The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040858	Lactobacillus plantarum strain 202195 chromosome, complete genome	3295668	146772	155286	3295668		Synechococcus_phage(33.33%)	9	NA	NA
WP_003642585.1|146772_147258_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.0	2.3e-16
WP_003644727.1|147241_148372_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_003642587.1|148374_149106_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4SM18	Cyanophage	37.3	1.6e-37
WP_061876238.1|149107_149362_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_033615420.1|149364_150042_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003642590.1|150034_152254_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.3	7.7e-144
WP_003642591.1|152238_153693_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.0	2.5e-50
WP_003642592.1|153689_154715_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.7	8.4e-61
WP_003642593.1|154707_155286_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.0	1.9e-22
>prophage 2
NZ_CP040858	Lactobacillus plantarum strain 202195 chromosome, complete genome	3295668	347083	407488	3295668	terminase,head,integrase,capsid,holin,tail,portal	Lactobacillus_phage(54.55%)	74	346886:346907	407725:407741
346886:346907	attL	TTGGCTGTCCTTTTGGCTGACT	NA	NA	NA	NA
WP_061876226.1|347083_348241_-|integrase	site-specific integrase	integrase	Q938N9	Temperate_phage	35.1	8.6e-54
346886:346907	attL	TTGGCTGTCCTTTTGGCTGACT	NA	NA	NA	NA
WP_061876225.1|348302_348992_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_061876223.1|349659_349878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061876222.1|349874_350675_+	DNA replication protein	NA	NA	NA	NA	NA
WP_061876221.1|350674_352069_+	virulence protein	NA	A0A1W6JQD6	Staphylococcus_phage	41.6	3.3e-68
WP_061876220.1|352331_352514_+	sporulation protein Cse60	NA	NA	NA	NA	NA
WP_061876219.1|352523_352862_+|head	phage head closure protein	head	A0A2P0ZLF0	Lactobacillus_phage	33.7	1.6e-08
WP_061876218.1|352854_353265_+	HNH endonuclease	NA	A0A1Q1PW15	Staphylococcus_phage	47.1	2.9e-20
WP_061876217.1|353826_354300_+|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_061876216.1|354296_356000_+|terminase	terminase large subunit	terminase	A0A2H4JBN3	uncultured_Caudovirales_phage	40.3	2.4e-121
WP_061876215.1|356154_357261_+|portal	phage portal protein	portal	A0A2H4J9Q5	uncultured_Caudovirales_phage	33.3	4.7e-49
WP_061876214.1|357250_358831_+|capsid	phage major capsid protein	capsid	B8R651	Lactobacillus_phage	26.1	4.8e-39
WP_061876213.1|359240_359510_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_061876212.1|359664_360024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061876211.1|360088_360724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003642774.1|361175_361382_+	hypothetical protein	NA	NA	NA	NA	NA
360848:360869	attR	TTGGCTGTCCTTTTGGCTGACT	NA	NA	NA	NA
WP_133279661.1|361733_362855_-|integrase	site-specific integrase	integrase	D6PSS4	Lactobacillus_phage	32.4	1.3e-46
360848:360869	attR	TTGGCTGTCCTTTTGGCTGACT	NA	NA	NA	NA
WP_133279660.1|362941_363856_-	DNA adenine methylase	NA	NA	NA	NA	NA
WP_133279659.1|363911_365684_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_021732649.1|366303_367023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003642781.1|367628_367997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041153536.1|368069_368486_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0M4RD70	Bacillus_phage	29.8	9.1e-06
WP_003644967.1|368497_368866_-	helix-turn-helix transcriptional regulator	NA	E9LUL4	Lactobacillus_phage	44.1	5.7e-20
WP_063096781.1|369015_369252_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015380634.1|369450_369756_+	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_133279658.1|369822_370335_+	transcriptional regulator	NA	D6PST4	Lactobacillus_phage	44.1	1.6e-28
WP_133279657.1|370714_372673_+	AAA family ATPase	NA	A0A0A0RNI0	Bacillus_phage	33.0	2.0e-71
