The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	0	3365	3356547		Bacillus_phage(100.0%)	3	NA	NA
WP_163956804.1|439_895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163956805.1|1176_1587_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_163956806.1|1694_3365_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	33.3	1.2e-11
>prophage 2
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	6417	6924	3356547		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_163956811.1|6417_6924_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	50.7	1.1e-34
>prophage 3
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	12459	13008	3356547		Escherichia_phage(100.0%)	1	NA	NA
WP_163956815.1|12459_13008_+	metallophosphoesterase	NA	H6W7Z4	Escherichia_phage	34.2	1.0e-17
>prophage 4
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	16030	18535	3356547		Bacillus_virus(100.0%)	1	NA	NA
WP_163956818.1|16030_18535_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	33.7	5.9e-116
>prophage 5
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	26623	28402	3356547		Tupanvirus(100.0%)	1	NA	NA
WP_163956826.1|26623_28402_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	27.9	2.2e-32
>prophage 6
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	37385	38444	3356547		Hokovirus(100.0%)	1	NA	NA
WP_163956833.1|37385_38444_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	25.2	5.1e-21
>prophage 7
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	42367	47904	3356547		uncultured_virus(66.67%)	5	NA	NA
WP_163956839.1|42367_44011_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	59.8	3.9e-169
WP_163956840.1|44089_44377_-	co-chaperone GroES	NA	A0A221S4G8	uncultured_virus	60.9	4.3e-23
WP_163956841.1|44534_45305_-	TonB family protein	NA	NA	NA	NA	NA
WP_163956842.1|45449_47327_+	signal peptide peptidase SppA	NA	NA	NA	NA	NA
WP_163956843.1|47328_47904_+	GNAT family N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	43.3	2.4e-33
>prophage 8
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	51803	55235	3356547		Shearwaterpox_virus(50.0%)	4	NA	NA
WP_163956848.1|51803_53117_+	alkaline phosphatase family protein	NA	A0A1V0QG10	Shearwaterpox_virus	31.3	3.6e-48
WP_163956849.1|53127_53574_+	MaoC family dehydratase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_163956850.1|53888_54608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163956851.1|54704_55235_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	41.1	1.3e-20
>prophage 9
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	65252	73393	3356547		Burkholderia_phage(20.0%)	7	NA	NA
WP_163956861.1|65252_65885_-	7-carboxy-7-deazaguanine synthase	NA	A5A3S6	Burkholderia_phage	33.6	1.1e-10
WP_163956862.1|65892_66591_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A0A0RPC6	Escherichia_phage	31.1	6.8e-22
WP_163956863.1|66820_67729_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_163956864.1|67843_68761_-	ornithine carbamoyltransferase	NA	Q84489	Paramecium_bursaria_Chlorella_virus	26.9	2.6e-13
WP_163956865.1|68911_70108_-	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.1	8.1e-31
WP_166753092.1|70217_71006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163956866.1|71410_73393_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	37.4	2.1e-100
>prophage 10
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	83519	86030	3356547		Indivirus(50.0%)	4	NA	NA
WP_163956877.1|83519_84530_-	polyprenyl synthetase family protein	NA	A0A1V0SE37	Indivirus	24.2	2.2e-05
WP_163956878.1|84651_84930_+	chorismate mutase	NA	NA	NA	NA	NA
WP_163959534.1|84979_85378_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_163956879.1|85391_86030_+	dTMP kinase	NA	R4T6U6	Halovirus	31.3	6.5e-11
>prophage 11
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	96002	96500	3356547		Streptococcus_phage(100.0%)	1	NA	NA
WP_163956885.1|96002_96500_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	47.0	5.5e-26
>prophage 12
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	117551	117923	3356547		Agrobacterium_phage(100.0%)	1	NA	NA
WP_163959537.1|117551_117923_-	reverse transcriptase-like protein	NA	A0A2L0V0T1	Agrobacterium_phage	35.6	6.4e-11
>prophage 13
