.1|1752232_1753051_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.4	3.1e-34
>prophage 136
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1762574	1763417	5441077		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_117096256.1|1762574_1763417_+	phosphonate ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	26.2	1.8e-13
>prophage 137
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1766665	1768028	5441077	transposase	Bacillus_phage(100.0%)	1	NA	NA
WP_085955203.1|1766665_1768028_+|transposase	IS3-like element ISKpn1 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.5	1.4e-74
>prophage 138
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1771481	1786935	5441077	integrase	Enterobacteria_phage(50.0%)	16	1773273:1773287	1797429:1797443
WP_004144576.1|1771481_1772534_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	57.9	1.4e-111
WP_004144574.1|1772823_1773927_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
1773273:1773287	attL	CAATCTCTCCGCGCT	NA	NA	NA	NA
WP_004147253.1|1773937_1775191_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	1.5e-88
WP_032416079.1|1775546_1776761_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	55.7	3.7e-132
WP_032416077.1|1776829_1777420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045339018.1|1777587_1777785_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_020802552.1|1778256_1778502_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_021312336.1|1778494_1779370_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_017880047.1|1779366_1779582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020802561.1|1779578_1779782_+	hypothetical protein	NA	K7PHG9	Enterobacteria_phage	51.6	1.9e-12
WP_032416075.1|1779792_1780107_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_004191845.1|1780103_1781867_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	43.8	2.5e-105
WP_032416072.1|1782440_1783235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050484422.1|1783371_1783773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023342981.1|1784216_1785716_-	hypothetical protein	NA	A0A1S5SA14	Streptococcus_phage	29.4	8.3e-25
WP_023342982.1|1785807_1786935_-	hypothetical protein	NA	J9Q803	Salmonella_phage	31.7	3.8e-30
1797429:1797443	attR	CAATCTCTCCGCGCT	NA	NA	NA	NA
>prophage 139
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1794028	1795426	5441077		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_004147204.1|1794028_1795426_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.7	4.4e-44
>prophage 140
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1800077	1801073	5441077		Catovirus(100.0%)	1	NA	NA
WP_016946602.1|1800077_1801073_+	2-hydroxyacid dehydrogenase	NA	A0A1V0SBV6	Catovirus	29.9	1.4e-28
>prophage 141
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1808604	1809888	5441077		Klosneuvirus(100.0%)	1	NA	NA
WP_011977690.1|1808604_1809888_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	31.4	4.9e-34
>prophage 142
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1827246	1827828	5441077		Caulobacter_phage(100.0%)	1	NA	NA
WP_004145825.1|1827246_1827828_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	29.8	2.2e-13
>prophage 143
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1833336	1837546	5441077		Bradyrhizobium_phage(33.33%)	5	NA	NA
WP_004152034.1|1833336_1834068_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	36.9	7.1e-38
WP_002889686.1|1834132_1834600_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	56.6	8.0e-51
WP_004226378.1|1834596_1835265_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004145833.1|1835351_1836107_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_002889632.1|1836178_1837546_+	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	29.1	4.0e-10
>prophage 144
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1841611	1842415	5441077		Indivirus(100.0%)	1	NA	NA
WP_160584862.1|1841611_1842415_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	37.0	8.4e-40
>prophage 145
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1849092	1850124	5441077		Planktothrix_phage(100.0%)	1	NA	NA
WP_002889450.1|1849092_1850124_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.3	9.4e-36
>prophage 146
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1863107	1867207	5441077		Saccharomonospora_phage(50.0%)	2	NA	NA
WP_004177353.1|1863107_1866590_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.5	3.1e-208
WP_002889376.1|1866607_1867207_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.6	1.6e-27
>prophage 147
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1876038	1876815	5441077		Flavobacterium_phage(100.0%)	1	NA	NA
WP_004145863.1|1876038_1876815_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	40.7	6.2e-24
>prophage 148
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1888375	1889809	5441077	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_004145870.1|1888375_1889809_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.3	3.0e-24
>prophage 149
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1893764	1894109	5441077		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_002889275.1|1893764_1894109_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	53.2	1.2e-27
>prophage 150
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1900076	1900874	5441077		Planktothrix_phage(100.0%)	1	NA	NA
WP_002889212.1|1900076_1900874_-	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	27.4	9.2e-15
>prophage 151
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1923009	1929780	5441077	tRNA	Acanthamoeba_polyphaga_mimivirus(50.0%)	6	NA	NA
WP_163589167.1|1923009_1925439_-	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.5	3.9e-40
WP_004145901.1|1925511_1926048_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_002888848.1|1926047_1926764_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_002888845.1|1926926_1927382_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_004177391.1|1927441_1928323_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_071526609.1|1928385_1929780_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	36.9	1.6e-25
>prophage 152
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1935184	1941831	5441077		Anomala_cuprea_entomopoxvirus(33.33%)	6	NA	NA
WP_002888823.1|1935184_1936111_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.4	1.8e-22
WP_004894195.1|1936295_1936958_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_002888819.1|1937017_1937554_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	31.8	3.9e-17
WP_012542835.1|1937558_1937678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002888816.1|1937758_1940149_+	glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_004177397.1|1940232_1941831_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	51.1	7.5e-16
>prophage 153
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1953487	1954912	5441077		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_002888731.1|1953487_1954912_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.9	2.1e-41
>prophage 154
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1966251	1966815	5441077		Sphingobium_phage(100.0%)	1	NA	NA
WP_002888692.1|1966251_1966815_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	30.4	4.1e-09
>prophage 155
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1971082	1972126	5441077		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_004145938.1|1971082_1972126_-	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	55.9	3.1e-103
>prophage 156
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	1998318	2000043	5441077		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_002888534.1|1998318_2000043_-	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	25.8	3.3e-33
>prophage 157
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2011442	2012198	5441077		Streptococcus_phage(100.0%)	1	NA	NA
WP_004177420.1|2011442_2012198_+	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	36.5	4.2e-25
>prophage 158
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2020897	2021599	5441077		Bacillus_virus(100.0%)	1	NA	NA
WP_163589172.1|2020897_2021599_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	36.2	8.1e-23
>prophage 159
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2027811	2033263	5441077		Fish_lymphocystis_disease_virus(50.0%)	2	NA	NA
WP_117096283.1|2027811_2030169_+	DNA polymerase II	NA	X5FTI3	Fish_lymphocystis_disease_virus	23.4	8.8e-13
WP_117096284.1|2030356_2033263_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	36.9	4.9e-21
>prophage 160
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2045721	2047302	5441077		Pseudomonas_phage(50.0%)	2	NA	NA
WP_002888321.1|2045721_2046570_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A0A0YWI7	Pseudomonas_phage	48.4	3.4e-07
WP_002888320.1|2046822_2047302_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.2e-28
>prophage 161
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2053785	2054934	5441077		Halovirus(100.0%)	1	NA	NA
WP_023279869.1|2053785_2054934_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.1	9.1e-48
>prophage 162
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2061500	2071453	5441077	tRNA	Tupanvirus(25.0%)	8	NA	NA
WP_117096301.1|2061500_2064317_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	2.1e-77
WP_002887969.1|2064360_2065299_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_002887965.1|2065628_2065892_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_016531348.1|2065888_2066002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163589176.1|2066011_2066908_-	transcriptional activator NhaR	NA	NA	NA	NA	NA
WP_163589177.1|2066962_2068186_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	51.6	3.5e-90
WP_002887955.1|2068315_2069449_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	35.5	1.2e-28
WP_004146997.1|2069536_2071453_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.6	6.4e-147
>prophage 163
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2075848	2076802	5441077		Cyanophage(100.0%)	1	NA	NA
WP_002887897.1|2075848_2076802_-	transaldolase	NA	A0A127KNC6	Cyanophage	32.1	1.3e-10
>prophage 164
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2093832	2098992	5441077		Bacillus_phage(33.33%)	3	NA	NA
WP_004182874.1|2093832_2095770_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	35.5	2.7e-12
WP_002887805.1|2095998_2097666_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.8	2.9e-42
WP_002887802.1|2097759_2098992_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	44.3	1.3e-87
>prophage 165
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2105323	2106646	5441077		Geobacillus_virus(100.0%)	1	NA	NA
WP_002887787.1|2105323_2106646_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	40.9	2.0e-78
>prophage 166
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2111381	2114102	5441077		Salmonella_phage(50.0%)	3	NA	NA
WP_002887716.1|2111381_2111543_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	67.9	1.2e-11
WP_135711582.1|2111672_2112293_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_002887711.1|2112512_2114102_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.9	5.3e-30
>prophage 167
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2127325	2128605	5441077		Salmonella_phage(50.0%)	2	NA	NA
WP_002887624.1|2127325_2127865_+	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.4e-27
WP_002887623.1|2127867_2128605_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	51.7	1.2e-64
>prophage 168
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2131765	2134933	5441077	transposase	Sodalis_phage(50.0%)	3	NA	NA
WP_163589181.1|2131765_2132710_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.4	2.2e-68
WP_025368464.1|2132843_2133854_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_004177511.1|2133871_2134933_-	SIS domain-containing protein	NA	M1I2B0	Paramecium_bursaria_Chlorella_virus	23.1	1.1e-07
>prophage 169
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2169756	2170659	5441077	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_020805202.1|2169756_2170659_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	45.3	3.5e-71
>prophage 170
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2187022	2188507	5441077		Bacillus_virus(100.0%)	1	NA	NA
WP_009309139.1|2187022_2188507_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.9	1.1e-13
>prophage 171
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2192423	2195168	5441077		Staphylococcus_phage(100.0%)	1	NA	NA
WP_117096299.1|2192423_2195168_+	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	2.7e-21
>prophage 172
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2204918	2207025	5441077		Hokovirus(50.0%)	2	NA	NA
WP_117096944.1|2204918_2206352_-	heavy metal sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	27.6	7.0e-13
WP_002887273.1|2206341_2207025_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	36.0	7.9e-31
>prophage 173
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2210263	2215221	5441077		Leptospira_phage(33.33%)	4	NA	NA
WP_163589187.1|2210263_2213413_+	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.4	7.8e-57
WP_004177568.1|2213485_2213833_+	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
WP_002887259.1|2213842_2214376_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	59.6	8.2e-52
WP_002887258.1|2214492_2215221_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	47.4	1.4e-46
>prophage 174
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2251449	2252596	5441077	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_087785717.1|2251449_2252596_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	93.0	1.9e-146
>prophage 175
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2255772	2256675	5441077		Bacillus_phage(100.0%)	1	NA	NA
WP_024195727.1|2255772_2256675_-	sce7726 family protein	NA	J9PQI8	Bacillus_phage	36.4	2.6e-05
>prophage 176
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2261539	2267590	5441077		Staphylococcus_phage(50.0%)	3	NA	NA
WP_016239399.1|2261539_2263087_+	SAM-dependent DNA methyltransferase	NA	A0A2H4PQP4	Staphylococcus_phage	27.8	2.5e-48
WP_016239398.1|2263083_2264283_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_023337662.1|2264341_2267590_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	28.6	1.5e-63
>prophage 177
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2277073	2280150	5441077	integrase,transposase	Cellulophaga_phage(33.33%)	3	2270163:2270174	2280860:2280871
2270163:2270174	attL	TCATAAAAATAT	NA	NA	NA	NA
WP_148414671.1|2277073_2277637_+	helix-turn-helix domain-containing protein	NA	M1PL54	Cellulophaga_phage	45.6	1.2e-37
WP_015958259.1|2277859_2278828_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.6	1.0e-180
WP_016239763.1|2278899_2280150_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	40.0	7.8e-85
2280860:2280871	attR	ATATTTTTATGA	NA	NA	NA	NA
>prophage 178
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2283264	2288090	5441077		Tupanvirus(50.0%)	5	NA	NA
WP_004177639.1|2283264_2284284_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	31.7	1.1e-44
WP_019704399.1|2284414_2285299_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_004177643.1|2285288_2286176_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_004178398.1|2286186_2287011_+	phosphodiesterase	NA	NA	NA	NA	NA
WP_004186744.1|2287016_2288090_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.1	5.2e-29
>prophage 179
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2302517	2311567	5441077	tRNA	Klebsiella_phage(33.33%)	6	NA	NA
WP_002886957.1|2302517_2304020_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	45.1	1.6e-84
WP_002886956.1|2304068_2305151_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_002886955.1|2305150_2306248_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_002886954.1|2306637_2308149_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.4	9.2e-48
WP_002886953.1|2308268_2308712_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_002886952.1|2308711_2311567_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.4	6.0e-141
>prophage 180
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2321663	2327722	5441077		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_002886928.1|2321663_2322599_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.9	1.3e-52
WP_002886927.1|2322612_2323074_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_002886926.1|2323226_2323613_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_117096819.1|2323686_2326395_-	magnesium-translocating P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	26.5	1.2e-45
WP_040147041.1|2326774_2327722_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	23.6	1.1e-11
>prophage 181
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2335479	2338678	5441077		Vibrio_phage(33.33%)	3	NA	NA
WP_004222153.1|2335479_2337618_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.2	4.1e-267
WP_004178375.1|2337925_2338390_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	59.5	3.8e-53
WP_004178374.1|2338393_2338678_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	59.6	1.4e-26
>prophage 182
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2354443	2361022	5441077		Klosneuvirus(33.33%)	6	NA	NA
WP_008807144.1|2354443_2355442_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.9	2.5e-70
WP_002886825.1|2355484_2356483_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_040088026.1|2356469_2357495_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004177669.1|2357505_2359008_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.2	7.6e-10
WP_002886769.1|2359131_2360088_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002886766.1|2360491_2361022_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	62.7	2.7e-55
>prophage 183
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2378234	2379203	5441077	transposase	Salmonella_phage(100.0%)	1	NA	NA
WP_016809156.1|2378234_2379203_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	3.9e-185
>prophage 184
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2412108	2416452	5441077		Lactococcus_phage(50.0%)	3	NA	NA
WP_117096787.1|2412108_2414541_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.7	1.4e-66
WP_002885667.1|2414577_2415003_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_002885665.1|2415153_2416452_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	1.7e-66
>prophage 185
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2422383	2425609	5441077		Wolbachia_phage(50.0%)	2	NA	NA
WP_160340601.1|2422383_2423844_-	DNA mismatch repair protein MutL	NA	A0A1B2LRQ5	Wolbachia_phage	33.8	4.4e-23
WP_004177713.1|2424253_2425609_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	30.1	1.8e-18
>prophage 186
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2430451	2430997	5441077		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_002885538.1|2430451_2430997_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	42.1	1.2e-29
>prophage 187
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2438351	2443545	5441077		Tupanvirus(33.33%)	6	NA	NA
WP_004146714.1|2438351_2439329_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	29.7	2.8e-29
WP_163589209.1|2439604_2441395_+	fumarate reductase (quinol) flavoprotein subunit	NA	A0A2P0ZL82	Lactobacillus_phage	27.2	3.8e-16
WP_163589210.1|2441387_2442122_+	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_025368530.1|2442132_2442528_+	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_117096781.1|2442538_2442898_+	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_002885523.1|2443011_2443545_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	50.0	5.0e-41
>prophage 188