WP_133279656.1|372674_373763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_133279655.1|373762_374488_+	MBL fold metallo-hydrolase	NA	A0A0H4TGC9	Bacillus_phage	41.5	1.3e-52
WP_163600794.1|374570_375524_+	DUF4373 domain-containing protein	NA	NA	NA	NA	NA
WP_133279653.1|375520_375808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_133279652.1|375804_376323_+	hypothetical protein	NA	O03915	Lactobacillus_phage	54.6	1.2e-39
WP_003642802.1|376319_376694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_133279651.1|376696_377008_+	hypothetical protein	NA	A0A2P0ZLB4	Lactobacillus_phage	97.1	3.7e-52
WP_041153378.1|377181_377433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_133279649.1|377445_377775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_133279676.1|377787_378168_+	hypothetical protein	NA	A0A2K9VD97	Lactobacillus_phage	53.3	4.0e-32
WP_053267730.1|378164_378611_+	DUF1642 domain-containing protein	NA	A0A2P0ZKT5	Lactobacillus_phage	41.4	1.8e-20
WP_033609727.1|378917_379388_+	hypothetical protein	NA	B4XYT9	Lactobacillus_phage	40.0	1.9e-15
WP_016511184.1|379625_379793_+	BC1881 family protein	NA	NA	NA	NA	NA
WP_087842062.1|379789_379999_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_163600795.1|380308_380455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_133279648.1|380984_381176_+	hypothetical protein	NA	E9LUP6	Lactobacillus_phage	85.1	7.5e-16
WP_163600796.1|381308_381608_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A1Q1PVT7	Staphylococcus_phage	36.7	5.7e-10
WP_133279646.1|381668_382271_+|terminase	terminase small subunit	terminase	O03926	Lactobacillus_phage	34.3	2.6e-14
WP_105316088.1|382263_383577_+|terminase	PBSX family phage terminase large subunit	terminase	D2IYW1	Enterococcus_phage	54.6	1.9e-126
WP_133279645.1|383591_385328_+|portal	phage portal protein	portal	A7J292	Streptococcus_phage	34.7	5.4e-68
WP_133279644.1|385327_386239_+|capsid	minor capsid protein	capsid	NA	NA	NA	NA
WP_133279643.1|386349_387009_+	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_060418034.1|387022_387394_+	hypothetical protein	NA	A0A0K2CNR0	Brevibacillus_phage	34.4	1.3e-08
WP_133279642.1|387409_388519_+|capsid	major capsid protein E	capsid	A0A2H4J022	uncultured_Caudovirales_phage	39.8	1.2e-60
WP_105316082.1|388536_388905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_133279641.1|388901_389234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_133279640.1|389234_389726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027821924.1|389728_390124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_133279639.1|390172_390826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_133279638.1|390855_391374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143143016.1|391463_391706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_133279675.1|391930_395719_+	tape measure protein	NA	A0A0A7DMV4	Lactobacillus_phage	58.6	1.0e-39
WP_068874366.1|395744_396011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105316075.1|396084_396996_+|tail	phage tail family protein	tail	A6M962	Geobacillus_virus	28.5	8.4e-20
WP_105316074.1|396988_398176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105316073.1|398150_398516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_133279637.1|398508_398784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_133279636.1|401177_401447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074028698.1|401439_401574_+	XkdX family protein	NA	NA	NA	NA	NA
WP_133279635.1|401591_402605_+	collagen-like protein	NA	A0A1I9KKB6	Lactobacillus_phage	53.0	5.6e-33
WP_133279634.1|402601_402814_+	hypothetical protein	NA	A0A0A1ENR9	Lactobacillus_phage	83.6	6.2e-19
WP_133279633.1|402825_403998_+	LysM peptidoglycan-binding domain-containing protein	NA	E9LUR8	Lactobacillus_phage	86.7	4.3e-194
WP_027821934.1|403998_404295_+	hypothetical protein	NA	A0A2K9VCD4	Lactobacillus_phage	73.5	2.4e-37
WP_133279632.1|404281_404665_+|holin	holin	holin	A0A2H4PBB2	Lactobacillus_phage	78.0	3.7e-14