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	122778	123441	3356547		Planktothrix_phage(100.0%)	1	NA	NA
WP_163956903.1|122778_123441_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	36.2	3.8e-30
>prophage 14
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	141518	142616	3356547		Sulfolobus_monocaudavirus(100.0%)	1	NA	NA
WP_163956916.1|141518_142616_-	glycosyltransferase	NA	A0A0N7A8R9	Sulfolobus_monocaudavirus	34.8	6.5e-11
>prophage 15
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	157656	165837	3356547		Gordonia_phage(20.0%)	8	NA	NA
WP_163956933.1|157656_158967_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	30.6	9.2e-20
WP_163956934.1|159001_159532_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_163956935.1|159883_160339_-	NINE protein	NA	M4ZS56	Bacillus_phage	42.3	6.5e-05
WP_163956936.1|160583_161708_-	molecular chaperone DnaJ	NA	A0A0G2YAM9	Acanthamoeba_polyphaga_mimivirus	28.5	1.8e-19
WP_163956937.1|161804_163709_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.1	2.6e-148
WP_163956938.1|163841_164336_+	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_163956939.1|164490_164970_+	vgr related protein	NA	NA	NA	NA	NA
WP_163956940.1|165132_165837_+	hypothetical protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	48.7	2.2e-07
>prophage 16
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	172201	172777	3356547	protease	Tupanvirus(100.0%)	1	NA	NA
WP_163956948.1|172201_172777_-|protease	serine protease	protease	A0A2K9L6R2	Tupanvirus	29.8	1.3e-07
>prophage 17
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	178880	179777	3356547	integrase	Mycobacterium_phage(100.0%)	1	170443:170458	179978:179993
170443:170458	attL	CGCCGAACTGCTCGGC	NA	NA	NA	NA
WP_163956956.1|178880_179777_-|integrase	tyrosine-type recombinase/integrase	integrase	R4JKS7	Mycobacterium_phage	31.8	1.0e-09
WP_163956956.1|178880_179777_-|integrase	tyrosine-type recombinase/integrase	integrase	R4JKS7	Mycobacterium_phage	31.8	1.0e-09
179978:179993	attR	CGCCGAACTGCTCGGC	NA	NA	NA	NA
>prophage 18
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	191314	195458	3356547		Acanthamoeba_polyphaga_mimivirus(50.0%)	3	NA	NA
WP_163956964.1|191314_192340_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.0	2.6e-17
WP_163959543.1|192346_193873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163956965.1|193946_195458_-	trypsin-like peptidase domain-containing protein	NA	W5SAB9	Pithovirus	29.9	3.0e-06
>prophage 19
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	216427	218512	3356547		Bacillus_phage(50.0%)	3	NA	NA
WP_163956979.1|216427_217087_-	response regulator	NA	W8CYM9	Bacillus_phage	34.4	1.4e-21
WP_163956980.1|217197_217809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163956981.1|217876_218512_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	35.7	9.9e-20
>prophage 20
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	223010	225395	3356547		Herpes_simplex_virus(100.0%)	1	NA	NA
WP_163959545.1|223010_225395_-	DUF4982 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	27.0	3.9e-24
>prophage 21
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	249295	251443	3356547		Bacillus_phage(100.0%)	1	NA	NA
WP_163956998.1|249295_251443_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	30.3	8.8e-44
>prophage 22
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	265298	265988	3356547		Bacillus_phage(100.0%)	1	NA	NA
WP_163957007.1|265298_265988_-	response regulator	NA	W8CYM9	Bacillus_phage	35.4	1.1e-27
>prophage 23
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	272380	273052	3356547		Bacillus_phage(100.0%)	1	NA	NA
WP_163959551.1|272380_273052_+	response regulator	NA	W8CYM9	Bacillus_phage	33.8	1.1e-29
>prophage 24
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	303015	304644	3356547		Saudi_moumouvirus(100.0%)	1	NA	NA
WP_163957036.1|303015_304644_+	carboxylesterase family protein	NA	A0A1S5V000	Saudi_moumouvirus	39.8	4.3e-35
>prophage 25
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	308825	309991	3356547	transposase	Leptospira_phage(100.0%)	1	NA	NA
WP_163957038.1|308825_309991_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.6	8.7e-46
>prophage 26