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2455009	2455978	5441077	transposase	Salmonella_phage(100.0%)	1	NA	NA
WP_015958259.1|2455009_2455978_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.6	1.0e-180
>prophage 189
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2459127	2461105	5441077		Vibrio_phage(50.0%)	2	NA	NA
WP_163589211.1|2459127_2460774_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	69.1	5.3e-190
WP_163589212.1|2460811_2461105_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	35.8	2.1e-09
>prophage 190
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2481415	2485152	5441077		Escherichia_phage(50.0%)	6	NA	NA
WP_004221988.1|2481415_2482099_+	TerC family protein	NA	W8EBD0	Pseudomonas_phage	42.2	5.1e-30
WP_020316611.1|2482055_2482169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002885338.1|2482244_2483162_+	curved DNA-binding protein	NA	A0A1V0SCV5	Indivirus	42.2	2.8e-07
WP_002885324.1|2483161_2483467_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_117096668.1|2483841_2484186_-	plasmid stabilization protein	NA	A0A222YWJ6	Escherichia_phage	58.6	3.7e-13
WP_004146678.1|2484195_2485152_-	recombinase	NA	A0A222YXF2	Escherichia_phage	78.0	1.3e-143
>prophage 191
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2489516	2491019	5441077		Burkholderia_virus(100.0%)	1	NA	NA
WP_004177782.1|2489516_2491019_-	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	32.7	1.1e-56
>prophage 192
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2496380	2497927	5441077		Bacillus_virus(50.0%)	2	NA	NA
WP_004178305.1|2496380_2497139_+	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	26.7	6.7e-15
WP_163589213.1|2497246_2497927_+	phosphonate C-P lyase system protein PhnL	NA	F2Y1V6	Organic_Lake_phycodnavirus	26.0	8.7e-06
>prophage 193
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2503307	2504828	5441077		Staphylococcus_phage(100.0%)	1	NA	NA
WP_117096675.1|2503307_2504828_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.5	2.2e-17
>prophage 194
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2510769	2517554	5441077		Escherichia_phage(50.0%)	5	NA	NA
WP_117096678.1|2510769_2512917_+	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	24.1	1.0e-31
WP_004151733.1|2513146_2513833_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_004146659.1|2513869_2515183_-	glutamate/aspartate:proton symporter GltP	NA	NA	NA	NA	NA
WP_032412778.1|2515294_2515495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002885145.1|2515595_2517554_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	41.3	3.0e-91
>prophage 195
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2529839	2531189	5441077		Moraxella_phage(100.0%)	1	NA	NA
WP_002885079.1|2529839_2531189_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.1	1.5e-158
>prophage 196
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2538718	2539801	5441077		Bacillus_virus(100.0%)	1	NA	NA
WP_004151741.1|2538718_2539801_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.3	3.2e-26
>prophage 197
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2551729	2557036	5441077		Vibrio_phage(33.33%)	3	NA	NA
WP_004192628.1|2551729_2553310_+	lytic transglycosylase F	NA	K7RVN3	Vibrio_phage	31.7	6.3e-07
WP_004151744.1|2553434_2553959_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	95.4	5.1e-54
WP_004146620.1|2554210_2557036_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.6	0.0e+00
>prophage 198
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2560217	2562744	5441077		Yellowstone_lake_mimivirus(50.0%)	2	NA	NA
WP_002884943.1|2560217_2561297_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.4	1.9e-26
WP_002884942.1|2561328_2562744_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.8	5.7e-201
>prophage 199
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2568739	2569348	5441077		Lactococcus_phage(100.0%)	1	NA	NA
WP_002884822.1|2568739_2569348_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	40.7	4.6e-14
>prophage 200
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2576414	2577524	5441077		Mycoplasma_phage(100.0%)	1	NA	NA
WP_002884743.1|2576414_2577524_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	3.6e-17
>prophage 201
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2594032	2594836	5441077		Moumouvirus(100.0%)	1	NA	NA
WP_004221836.1|2594032_2594836_+	SDR family oxidoreductase	NA	A0A2P1ELN2	Moumouvirus	24.2	2.3e-05
>prophage 202
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2601404	2605088	5441077		Dickeya_phage(100.0%)	1	NA	NA
WP_004151753.1|2601404_2605088_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	4.9e-26
>prophage 203
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2618807	2620397	5441077		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_065804665.1|2618807_2620397_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	49.0	5.3e-70
>prophage 204
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2625818	2627582	5441077		Bacillus_phage(50.0%)	3	NA	NA
WP_002884342.1|2625818_2626091_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	56.7	9.4e-20
WP_002884331.1|2626277_2626868_-	YjaG family protein	NA	NA	NA	NA	NA
WP_117096926.1|2626910_2627582_-	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	27.6	2.0e-18
>prophage 205
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2636007	2648450	5441077		Bacillus_phage(33.33%)	6	NA	NA
WP_004178221.1|2636007_2637540_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.1	2.2e-12
WP_002884150.1|2637712_2638018_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002884149.1|2638021_2638339_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_004192681.1|2638381_2639722_-	anaerobic C4-dicarboxylate transporter DcuB	NA	NA	NA	NA	NA
WP_002884146.1|2640121_2644345_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.5	9.1e-69
WP_004152306.1|2644421_2648450_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	28.6	2.3e-21
>prophage 206
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2652611	2655732	5441077		Tupanvirus(50.0%)	2	NA	NA
WP_004174069.1|2652611_2653796_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	27.2	5.2e-14
WP_002883524.1|2654781_2655732_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	2.7e-29
>prophage 207
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2665498	2666113	5441077		Streptococcus_phage(100.0%)	1	NA	NA
WP_002883449.1|2665498_2666113_-	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	32.5	9.6e-20
>prophage 208
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2674830	2678174	5441077		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_002883427.1|2674830_2675610_-	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	31.7	7.4e-25
WP_002883426.1|2675612_2676149_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_002883425.1|2676152_2676404_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_004177924.1|2676533_2678174_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	2.2e-39
>prophage 209
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2690175	2693637	5441077	transposase	Sodalis_phage(50.0%)	3	NA	NA
WP_004895074.1|2690175_2691084_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.8	3.7e-68
WP_004152056.1|2691128_2691749_-	threonine export protein RhtC	NA	NA	NA	NA	NA
WP_004152055.1|2691810_2693637_-	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	5.7e-84
>prophage 210
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2697473	2701318	5441077		Bacillus_phage(50.0%)	3	NA	NA
WP_002883398.1|2697473_2699636_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.3	6.0e-117
WP_002883397.1|2699699_2700416_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_002883396.1|2700415_2701318_-	tyrosine recombinase XerC	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	29.4	5.9e-18
>prophage 211
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2717600	2723742	5441077		uncultured_marine_virus(20.0%)	6	NA	NA
WP_002883310.1|2717600_2718731_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	40.9	3.3e-18
WP_004146507.1|2718736_2719411_-	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_019704852.1|2719388_2720270_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	67.7	2.7e-108
WP_163589221.1|2720288_2721356_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	6.2e-99
WP_002883302.1|2721352_2722615_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HPJ2	Paramecium_bursaria_Chlorella_virus	25.9	3.8e-23
WP_002883297.1|2722611_2723742_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	33.2	9.7e-26
>prophage 212
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2727792	2729729	5441077		Indivirus(50.0%)	2	NA	NA
WP_002883224.1|2727792_2728122_-	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	39.6	2.5e-14
WP_002883222.1|2728463_2729729_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.3	1.8e-41
>prophage 213
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2734220	2736242	5441077		Bacillus_phage(100.0%)	1	NA	NA
WP_004181641.1|2734220_2736242_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.0	1.4e-112
>prophage 214
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2744345	2745992	5441077		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_002883142.1|2744345_2745992_-	acetolactate synthase 2 catalytic subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	32.9	3.1e-65
>prophage 215
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2756053	2757892	5441077		Acinetobacter_phage(100.0%)	1	NA	NA
WP_004146288.1|2756053_2757892_-	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	29.2	2.3e-08
>prophage 216
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2772522	2773185	5441077		Cyanophage(100.0%)	1	NA	NA
WP_004177977.1|2772522_2773185_+	fructose-6-phosphate aldolase	NA	M4SLG0	Cyanophage	34.0	4.6e-28
>prophage 217
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2790577	2791912	5441077		Erwinia_phage(100.0%)	1	NA	NA
WP_163589225.1|2790577_2791912_+	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	29.7	1.6e-43
>prophage 218
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2796426	2799929	5441077		Feldmannia_irregularis_virus(33.33%)	4	NA	NA
WP_163589227.1|2796426_2797125_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	28.7	1.8e-06
WP_163589228.1|2797121_2798495_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	24.0	1.4e-10
WP_002882896.1|2798561_2799236_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_002882894.1|2799308_2799929_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	57.9	3.5e-62
>prophage 219
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2808267	2809779	5441077		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004151860.1|2808267_2809779_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.0	7.6e-18
>prophage 220
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2832751	2833669	5441077		Pandoravirus(100.0%)	1	NA	NA
WP_021466676.1|2832751_2833669_+	alpha/beta hydrolase	NA	S4W4Z4	Pandoravirus	28.9	1.5e-16
>prophage 221
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2840490	2842958	5441077		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_004146229.1|2840490_2841540_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	1.0e-08
WP_002882749.1|2841548_2842958_+	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.3	4.8e-06
>prophage 222
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2846846	2849639	5441077		uncultured_virus(100.0%)	1	NA	NA
WP_117096738.1|2846846_2849639_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.5	1.4e-70
>prophage 223
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2863929	2869808	5441077		Enterobacteria_phage(33.33%)	5	NA	NA
WP_002882536.1|2863929_2864820_-	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	3.3e-05
WP_163589232.1|2864847_2865813_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_002882529.1|2865818_2867324_-	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2K9L0W2	Tupanvirus	22.3	4.0e-19
WP_002882527.1|2867334_2867754_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_002882520.1|2867939_2869808_-	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	8.4e-67
>prophage 224
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2872973	2873966	5441077		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_002882514.1|2872973_2873966_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.0	4.6e-48
>prophage 225
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2886316	2891077	5441077		Chrysochromulina_ericina_virus(33.33%)	3	NA	NA
WP_004173839.1|2886316_2887687_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.6	2.8e-35
WP_008806727.1|2887870_2889700_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1H1Z3	Paramecium_bursaria_Chlorella_virus	41.4	1.9e-124
WP_004150308.1|2890036_2891077_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	38.1	3.4e-49
>prophage 226
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2899817	2900633	5441077		Autographa_californica_nuclear_polyhedrosis_virus(100.0%)	1	NA	NA
WP_000018329.1|2899817_2900633_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
>prophage 227
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2907407	2908745	5441077		Moraxella_phage(100.0%)	1	NA	NA
WP_004145100.1|2907407_2908745_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.6	1.1e-63
>prophage 228
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2916238	2923768	5441077		Staphylococcus_phage(33.33%)	7	NA	NA
WP_004151536.1|2916238_2916496_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	55.2	9.2e-17
WP_004151535.1|2916459_2916819_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_000831330.1|2916834_2916975_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_004151534.1|2917596_2919000_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_004145090.1|2919004_2920105_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.2	1.8e-53
WP_004151532.1|2920251_2921325_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_004173845.1|2921353_2923768_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.3	8.2e-115
>prophage 229
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2929535	2930684	5441077		Oenococcus_phage(100.0%)	1	NA	NA
WP_004150286.1|2929535_2930684_+	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	33.7	4.7e-52
>prophage 230
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2934119	2936039	5441077		Cyanophage(33.33%)	3	NA	NA
WP_004151523.1|2934119_2934533_+	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
WP_004145074.1|2934649_2935078_+	heat shock chaperone IbpB	NA	A0A2H4N7P1	Lake_Baikal_phage	41.1	2.6e-16
WP_009308837.1|2935214_2936039_+	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	77.9	2.2e-91
>prophage 231
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2946959	2952399	5441077		Salmonella_phage(50.0%)	7	NA	NA
WP_004181587.1|2946959_2948144_-	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	25.2	1.1e-11
WP_002923296.1|2948319_2949153_-	EamA family transporter	NA	NA	NA	NA	NA
WP_023279346.1|2949221_2949668_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004145059.1|2949758_2949878_-	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_014343455.1|2950330_2950498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002923286.1|2950510_2950606_+	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_004173858.1|2950710_2952399_+	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	31.0	2.9e-58
>prophage 232
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2964577	2965690	5441077		Bacillus_virus(100.0%)	1	NA	NA
WP_004181577.1|2964577_2965690_+	2-aminoethylphosphonate ABC transport system ATP-binding subunit PhnT	NA	G3M9Y6	Bacillus_virus	33.5	1.5e-26
>prophage 233
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	2984125	2985289	5441077		Salmonella_phage(100.0%)	1	NA	NA
WP_015959157.1|2984125_2985289_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.9	7.6e-26
>prophage 234
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3002419	3003469	5441077		Tupanvirus(100.0%)	1	NA	NA
WP_004901462.1|3002419_3003469_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	43.9	3.4e-73
>prophage 235
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3016642	3019218	5441077	transposase	Mannheimia_phage(50.0%)	2	NA	NA
WP_032736789.1|3016642_3017689_-|transposase	IS481-like element ISKpn28 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	21.9	1.3e-05
WP_004150226.1|3017826_3019218_-	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	95.2	1.4e-66
>prophage 236
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3022352	3023204	5441077		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_002922941.1|3022352_3023204_-	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.2	2.2e-14
>prophage 237
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3034185	3042476	5441077		Bordetella_phage(25.0%)	7	NA	NA
WP_004150214.1|3034185_3036306_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
WP_000135058.1|3036324_3036600_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_002922664.1|3036654_3037278_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	35.0	1.7e-19
WP_064164082.1|3037536_3039213_+	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	23.8	1.9e-22
WP_002922654.1|3039218_3039836_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_004188107.1|3040111_3041362_+	chloride channel protein	NA	NA	NA	NA	NA
WP_117096620.1|3041417_3042476_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	47.5	4.1e-18
>prophage 238
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3047518	3048436	5441077		Staphylococcus_phage(100.0%)	1	NA	NA
WP_163589240.1|3047518_3048436_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.5	3.6e-23
>prophage 239
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3053075	3057764	5441077		Xanthomonas_phage(25.0%)	7	NA	NA
WP_004145270.1|3053075_3053534_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	4.7e-48
WP_049118145.1|3053511_3054729_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.4	3.2e-43
WP_002922589.1|3054898_3055564_+	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_000091955.1|3055780_3056017_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_002922510.1|3056037_3056205_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_004173907.1|3056340_3057150_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.1	2.2e-24
WP_002922501.1|3057284_3057764_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.3	2.8e-27
>prophage 240
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3070532	3079682	5441077		Prochlorococcus_phage(20.0%)	9	NA	NA
WP_002922463.1|3070532_3071465_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	36.4	2.2e-36
WP_002922462.1|3071678_3072872_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	28.5	1.7e-36
WP_002922461.1|3072884_3073910_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	82.7	3.6e-19
WP_002922460.1|3074078_3074867_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_002922459.1|3074872_3075820_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_002922458.1|3075823_3077095_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	30.3	3.5e-08
WP_117096625.1|3077104_3078649_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_002922436.1|3078894_3079326_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_002922429.1|3079430_3079682_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	52.1	9.9e-16
>prophage 241
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3095528	3097370	5441077		Tupanvirus(100.0%)	1	NA	NA
WP_020804947.1|3095528_3097370_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	24.7	1.2e-12
>prophage 242
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3105344	3106886	5441077		Staphylococcus_phage(100.0%)	1	NA	NA
WP_002922346.1|3105344_3106886_-	xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	2.5e-16