WP_077727028.1|405254_405557_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027821936.1|405666_406338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_133279631.1|406345_407488_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	28.5	2.7e-39
407725:407741	attR	CCGTGCGGGTGATAAGT	NA	NA	NA	NA
>prophage 3
NZ_CP040858	Lactobacillus plantarum strain 202195 chromosome, complete genome	3295668	1039224	1082828	3295668	terminase,transposase,integrase,head,holin,capsid,tail,plate,portal	Lactobacillus_phage(51.85%)	52	1033490:1033504	1083604:1083617
1033490:1033504	attL	ATCACCTCAAAGTAA	NA	NA	NA	NA
WP_022638004.1|1039224_1039650_+|integrase	phage integrase family site-specific recombinase	integrase	NA	NA	NA	NA
1033490:1033504	attL	ATCACCTCAAAGTAA	NA	NA	NA	NA
WP_126043865.1|1039659_1040271_+|integrase	site-specific integrase	integrase	A0A0P0I3D2	Lactobacillus_phage	38.0	1.1e-31
WP_053566705.1|1041003_1041504_+	N-acetyltransferase	NA	A0A1P8CWJ6	Bacillus_phage	36.7	8.3e-22
1040844:1040858	attR	TTACTTTGAGGTGAT	NA	NA	NA	NA
WP_133279719.1|1041669_1042275_-	chitin-binding protein	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	29.2	1.6e-14
1040844:1040858	attR	TTACTTTGAGGTGAT	NA	NA	NA	NA
WP_053566703.1|1042470_1042695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058011761.1|1042946_1043153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053566701.1|1043485_1043848_-	hypothetical protein	NA	A0A2H4PBB2	Lactobacillus_phage	69.6	2.8e-19
WP_133279720.1|1043861_1044125_-|holin	holin	holin	E9LUR9	Lactobacillus_phage	71.3	2.5e-25
WP_133279721.1|1044124_1045279_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A2K9V5A4	Lactobacillus_phage	69.5	2.5e-45
WP_080373208.1|1045256_1045433_-	XkdX family protein	NA	NA	NA	NA	NA
WP_053566698.1|1045432_1045753_-	DUF2977 domain-containing protein	NA	NA	NA	NA	NA
WP_133279722.1|1045753_1046494_-	hypothetical protein	NA	Q4ZE15	Staphylococcus_virus	21.7	1.3e-07
WP_053566696.1|1046499_1047114_-|plate	phage baseplate upper protein	plate	A0A1J0MFQ3	Staphylococcus_phage	48.3	6.6e-45
WP_011101126.1|1047128_1048121_-	SGNH/GDSL hydrolase family protein	NA	A0A1J0MFI8	Staphylococcus_phage	41.0	4.1e-36
WP_133279723.1|1048125_1050000_-	endolysin	NA	A0A1X9IGI5	Lactococcus_phage	33.4	4.6e-49
WP_053566693.1|1049999_1050737_-	hypothetical protein	NA	A0A1S5SA63	Streptococcus_phage	37.1	8.2e-42
WP_133279724.1|1050730_1054735_-	tape measure protein	NA	E9LUR1	Lactobacillus_phage	44.3	5.2e-82
WP_053566691.1|1054734_1054971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053566690.1|1055039_1055552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053566689.1|1055569_1056157_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_133279725.1|1056168_1056555_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_133279726.1|1056555_1057110_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_069710549.1|1057099_1057423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061871711.1|1057427_1057793_-|head,tail	phage head-tail connector protein	head,tail	H9A0V3	Staphylococcus_phage	35.6	8.8e-05
WP_061871712.1|1057807_1058878_-	hypothetical protein	NA	A0A0S0N2Q7	Pseudomonas_phage	30.3	7.7e-33
WP_133279727.1|1058891_1059539_-	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_133279728.1|1059647_1060592_-|capsid	minor capsid protein	capsid	NA	NA	NA	NA
WP_133279729.1|1060591_1062250_-|portal	phage portal protein	portal	D2IZF6	Enterococcus_phage	32.6	8.2e-66
WP_133279730.1|1062239_1063526_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2H4IYR5	uncultured_Caudovirales_phage	50.6	1.5e-115
WP_053566680.1|1063509_1063974_-	hypothetical protein	NA	Q597W0	Lactobacillus_virus	56.4	8.2e-32
WP_003644595.1|1064319_1065582_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_163600798.1|1065435_1066050_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_053566678.1|1066619_1067048_-	transcriptional regulator	NA	E9LUP5	Lactobacillus_phage	78.0	1.9e-59