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	374824	376094	3356547		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
WP_163957073.1|374824_375406_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	50.6	5.1e-47
WP_163957074.1|375428_375644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163957075.1|375689_376094_+	hypothetical protein	NA	A0A1B1ITZ6	uncultured_Mediterranean_phage	35.8	4.2e-08
>prophage 27
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	403176	404838	3356547		Flavobacterium_phage(100.0%)	1	NA	NA
WP_163957104.1|403176_404838_+	cytochrome c oxidase subunit I	NA	R9VX24	Flavobacterium_phage	40.8	2.6e-11
>prophage 28
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	418902	419667	3356547		Bacillus_phage(100.0%)	1	NA	NA
WP_163957118.1|418902_419667_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	35.2	1.3e-13
>prophage 29
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	428298	429264	3356547		Tupanvirus(100.0%)	1	NA	NA
WP_163957126.1|428298_429264_+	alpha/beta fold hydrolase	NA	A0A2K9L3Q7	Tupanvirus	31.6	1.1e-06
>prophage 30
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	438709	442124	3356547		Mollivirus(50.0%)	3	NA	NA
WP_163957133.1|438709_440254_-	carboxylesterase family protein	NA	A0A0M4JT58	Mollivirus	27.7	2.9e-25
WP_163957134.1|440240_441251_-	sugar kinase	NA	NA	NA	NA	NA
WP_163957135.1|441371_442124_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	35.5	2.8e-21
>prophage 31
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	447323	448757	3356547		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_163959571.1|447323_448757_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	33.3	2.6e-44
>prophage 32
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	458525	459878	3356547		Mycobacterium_phage(100.0%)	1	NA	NA
WP_163957143.1|458525_459878_-	serine hydrolase	NA	A0A2D1GA60	Mycobacterium_phage	21.4	1.7e-05
>prophage 33
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	470552	471347	3356547		Staphylococcus_phage(100.0%)	1	NA	NA
WP_163957152.1|470552_471347_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.4	1.5e-52
>prophage 34
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	483399	485379	3356547		Bathycoccus_sp._RCC1105_virus(100.0%)	1	NA	NA
WP_163957165.1|483399_485379_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5ESM9	Bathycoccus_sp._RCC1105_virus	46.8	2.0e-111
>prophage 35
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	491487	492507	3356547		uncultured_virus(100.0%)	1	NA	NA
WP_163957171.1|491487_492507_-	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	32.8	5.9e-06
>prophage 36
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	498306	502436	3356547		Agrobacterium_phage(50.0%)	4	NA	NA
WP_163957181.1|498306_498573_-	DUF2312 domain-containing protein	NA	J7FAQ3	Agrobacterium_phage	66.2	3.6e-16
WP_163957182.1|498690_499065_-	DUF1244 domain-containing protein	NA	NA	NA	NA	NA
WP_163957183.1|500701_501241_+	DUF4337 family protein	NA	NA	NA	NA	NA
WP_163957184.1|501419_502436_+	glycosyltransferase	NA	A0A075B8F6	Enterobacteria_phage	35.7	7.3e-49
>prophage 37
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	506448	507732	3356547		Shahe_endorna-like_virus(100.0%)	1	NA	NA
WP_163957188.1|506448_507732_+	glycosyltransferase family 1 protein	NA	A0A1L3KK54	Shahe_endorna-like_virus	41.1	6.3e-05
>prophage 38
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	522302	531416	3356547		Liberibacter_phage(50.0%)	8	NA	NA
WP_163957201.1|522302_522857_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	28.6	6.0e-13
WP_163957202.1|522867_523068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163959581.1|523309_524809_+	N-6 DNA methylase	NA	A0A220A2U4	Liberibacter_phage	43.6	9.6e-114
WP_163957203.1|524798_525998_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_163957204.1|525994_529039_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	30.1	2.6e-94
WP_163957205.1|529038_529770_+	DUF45 domain-containing protein	NA	NA	NA	NA	NA
WP_163957206.1|529914_530412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163957207.1|530501_531416_+	helix-turn-helix domain-containing protein	NA	H6X4Q4	Enterobacteria_phage	31.4	6.9e-06
>prophage 39