>prophage 243
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3112354	3113350	5441077		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_004173929.1|3112354_3113350_-	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	24.6	1.6e-08
>prophage 244
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3117253	3120758	5441077	transposase	Mannheimia_phage(33.33%)	4	NA	NA
WP_004173931.1|3117253_3118300_-|transposase	IS481-like element ISKpn28 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	21.9	1.3e-05
WP_002922102.1|3118373_3118526_+	type I toxin-antitoxin system toxin HokA	NA	NA	NA	NA	NA
WP_163589246.1|3118827_3120447_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1B0RXA0	Streptococcus_phage	25.8	1.4e-25
WP_000014594.1|3120545_3120758_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 245
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3124160	3125132	5441077		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_117096639.1|3124160_3125132_-	glyoxylate/hydroxypyruvate reductase GhrB	NA	M1HST2	Paramecium_bursaria_Chlorella_virus	26.9	2.9e-18
>prophage 246
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3130291	3133031	5441077		Escherichia_phage(50.0%)	2	NA	NA
WP_163589248.1|3130291_3132622_+	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	A0A077SK27	Escherichia_phage	29.3	4.4e-65
WP_062920402.1|3132590_3133031_-	N-acetyltransferase	NA	A0A1X9I6I8	Streptococcus_phage	33.6	1.0e-15
>prophage 247
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3139544	3140907	5441077	transposase	Bacillus_phage(100.0%)	1	NA	NA
WP_085955203.1|3139544_3140907_+|transposase	IS3-like element ISKpn1 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.5	1.4e-74
>prophage 248
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3145231	3151204	5441077		Planktothrix_phage(33.33%)	6	NA	NA
WP_002921785.1|3145231_3146215_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.1	2.3e-15
WP_002921784.1|3146211_3147225_+	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.4	7.4e-17
WP_004145206.1|3147243_3147423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004186070.1|3147739_3148279_+	cellulose biosynthesis protein BcsO	NA	NA	NA	NA	NA
WP_004173940.1|3148269_3149073_+	cellulose synthase operon protein YhjQ	NA	NA	NA	NA	NA
WP_050484911.1|3149092_3151204_+	UDP-forming cellulose synthase catalytic subunit	NA	M1I277	Paramecium_bursaria_Chlorella_virus	34.2	4.6e-37
>prophage 249
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3157963	3158932	5441077	transposase	Salmonella_phage(100.0%)	1	NA	NA
WP_015958259.1|3157963_3158932_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.6	1.0e-180
>prophage 250
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3195994	3198037	5441077		Indivirus(100.0%)	1	NA	NA
WP_004151426.1|3195994_3198037_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	22.8	3.8e-44
>prophage 251
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3206578	3207370	5441077		Bacillus_virus(100.0%)	1	NA	NA
WP_117096754.1|3206578_3207370_-	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	27.8	2.9e-13
>prophage 252
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3213472	3217579	5441077		Tupanvirus(66.67%)	3	NA	NA
WP_004889389.1|3213472_3214612_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L0G1	Tupanvirus	27.3	3.2e-29
WP_163589255.1|3214613_3215597_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase ArnC	NA	A8CG95	Salmonella_phage	33.3	1.3e-37
WP_002921032.1|3215593_3217579_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.7	5.7e-21
>prophage 253
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3223879	3228016	5441077		Dickeya_phage(50.0%)	4	NA	NA
WP_002920860.1|3223879_3224545_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	55.8	2.1e-57
WP_002920858.1|3224751_3224997_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	86.1	4.7e-10
WP_004145145.1|3225100_3227311_-	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	36.1	1.1e-113
WP_004173987.1|3227389_3228016_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	60.2	2.1e-30
>prophage 254
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3231100	3236901	5441077		Staphylococcus_phage(25.0%)	5	NA	NA
WP_002920817.1|3231100_3231769_+	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	26.1	5.0e-14
WP_002920816.1|3231761_3232817_+	cell division protein FtsX	NA	NA	NA	NA	NA
WP_002920815.1|3233086_3233941_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.7	7.0e-45
WP_004889407.1|3233993_3235517_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	26.2	1.4e-14
WP_117096749.1|3235635_3236901_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.4	3.0e-23
>prophage 255
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3244345	3246578	5441077		Anomala_cuprea_entomopoxvirus(66.67%)	4	NA	NA
WP_002920803.1|3244345_3245113_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.4	5.8e-14
WP_004145133.1|3245114_3245828_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.2	1.7e-12
WP_004174006.1|3245991_3246213_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_004185990.1|3246209_3246578_+	type II toxin-antitoxin system death-on-curing family toxin	NA	E4ZFM2	Streptococcus_phage	30.1	4.6e-09
>prophage 256
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3250004	3251812	5441077		Planktothrix_phage(50.0%)	2	NA	NA
WP_004150074.1|3250004_3251075_+	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	34.7	2.6e-20
WP_004185985.1|3251071_3251812_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.0	4.1e-09
>prophage 257
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3269556	3272004	5441077		Dickeya_phage(100.0%)	1	NA	NA
WP_002920561.1|3269556_3272004_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	83.3	2.7e-33
>prophage 258
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3275861	3276620	5441077		Escherichia_phage(100.0%)	1	NA	NA
WP_002920548.1|3275861_3276620_+	DeoR/GlpR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	31.6	2.3e-23
>prophage 259
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3279965	3282356	5441077		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_004151407.1|3279965_3282356_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	40.2	1.1e-13
>prophage 260
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3295182	3298954	5441077		Bacillus_phage(66.67%)	3	NA	NA
WP_001157751.1|3295182_3295902_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
WP_002920333.1|3295898_3297254_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	24.7	1.6e-11
WP_004210368.1|3297331_3298954_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	51.3	1.7e-140
>prophage 261
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3313777	3314605	5441077		Vibrio_phage(100.0%)	1	NA	NA
WP_002920260.1|3313777_3314605_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	50.0	6.1e-70
>prophage 262
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3326006	3335650	5441077		Acinetobacter_phage(25.0%)	10	NA	NA
WP_002920229.1|3326006_3326570_+	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	58.4	8.1e-58
WP_004174049.1|3326660_3327881_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_117096724.1|3327870_3329949_-	hypothetical protein	NA	H9YQA8	environmental_Halophage	84.8	4.1e-62
WP_000242758.1|3330000_3330633_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_002920158.1|3330939_3331344_+	OsmC family protein	NA	NA	NA	NA	NA
WP_002920153.1|3331398_3332268_-	phosphoribulokinase	NA	NA	NA	NA	NA
WP_002920151.1|3332304_3332523_-	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	37.3	4.0e-05
WP_024264627.1|3332519_3333518_-	hydrolase	NA	NA	NA	NA	NA
WP_014343437.1|3333482_3333683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004185926.1|3333745_3335650_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	33.9	6.5e-75
>prophage 263
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3343495	3346864	5441077		Streptococcus_phage(50.0%)	2	NA	NA
WP_002920103.1|3343495_3345610_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.6	1.8e-57
WP_004174069.1|3345679_3346864_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	27.2	5.2e-14
>prophage 264
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3366767	3368239	5441077	tRNA	Prochlorococcus_phage(50.0%)	2	NA	NA
WP_004150007.1|3366767_3367715_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
WP_004174081.1|3367729_3368239_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	1.5e-18
>prophage 265
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3395770	3396814	5441077		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_002918653.1|3395770_3396814_+	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 266
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3414864	3416133	5441077		Oenococcus_phage(100.0%)	1	NA	NA
WP_004181428.1|3414864_3416133_+	SLC13/DASS family transporter	NA	Q6A201	Oenococcus_phage	33.5	1.8e-60
>prophage 267
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3423118	3424486	5441077	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_004174125.1|3423118_3424486_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	6.0e-22
>prophage 268
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3428431	3428926	5441077	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_002918465.1|3428431_3428926_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	1.5e-26
>prophage 269
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3436371	3437304	5441077		Staphylococcus_phage(100.0%)	1	NA	NA
WP_002918455.1|3436371_3437304_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	33.8	3.4e-16
>prophage 270
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3441248	3454179	5441077		Hokovirus(16.67%)	15	NA	NA
WP_002918444.1|3441248_3443588_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	30.6	9.3e-39
WP_021314737.1|3443821_3444475_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_117096566.1|3444471_3445197_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_002918431.1|3445260_3445533_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_002918428.1|3445529_3446384_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.4e-05
WP_004144926.1|3446429_3446918_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_002918423.1|3446988_3447276_-	ribosome hibernation promoting factor	NA	NA	NA	NA	NA
WP_002918420.1|3447298_3448732_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_002918417.1|3448779_3449505_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	9.3e-22
WP_002918415.1|3449511_3450057_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_002918413.1|3450025_3450601_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_002918405.1|3450597_3451164_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	81.3	5.3e-57
WP_002918399.1|3451178_3452165_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.8	3.0e-39
WP_002918397.1|3452179_3453157_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_004150950.1|3453366_3454179_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	28.8	1.6e-17
>prophage 271
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3458228	3459670	5441077		Vibrio_phage(50.0%)	2	NA	NA
WP_002918381.1|3458228_3458501_-	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	63.5	3.1e-15
WP_004144907.1|3458698_3459670_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.0	1.0e-07
>prophage 272
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3466268	3469145	5441077	protease	Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_002918372.1|3466268_3468203_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.5	4.1e-117
WP_002918371.1|3468296_3469145_+	dihydropteroate synthase	NA	S4VNV0	Pandoravirus	30.7	6.0e-20
>prophage 273
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3473408	3480027	5441077		Dickeya_phage(50.0%)	5	NA	NA
WP_163589264.1|3473408_3474752_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
WP_032413455.1|3474731_3474887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002918364.1|3475344_3475797_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_002918252.1|3475824_3477312_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_002918250.1|3477336_3480027_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.4	5.1e-25
>prophage 274
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3485441	3487373	5441077		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_004150943.1|3485441_3487373_+	ATP-dependent RNA helicase DeaD	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	31.0	2.1e-52
>prophage 275
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3493066	3500942	5441077		Invertebrate_iridovirus(25.0%)	10	NA	NA
WP_002918226.1|3493066_3493357_-	GIY-YIG nuclease family protein	NA	S6DF82	Invertebrate_iridovirus	52.6	3.1e-13
WP_002918223.1|3493406_3493850_+	YhbP family protein	NA	NA	NA	NA	NA
WP_002918221.1|3493811_3494348_-	type 1 glutamine amidotransferase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	9.3e-11
WP_002918218.1|3494476_3495124_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_004188467.1|3495199_3496240_+	permease	NA	NA	NA	NA	NA
WP_002918214.1|3496361_3496937_-	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_002918211.1|3496946_3497537_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.8	5.4e-12
WP_002918206.1|3497562_3497949_-	YraN family protein	NA	NA	NA	NA	NA
WP_117096574.1|3497906_3500015_-	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_004213223.1|3500078_3500942_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	47.5	1.6e-49
>prophage 276
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3506216	3507362	5441077		Streptococcus_phage(100.0%)	1	NA	NA
WP_015959048.1|3506216_3507362_+	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	39.2	9.7e-50
>prophage 277
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3524266	3525238	5441077		Escherichia_phage(100.0%)	1	NA	NA
WP_004144845.1|3524266_3525238_-	TerC family protein	NA	A0A291LBC5	Escherichia_phage	32.4	1.5e-35
>prophage 278
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3534831	3536319	5441077		Staphylococcus_phage(100.0%)	1	NA	NA
WP_117096582.1|3534831_3536319_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.3	1.4e-19
>prophage 279
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3540590	3541970	5441077		Klosneuvirus(100.0%)	1	NA	NA
WP_032433597.1|3540590_3541970_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.0	1.4e-31
>prophage 280
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3555108	3556077	5441077	transposase	Salmonella_phage(100.0%)	1	NA	NA
WP_074185243.1|3555108_3556077_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.3	6.5e-172
>prophage 281
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3561114	3561918	5441077		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_117096589.1|3561114_3561918_+	aquaporin	NA	M1HJ75	Acanthocystis_turfacea_Chlorella_virus	31.5	2.1e-14
>prophage 282
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3570089	3575473	5441077	tRNA	Vibrio_phage(33.33%)	4	NA	NA
WP_004174339.1|3570089_3571931_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_004149864.1|3572149_3573895_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.7	1.6e-75
WP_001144069.1|3574006_3574222_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_004900709.1|3574459_3575473_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	1.4e-108
>prophage 283
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3584766	3586008	5441077		Sinorhizobium_phage(100.0%)	1	NA	NA
WP_002916864.1|3584766_3586008_-	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	50.1	5.2e-89
>prophage 284
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3591119	3598000	5441077		uncultured_Mediterranean_phage(25.0%)	9	NA	NA
WP_163589269.1|3591119_3592553_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.8	1.1e-39
WP_004144536.1|3592630_3592780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002916857.1|3592771_3592969_+	cell surface composition regulator GlgS	NA	NA	NA	NA	NA
WP_002916856.1|3593004_3593277_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_004185664.1|3593654_3594308_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.8	3.1e-45
WP_004213783.1|3594369_3595140_-	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_004174357.1|3595326_3596118_+	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_163589270.1|3596162_3597323_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.9	1.2e-87
WP_002916849.1|3597328_3598000_-	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	48.3	9.7e-42
>prophage 285
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3602345	3604241	5441077		Bacillus_virus(100.0%)	1	NA	NA
WP_002916844.1|3602345_3604241_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	34.7	5.9e-92
>prophage 286
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3607553	3617456	5441077		Stx_converting_phage(25.0%)	8	NA	NA
WP_002916833.1|3607553_3607949_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	42.5	9.8e-18
WP_002916831.1|3608026_3608896_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004181324.1|3609017_3611276_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	36.1	1.4e-84
WP_002916826.1|3611467_3612205_+	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_004144547.1|3612288_3613701_+	cell division protein FtsP	NA	NA	NA	NA	NA
WP_004174383.1|3613824_3616008_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	1.0e-103
WP_004144550.1|3616065_3616593_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002916796.1|3616628_3617456_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	42.9	3.4e-60
>prophage 287
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3643877	3644963	5441077		Geobacillus_virus(100.0%)	1	NA	NA
WP_004144786.1|3643877_3644963_-	membrane-bound lytic murein transglycosylase MltC	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	1.0e-11
>prophage 288
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3659831	3660986	5441077		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004149807.1|3659831_3660986_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.4	1.4e-128
>prophage 289
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3674741	3675536	5441077		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_002916526.1|3674741_3675536_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	25.7	1.4e-07
>prophage 290
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3692797	3694030	5441077		Catovirus(100.0%)	1	NA	NA
WP_002916493.1|3692797_3694030_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.6	3.1e-102
>prophage 291
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3701973	3707080	5441077	transposase	Prochlorococcus_phage(50.0%)	3	NA	NA
WP_002916478.1|3701973_3704847_+	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	51.6	5.7e-264
WP_038435693.1|3704909_3705653_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_085955203.1|3705716_3707080_-|transposase	IS3-like element ISKpn1 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.5	1.4e-74
>prophage 292
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3710871	3712305	5441077		Pandoravirus(100.0%)	1	NA	NA
WP_002916322.1|3710871_3712305_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.1	3.6e-33
>prophage 293
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3716949	3724851	5441077	tRNA	Brevibacillus_phage(20.0%)	8	NA	NA
WP_004144729.1|3716949_3717846_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	7.9e-31
WP_002916301.1|3717868_3718582_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_004149758.1|3718587_3720321_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.2	8.3e-61
WP_095858446.1|3720406_3721504_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	3.1e-05