WP_133279700.1|1067430_1069194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_133279699.1|1069560_1069863_-	hypothetical protein	NA	E9LUN7	Lactobacillus_phage	82.0	2.2e-41
WP_062688445.1|1069995_1070838_-	ATP-binding protein	NA	O03914	Lactobacillus_phage	99.3	4.6e-158
WP_069710545.1|1070818_1071607_-	DNA replication protein DnaD	NA	NA	NA	NA	NA
WP_133279698.1|1071687_1072233_-	DUF669 domain-containing protein	NA	D2KRE3	Lactobacillus_phage	45.4	2.5e-27
WP_058011814.1|1072229_1072898_-	AAA family ATPase	NA	E9LUU1	Lactobacillus_phage	75.6	9.2e-93
WP_053566668.1|1072904_1073414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061871426.1|1073946_1074210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072536110.1|1074224_1074773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058011817.1|1074837_1075020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024971535.1|1075245_1075446_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024971534.1|1075593_1075830_+	helix-turn-helix transcriptional regulator	NA	A0A0K2CNE2	Brevibacillus_phage	36.0	2.2e-09
WP_053566663.1|1075867_1076182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058011821.1|1076279_1076546_-	helix-turn-helix transcriptional regulator	NA	O03906	Lactobacillus_phage	96.6	3.0e-39
WP_053566661.1|1076714_1077113_+	helix-turn-helix transcriptional regulator	NA	O03970	Lactobacillus_phage	97.0	3.6e-68
WP_058011822.1|1077121_1077553_+	hypothetical protein	NA	O03904	Lactobacillus_phage	83.6	2.8e-66
WP_133279696.1|1078853_1080536_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_133279695.1|1080610_1081525_+	DNA adenine methylase	NA	NA	NA	NA	NA
WP_133279694.1|1081607_1082828_+|integrase	site-specific integrase	integrase	A0A0P0I3D2	Lactobacillus_phage	42.1	1.9e-83
1083604:1083617	attR	AAAAAATGTTAACA	NA	NA	NA	NA
>prophage 4
NZ_CP040858	Lactobacillus plantarum strain 202195 chromosome, complete genome	3295668	1286307	1296144	3295668		Lactobacillus_phage(87.5%)	9	NA	NA
WP_003645220.1|1286307_1287303_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	38.8	3.1e-52
WP_015380221.1|1287929_1288067_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_011101401.1|1288162_1288603_+	nucleoside 2-deoxyribosyltransferase	NA	A0A2P0ZL88	Lactobacillus_phage	98.6	3.0e-76
WP_003643095.1|1288673_1289234_-	hypothetical protein	NA	A0A2P0ZL75	Lactobacillus_phage	100.0	2.7e-101
WP_061876166.1|1289321_1291760_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	99.6	0.0e+00
WP_003643097.1|1291762_1292377_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	100.0	6.3e-112
WP_027822909.1|1292719_1293667_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	99.7	1.0e-177
WP_033608586.1|1293852_1294824_+	peptidase S41	NA	A0A2P0ZL68	Lactobacillus_phage	98.5	5.9e-181
WP_061876165.1|1294914_1296144_-	hypothetical protein	NA	A0A2P0ZL72	Lactobacillus_phage	97.4	4.6e-215
>prophage 5
NZ_CP040858	Lactobacillus plantarum strain 202195 chromosome, complete genome	3295668	1503869	1610970	3295668	transposase,terminase,tRNA,head,integrase,holin,capsid,tail,protease,portal	Lactobacillus_phage(61.36%)	103	1518368:1518384	1601425:1601441
WP_046947841.1|1503869_1504793_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	27.2	2.6e-13
WP_046947814.1|1505298_1506933_-	TIGR04141 family sporadically distributed protein	NA	NA	NA	NA	NA
WP_046947815.1|1507423_1509364_-	ATP-dependent helicase	NA	NA	NA	NA	NA
WP_046947816.1|1509345_1511715_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_046947817.1|1511943_1513191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080343129.1|1513216_1514254_-	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
WP_046947819.1|1514770_1514968_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_063489331.1|1515002_1516385_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_157664747.1|1516442_1517480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046947822.1|1517508_1518468_-	glycosyltransferase	NA	NA	NA	NA	NA