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	535544	537475	3356547	transposase	Burkholderia_phage(50.0%)	2	NA	NA
WP_163957201.1|535544_536099_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	28.6	6.0e-13
WP_163957038.1|536310_537475_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.6	8.7e-46
>prophage 40
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	542100	549651	3356547	integrase	uncultured_phage(50.0%)	4	538447:538506	543642:543800
538447:538506	attL	TCCCTTCGCCCGCTCCAGCGACTTCCAAACCATTGGAAGTCCTCGCAAAACCGTCGAAGC	NA	NA	NA	NA
WP_163957217.1|542100_543465_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A059XK29	uncultured_phage	29.2	7.1e-23
WP_163957218.1|543901_544675_+	hypothetical protein	NA	NA	NA	NA	NA
543642:543800	attR	GCTTCGACGGTTTTGCGAGGACTTCCAATGGTTTGGAAGTCGCTGGAGCGGGCGAAGGGATTCGAACCCTCGACCCCAACCTTGGCAAGGTTGTGCTCTACCCCTGAGCTACGCCCGCTCTGGCGCCTGTCCGACCGGCTGGTCGGTGGGTGAGGGGCG	NA	NA	NA	NA
WP_163959582.1|544583_546119_+	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_163957219.1|546321_549651_+	error-prone DNA polymerase	NA	Q8W6C3	Saccharomonospora_phage	29.1	3.7e-65
>prophage 41
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	553161	553728	3356547		Virus_Rctr197k(100.0%)	1	NA	NA
WP_163957220.1|553161_553728_-	HNH endonuclease	NA	A0A1P8DIY8	Virus_Rctr197k	38.8	6.5e-23
>prophage 42
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	578770	583180	3356547		Planktothrix_phage(50.0%)	2	NA	NA
WP_163957236.1|578770_580264_-	peptidoglycan DD-metalloendopeptidase family protein	NA	G9BW84	Planktothrix_phage	42.6	6.4e-17
WP_163957237.1|580690_583180_+	helicase	NA	A0A248SJQ0	Salicola_phage	33.3	2.6e-23
>prophage 43
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	589359	593307	3356547		uncultured_Mediterranean_phage(50.0%)	3	NA	NA
WP_163957245.1|589359_589818_+	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	54.1	7.9e-35
WP_163957246.1|589871_590759_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_163957247.1|591015_593307_+	CDC48 family AAA ATPase	NA	R4TQL5	Phaeocystis_globosa_virus	40.1	6.9e-47
>prophage 44
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	626555	639585	3356547		Catovirus(16.67%)	16	NA	NA
WP_163959592.1|626555_627449_+	tetratricopeptide repeat protein	NA	A0A1V0SAT9	Catovirus	35.3	3.6e-07
WP_163959593.1|627451_628087_+	LON peptidase substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_163957276.1|628083_628257_+	Trm112 family protein	NA	NA	NA	NA	NA
WP_163959594.1|628275_628809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163957277.1|628796_630011_-	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_163957278.1|630147_632469_+	DNA translocase FtsK 4TM domain-containing protein	NA	S5VNE3	Mycobacterium_phage	44.5	1.8e-79
WP_163957279.1|632586_633204_+	outer-membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
WP_163957280.1|633663_634446_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_163957281.1|634442_635504_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	42.1	4.8e-35
WP_163957282.1|635517_636009_-	MmcB family DNA repair protein	NA	B2ZY91	Ralstonia_phage	33.0	3.0e-08
WP_163957283.1|636071_636743_-	cell wall hydrolase	NA	A0A1B0UXM4	Roseobacter_phage	39.3	3.6e-12
WP_163957284.1|636896_637223_-	DUF1491 family protein	NA	NA	NA	NA	NA
WP_163957285.1|637230_637713_-	hotdog fold thioesterase	NA	NA	NA	NA	NA
WP_163957286.1|637702_638167_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_163957287.1|638233_638842_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_163957288.1|638892_639585_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	51.1	1.3e-52
>prophage 45
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	646201	646918	3356547		Pseudomonas_phage(100.0%)	1	NA	NA
WP_163957296.1|646201_646918_+	YjbE family putative metal transport protein	NA	W8EBD0	Pseudomonas_phage	32.8	1.7e-12
>prophage 46
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	652041	658491	3356547	tRNA	Natrialba_phage(33.33%)	6	NA	NA
WP_163957302.1|652041_652824_+	AAA family ATPase	NA	Q8JL10	Natrialba_phage	34.0	8.4e-29
WP_163957303.1|652820_653726_+	ParB/RepB/Spo0J family partition protein	NA	S5VTK0	Leptospira_phage	31.4	1.4e-14