WP_002916299.1|3721514_3723032_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	37.2	1.5e-85
WP_002916298.1|3723266_3723821_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_004218859.1|3723961_3724087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004157874.1|3724137_3724851_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I3PV79	Clostridium_phage	35.8	1.7e-12
>prophage 294
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3728819	3729839	5441077		Klosneuvirus(100.0%)	1	NA	NA
WP_032434634.1|3728819_3729839_-	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	21.7	5.0e-05
>prophage 295
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3733338	3737470	5441077		uncultured_Caudovirales_phage(75.0%)	4	NA	NA
WP_002916281.1|3733338_3733668_+	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	54.0	2.9e-23
WP_032418371.1|3733719_3735012_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.0	5.1e-164
WP_004181224.1|3735021_3735444_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	65.7	4.5e-45
WP_002916277.1|3735916_3737470_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	57.1	9.5e-157
>prophage 296
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3751942	3753622	5441077	integrase	Escherichia_phage(100.0%)	2	3745953:3745967	3755743:3755757
3745953:3745967	attL	TTCAGCGTGGTGCCG	NA	NA	NA	NA
WP_002916189.1|3751942_3752551_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	51.0	1.5e-49
WP_004151951.1|3753016_3753622_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	51.4	6.1e-51
3755743:3755757	attR	TTCAGCGTGGTGCCG	NA	NA	NA	NA
>prophage 297
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3774219	3777690	5441077		Trichoplusia_ni_ascovirus(33.33%)	3	NA	NA
WP_002916003.1|3774219_3774981_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	1.0e-18
WP_163589276.1|3775276_3776698_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	27.6	3.5e-25
WP_004149647.1|3776694_3777690_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.2	2.8e-13
>prophage 298
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3783453	3784581	5441077		Bacillus_phage(100.0%)	1	NA	NA
WP_025367902.1|3783453_3784581_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.5	4.7e-12
>prophage 299
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3790293	3791295	5441077		Enterobacteria_phage(100.0%)	1	NA	NA
WP_163589417.1|3790293_3791295_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.5	1.3e-26
>prophage 300
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3797282	3809201	5441077		Staphylococcus_phage(25.0%)	11	NA	NA
WP_094313538.1|3797282_3799442_+	bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase	NA	A0A2H4PQU7	Staphylococcus_phage	25.4	3.7e-18
WP_004185495.1|3799434_3800628_+	lysophospholipid transporter LplT	NA	NA	NA	NA	NA
WP_163589279.1|3800731_3801772_-	NADP(H)-dependent aldo-keto reductase	NA	NA	NA	NA	NA
WP_002915974.1|3801992_3802211_-	YgdI/YgdR family lipoprotein	NA	NA	NA	NA	NA
WP_002915973.1|3802334_3803048_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	46.8	4.5e-45
WP_004143967.1|3803111_3803807_-	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_004218186.1|3803892_3804036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002915936.1|3804489_3805020_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_002915935.1|3805032_3807279_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	23.3	5.6e-09
WP_002915934.1|3807524_3808400_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_002915933.1|3808406_3809201_+	thymidylate synthase	NA	R4IFY1	Cronobacter_phage	63.8	2.4e-119
>prophage 301
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3814715	3817601	5441077		Hokovirus(100.0%)	1	NA	NA
WP_004181181.1|3814715_3817601_+	pitrilysin	NA	A0A1V0SH69	Hokovirus	21.9	8.2e-45
>prophage 302
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3821130	3826395	5441077		Brevibacillus_phage(50.0%)	4	NA	NA
WP_163589280.1|3821130_3822975_+	exodeoxyribonuclease V subunit alpha	NA	A0A0K2FLP8	Brevibacillus_phage	24.8	5.3e-21
WP_021465743.1|3823032_3823353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004149616.1|3823582_3824914_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_004174538.1|3825141_3826395_+	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	28.9	1.5e-14
>prophage 303
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3859046	3859871	5441077		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
WP_002915614.1|3859046_3859871_+	energy-coupling factor ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	23.3	4.3e-07
>prophage 304
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3871816	3876193	5441077	transposase	Salmonella_phage(50.0%)	2	NA	NA
WP_016809156.1|3871816_3872785_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	3.9e-185
WP_163589290.1|3873712_3876193_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	31.0	2.4e-16
>prophage 305
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3883306	3885807	5441077	tRNA	Pandoravirus(50.0%)	3	NA	NA
WP_002915577.1|3883306_3884128_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	31.7	1.6e-14
WP_004142894.1|3884170_3884602_-	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_163589292.1|3884601_3885807_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.8	3.1e-70
>prophage 306
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3897340	3898096	5441077		Bacillus_phage(100.0%)	1	NA	NA
WP_004142871.1|3897340_3898096_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.6	1.7e-10
>prophage 307
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3904500	3908474	5441077	transposase	Bacillus_phage(50.0%)	4	NA	NA
WP_020317275.1|3904500_3905523_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	33.0	1.0e-13
WP_015958893.1|3905519_3906218_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002915265.1|3906214_3907093_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015958259.1|3907505_3908474_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.6	1.0e-180
>prophage 308
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3916845	3917691	5441077		Vibrio_phage(100.0%)	1	NA	NA
WP_004174633.1|3916845_3917691_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.4	2.5e-42
>prophage 309
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3925105	3930571	5441077		Streptococcus_phage(33.33%)	3	NA	NA
WP_002915222.1|3925105_3926245_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	39.9	3.4e-47
WP_004151066.1|3926402_3929153_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	28.9	6.4e-47
WP_085205701.1|3929266_3930571_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.7	1.3e-34
>prophage 310
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3934113	3939450	5441077		Only_Syngen_Nebraska_virus(33.33%)	5	NA	NA
WP_004142808.1|3934113_3935751_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.7	2.3e-153
WP_002915213.1|3935832_3937131_+	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	57.5	7.5e-131
WP_021312560.1|3937194_3938304_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_163589296.1|3938487_3938616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002915210.1|3938778_3939450_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	32.1	2.5e-13
>prophage 311
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3948216	3950249	5441077		Hokovirus(50.0%)	2	NA	NA
WP_004181094.1|3948216_3949644_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	27.1	1.1e-34
WP_002915158.1|3949643_3950249_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	37.6	6.1e-27
>prophage 312
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3953319	3959738	5441077		uncultured_Mediterranean_phage(40.0%)	7	NA	NA
WP_004174648.1|3953319_3954081_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.4	1.7e-58
WP_002915108.1|3954074_3954701_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	51.2	6.3e-35
WP_163589298.1|3954826_3955963_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	3.8e-06
WP_002915106.1|3956120_3957113_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	4.6e-32
WP_009485531.1|3957165_3957543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163589299.1|3957539_3958742_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_020801743.1|3958850_3959738_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.3	6.7e-06
>prophage 313
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3963205	3966700	5441077		Cafeteria_roenbergensis_virus(50.0%)	2	NA	NA
WP_004151059.1|3963205_3965767_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.9	1.3e-30
WP_032432217.1|3965920_3966700_-	heme ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	29.4	9.3e-12
>prophage 314
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3978442	3979264	5441077		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_163589303.1|3978442_3979264_-	manganese/iron ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.8	1.2e-14
>prophage 315
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	3989630	3991031	5441077		Pandoravirus(100.0%)	1	NA	NA
WP_002914970.1|3989630_3991031_+	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	28.3	5.2e-45
>prophage 316
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	4017972	4018938	5441077		Tetraselmis_virus(100.0%)	1	NA	NA
WP_004174691.1|4017972_4018938_-	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.6	1.6e-37
>prophage 317
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	4024689	4032927	5441077	tRNA	Bodo_saltans_virus(20.0%)	8	NA	NA
WP_015958867.1|4024689_4025400_+	ATP-binding cassette domain-containing protein	NA	A0A2H4UU96	Bodo_saltans_virus	29.3	3.1e-06
WP_004149458.1|4025396_4026260_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_023286807.1|4026267_4027146_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002914771.1|4027285_4027783_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	51.0	8.3e-30
WP_002914769.1|4027873_4028932_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	2.3e-114
WP_004213244.1|4028999_4029500_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_004174700.1|4029750_4032378_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	4.9e-81
WP_000906486.1|4032741_4032927_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
>prophage 318
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	4047513	4052812	5441077		Bacillus_virus(25.0%)	5	NA	NA
WP_002914328.1|4047513_4048716_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.8	1.2e-26
WP_002914327.1|4049072_4050035_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	72.2	1.5e-131
WP_020802076.1|4050045_4052187_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	47.9	1.6e-191
WP_002914321.1|4052159_4052570_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
WP_002914320.1|4052566_4052812_-	glutaredoxin-like protein NrdH	NA	A0A0M7REK7	Lactobacillus_phage	41.1	5.5e-11
>prophage 319
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	4057992	4058895	5441077		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_002914281.1|4057992_4058895_+	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	40.2	2.6e-37
>prophage 320
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	4081053	4082574	5441077		Planktothrix_phage(100.0%)	1	NA	NA
WP_163589317.1|4081053_4082574_-	amino acid ABC transporter permease/ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.4	3.8e-33
>prophage 321
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	4099770	4103766	5441077	integrase	Shigella_phage(50.0%)	4	4091402:4091416	4110105:4110119
4091402:4091416	attL	AATCGACAGCACCGC	NA	NA	NA	NA
WP_072032620.1|4099770_4100343_-	hypothetical protein	NA	S5FXQ0	Shigella_phage	55.9	9.2e-49
WP_032417508.1|4100350_4101373_-	hypothetical protein	NA	S5FNT5	Shigella_phage	45.3	8.1e-80
WP_138074193.1|4101359_4102592_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	49.6	9.3e-107
WP_002914164.1|4103283_4103766_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
4110105:4110119	attR	AATCGACAGCACCGC	NA	NA	NA	NA
>prophage 322
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	4119111	4120182	5441077		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_002914114.1|4119111_4120182_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	1.8e-90
>prophage 323
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	4126971	4129545	5441077		Enterobacteria_phage(100.0%)	1	NA	NA
WP_004150973.1|4126971_4129545_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	6.9e-128
>prophage 324
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	4135521	4136820	5441077		Burkholderia_virus(100.0%)	1	NA	NA
WP_004144368.1|4135521_4136820_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.5	4.1e-44
>prophage 325
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	4142118	4146653	5441077	tRNA	Streptomyces_phage(25.0%)	5	NA	NA
WP_002914091.1|4142118_4142544_-	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	6.0e-13
WP_020317146.1|4142747_4143833_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_002914088.1|4143890_4144580_-	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	53.0	1.3e-57
WP_002914084.1|4144892_4145276_+	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	79.3	4.0e-32
WP_002914082.1|4145321_4146653_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.9	6.2e-48
>prophage 326
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	4152422	4174489	5441077	tRNA	Bacillus_phage(25.0%)	19	NA	NA
WP_002914069.1|4152422_4154222_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.4	5.5e-23
WP_002914067.1|4154237_4155212_+	signal peptidase I	NA	NA	NA	NA	NA
WP_002914065.1|4155461_4156142_+	ribonuclease III	NA	A0A0P0YM82	Yellowstone_lake_phycodnavirus	29.7	1.6e-20
WP_002914063.1|4156138_4157044_+	GTPase Era	NA	NA	NA	NA	NA
WP_002914062.1|4157055_4157793_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_004180923.1|4157804_4158536_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_004144351.1|4158535_4158916_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_004888420.1|4158928_4159189_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	54.7	1.3e-18
WP_004144349.1|4159245_4160094_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002914050.1|4160307_4160943_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_004890375.1|4160972_4161515_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	33.8	2.6e-05
WP_163589323.1|4161511_4163128_-	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_163589324.1|4163302_4167190_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.9	5.0e-130
WP_004888415.1|4167779_4169201_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	25.4	4.1e-13
WP_002914033.1|4169230_4169917_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_004149357.1|4169903_4171241_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	35.0	1.0e-10
WP_002914032.1|4171306_4171645_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_002914028.1|4171719_4172910_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_002914027.1|4173235_4174489_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.1	1.9e-99
>prophage 327
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	4189736	4196057	5441077		Faustovirus(20.0%)	8	NA	NA
WP_002913992.1|4189736_4190951_+	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.8	3.2e-35
WP_002913991.1|4190977_4191364_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	77.3	2.7e-52
WP_002913979.1|4191381_4191705_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	47.7	1.6e-21
WP_004174835.1|4191779_4192295_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_004149343.1|4192310_4194161_+	Fe-S protein assembly chaperone HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	39.5	1.4e-103
WP_002913956.1|4194162_4194498_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_002913954.1|4194499_4194700_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_004185110.1|4194770_4196057_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	9.9e-35
>prophage 328
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	4206570	4263502	5441077	tail,tRNA,integrase,terminase,holin	Salmonella_phage(50.0%)	63	4199908:4199923	4266430:4266445
4199908:4199923	attL	CGCTCCAGCAGCCTGG	NA	NA	NA	NA
WP_004144312.1|4206570_4207002_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	38.6	1.7e-18
WP_002913894.1|4207485_4208652_+|tRNA	bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN	tRNA	NA	NA	NA	NA
WP_004149336.1|4208928_4209924_+	cytoskeleton protein RodZ	NA	NA	NA	NA	NA
WP_002913892.1|4209950_4211072_+	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_004149335.1|4211163_4212438_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002913890.1|4212472_4213093_+	YfgM family protein	NA	NA	NA	NA	NA
WP_002913889.1|4213103_4214282_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_004144309.1|4214395_4215874_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_117096147.1|4215991_4217071_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_004144303.1|4217120_4217339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004149333.1|4217322_4218714_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	33.0	6.3e-35
WP_004151980.1|4218872_4220339_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
WP_004151979.1|4220406_4221984_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_073520399.1|4222175_4223426_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9TCT6	Enterobacter_phage	85.1	6.8e-206
WP_073520398.1|4223443_4223635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073520397.1|4223631_4224228_-	adenine methylase	NA	T1SA14	Salmonella_phage	92.3	4.1e-108
WP_073520396.1|4224224_4224731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073520395.1|4224727_4224886_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	76.9	4.3e-17
WP_040025490.1|4224878_4225172_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	70.1	8.9e-32
WP_004144294.1|4225281_4225530_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	78.0	2.8e-31
WP_004152542.1|4225580_4226603_-	recombination protein RecT	NA	Q858E1	Salmonella_phage	95.3	2.4e-180
WP_059065285.1|4226612_4227512_-	endonuclease	NA	Q858E0	Salmonella_phage	91.0	1.9e-157
WP_047718663.1|4227508_4227808_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	4.7e-20
WP_077259385.1|4227815_4228847_-	hypothetical protein	NA	A0A059VK18	Pseudomonas_phage	51.6	4.2e-36
WP_163589326.1|4229247_4229829_-	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.3	5.4e-65
WP_004152538.1|4229982_4230216_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
WP_004152537.1|4230362_4230572_+	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
WP_163589327.1|4230571_4231339_+	primosomal protein	NA	A0A193GZ86	Enterobacter_phage	90.6	2.6e-139
WP_163589328.1|4231335_4232121_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.0	2.4e-132
WP_115272428.1|4232240_4232588_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	82.6	8.6e-50
WP_163589329.1|4232780_4233215_+	hypothetical protein	NA	K7P858	Enterobacteria_phage	38.5	1.3e-18
WP_049124164.1|4233211_4233475_+	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	74.4	3.7e-29
WP_023339691.1|4233850_4234039_+	hypothetical protein	NA	A0A192Y8X2	Salmonella_phage	88.7	3.7e-23
WP_163589418.1|4234166_4234955_+	DUF551 domain-containing protein	NA	R9TQX3	Aeromonas_phage	67.5	1.6e-35
WP_114265632.1|4234954_4235158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_116440151.1|4235150_4235489_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	90.0	5.8e-51
WP_072030986.1|4235565_4235895_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	55.1	8.7e-28
WP_163589330.1|4235952_4236573_+|terminase	terminase small subunit	terminase	A0A193GYG6	Enterobacter_phage	74.1	3.9e-77
WP_163589331.1|4236569_4238045_+|terminase	terminase	terminase	Q858H3	Salmonella_phage	92.2	1.6e-278