1518368:1518384	attL	AATTCGGCCGGCAAACA	NA	NA	NA	NA
WP_046947823.1|1518452_1519727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046947824.1|1519710_1520751_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_046947825.1|1520770_1521856_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_046947826.1|1521855_1522533_-	sugar transferase	NA	NA	NA	NA	NA
WP_046947827.1|1522513_1523461_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SAI6	Catovirus	34.9	1.8e-41
WP_027822000.1|1523478_1524252_-	tyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_011101299.1|1524238_1524967_-	CpsD/CapB family tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_052751298.1|1524978_1525749_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_076657828.1|1526105_1526708_+|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	42.5	1.7e-32
WP_046947829.1|1526765_1527770_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	41.5	2.0e-67
WP_057136724.1|1527975_1529175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046947831.1|1529345_1530764_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_133279742.1|1531006_1532326_-	oligosaccharide repeat unit polymerase	NA	NA	NA	NA	NA
WP_052098028.1|1532390_1533437_-	sugar transferase	NA	NA	NA	NA	NA
WP_046947833.1|1533426_1534428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052098027.1|1534435_1535437_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	30.4	1.3e-10
WP_046947845.1|1535457_1536240_-	DUF4422 domain-containing protein	NA	NA	NA	NA	NA
WP_133279741.1|1536299_1537421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046947835.1|1537425_1538016_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_046947836.1|1538020_1538686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046947837.1|1538976_1540092_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	79.3	8.8e-173
WP_003643315.1|1540241_1540958_-	aquaporin family protein	NA	A0A1J0F964	Only_Syngen_Nebraska_virus	32.7	5.6e-19
WP_003643314.1|1541147_1542077_-	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_003646267.1|1542462_1543581_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	31.2	2.7e-20
WP_011101277.1|1543786_1544962_-	serine hydrolase	NA	NA	NA	NA	NA
WP_046947838.1|1545229_1546576_+	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_061876112.1|1546658_1547222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003643305.1|1547655_1548096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003643304.1|1548295_1548496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003643303.1|1548645_1549512_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003644138.1|1549504_1550812_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003643301.1|1550945_1551386_+	universal stress protein	NA	NA	NA	NA	NA
WP_003644595.1|1551486_1552749_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_060417438.1|1553244_1553460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060417439.1|1553740_1554118_-|holin	holin	holin	A0A2H4PBB2	Lactobacillus_phage	81.2	3.1e-13
WP_060417440.1|1554128_1554392_-|holin	holin	holin	E9LUR9	Lactobacillus_phage	87.4	1.1e-33
WP_060417441.1|1554391_1555564_-	LysM peptidoglycan-binding domain-containing protein	NA	E9LUR8	Lactobacillus_phage	89.7	1.4e-200
WP_060417442.1|1555579_1556455_-	hypothetical protein	NA	E9LUR7	Lactobacillus_phage	88.1	9.2e-133
WP_003641409.1|1556603_1556843_-	hypothetical protein	NA	A0A2K9VDF6	Lactobacillus_phage	97.4	1.9e-32
WP_060417444.1|1559605_1562017_-	hypothetical protein	NA	A0A2P0ZLF8	Lactobacillus_phage	91.8	0.0e+00
WP_060417445.1|1562083_1563856_-|tail	phage tail protein	tail	A0A2P0ZLH2	Lactobacillus_phage	92.2	1.1e-310
WP_133279610.1|1563920_1568777_-	peptidase M23	NA	A0A2P0ZLG0	Lactobacillus_phage	61.2	0.0e+00
WP_015640500.1|1568808_1568994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060417447.1|1569038_1569413_-	hypothetical protein	NA	A0A2P0ZLH4	Lactobacillus_phage	93.5	1.0e-56