WP_163957304.1|653725_654472_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_163957305.1|654475_655495_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_163957306.1|655504_655996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163957307.1|655992_658491_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	39.7	1.2e-169
>prophage 47
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	685602	686697	3356547		Pacmanvirus(100.0%)	1	NA	NA
WP_163957330.1|685602_686697_-	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	27.3	6.1e-17
>prophage 48
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	691129	691705	3356547		Paracoccus_phage(100.0%)	1	NA	NA
WP_163957335.1|691129_691705_-	single-stranded DNA-binding protein	NA	A0A0U2C0X4	Paracoccus_phage	79.5	1.1e-49
>prophage 49
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	697978	705146	3356547		Diadromus_pulchellus_ascovirus(25.0%)	7	NA	NA
WP_163957342.1|697978_699748_-	DNA helicase RecQ	NA	F2NZ48	Diadromus_pulchellus_ascovirus	40.8	3.3e-73
WP_163957343.1|699725_700841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163957344.1|700850_702698_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	28.0	1.9e-39
WP_163957345.1|702795_703026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163959601.1|703041_703980_-	squalene/phytoene synthase family protein	NA	NA	NA	NA	NA
WP_163957346.1|703969_704551_-	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	30.1	1.3e-13
WP_163957347.1|704600_705146_-	septal ring lytic transglycosylase RlpA family protein	NA	H2BCY4	Synechococcus_phage	41.9	2.9e-12
>prophage 50
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	723545	724235	3356547		Bubaline_alphaherpesvirus(100.0%)	1	NA	NA
WP_163957363.1|723545_724235_-	uracil-DNA glycosylase	NA	A0A1L5JKJ8	Bubaline_alphaherpesvirus	50.0	2.8e-44
>prophage 51
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	729794	730718	3356547		Staphylococcus_phage(100.0%)	1	NA	NA
WP_163957369.1|729794_730718_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	2.3e-17
>prophage 52
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	735642	738784	3356547		Staphylococcus_phage(75.0%)	4	NA	NA
WP_163957377.1|735642_736062_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2I2L4Y7	Orpheovirus	30.8	1.1e-06
WP_163957378.1|736063_737227_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	40.3	1.1e-56
WP_163957379.1|737216_737822_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	35.7	1.2e-22
WP_163959608.1|737806_738784_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	32.0	4.6e-24
>prophage 53
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	741860	742808	3356547		Hokovirus(100.0%)	1	NA	NA
WP_163957383.1|741860_742808_+	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	36.6	1.4e-46
>prophage 54
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	750979	752191	3356547		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_163957395.1|750979_752191_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.4	8.3e-84
>prophage 55
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	763290	764157	3356547		Enterococcus_phage(100.0%)	1	NA	NA
WP_163957405.1|763290_764157_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	38.1	2.0e-31
>prophage 56
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	767444	773285	3356547	tRNA	Moraxella_phage(33.33%)	6	NA	NA
WP_163957408.1|767444_768473_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	42.9	7.1e-60
WP_163957409.1|768469_769444_+	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_163957410.1|769525_770785_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_163957411.1|770783_772202_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	34.1	2.4e-34
WP_163957412.1|772218_772419_+	DUF2093 domain-containing protein	NA	NA	NA	NA	NA
WP_163957420.1|772415_773285_+	peptidoglycan DD-metalloendopeptidase family protein	NA	V5R8R0	Arthrobacter_phage	45.9	1.2e-12
>prophage 57
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	776747	779327	3356547		Cronobacter_phage(100.0%)	1	NA	NA
WP_163957424.1|776747_779327_-	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	36.6	1.9e-122
>prophage 58