WP_148721726.1|4238041_4238452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148721725.1|4238524_4238827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152472.1|4239273_4239477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004149313.1|4239480_4241160_+|tail	tail protein	tail	T1S9Z7	Salmonella_phage	59.3	3.6e-194
WP_004152470.1|4241156_4241462_+	hypothetical protein	NA	Q2A090	Sodalis_phage	51.3	1.1e-16
WP_004152468.1|4241743_4242142_+	peptidase	NA	T1SAP9	Salmonella_phage	59.5	5.6e-37
WP_004197367.1|4242154_4243162_+	bbp17	NA	T1S9H9	Salmonella_phage	92.8	2.1e-181
WP_004152466.1|4243171_4243564_+	hypothetical protein	NA	T1SA71	Salmonella_phage	89.9	1.5e-55
WP_073520392.1|4243556_4243835_+	hypothetical protein	NA	T1SA01	Salmonella_phage	58.9	1.1e-20
WP_073520391.1|4243883_4244495_+	hypothetical protein	NA	T1SAQ2	Salmonella_phage	48.3	2.7e-46
WP_073520390.1|4244494_4246972_+	hypothetical protein	NA	G9L6D0	Escherichia_phage	56.5	8.0e-267
WP_049139501.1|4246973_4247444_+	hypothetical protein	NA	Q858G2	Salmonella_phage	55.3	7.3e-44
WP_024622833.1|4247436_4247934_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	41.7	5.2e-24
WP_073520389.1|4247946_4250463_+	hypothetical protein	NA	Q858G0	Salmonella_phage	52.8	9.4e-247
WP_073520388.1|4250462_4252340_+	hypothetical protein	NA	Q858F9	Salmonella_phage	59.2	1.2e-198
WP_073520387.1|4252339_4255114_+	hypothetical protein	NA	Q858F8	Salmonella_phage	78.8	0.0e+00
WP_004221292.1|4255470_4255623_-	hypothetical protein	NA	G9L6D9	Escherichia_phage	85.7	1.9e-14
WP_004141317.1|4255714_4256260_-	DUF2335 domain-containing protein	NA	NA	NA	NA	NA
WP_073520384.1|4257095_4259357_+|tail	phage tail protein	tail	A0A0A8J9V7	Klebsiella_phage	36.4	1.4e-71
WP_073520383.1|4259619_4260024_+	hypothetical protein	NA	T1SA79	Salmonella_phage	83.3	1.2e-55
WP_002913854.1|4260010_4260316_+|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	82.4	1.6e-39
WP_073520382.1|4260305_4260935_+	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	76.4	1.5e-89
WP_073520381.1|4260931_4261414_+	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	88.8	1.3e-67
WP_009309501.1|4261633_4263502_-	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
4266430:4266445	attR	CCAGGCTGCTGGAGCG	NA	NA	NA	NA
>prophage 329
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	4267213	4267444	5441077		Escherichia_phage(100.0%)	1	NA	NA
WP_052536217.1|4267213_4267444_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	78.8	1.4e-16
>prophage 330
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	4273873	4275549	5441077		Prochlorococcus_phage(100.0%)	2	NA	NA
WP_004145656.1|4273873_4274515_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	41.1	9.0e-29
WP_002913836.1|4274511_4275549_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.5	8.2e-72
>prophage 331
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	4279088	4282083	5441077	transposase	Enterobacteria_phage(50.0%)	3	NA	NA
WP_002913824.1|4279088_4280375_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.1	1.9e-65
WP_020947395.1|4280473_4281175_+	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_087787837.1|4281171_4282083_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	58.3	2.2e-73
>prophage 332
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	4288728	4289442	5441077		Cyanophage(100.0%)	1	NA	NA
WP_002913801.1|4288728_4289442_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A127KMU1	Cyanophage	35.7	1.1e-38
>prophage 333
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	4325118	4328695	5441077		Paenibacillus_phage(50.0%)	5	NA	NA
WP_060415788.1|4325118_4325991_-	N-acetylmuramoyl-L-alanine amidase AmiA	NA	A0A0N9SGH1	Paenibacillus_phage	31.9	2.2e-17
WP_002913637.1|4326202_4326628_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_060415787.1|4326614_4327064_+	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_002913630.1|4327125_4327701_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_004145614.1|4327795_4328695_+	Dyp-type peroxidase	NA	S4VVJ7	Pandoravirus	32.6	3.8e-25
>prophage 334
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	4332048	4334173	5441077		Planktothrix_phage(50.0%)	2	NA	NA
WP_060415786.1|4332048_4333143_+	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G9BWD6	Planktothrix_phage	39.4	1.6e-30
WP_004145610.1|4333261_4334173_+	cysteine synthase CysM	NA	A0A1W6JHY1	Lactococcus_phage	40.3	2.2e-52
>prophage 335
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	4337781	4347693	5441077		Hokovirus(25.0%)	10	NA	NA
WP_060415785.1|4337781_4339509_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.6	3.3e-17
WP_002913505.1|4339553_4339811_-	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_004218972.1|4339854_4339980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002913498.1|4340191_4341163_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.3	3.3e-75
WP_004174922.1|4341339_4342101_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_023301630.1|4342331_4343378_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_060415784.1|4343447_4345463_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	42.6	4.4e-146
WP_002913440.1|4345464_4345683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002913439.1|4345679_4346678_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_002913438.1|4346766_4347693_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	23.3	4.1e-06
>prophage 336
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	4362183	4364630	5441077		Clostridioides_phage(50.0%)	2	NA	NA
WP_004145587.1|4362183_4362936_-	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	26.3	1.5e-14
WP_004149230.1|4362932_4364630_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	28.5	6.7e-47
>prophage 337
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	4367900	4375122	5441077	transposase	Pandoravirus(20.0%)	6	NA	NA
WP_025861128.1|4367900_4368359_-	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	32.3	1.6e-11
WP_163589334.1|4368491_4369400_+	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	24.2	3.5e-10
WP_004149226.1|4369409_4370291_-	hypothetical protein	NA	A0A2H4JEC4	uncultured_Caudovirales_phage	56.8	1.5e-05
WP_004174945.1|4370659_4371142_-	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_009310076.1|4373016_4373997_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	1.2e-184
WP_001185343.1|4374849_4375122_-	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	41.1	8.3e-08
>prophage 338
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	4380537	4384857	5441077	integrase	Enterobacteria_phage(50.0%)	6	4371393:4371413	4383766:4383786
4371393:4371413	attL	GTGTCCCCTGCAGGAATCGAA	NA	NA	NA	NA
WP_001118612.1|4380537_4380714_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	55.6	4.2e-05
WP_000538173.1|4380830_4381025_+	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	52.5	1.1e-09
WP_000173141.1|4381074_4381290_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_163589336.1|4381392_4382274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000996991.1|4382304_4383579_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.8	5.9e-72
WP_004149224.1|4383927_4384857_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	81.4	6.7e-134
4383766:4383786	attR	GTGTCCCCTGCAGGAATCGAA	NA	NA	NA	NA
>prophage 339
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	4393972	4395058	5441077		Pandoravirus(100.0%)	1	NA	NA
WP_002913342.1|4393972_4395058_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.6	4.5e-89
>prophage 340
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	4403543	4404680	5441077		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_023282883.1|4403543_4404680_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	27.8	9.4e-21
>prophage 341
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	4411123	4412641	5441077		Mollivirus(100.0%)	1	NA	NA
WP_064175659.1|4411123_4412641_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	43.6	1.0e-86
>prophage 342
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	4416932	4417706	5441077		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_002913206.1|4416932_4417706_+	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	29.1	1.9e-09
>prophage 343
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	4430108	4430708	5441077		Salmonella_phage(100.0%)	1	NA	NA
WP_002913188.1|4430108_4430708_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	39.8	2.4e-07
>prophage 344
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	4458737	4459679	5441077	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_004180717.1|4458737_4459679_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.7	1.5e-67
>prophage 345
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	4462795	4464001	5441077		Oenococcus_phage(100.0%)	1	NA	NA
WP_004184969.1|4462795_4464001_+	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.0	6.1e-26
>prophage 346
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	4471846	4483977	5441077		Pseudomonas_phage(33.33%)	7	NA	NA
WP_048337182.1|4471846_4472917_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	52.6	2.1e-09
WP_002913017.1|4473380_4473635_-	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	65.3	8.2e-26
WP_004140835.1|4473634_4474765_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	79.7	1.0e-176
WP_002913016.1|4474866_4477152_-	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	63.6	2.5e-283
WP_002913014.1|4477496_4478225_-	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_004140833.1|4478371_4481005_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	31.0	3.5e-95
WP_060415751.1|4481136_4483977_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	25.9	2.9e-42
>prophage 347
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	4488117	4489212	5441077		Enterobacteria_phage(100.0%)	1	NA	NA
WP_020801664.1|4488117_4489212_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.0	3.0e-117
>prophage 348
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	4495423	4496584	5441077		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_020324457.1|4495423_4496584_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	48.2	6.6e-78
>prophage 349
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	4502951	4503959	5441077		Vibrio_phage(100.0%)	1	NA	NA
WP_004144267.1|4502951_4503959_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	49.8	2.4e-84
>prophage 350
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	4508195	4514282	5441077		Vibrio_phage(33.33%)	5	NA	NA
WP_004144263.1|4508195_4509953_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	6.4e-101
WP_002912977.1|4510100_4510820_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_002912975.1|4510816_4512013_+	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	24.2	2.6e-21
WP_002912974.1|4512344_4512689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151118.1|4512692_4514282_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.8	4.5e-21
>prophage 351
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	4520037	4524349	5441077		Clostridioides_phage(50.0%)	4	NA	NA
WP_002912967.1|4520037_4520607_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.0	3.1e-12
WP_072269286.1|4521033_4521747_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_021463904.1|4521784_4522762_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_004200498.1|4522882_4524349_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	31.2	3.2e-45
>prophage 352
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	4532179	4533034	5441077		Catovirus(100.0%)	1	NA	NA
WP_002912937.1|4532179_4533034_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	33.2	1.5e-23
>prophage 353
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	4540671	4541340	5441077		Cellulophaga_phage(100.0%)	1	NA	NA
WP_002912924.1|4540671_4541340_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	55.8	3.4e-55
>prophage 354
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	4545104	4546625	5441077		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_004175074.1|4545104_4546625_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	32.0	3.1e-11
>prophage 355
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	4562648	4563203	5441077		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_002912829.1|4562648_4563203_-	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	37.8	1.3e-20
>prophage 356
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	4569737	4576791	5441077	tRNA	Enterobacteria_phage(50.0%)	7	NA	NA
WP_022631307.1|4569737_4570685_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	1.2e-24
WP_022631308.1|4570668_4571406_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002912762.1|4571380_4571494_-	protein YohO	NA	NA	NA	NA	NA
WP_002912760.1|4571723_4573412_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	84.1	5.5e-259
WP_004144215.1|4573405_4574125_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_002912756.1|4574172_4574643_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	74.4	6.6e-61
WP_002912753.1|4574757_4576791_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.4	8.9e-54
>prophage 357
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	4588099	4589104	5441077		Serratia_phage(100.0%)	1	NA	NA
WP_060415736.1|4588099_4589104_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	28.5	5.8e-14
>prophage 358
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	4592319	4597360	5441077	tRNA	Bacillus_phage(50.0%)	4	NA	NA
WP_072269283.1|4592319_4593216_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	7.2e-16
WP_060415732.1|4593458_4594820_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.0	2.0e-206
WP_060415731.1|4595138_4595861_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	1.1e-30
WP_060415730.1|4595857_4597360_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	1.5e-29
>prophage 359
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	4614453	4621428	5441077		Catovirus(25.0%)	6	NA	NA
WP_002912442.1|4614453_4615095_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.3	2.0e-36
WP_004151145.1|4615185_4615767_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	41.6	5.1e-31
WP_060415722.1|4615797_4617645_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_060415721.1|4618189_4619773_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	43.1	1.4e-35
WP_127897274.1|4620131_4620338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102949335.1|4620537_4621428_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	40.6	5.6e-45
>prophage 360
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	4641258	4660480	5441077		Ostreococcus_lucimarinus_virus(10.0%)	15	NA	NA
WP_032442105.1|4641258_4642665_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.9	9.5e-39
WP_040236966.1|4642907_4644323_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.7	1.5e-52
WP_040236965.1|4644346_4645717_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	25.9	7.1e-31
WP_004152483.1|4645880_4647047_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	4.1e-112
WP_032442108.1|4647469_4647592_-	small membrane protein	NA	NA	NA	NA	NA
WP_040236964.1|4647992_4648997_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.4	4.0e-31
WP_002912373.1|4650042_4650810_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004175264.1|4650809_4651550_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	25.7	3.0e-07
WP_004214006.1|4651565_4653461_+	DUF4422 domain-containing protein	NA	NA	NA	NA	NA
WP_004890861.1|4653476_4654631_+	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	41.5	3.8e-78
WP_020801538.1|4654627_4655521_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_072269281.1|4655521_4656664_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_038806575.1|4656759_4657968_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	39.1	4.4e-08
WP_020801539.1|4658037_4659498_-	glucosyl transferase GtrII	NA	E5AGC8	Erwinia_phage	43.0	3.2e-106
WP_020801547.1|4659499_4660480_-	glycosyltransferase family 2 protein	NA	B9UDL7	Salmonella_phage	34.8	5.2e-44
>prophage 361
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	4667190	4668090	5441077		Cellulophaga_phage(100.0%)	1	NA	NA
WP_002912152.1|4667190_4668090_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	92.1	1.4e-11
>prophage 362
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	4672596	4679139	5441077	transposase	Streptococcus_phage(33.33%)	4	NA	NA
WP_002912106.1|4672596_4674699_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.9	2.8e-63
WP_085955203.1|4674865_4676229_-|transposase	IS3-like element ISKpn1 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.5	1.4e-74
WP_032429635.1|4676370_4677795_-	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_004153104.1|4677975_4679139_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	80.6	2.2e-182
>prophage 363
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	4694659	4695496	5441077		Mycobacterium_phage(100.0%)	1	NA	NA
WP_004180471.1|4694659_4695496_+	alpha/beta hydrolase	NA	A0A2D1GKK1	Mycobacterium_phage	28.8	4.8e-14
>prophage 364
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	4714963	4748817	5441077	portal,tail,integrase,head,capsid,terminase,holin,protease	Salmonella_phage(17.07%)	49	4714790:4714849	4756364:4756427
4714790:4714849	attL	CGGTCTCGAAAACCGGAGTAGGGGCAACTCTACCGGGGGTTCAAATCCCCCTCTCTCCGC	NA	NA	NA	NA
WP_004184758.1|4714963_4715956_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	87.2	4.9e-175
WP_163589346.1|4715957_4716185_-	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	78.4	1.4e-29
WP_134896119.1|4716492_4716696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163589347.1|4716682_4717291_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	60.7	1.9e-60
WP_057216498.1|4717287_4717803_-	hypothetical protein	NA	A0A0P0ZBM8	Stx2-converting_phage	75.8	1.4e-69
WP_163589419.1|4717802_4718324_-	ead/Ea22-like family protein	NA	K7PJQ4	Enterobacteria_phage	71.7	2.0e-50
WP_025714330.1|4718435_4718744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099755875.1|4718871_4719657_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	52.5	3.4e-62
WP_163589348.1|4719656_4719956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_117056156.1|4720045_4720963_-	recombination-associated protein RdgC	NA	A0A1W6JP69	Morganella_phage	36.2	9.9e-45
WP_158236372.1|4721250_4721421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032408726.1|4721767_4722415_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	63.0	9.3e-74
WP_016530206.1|4722519_4722717_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	66.1	2.7e-16
WP_117056157.1|4722742_4723204_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	80.3	9.9e-62
WP_001208720.1|4723441_4723621_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	73.1	4.6e-15
WP_017880208.1|4723610_4724564_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	69.0	6.1e-90
WP_163589349.1|4724560_4725370_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	68.5	3.2e-108
WP_163589350.1|4725379_4725757_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	72.8	2.5e-47
WP_038435278.1|4725769_4726750_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	66.9	7.1e-134
WP_099721910.1|4726763_4727342_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	57.2	7.6e-51
WP_001018764.1|4727492_4727732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001294159.1|4727897_4728284_+	membrane protein	NA	A0A192Y8P2	Salmonella_phage	90.6	1.6e-57
WP_071603196.1|4728270_4728552_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	47.3	2.4e-18
WP_048997722.1|4728551_4729181_+	glycoside hydrolase family 19 protein	NA	F1C591	Cronobacter_phage	75.4	8.4e-88