WP_060417448.1|1569492_1570152_-|tail	phage tail protein	tail	A0A2P0ZLH1	Lactobacillus_phage	91.7	1.4e-104
WP_060417449.1|1570167_1570548_-	DUF806 family protein	NA	A0A2P0ZLF4	Lactobacillus_phage	88.9	1.6e-57
WP_060417450.1|1570547_1570955_-	hypothetical protein	NA	A0A2P0ZLE6	Lactobacillus_phage	94.7	1.2e-66
WP_060417451.1|1570957_1571305_-|head	phage head closure protein	head	A0A2P0ZLF0	Lactobacillus_phage	93.0	5.2e-55
WP_060417452.1|1571305_1571584_-	hypothetical protein	NA	A0A2P0ZLF2	Lactobacillus_phage	72.8	9.9e-33
WP_060417453.1|1571674_1573036_-|capsid	phage major capsid protein	capsid	A0A0M7RF71	Lactobacillus_phage	60.1	8.2e-96
WP_060417454.1|1573042_1573648_-|head,protease	HK97 family phage prohead protease	head,protease	B8R651	Lactobacillus_phage	49.1	8.2e-40
WP_060417455.1|1573619_1574738_-|portal	phage portal protein	portal	Q9AZM4	Lactococcus_phage	39.2	1.8e-64
WP_060417456.1|1574957_1576874_-|terminase	terminase large subunit	terminase	A0A0M7RDK9	Lactobacillus_phage	42.0	5.7e-135
WP_049821959.1|1576860_1577295_-|terminase	phage terminase small subunit P27 family	terminase	B8R648	Lactobacillus_phage	37.7	8.3e-18
WP_060417457.1|1577529_1577832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060417458.1|1577858_1578518_-	HNH endonuclease	NA	E9LUP6	Lactobacillus_phage	89.6	1.6e-17
WP_033098961.1|1578677_1579490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_133279611.1|1580698_1581124_-	transcriptional regulator	NA	E9LUP5	Lactobacillus_phage	80.9	1.2e-61
WP_080440299.1|1581340_1581775_-	hypothetical protein	NA	A0A2K9VD97	Lactobacillus_phage	55.3	8.8e-36
WP_060417460.1|1581855_1582110_-	hypothetical protein	NA	A0A2H4PBA1	Lactobacillus_phage	82.1	1.1e-35
WP_060417461.1|1582263_1582572_-	hypothetical protein	NA	E9LUN7	Lactobacillus_phage	86.3	6.2e-44
WP_060417462.1|1582707_1583493_-	ATP-binding protein	NA	E9LUN6	Lactobacillus_phage	91.2	1.2e-131
WP_052098025.1|1584282_1584840_-	hypothetical protein	NA	X2KXT0	Enterococcus_phage	51.4	1.1e-22
WP_060417463.1|1584915_1585173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003641371.1|1585628_1585829_-	hypothetical protein	NA	E9LUT7	Lactobacillus_phage	89.4	1.0e-26
WP_016511003.1|1585831_1586080_-	hypothetical protein	NA	E9LUT6	Lactobacillus_phage	75.0	2.3e-28
WP_003641369.1|1586092_1586296_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003641368.1|1586461_1586752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003641367.1|1587345_1587606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025015699.1|1587663_1587885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003641365.1|1587879_1588128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060417464.1|1588141_1588351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060417479.1|1588362_1589082_-	antirepressor	NA	D2IZW4	Enterococcus_phage	57.9	9.1e-70
WP_033608412.1|1589115_1589325_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_050495853.1|1589579_1590014_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_033608411.1|1590023_1590500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003641356.1|1591540_1591855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060417466.1|1592022_1593204_+|integrase	site-specific integrase	integrase	B4XYR4	Lactobacillus_phage	38.2	1.4e-59
WP_046947873.1|1593445_1594780_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	30.9	2.9e-37
WP_003641353.1|1594792_1595800_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_003638174.1|1595986_1596187_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	71.4	3.1e-20
WP_003641352.1|1596530_1596896_+	DUF4828 domain-containing protein	NA	NA	NA	NA	NA
WP_003641351.1|1597051_1597828_-	lysozyme	NA	A0A141HSE6	Bacillus_phage	31.1	2.6e-06
WP_003644133.1|1597852_1598731_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003641349.1|1598855_1599740_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003644132.1|1599732_1601049_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_024971402.1|1601289_1603629_-	cation-translocating P-type ATPase	NA	M1HI01	Paramecium_bursaria_Chlorella_virus	24.9	2.4e-39