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	783959	784442	3356547		Tetraselmis_virus(100.0%)	1	NA	NA
WP_163957432.1|783959_784442_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	43.1	8.3e-19
>prophage 59
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	788811	790914	3356547		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_163959610.1|788811_790914_-	RelA/SpoT family protein	NA	A0A1B1IUF0	uncultured_Mediterranean_phage	34.3	1.8e-09
>prophage 60
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	797999	798329	3356547	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_163959611.1|797999_798329_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	46.2	2.7e-13
>prophage 61
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	801788	803102	3356547		Pandoravirus(100.0%)	1	NA	NA
WP_163957465.1|801788_803102_-	cystathionine gamma-synthase family protein	NA	A0A0B5JD48	Pandoravirus	31.6	4.0e-23
>prophage 62
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	807145	808825	3356547		Staphylococcus_phage(100.0%)	1	NA	NA
WP_163957467.1|807145_808825_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	25.9	8.2e-29
>prophage 63
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	816416	817085	3356547		Bacillus_virus(100.0%)	1	NA	NA
WP_163957479.1|816416_817085_-	OmpA family protein	NA	G3M9Z0	Bacillus_virus	36.0	3.9e-06
>prophage 64
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	825894	833340	3356547		Prochlorococcus_phage(33.33%)	4	NA	NA
WP_163957493.1|825894_827448_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	48.2	6.5e-65
WP_163957494.1|827690_829205_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_163957497.1|829326_832083_-	DNA polymerase I	NA	A0A142F1Q9	Bacillus_phage	33.0	1.0e-60
WP_163957499.1|832233_833340_-	serine hydrolase	NA	Q38058	Escherichia_phage	27.0	2.4e-13
>prophage 65
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	854937	857813	3356547		Pseudomonas_phage(50.0%)	3	NA	NA
WP_163957538.1|854937_855414_+	hypothetical protein	NA	A0A1B0VMI8	Pseudomonas_phage	38.8	4.4e-20
WP_166753177.1|855555_856200_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_163959626.1|856379_857813_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	46.3	5.0e-11
>prophage 66
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	862756	863122	3356547		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_163957547.1|862756_863122_+	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	35.0	2.8e-11
>prophage 67
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	876138	877494	3356547		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_163957561.1|876138_877494_-	hypothetical protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.0	2.1e-06
>prophage 68
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	880749	881637	3356547		Pandoravirus(100.0%)	1	NA	NA
WP_163959638.1|880749_881637_-	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	38.7	1.4e-32
>prophage 69
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	885896	887711	3356547		Acinetobacter_phage(100.0%)	1	NA	NA
WP_163957574.1|885896_887711_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	33.4	8.2e-43
>prophage 70
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	892208	898636	3356547		Emiliania_huxleyi_virus(25.0%)	6	NA	NA
WP_163957581.1|892208_892877_+	ribonuclease HII	NA	D2TEQ2	Emiliania_huxleyi_virus	38.6	1.9e-21
WP_163957583.1|893051_894206_+	site-specific DNA-methyltransferase	NA	A0A249XUJ2	Enterococcus_phage	31.5	2.1e-28
WP_163957584.1|894374_895430_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.7	2.8e-19
WP_163957586.1|895501_896386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163957588.1|896386_897133_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_163957590.1|897214_898636_-	sigma 54-interacting transcriptional regulator	NA	W8CYM9	Bacillus_phage	33.9	1.4e-08
>prophage 71
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	915332	917177	3356547		Tupanvirus(100.0%)	1	NA	NA
WP_163959654.1|915332_917177_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	32.2	3.6e-70
>prophage 72
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	921745	939239	3356547	protease,portal,head,tail,capsid	Pseudomonas_phage(25.0%)	17	NA	NA