WP_060589019.1|4729183_4729459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004104248.1|4729694_4729979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004104246.1|4730118_4730364_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	98.8	1.4e-35
WP_127897272.1|4730437_4730665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072269277.1|4730718_4731075_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	80.9	1.8e-50
WP_032408649.1|4731896_4732394_+|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	72.1	1.1e-61
WP_060415702.1|4732393_4734151_+|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	90.6	0.0e+00
WP_032408651.1|4734161_4734347_+	hypothetical protein	NA	Q8HAD5	Salmonella_phage	61.7	6.2e-15
WP_049088851.1|4734346_4735576_+|portal	phage portal protein	portal	U5P411	Shigella_phage	82.4	4.8e-204
WP_049088852.1|4735562_4736216_+|head,protease	HK97 family phage prohead protease	head,protease	Q8W628	Enterobacteria_phage	86.9	6.0e-105
WP_060415701.1|4736230_4737439_+|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	85.4	2.0e-194
WP_060415700.1|4737477_4737681_+	hypothetical protein	NA	S5FNU1	Shigella_phage	47.0	1.1e-07
WP_049088855.1|4737677_4737998_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	39.8	1.7e-15
WP_004884319.1|4738006_4738345_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	74.1	6.4e-42
WP_019705270.1|4738341_4738791_+	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	82.6	6.7e-63
WP_050849661.1|4738787_4739135_+	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	63.7	2.8e-32
WP_023313062.1|4739191_4739896_+	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	66.9	5.5e-80
WP_021313622.1|4739926_4740331_+|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	57.7	8.5e-33
WP_004177139.1|4740333_4740639_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	64.6	4.7e-28
WP_137916789.1|4740711_4740945_+	hypothetical protein	NA	K7PH16	Enterobacteria_phage	45.8	3.2e-08
WP_049102630.1|4741005_4744392_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	57.9	3.3e-303
WP_004177132.1|4744413_4744887_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.1	1.4e-55
WP_004864228.1|4744873_4745350_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	65.8	4.8e-51
WP_069377167.1|4745362_4745743_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	83.3	2.6e-60
WP_163589351.1|4745739_4748817_+	kinase	NA	A0A286S259	Klebsiella_phage	62.3	0.0e+00
4756364:4756427	attR	CGGTCTCGAAAACCGGAGTAGGGGCAACTCTACCGGGGGTTCAAATCCCCCTCTCTCCGCCACT	NA	NA	NA	NA
>prophage 365
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	4753964	4765141	5441077		Burkholderia_phage(28.57%)	11	NA	NA
WP_163589353.1|4753964_4755452_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_087867256.1|4755724_4756093_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	52.0	4.1e-26
WP_002911596.1|4756697_4757843_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.7	1.1e-117
WP_072145321.1|4758234_4758501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151461.1|4758381_4758663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002911594.1|4758705_4759413_+	phosphohydrolase	NA	S4W232	Pandoravirus	27.7	2.8e-07
WP_004153246.1|4759489_4760890_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	53.0	3.9e-101
WP_024622769.1|4760870_4761365_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	50.0	2.8e-30
WP_004184683.1|4761339_4762251_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_002911591.1|4762434_4763346_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_064175734.1|4763461_4765141_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	41.1	6.9e-20
>prophage 366
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	4771742	4772495	5441077		Bacillus_virus(100.0%)	1	NA	NA
WP_024622767.1|4771742_4772495_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.4	1.3e-26
>prophage 367
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	4789104	4790619	5441077		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004184670.1|4789104_4790619_+	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.5	5.7e-13
>prophage 368
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	4797557	4882660	5441077	portal,tail,tRNA,integrase,head,capsid,terminase,holin,protease	Klebsiella_phage(14.55%)	103	4803953:4803975	4843660:4843682
WP_004151452.1|4797557_4799291_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.8	1.4e-87
WP_015958659.1|4799526_4800096_+	VOC family protein	NA	NA	NA	NA	NA
WP_002911488.1|4800172_4800916_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_024622764.1|4800997_4802002_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_004175417.1|4801998_4802742_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.1e-25
WP_002911484.1|4802781_4803177_-	membrane protein	NA	NA	NA	NA	NA
WP_047670146.1|4803229_4804009_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	81.9	3.2e-60
4803953:4803975	attL	CACGCAGTTAAAGTGGCGGGCGT	NA	NA	NA	NA
WP_060415715.1|4804005_4805265_-|integrase	site-specific integrase	integrase	A0A286S1S8	Klebsiella_phage	89.7	1.4e-222
WP_019725112.1|4805312_4805555_-	excisionase family protein	NA	A0A286S2A4	Klebsiella_phage	81.3	2.0e-29
WP_029363648.1|4805714_4805933_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	51.0	9.6e-07
WP_163589354.1|4805929_4806544_-	hypothetical protein	NA	M1F3E2	Salmonella_phage	44.8	2.4e-39
WP_163589355.1|4806536_4806881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025714702.1|4806877_4807102_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	54.1	1.0e-16
WP_123640128.1|4807333_4807555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047718833.1|4807625_4807919_-	host cell division inhibitory peptide Kil	NA	NA	NA	NA	NA
WP_071844745.1|4808393_4808588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023158874.1|4808553_4808772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025714806.1|4808982_4809192_+	fumarate hydratase FumD	NA	I6R0R9	Salmonella_phage	91.3	9.4e-28
WP_025714807.1|4809220_4809625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042930084.1|4809769_4810171_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	47.0	1.8e-11
WP_042930083.1|4810279_4810531_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_025714803.1|4810534_4810960_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_064174186.1|4811224_4812253_+	hypothetical protein	NA	K7PLZ7	Enterobacterial_phage	50.0	1.6e-30
WP_032454809.1|4812279_4812675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064169003.1|4812888_4813680_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	51.8	4.5e-62
WP_009309608.1|4813672_4814308_+	hypothetical protein	NA	A6N3G8	Burkholderia_virus	43.6	6.4e-19
WP_163589356.1|4814307_4814676_+	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	91.7	3.6e-62
WP_023312767.1|4815126_4815396_+	hypothetical protein	NA	H6WRY4	Salmonella_phage	81.8	1.2e-35
WP_064169000.1|4815636_4816230_+	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	63.2	1.2e-40
WP_047718844.1|4816226_4816997_+	hypothetical protein	NA	D5LH17	Escherichia_phage	51.6	1.2e-64
WP_074188105.1|4816993_4817653_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	77.6	6.5e-99
WP_163589357.1|4817649_4818228_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	57.8	1.3e-50
WP_001018764.1|4818378_4818618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001294159.1|4818783_4819170_+	membrane protein	NA	A0A192Y8P2	Salmonella_phage	90.6	1.6e-57
WP_071603196.1|4819156_4819438_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	47.3	2.4e-18
WP_048997722.1|4819437_4820067_+	glycoside hydrolase family 19 protein	NA	F1C591	Cronobacter_phage	75.4	8.4e-88
WP_060589019.1|4820069_4820345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004104248.1|4820580_4820865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004104246.1|4821004_4821250_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	98.8	1.4e-35
WP_127897272.1|4821323_4821551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072269277.1|4821604_4821961_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	80.9	1.8e-50
WP_032408649.1|4822782_4823280_+|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	72.1	1.1e-61
WP_060415702.1|4823279_4825037_+|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	90.6	0.0e+00
WP_032408651.1|4825047_4825233_+	hypothetical protein	NA	Q8HAD5	Salmonella_phage	61.7	6.2e-15
WP_049088851.1|4825232_4826462_+|portal	phage portal protein	portal	U5P411	Shigella_phage	82.4	4.8e-204
WP_049088852.1|4826448_4827102_+|head,protease	HK97 family phage prohead protease	head,protease	Q8W628	Enterobacteria_phage	86.9	6.0e-105
WP_060415701.1|4827116_4828325_+|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	85.4	2.0e-194
WP_060415700.1|4828363_4828567_+	hypothetical protein	NA	S5FNU1	Shigella_phage	47.0	1.1e-07
WP_049088855.1|4828563_4828884_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	39.8	1.7e-15
WP_004884319.1|4828892_4829231_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	74.1	6.4e-42
WP_049088856.1|4829227_4829677_+	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	81.2	7.4e-62
WP_060415699.1|4829673_4830021_+	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	64.6	2.5e-33
WP_163589358.1|4830077_4830782_+|tail	phage tail protein	tail	K7PHL2	Enterobacterial_phage	66.1	2.3e-78
WP_021313622.1|4830812_4831217_+|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	57.7	8.5e-33
WP_032415151.1|4831219_4831525_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	65.7	8.1e-28
WP_032415149.1|4831599_4831983_+	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	53.9	3.1e-32
WP_163589359.1|4832049_4835466_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	42.1	1.1e-186
WP_163589360.1|4835489_4835954_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.7	2.5e-52
WP_064174268.1|4835950_4836427_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	67.1	1.3e-53
WP_117032212.1|4836442_4836823_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	80.2	1.4e-58
WP_108914936.1|4836819_4839894_+	kinase	NA	A0A286S259	Klebsiella_phage	60.6	0.0e+00
WP_163589361.1|4839970_4842760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163589057.1|4843025_4843166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163589362.1|4843169_4843487_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	51.0	3.1e-22
WP_004145564.1|4843751_4844318_-	hydrolase	NA	NA	NA	NA	NA
4843660:4843682	attR	CACGCAGTTAAAGTGGCGGGCGT	NA	NA	NA	NA
WP_002911479.1|4844585_4846373_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	27.2	1.3e-11
WP_002911477.1|4846374_4846818_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_002911459.1|4846845_4847586_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002911456.1|4847620_4848142_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	3.4e-10
WP_002911454.1|4848221_4848833_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_004148860.1|4848841_4849852_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	24.3	1.4e-07
WP_004212745.1|4849915_4850701_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_002911449.1|4850700_4851453_-	zinc ABC transporter ATP-binding protein ZnuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.4	6.7e-15
WP_004180437.1|4851531_4852476_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_004148858.1|4852491_4853811_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	38.2	5.3e-15
WP_004175421.1|4853928_4854903_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_002911440.1|4854943_4856386_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_004145555.1|4856511_4857417_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004145554.1|4857576_4857726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002911427.1|4857736_4859212_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.8	3.2e-77
WP_002911425.1|4859434_4861246_+	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_002911423.1|4861284_4861926_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_002911418.1|4861983_4863162_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_004184662.1|4863306_4863654_+	LexA family transcriptional regulator	NA	NA	NA	NA	NA
WP_004180434.1|4863793_4864453_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_004151449.1|4864573_4866634_+	oligopeptidase B	NA	NA	NA	NA	NA
WP_002911407.1|4866637_4867297_-	exodeoxyribonuclease X	NA	A0A0H4IT92	Pseudoalteromonas_phage	31.7	2.2e-14
WP_002911406.1|4867375_4867606_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	57.4	5.9e-15
WP_004151448.1|4867718_4868093_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_004189267.1|4868096_4868966_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_002911404.1|4868982_4869321_+	YebY family protein	NA	NA	NA	NA	NA
WP_002911398.1|4869956_4870100_-	Ecr family regulatory small membrane protein	NA	NA	NA	NA	NA
WP_014907334.1|4870204_4871173_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_009484457.1|4871329_4871983_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	3.0e-56
WP_002911395.1|4871979_4872171_-	YebW family protein	NA	NA	NA	NA	NA
WP_004227120.1|4872268_4872577_-	YebV family protein	NA	NA	NA	NA	NA
WP_004148845.1|4872623_4874057_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_002911388.1|4874181_4876815_-	PqiB family protein	NA	NA	NA	NA	NA
WP_002911387.1|4876783_4878067_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_004175442.1|4878142_4878697_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_002911385.1|4878794_4879472_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_163589363.1|4879491_4881540_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.3	1.4e-86
WP_002911381.1|4881775_4882660_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 369
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	4886777	4886987	5441077		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|4886777_4886987_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 370
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	4894427	4895987	5441077		Moraxella_phage(100.0%)	1	NA	NA
WP_004145524.1|4894427_4895987_+	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	44.0	1.1e-40
>prophage 371
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	4899889	4907258	5441077	tRNA	Pandoravirus(33.33%)	7	NA	NA
WP_064175732.1|4899889_4901245_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	40.4	2.3e-42
WP_002910911.1|4901333_4901519_+	YoaH family protein	NA	NA	NA	NA	NA
WP_002910910.1|4901519_4901864_-	RidA family protein	NA	NA	NA	NA	NA
WP_004175456.1|4901995_4903906_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	33.0	1.1e-90
WP_004151443.1|4904051_4904747_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_002910905.1|4904785_4905367_+	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_002910904.1|4905572_4907258_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.7e-34
>prophage 372
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	4922883	4923495	5441077		Geobacillus_virus(100.0%)	1	NA	NA
WP_002910846.1|4922883_4923495_+	membrane-bound lytic murein transglycosylase EmtA	NA	A0A0H3V0Q1	Geobacillus_virus	40.7	3.0e-05
>prophage 373
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	4931229	4977731	5441077	protease,holin,integrase,transposase	Klebsiella_phage(52.94%)	61	4945010:4945026	4972304:4972320
WP_002910830.1|4931229_4931976_+|protease	proteasome-type protease	protease	NA	NA	NA	NA
WP_004211065.1|4932414_4933401_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_009484363.1|4933393_4934194_+	PhnD/SsuA/transferrin family substrate-binding protein	NA	NA	NA	NA	NA
WP_004145488.1|4934231_4934354_-	nitrilotriacetate monooxygenase	NA	NA	NA	NA	NA
WP_004219597.1|4934651_4934795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064175728.1|4934971_4935913_+	transcriptional regulator TdcA	NA	NA	NA	NA	NA
WP_002910762.1|4936006_4936996_+	bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB	NA	NA	NA	NA	NA
WP_004145486.1|4937021_4938353_+	threonine/serine transporter TdcC	NA	NA	NA	NA	NA
WP_064175727.1|4938380_4939589_+	propionate kinase	NA	NA	NA	NA	NA
WP_064175726.1|4939617_4941912_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.8	1.1e-158
WP_014907354.1|4941963_4942110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004189329.1|4942399_4943458_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004175489.1|4943567_4944482_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_064175725.1|4944491_4945778_+	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
4945010:4945026	attL	CTGGGCGATGCTGCCGC	NA	NA	NA	NA
WP_040219025.1|4945774_4946650_+	ATP-binding cassette domain-containing protein	NA	A0A285PWH2	Cedratvirus	25.5	6.8e-11
WP_004175491.1|4946646_4947366_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	1.5e-11
WP_002910720.1|4947371_4948265_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004148802.1|4948548_4950192_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.4	5.7e-136
WP_002910717.1|4950241_4950718_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002910715.1|4950818_4951745_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152313.1|4952048_4953344_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	1.3e-61
WP_004145468.1|4953355_4954165_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_101974243.1|4954139_4954433_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004145342.1|4954405_4955659_-|integrase	site-specific integrase	integrase	A0A286S1S8	Klebsiella_phage	100.0	1.5e-245
WP_032451986.1|4955714_4955948_-	excisionase family protein	NA	A0A286S2A4	Klebsiella_phage	100.0	1.6e-39
WP_004218013.1|4956005_4956119_-	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	100.0	4.6e-13
WP_023317194.1|4956214_4956439_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	90.5	2.4e-29
WP_042920740.1|4956428_4957154_-	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	97.5	1.3e-129
WP_032422926.1|4957159_4957678_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.3	5.0e-94
WP_040186814.1|4957718_4958159_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	80.8	7.5e-59
WP_004146412.1|4958155_4958278_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	100.0	1.3e-16
WP_009309070.1|4958345_4958603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048264118.1|4958606_4958882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071889502.1|4958922_4959132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025714643.1|4959244_4959508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032409574.1|4960160_4960367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009309064.1|4960536_4961253_-	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	71.3	1.2e-98
WP_032409419.1|4961925_4962114_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_009309063.1|4962110_4962941_+	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	70.3	2.0e-84
WP_009309062.1|4962952_4963831_+	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	63.9	1.1e-85
WP_042920731.1|4963827_4965207_+	AAA family ATPase	NA	Q8W640	Enterobacteria_phage	64.5	1.4e-159
WP_031592532.1|4965193_4965562_+	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	60.3	2.1e-38
WP_042920726.1|4965558_4966341_+	molecular chaperone	NA	F1C595	Cronobacter_phage	76.7	6.1e-112
WP_004184721.1|4966494_4966752_+	hypothetical protein	NA	A0A286N2Q3	Klebsiella_phage	100.0	1.3e-42
WP_031280381.1|4966657_4967104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023304726.1|4967288_4968335_+|transposase	IS481-like element ISKpn28 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	21.9	1.3e-05
WP_004196907.1|4968698_4970237_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.2	7.4e-295
WP_004196919.1|4970285_4970633_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	3.3e-62
WP_003031976.1|4970629_4971034_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	98.5	4.3e-69