1601425:1601441	attR	AATTCGGCCGGCAAACA	NA	NA	NA	NA
WP_003641346.1|1603896_1604475_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003641345.1|1604928_1606302_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	50.0	4.2e-124
WP_003641344.1|1606635_1607658_-	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	26.5	2.6e-17
WP_003641343.1|1607762_1609187_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_003641342.1|1609186_1610650_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_003641341.1|1610649_1610970_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP040858	Lactobacillus plantarum strain 202195 chromosome, complete genome	3295668	2008103	2016727	3295668		Streptococcus_phage(66.67%)	11	NA	NA
WP_013355240.1|2008103_2009099_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.5	2.0e-51
WP_003640969.1|2009237_2010023_-	acyl-ACP thioesterase	NA	NA	NA	NA	NA
WP_013355239.1|2010026_2010923_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	55.7	4.4e-82
WP_003640967.1|2011021_2011369_-	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	33.3	2.4e-12
WP_003640966.1|2011393_2012413_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	33.5	2.1e-32
WP_003640965.1|2012429_2012759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011101140.1|2012755_2013421_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	52.7	1.4e-53
WP_003640957.1|2013818_2014070_-	YaaL family protein	NA	NA	NA	NA	NA
WP_003637790.1|2014084_2014684_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_003640956.1|2014699_2015008_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_003644909.1|2015029_2016727_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	37.0	3.9e-55
>prophage 7
NZ_CP040858	Lactobacillus plantarum strain 202195 chromosome, complete genome	3295668	2163052	2224246	3295668	protease,bacteriocin,tRNA	uncultured_Mediterranean_phage(22.22%)	55	NA	NA
WP_061876050.1|2163052_2164324_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	43.7	3.4e-96
WP_003642042.1|2164790_2166404_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.9	1.2e-143
WP_003642041.1|2166576_2167185_-	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
WP_003642040.1|2167229_2167670_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_024971479.1|2168032_2168965_+	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_003642038.1|2168979_2170332_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	32.9	5.2e-26
WP_003642037.1|2170351_2171161_+	sugar-phosphatase	NA	NA	NA	NA	NA
WP_024971609.1|2171329_2172316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003642034.1|2172398_2173421_-	YdcF family protein	NA	NA	NA	NA	NA
WP_003643830.1|2173709_2174690_-	ribose-phosphate diphosphokinase	NA	A0A2K9L8D8	Tupanvirus	36.3	4.9e-42
WP_003642032.1|2175055_2175880_-	serine hydrolase	NA	NA	NA	NA	NA
WP_061876049.1|2176115_2177498_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L140	Tupanvirus	33.2	5.7e-28
WP_003642030.1|2177566_2178403_-	pur operon repressor	NA	NA	NA	NA	NA
WP_003642029.1|2178895_2179159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003642028.1|2179173_2179716_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_003646500.1|2180794_2181592_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_003642023.1|2181584_2182283_-	ABC transporter ATP-binding protein	NA	A0A1V0SGN0	Hokovirus	27.8	1.2e-15
WP_003642022.1|2182551_2183496_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003642021.1|2183805_2184672_-	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_003642020.1|2184804_2185056_-	Veg protein	NA	NA	NA	NA	NA
WP_003642019.1|2185160_2186051_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_011101014.1|2186047_2186611_-	ribonuclease M5	NA	NA	NA	NA	NA
WP_003642017.1|2186597_2187374_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_043992601.1|2188675_2189566_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_016511603.1|2189599_2190784_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_003643823.1|2191016_2193068_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	35.8	2.7e-90
WP_033608013.1|2193389_2193818_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_027821490.1|2194373_2195216_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_027821491.1|2195215_2195920_-	NAD-dependent protein deacylase	NA	NA	NA	NA	NA
WP_027821492.1|2195941_2196901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046947774.1|2196893_2198168_-	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
WP_003642008.1|2198213_2199131_-	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
WP_061876048.1|2199299_2200094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046947773.1|2200098_2201232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046947772.1|2201685_2202699_-|tRNA	tRNA-dihydrouridine synthase family protein	tRNA	NA	NA	NA	NA
WP_003642004.1|2202811_2203558_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011101006.1|2203707_2204604_-	ROK family protein	NA	NA	NA	NA	NA
WP_003642002.1|2204724_2206161_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.5	9.7e-31
WP_003643816.1|2206178_2207534_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_046947771.1|2207756_2208179_-	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
WP_003641999.1|2208168_2208357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003641998.1|2208363_2209725_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003641997.1|2209797_2210508_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003643815.1|2210913_2211930_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_021356643.1|2212369_2213146_-	carbon-nitrogen family hydrolase	NA	NA	NA	NA	NA
WP_046947770.1|2213404_2215714_+	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003641993.1|2215808_2216012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003641992.1|2216149_2216836_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003641991.1|2216929_2217610_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003641990.1|2217696_2218365_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003641987.1|2219211_2220588_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_003641986.1|2220603_2222754_-	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	27.9	6.1e-45
WP_003641985.1|2223020_2223191_+|bacteriocin	two-peptide bacteriocin plantaricin EF subunit PlnE	bacteriocin	NA	NA	NA	NA
WP_003643811.1|2223215_2223374_+|bacteriocin	two-peptide bacteriocin plantaricin EF subunit PlnF	bacteriocin	NA	NA	NA	NA
WP_046947769.1|2223472_2224246_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 1
NZ_CP040857	Lactobacillus plantarum strain 202195 plasmid unnamed, complete sequence	60765	32166	43552	60765	transposase	Enterococcus_phage(25.0%)	11	NA	NA
WP_163600791.1|32166_34314_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	60.2	2.0e-253
WP_133279749.1|34420_35347_+	ribonucleoside-diphosphate reductase	NA	A0A2H4P8A9	Corynebacterium_phage	32.4	3.4e-37
WP_133279750.1|35361_36312_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	55.0	1.1e-99
WP_133279751.1|36445_37249_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	29.6	4.9e-16
WP_133279752.1|37362_37995_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	33.2	6.2e-14
WP_020923858.1|38081_38984_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	40.3	8.2e-52
WP_133279753.1|39154_40084_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	28.2	1.8e-22
WP_027822898.1|41150_41474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046041500.1|41546_41945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063207381.1|41937_42258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_133279754.1|42250_43552_-	Y-family DNA polymerase	NA	M1Q231	Streptococcus_phage	40.0	5.8e-83