WP_031280382.1|4971280_4971580_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	99.0	2.9e-46
WP_004177182.1|4971576_4972116_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.3	2.0e-101
WP_004177180.1|4972112_4972460_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	83.5	1.9e-41
4972304:4972320	attR	CTGGGCGATGCTGCCGC	NA	NA	NA	NA
WP_004177178.1|4972456_4972732_+	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	96.7	8.4e-08
WP_004177174.1|4972967_4973252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004177172.1|4973384_4973657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004177168.1|4973967_4974168_+	hypothetical protein	NA	A0A1L6Z528	Klebsiella_phage	75.0	3.4e-19
WP_163589365.1|4974565_4974775_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	56.9	9.5e-12
WP_077254646.1|4974792_4975761_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	97.8	3.1e-182
WP_004884312.1|4976401_4976875_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.7	1.1e-55
WP_004864228.1|4976861_4977338_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	65.8	4.8e-51
WP_032408661.1|4977350_4977731_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	84.1	5.3e-61
>prophage 374
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	4984677	4989581	5441077		Klebsiella_phage(66.67%)	4	NA	NA
WP_064175845.1|4984677_4986624_-	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	84.4	1.6e-52
WP_040200683.1|4986714_4987266_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	99.5	3.7e-95
WP_002910657.1|4988209_4988692_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_074193811.1|4988789_4989581_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.2	6.0e-06
>prophage 375
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	4995087	4999073	5441077	transposase	Salmonella_phage(50.0%)	2	NA	NA
WP_015958259.1|4995087_4996056_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.6	1.0e-180
WP_064175838.1|4996373_4999073_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	28.9	6.3e-15
>prophage 376
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	5025552	5028304	5441077		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_004200291.1|5025552_5027232_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.4	1.0e-23
WP_002910407.1|5027356_5028304_-	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.5	2.3e-44
>prophage 377
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	5031516	5037230	5441077		Pseudomonas_phage(33.33%)	7	NA	NA
WP_002910403.1|5031516_5032599_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.9e-07
WP_064175748.1|5032598_5033447_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_004145428.1|5033446_5033839_+	SirB family protein	NA	NA	NA	NA	NA
WP_002910395.1|5033842_5034655_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_002910393.1|5034694_5035549_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.2	2.3e-48
WP_002910392.1|5035635_5036736_-	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_004145426.1|5036978_5037230_+	putative cation transport regulator ChaB	NA	A0A1S5YE01	Mythimna_unipuncta_granulovirus	48.0	7.6e-08
>prophage 378
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	5042741	5043530	5441077		Bacillus_virus(100.0%)	1	NA	NA
WP_064175750.1|5042741_5043530_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.9	9.1e-31
>prophage 379
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	5060023	5061559	5441077		Escherichia_phage(100.0%)	1	NA	NA
WP_002910193.1|5060023_5061559_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	41.4	2.8e-20
>prophage 380
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	5065559	5071829	5441077		Synechococcus_phage(25.0%)	8	NA	NA
WP_004151854.1|5065559_5066402_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	43.1	8.3e-14
WP_072093171.1|5066444_5066915_-	YchJ family protein	NA	NA	NA	NA	NA
WP_002910108.1|5067015_5067918_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_004175574.1|5068007_5069021_+	two-component system response regulator RssB	NA	Q6XM27	Feldmannia_irregularis_virus	29.4	1.1e-07
WP_002910105.1|5069218_5070121_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.6	1.8e-59
WP_002910103.1|5070242_5070650_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_004145401.1|5071072_5071204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910100.1|5071211_5071829_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.2e-54
>prophage 381
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	5080088	5082986	5441077		Planktothrix_phage(33.33%)	3	NA	NA
WP_004151853.1|5080088_5081102_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.7	3.8e-13
WP_002910083.1|5081098_5082103_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	29.6	2.6e-14
WP_117096160.1|5082158_5082986_+	ion transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	40.0	3.9e-08
>prophage 382
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	5092658	5099827	5441077	tRNA	Tupanvirus(25.0%)	8	NA	NA
WP_002910026.1|5092658_5094587_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.9	2.3e-128
WP_004189469.1|5094590_5095133_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.5	6.3e-15
WP_001124225.1|5095225_5095423_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124850.1|5095473_5095830_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|5095953_5095998_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_002909105.1|5096136_5097120_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	42.6	4.9e-34
WP_015958605.1|5097135_5099523_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_002909098.1|5099527_5099827_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
>prophage 383
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	5106893	5114862	5441077		Brazilian_cedratvirus(25.0%)	8	NA	NA
WP_020803964.1|5106893_5107643_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	30.9	4.9e-10
WP_002909082.1|5107724_5108189_+	lipoprotein	NA	NA	NA	NA	NA
WP_004184566.1|5108302_5109745_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	37.0	2.0e-55
WP_002909070.1|5109774_5110002_-	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_048995548.1|5110109_5111156_-	3-deoxy-7-phosphoheptulonate synthase AroH	NA	A0A0B5IW14	Pandoravirus	46.6	1.4e-82
WP_002909061.1|5111310_5112144_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_002909058.1|5112288_5112408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002909055.1|5112483_5114862_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	37.1	1.4e-172
>prophage 384
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	5124841	5125603	5441077		Indivirus(100.0%)	1	NA	NA
WP_002909000.1|5124841_5125603_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	30.2	2.3e-15
>prophage 385
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	5140102	5143315	5441077		Indivirus(50.0%)	3	NA	NA
WP_002908876.1|5140102_5140849_+	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	24.5	3.0e-07
WP_002908869.1|5140823_5142098_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_002908867.1|5142094_5143315_+	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	42.0	9.9e-93
>prophage 386
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	5153235	5153985	5441077		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_004151841.1|5153235_5153985_-	ABC transporter ATP-binding protein	NA	A0A2I4R674	Erysipelothrix_phage	29.4	3.7e-05
>prophage 387
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	5161422	5163386	5441077		Micromonas_sp._RCC1109_virus(100.0%)	2	NA	NA
WP_004189514.1|5161422_5162373_+	acetaldehyde dehydrogenase (acetylating)	NA	E5EQ71	Micromonas_sp._RCC1109_virus	36.7	9.6e-35
WP_117096169.1|5162369_5163386_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.7	1.5e-41
>prophage 388
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	5174036	5174810	5441077		Bacillus_virus(100.0%)	1	NA	NA
WP_002908439.1|5174036_5174810_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.2	3.1e-31
>prophage 389
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	5177852	5178674	5441077		Planktothrix_phage(100.0%)	1	NA	NA
WP_080851153.1|5177852_5178674_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.5	8.6e-16
>prophage 390
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	5198196	5199267	5441077		Bacillus_virus(100.0%)	1	NA	NA
WP_004200198.1|5198196_5199267_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.4	4.1e-26
>prophage 391
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	5207172	5207796	5441077		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004184335.1|5207172_5207796_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2H4PQG7	Staphylococcus_phage	23.4	1.4e-05
>prophage 392
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	5217353	5222995	5441077		Bacillus_phage(50.0%)	4	NA	NA
WP_163589373.1|5217353_5218055_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.7	1.2e-26
WP_163589374.1|5218337_5218727_+	transporter	NA	NA	NA	NA	NA
WP_004151176.1|5218956_5219841_+	membrane protein	NA	NA	NA	NA	NA
WP_117096176.1|5219878_5222995_+	multidrug efflux RND transporter permease subunit KexD	NA	S5VTK5	Leptospira_phage	22.1	6.1e-54
>prophage 393
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	5241858	5246376	5441077		Ochrobactrum_phage(50.0%)	4	NA	NA
WP_004898695.1|5241858_5243226_+	chromate efflux transporter	NA	A0A219VHC2	Ochrobactrum_phage	64.0	6.6e-29
WP_032421429.1|5243280_5244702_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_117096178.1|5244728_5245544_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_023280203.1|5245545_5246376_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.6	1.4e-26
>prophage 394
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	5260075	5262024	5441077		Planktothrix_phage(50.0%)	2	NA	NA
WP_117096186.1|5260075_5261047_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	28.6	3.2e-17
WP_163589378.1|5261043_5262024_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.8	1.5e-11
>prophage 395
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	5267208	5267979	5441077		Escherichia_phage(100.0%)	1	NA	NA
WP_009307695.1|5267208_5267979_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.4	2.4e-12
>prophage 396
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	5273455	5274340	5441077		Burkholderia_virus(100.0%)	1	NA	NA
WP_002907799.1|5273455_5274340_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	28.7	1.5e-21
>prophage 397
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	5277837	5287774	5441077	transposase	Escherichia_phage(20.0%)	9	NA	NA
WP_009310076.1|5277837_5278818_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	1.2e-184
WP_004175848.1|5279505_5280084_+	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	35.5	5.9e-19
WP_040024451.1|5280224_5280632_-	acid resistance repetitive basic protein Asr	NA	NA	NA	NA	NA
WP_163589381.1|5280807_5282181_-	MdtK family multidrug efflux MATE transporter	NA	NA	NA	NA	NA
WP_002907792.1|5282410_5283046_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	36.3	1.3e-22
WP_002907788.1|5283082_5284231_-	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	1.2e-84
WP_002907785.1|5284523_5285705_-	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_023316933.1|5285817_5286822_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002907778.1|5286748_5287774_-	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	30.9	1.2e-30
>prophage 398
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	5291045	5291918	5441077		Bacillus_phage(100.0%)	1	NA	NA
WP_032104201.1|5291045_5291918_-	C40 family peptidase	NA	A0A217EQL1	Bacillus_phage	39.5	1.7e-17
>prophage 399
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	5296105	5297593	5441077		Indivirus(50.0%)	2	NA	NA
WP_004212768.1|5296105_5297002_+	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	28.7	2.3e-06
WP_004184268.1|5297071_5297593_+	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	58.0	2.3e-51
>prophage 400
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	5301399	5302761	5441077		Bacillus_phage(100.0%)	1	NA	NA
WP_040236918.1|5301399_5302761_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.7	5.2e-18
>prophage 401
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	5306096	5307371	5441077	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_002907740.1|5306096_5307371_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.0	1.1e-86
>prophage 402
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	5318626	5319997	5441077		Pandoravirus(100.0%)	1	NA	NA
WP_004180160.1|5318626_5319997_-	beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	35.1	2.1e-67
>prophage 403
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	5325548	5327599	5441077		Escherichia_phage(50.0%)	3	NA	NA
WP_002907640.1|5325548_5326076_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	46.8	5.9e-18
WP_002907563.1|5326180_5326456_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_101850509.1|5326480_5327599_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	30.0	1.4e-32
>prophage 404
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	5334424	5337062	5441077		Moumouvirus(100.0%)	2	NA	NA
WP_117096196.1|5334424_5335927_+	carboxylesterase/lipase family protein	NA	M1PNU1	Moumouvirus	37.6	9.5e-29
WP_002907491.1|5335973_5337062_-	NAD(P)-dependent alcohol dehydrogenase	NA	M1PHA2	Moumouvirus	25.9	6.9e-05
>prophage 405
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	5347493	5349455	5441077		Phage_TP(100.0%)	1	NA	NA
WP_002907469.1|5347493_5349455_+	U32 family peptidase	NA	Q6DW11	Phage_TP	28.0	5.1e-22
>prophage 406
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	5356304	5357318	5441077		Mycoplasma_phage(100.0%)	1	NA	NA
WP_004184243.1|5356304_5357318_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	56.4	2.1e-24
>prophage 407
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	5373008	5375114	5441077		Salmonella_phage(100.0%)	1	NA	NA
WP_163589386.1|5373008_5375114_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	67.4	2.3e-137
>prophage 408
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	5379679	5380231	5441077		Leuconostoc_phage(100.0%)	1	NA	NA
WP_004180132.1|5379679_5380231_+	adenylate kinase	NA	A0A097BYE2	Leuconostoc_phage	33.7	8.1e-10
>prophage 409
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	5386169	5386949	5441077		Bacillus_virus(100.0%)	1	NA	NA
WP_163589390.1|5386169_5386949_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.3	2.7e-19
>prophage 410
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	5396804	5397509	5441077		Bacillus_virus(100.0%)	1	NA	NA
WP_004189827.1|5396804_5397509_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.6	1.3e-31
>prophage 411
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	5400932	5405669	5441077	transposase	Bacillus_phage(50.0%)	4	NA	NA
WP_085955203.1|5400932_5402296_-|transposase	IS3-like element ISKpn1 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.5	1.4e-74
WP_002906549.1|5402752_5403433_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_019705698.1|5403429_5404125_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_004148517.1|5404124_5405669_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.5	1.4e-19
>prophage 412
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	5411776	5413276	5441077		Mycobacterium_phage(100.0%)	1	NA	NA
WP_004175980.1|5411776_5413276_+	efflux MFS transporter KmrA	NA	A0A0M3UL24	Mycobacterium_phage	29.3	7.8e-31
>prophage 413
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	5419754	5420528	5441077		Bacillus_phage(100.0%)	1	NA	NA
WP_004143751.1|5419754_5420528_+	1,6-dihydroxycyclohexa-2,4-diene-1-carboxylate dehydrogenase	NA	W8CYX9	Bacillus_phage	48.5	3.8e-05
>prophage 414
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	5431799	5433416	5441077		Planktothrix_phage(100.0%)	1	NA	NA
WP_040218946.1|5431799_5433416_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.0	2.5e-19
>prophage 415
NZ_CP040861	Klebsiella pneumoniae strain Xen39 chromosome, complete genome	5441077	5437004	5438867	5441077		Tupanvirus(50.0%)	2	NA	NA
WP_002906221.1|5437004_5438015_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.8	4.9e-29
WP_002906218.1|5438267_5438867_+	inorganic diphosphatase	NA	A0A1B1ISK6	uncultured_Mediterranean_phage	39.1	5.0e-21
>prophage 1
NZ_CP040859	Klebsiella pneumoniae strain Xen39 plasmid unnamed1, complete sequence	60832	0	55580	60832	integrase,transposase,protease	Burkholderia_phage(17.65%)	60	12353:12370	19537:19554
WP_000128596.1|39_1035_-	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_000101710.1|1076_2237_-	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_000735066.1|2236_3121_-	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_000646594.1|3131_3830_-	type IV secretion system protein	NA	NA	NA	NA	NA
WP_001749958.1|4048_5089_-	type IV secretion system protein	NA	NA	NA	NA	NA
WP_001749959.1|5104_5332_-	IncN-type entry exclusion lipoprotein EexN	NA	NA	NA	NA	NA
WP_001749960.1|5339_6053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001749961.1|6070_8671_-	VirB4 family type IV secretion/conjugal transfer ATPase	NA	NA	NA	NA	NA
WP_000496058.1|8670_8988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001749962.1|9037_9331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000440698.1|9340_9622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001749963.1|9630_10365_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_024129965.1|10428_10779_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_001749964.1|10794_11139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001749965.1|11135_11450_+	KikA protein	NA	NA	NA	NA	NA
WP_001452736.1|11485_11797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001749966.1|11852_12494_+	restriction endonuclease	NA	NA	NA	NA	NA
12353:12370	attL	CCTGATAGATTTGCTCAC	NA	NA	NA	NA
WP_001749967.1|12498_12705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001288432.1|13086_14520_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
WP_004098817.1|14553_15768_-	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_001389365.1|16028_16793_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001144737.1|16935_17202_-	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_004201280.1|17422_17896_-	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_000845048.1|18051_19065_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001749988.1|19457_20027_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	43.2	5.2e-36
19537:19554	attR	GTGAGCAAATCTATCAGG	NA	NA	NA	NA
WP_001749982.1|21983_22703_-	replication initiation protein	NA	I3WF20	Macacine_betaherpesvirus	28.9	8.6e-20
WP_000057569.1|23262_23604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001452808.1|23618_24410_-|protease	zinc metalloprotease	protease	NA	NA	NA	NA
WP_001749980.1|24560_25826_-	translesion error-prone DNA polymerase V subunit MucB	NA	F1C5A5	Cronobacter_phage	53.8	2.2e-119
WP_000861760.1|25813_26254_-	translesion error-prone DNA polymerase V autoproteolytic subunit MucA	NA	A0A1W6JNS2	Morganella_phage	48.8	1.2e-27
WP_000447669.1|26668_27094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000881513.1|27151_27556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000932975.1|27565_27805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000545925.1|28690_28987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001750003.1|28983_29343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001750002.1|29411_29696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012561126.1|29904_30237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000129958.1|31589_32099_+	antirestriction protein ArdA	NA	NA	NA	NA	NA
WP_000214483.1|32825_33005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001749971.1|33059_33380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048968061.1|33490_33724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000414913.1|34016_34385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001749973.1|34386_35103_-	StdB	NA	NA	NA	NA	NA
WP_020319858.1|35111_35249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001749975.1|36021_36438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000342688.1|36439_37969_+	type IV secretion system DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_012561166.1|37968_41205_+	conjugative relaxase	NA	U5J9B0	Bacillus_phage	27.3	2.4e-05
WP_012561167.1|41204_41570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|42142_42847_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000842134.1|43336_44446_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.2	2.8e-33
WP_001039466.1|44540_45725_-	tetracycline efflux MFS transporter Tet(D)	NA	NA	NA	NA	NA
WP_000113282.1|45820_46477_+	tetracycline resistance transcriptional repressor TetR(D)	NA	NA	NA	NA	NA
WP_001143760.1|47068_50074_-|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
WP_001235713.1|50237_50795_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|50977_51838_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001120891.1|52047_52587_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000480968.1|52558_53395_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|53394_54198_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_001043260.1|54258_55074_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000954592.1|55403_55580_+	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
>prophage 2
NZ_CP040859	Klebsiella pneumoniae strain Xen39 plasmid unnamed1, complete sequence	60832	58662	59367	60832	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_001067855.1|58662_59367_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 1
NZ_CP040862	Klebsiella pneumoniae strain Xen39 plasmid unnamed3, complete sequence	263991	0	66745	263991	transposase,protease	Salmonella_phage(28.57%)	46	NA	NA
WP_042922283.1|3740_4169_+	small heat shock protein sHSP20-GI	NA	NA	NA	NA	NA
WP_032427176.1|4221_5136_+	heat resistance protein YfdX1	NA	NA	NA	NA	NA
WP_032732001.1|5238_6126_+	heat resistance protein YfdX2	NA	NA	NA	NA	NA
WP_032427177.1|6215_6827_+	heat resistance membrane protein HdeD-GI	NA	NA	NA	NA	NA
WP_071010271.1|6906_8052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786814.1|8041_8482_+	heat resistance system thioredoxin Trx-GI	NA	A0A023NHA9	Dinoroseobacter_phage	34.7	5.8e-11
WP_023326110.1|8485_10195_+	heat resistance system K+/H+ antiporter KefB-GI	NA	NA	NA	NA	NA
WP_163589427.1|10197_10695_+	heat resistance protein PsiE-GI	NA	NA	NA	NA	NA
WP_071010273.1|10672_11638_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_000323730.1|11662_12814_+|protease	trypsin-like serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.3	7.5e-26
WP_004118750.1|13658_14654_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.3	7.0e-20
WP_001554382.1|14847_15276_+	S-(hydroxymethyl)glutathione synthase	NA	NA	NA	NA	NA
WP_032435793.1|16963_17290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118106.1|17370_18267_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016151338.1|18431_19508_-	dihydroorotase	NA	NA	NA	NA	NA
WP_004118110.1|19504_20761_-	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_004118113.1|20797_21739_-	dihydroorotate dehydrogenase	NA	A0A1V0SH91	Hokovirus	32.6	3.6e-18
WP_016151336.1|21731_22580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097404624.1|22944_24201_+	MFS transporter	NA	NA	NA	NA	NA
WP_004118118.1|24413_25679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097404625.1|26348_27131_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	96.1	1.4e-135
WP_000627495.1|27127_28150_-|transposase	IS21-like element ISSen3 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	85.3	1.9e-174
WP_080884488.1|29123_29861_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_016151349.1|30134_31103_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.3	5.0e-180
WP_004181739.1|32466_32883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163589428.1|32979_33948_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	95.7	1.9e-179
WP_032442632.1|34095_34923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077254647.1|34924_36406_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_040190672.1|37385_37520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032249431.1|37812_38670_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_020804505.1|38662_38740_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_004099069.1|38955_39234_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_064762441.1|39554_40034_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.1	5.4e-18
WP_020805034.1|41338_43381_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_000443938.1|43373_44825_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_009310009.1|45684_46440_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_013214044.1|46436_49721_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.6	4.3e-66
WP_020803820.1|49773_50457_-	YecA family protein	NA	NA	NA	NA	NA
WP_072271181.1|50453_51647_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	30.0	3.3e-08
WP_074185243.1|51827_52796_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.3	6.5e-172
WP_163589429.1|55414_56017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152380.1|56177_56771_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_055317648.1|56842_57568_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A1D6ZIU7	Xanthomonas_phage	27.6	5.5e-06
WP_065772193.1|57647_62909_-	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_017900859.1|65347_65731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013815099.1|65776_66745_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	1.0e-185
>prophage 2
NZ_CP040862	Klebsiella pneumoniae strain Xen39 plasmid unnamed3, complete sequence	263991	85034	128695	263991	transposase	Salmonella_phage(13.33%)	50	NA	NA
WP_015958259.1|85034_86003_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.6	1.0e-180
WP_004194114.1|86339_86732_-	relaxosome protein TraM	NA	NA	NA	NA	NA
WP_001568108.1|87163_87649_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_011977736.1|87681_88011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023316395.1|88043_88865_-	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	40.1	8.8e-45
WP_032409235.1|89582_89819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004574636.1|89787_91077_-|transposase	ISL3-like element ISPpu12 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	40.4	9.5e-86
WP_004863699.1|91098_91611_-	signal peptidase II	NA	NA	NA	NA	NA
WP_004574643.1|91614_92511_-	cation transporter	NA	NA	NA	NA	NA
WP_004364961.1|92606_93014_+	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_004152721.1|93487_93766_-	helix-turn-helix transcriptional regulator	NA	O64356	Escherichia_phage	39.4	2.5e-07
WP_004152720.1|93755_94076_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	39.5	6.8e-09
WP_014343499.1|94156_94381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019706020.1|94391_94604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019706019.1|94664_95021_-	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	58.1	4.4e-25
WP_014343503.1|95277_95454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014343504.1|95597_95732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015065519.1|95861_96179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163589430.1|96193_96544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032425552.1|96540_96813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001300563.1|97668_98781_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_014343509.1|98859_99018_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_000323025.1|100174_100462_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_004196370.1|100461_100701_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	9.1e-19
WP_009651956.1|100951_101317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008460272.1|101360_102098_+	HupE/UreJ family protein	NA	NA	NA	NA	NA
WP_004196322.1|102111_102801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008460269.1|104164_105088_-	chromate resistance protein	NA	NA	NA	NA	NA
WP_004196359.1|105488_105860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196315.1|105922_106843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032442618.1|106896_107634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077254646.1|107651_108620_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	97.8	3.1e-182
WP_004196314.1|108954_110253_+	MFS transporter	NA	NA	NA	NA	NA
WP_004196355.1|110358_110628_+	nickel-sensing transcriptional repressor NcrB	NA	NA	NA	NA	NA
WP_004196366.1|110640_111771_+	Ni(II)/Co(II) efflux transporter permease subunit NcrC	NA	NA	NA	NA	NA
WP_139108066.1|111932_112355_+	NirD/YgiW/YdeI family stress tolerance protein	NA	NA	NA	NA	NA
WP_004196353.1|112610_113951_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_009310015.1|114039_115572_+|transposase	IS3-like element ISKpn38 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.8	4.1e-51
WP_032442619.1|115701_116775_+|transposase	IS481-like element ISKpn28 family transposase	transposase	NA	NA	NA	NA
WP_077253291.1|117106_119230_-	S8 family peptidase	NA	NA	NA	NA	NA
WP_009310020.1|119594_120635_-	ATP-binding protein	NA	M4QMW8	Micromonas_pusilla_virus	35.2	9.5e-20
WP_086937184.1|120804_122180_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	74.1	1.4e-79
WP_023280872.1|122380_122755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568059.1|122810_123137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568058.1|123133_123862_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_020804497.1|123858_124290_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_009310025.1|124334_126392_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	25.4	2.6e-21
WP_009310026.1|126461_126710_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_020804498.1|126758_127301_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	76.7	4.6e-50
WP_009310029.1|128131_128695_-	methyltransferase	NA	A0A2I7RHK4	Vibrio_phage	34.3	4.4e-19
>prophage 3
NZ_CP040862	Klebsiella pneumoniae strain Xen39 plasmid unnamed3, complete sequence	263991	131733	169713	263991	integrase,transposase	Macacine_betaherpesvirus(25.0%)	39	143240:143254	172542:172556
WP_011977779.1|131733_131988_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	48.8	4.0e-12
WP_023332910.1|132175_132367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023332911.1|132409_132916_-	antirestriction protein ArdA	NA	G9FHQ1	Rhodococcus_virus	32.2	5.3e-08
WP_074186020.1|132958_133624_-	DUF1472 domain-containing protein	NA	NA	NA	NA	NA
WP_032425557.1|133638_133995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_055317527.1|134067_134835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004144453.1|134888_135308_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001568042.1|135317_135539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032743909.1|135538_136240_-	methylase	NA	A0A2K9VH43	Faecalibacterium_phage	33.6	9.0e-22
WP_072201213.1|136441_136558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568040.1|136676_136907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152354.1|136969_137641_-	mediator of plasmid stability	NA	NA	NA	NA	NA
WP_001568038.1|137643_138615_-	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_072201150.1|138745_138871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004178082.1|138863_140351_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_009309980.1|140753_141179_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	50.4	2.9e-31
WP_004206782.1|141178_142450_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.0	8.6e-156
WP_004206783.1|142528_142780_+	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_009309981.1|142833_143139_+	hypothetical protein	NA	NA	NA	NA	NA
143240:143254	attL	ATATGTTGTGTCCCT	NA	NA	NA	NA
WP_009309982.1|144421_145393_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.3	9.2e-150
WP_000523812.1|145392_146559_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.7	3.0e-224
WP_000200070.1|147309_148320_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	54.3	3.0e-87
WP_001515717.1|149017_149758_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
WP_023280912.1|150713_151790_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_004187025.1|153284_153533_+	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_020804663.1|154621_155287_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000654811.1|155482_156451_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.6	1.7e-172
WP_074185243.1|156666_157635_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.3	6.5e-172
WP_020804844.1|157840_158449_+	type 3 fimbria major subunit MrkA	NA	NA	NA	NA	NA
WP_000820818.1|158544_159246_+	type 3 fimbria chaperone MrkB	NA	NA	NA	NA	NA
WP_023317262.1|159257_161741_+	type 3 fimbria usher protein MrkC	NA	NA	NA	NA	NA
WP_009308594.1|161731_162727_+	type 3 fimbria adhesin subunit MrkD	NA	NA	NA	NA	NA
WP_064161452.1|162740_163376_+	type 3 fimbria minor subunit MrkF	NA	NA	NA	NA	NA
WP_025714822.1|163410_164127_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_009310076.1|164460_165441_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	1.2e-184
WP_000654811.1|166876_167845_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.6	1.7e-172
WP_014343462.1|168376_168490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009310077.1|168618_168876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023287113.1|168933_169713_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.0	5.4e-52
172542:172556	attR	AGGGACACAACATAT	NA	NA	NA	NA
>prophage 4
NZ_CP040862	Klebsiella pneumoniae strain Xen39 plasmid unnamed3, complete sequence	263991	177752	235134	263991	transposase,protease	Bacillus_phage(22.73%)	56	NA	NA
WP_004187110.1|177752_178103_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	51.4	6.0e-19
WP_074181092.1|178183_179152_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.9	1.0e-180
WP_009309902.1|179316_179748_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_009309901.1|179993_181469_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	7.9e-28
WP_000697969.1|181461_182142_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	36.0	2.1e-31
WP_000475512.1|182331_183717_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_004213578.1|183745_184108_+	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_009309900.1|184221_185514_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_009309899.1|185524_188671_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.3	1.8e-61
WP_000758228.1|188757_189198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004098955.1|189324_191772_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
WP_000843497.1|191812_192010_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004118669.1|192043_192781_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
WP_001023257.1|193069_193519_-	copper resistance protein	NA	NA	NA	NA	NA
WP_000925242.1|193752_195570_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_001378118.1|195575_196466_+	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_000025662.1|196505_196886_+	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_004118344.1|196890_197820_+	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_009309896.1|197874_198555_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.8	3.0e-30
WP_009309895.1|198551_199952_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.6	2.4e-18
WP_009309894.1|200167_200602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009654306.1|200980_201100_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_004118349.1|201065_201245_-	antitoxin	NA	NA	NA	NA	NA
WP_003031976.1|201395_201800_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	98.5	4.3e-69
WP_004196919.1|201796_202144_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	3.3e-62
WP_004196907.1|202192_203731_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.2	7.4e-295
WP_009310051.1|204020_204284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009310052.1|204280_204847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009310053.1|204877_205372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009310054.1|205415_205784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004098931.1|205814_206018_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_004098928.1|206066_206324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004118702.1|206399_206654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003026799.1|206829_207096_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_003026803.1|207083_207566_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152113.1|209076_210039_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_009483782.1|210025_210775_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_004152115.1|211012_211210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163589432.1|211209_214005_-	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.0	5.2e-129
WP_004152117.1|214128_214698_-	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_004152118.1|214732_215014_-	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
WP_004118208.1|215257_215521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118209.1|215535_215799_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_004181997.1|216949_217957_-	formamidase	NA	NA	NA	NA	NA
WP_004181996.1|217992_218682_-	urea ABC transporter ATP-binding subunit UrtE	NA	G9BWD6	Planktothrix_phage	29.6	8.5e-17
WP_004181995.1|218692_219442_-	urea ABC transporter ATP-binding protein UrtD	NA	A0A2H4PQG7	Staphylococcus_phage	26.4	2.4e-17
WP_004181994.1|219438_220554_-	urea ABC transporter permease subunit UrtC	NA	NA	NA	NA	NA
WP_004181993.1|220563_221490_-	urea ABC transporter permease subunit UrtB	NA	NA	NA	NA	NA
WP_004197507.1|221546_222737_-	urea ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004181991.1|223041_226422_+	response regulator	NA	A0A1V0SGX0	Hokovirus	30.3	1.7e-41
WP_004181990.1|226384_227305_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.1	2.0e-13
WP_072143344.1|228301_229270_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.6	2.0e-173
WP_000427623.1|229543_230548_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_009310076.1|230896_231877_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	1.2e-184
WP_004118832.1|232445_234179_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	6.9e-15
WP_004118225.1|234186_235134_-	acetamidase/formamidase family protein	NA	A0A1V0S8X7	Catovirus	22.7	9.6e-11
>prophage 5
NZ_CP040862	Klebsiella pneumoniae strain Xen39 plasmid unnamed3, complete sequence	263991	248616	256516	263991	transposase	Bacillus_virus(25.0%)	6	NA	NA
WP_004152282.1|248616_249384_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
WP_004118251.1|249482_249776_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	96.9	2.7e-49
WP_071785586.1|250106_250349_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000427623.1|250646_251651_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_004152286.1|252237_253320_+	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	96.4	6.8e-186
WP_040236942.1|253441_256516_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.7	0.0e+00
>prophage 6
NZ_CP040862	Klebsiella pneumoniae strain Xen39 plasmid unnamed3, complete sequence	263991	261430	262399	263991	transposase	Salmonella_phage(100.0%)	1	NA	NA
WP_074185243.1|261430_262399_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.3	6.5e-172