WP_163957626.1|921745_923077_+	DNA-packaging protein	NA	A0A0K0N6T3	Gordonia_phage	38.3	1.6e-64
WP_163957628.1|923520_924624_+|portal	phage portal protein	portal	W8ECU7	Geobacillus_phage	34.7	3.9e-48
WP_163957630.1|924620_924941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163959655.1|924937_925312_+|head,protease	HK97 family phage prohead protease	head,protease	NA	NA	NA	NA
WP_163957632.1|925351_926353_+|capsid	phage major capsid protein	capsid	A0A2D1GNH4	Pseudomonas_phage	46.0	4.3e-78
WP_163957634.1|926413_926944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163959656.1|926994_927369_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_163957637.1|927382_927790_+|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_163957639.1|927786_928101_+	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_163957641.1|928097_928301_+|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_163957643.1|928293_928836_+|tail	tail tape measure protein	tail	D6PEW0	uncultured_phage	34.0	1.8e-06
WP_163957646.1|931459_932257_+	DUF2163 domain-containing protein	NA	A0A0K1Y6Z2	Rhodobacter_phage	40.0	1.4e-39
WP_163959657.1|932243_932642_+	peptidoglycan endopeptidase	NA	NA	NA	NA	NA
WP_163957648.1|932641_934807_+	hypothetical protein	NA	A0A1W6DWX7	Sphingobium_phage	39.6	1.6e-29
WP_163957649.1|934809_935313_+	DUF2793 domain-containing protein	NA	A0A0A1IV74	Pseudomonas_phage	36.2	1.4e-05
WP_163957650.1|935427_936549_+	OmpA family protein	NA	NA	NA	NA	NA
WP_163957651.1|937928_939239_+	nucleotide sugar dehydrogenase	NA	A0A127AXI2	Bacillus_phage	38.5	1.3e-77
>prophage 73
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	953211	953625	3356547		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_163957664.1|953211_953625_-	DUF1810 family protein	NA	A0A2H4UVK5	Bodo_saltans_virus	41.2	7.6e-13
>prophage 74
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	961392	962523	3356547	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_163957674.1|961392_962523_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	33.0	1.5e-23
>prophage 75
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	968250	971373	3356547		Streptococcus_phage(50.0%)	4	NA	NA
WP_163959660.1|968250_969750_+	peptide chain release factor 3	NA	A0A1B0RXH7	Streptococcus_phage	28.6	2.0e-39
WP_163957678.1|970327_970537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163957679.1|970708_971068_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_163959661.1|971073_971373_-	integration host factor subunit alpha	NA	Q2A099	Sodalis_phage	33.7	8.2e-09
>prophage 76
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	974866	976618	3356547		Pandoravirus(100.0%)	1	NA	NA
WP_163959662.1|974866_976618_+	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	36.9	1.1e-60
>prophage 77
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	979797	981732	3356547		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_163957687.1|979797_981732_+	KUP/HAK/KT family potassium transporter	NA	M1GW05	Acanthocystis_turfacea_Chlorella_virus	35.2	2.3e-67
>prophage 78
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	988832	996687	3356547		Staphylococcus_phage(25.0%)	9	NA	NA
WP_163957693.1|988832_989612_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.1	6.5e-21
WP_163957694.1|989801_990338_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_163957695.1|990344_990974_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_163957696.1|991025_991646_-	ribonuclease D	NA	NA	NA	NA	NA
WP_163957697.1|991929_992772_+	cold shock domain-containing protein	NA	Q9AZD3	Lactococcus_phage	49.2	4.7e-09
WP_163957698.1|992902_993841_+	glutaminyl-peptide cyclotransferase	NA	NA	NA	NA	NA
WP_163957699.1|993896_994586_+	HTH domain-containing protein	NA	A0A1B0RXM1	Streptococcus_phage	33.3	1.0e-14
WP_163957700.1|994671_995043_+	VOC family protein	NA	NA	NA	NA	NA
WP_163957701.1|995091_996687_-	cisplatin damage response ATP-dependent DNA ligase	NA	V5LNG6	Emiliania_huxleyi_virus	22.8	2.5e-11
>prophage 79
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	1009864	1016617	3356547	tRNA	uncultured_Mediterranean_phage(66.67%)	7	NA	NA
WP_163957714.1|1009864_1012702_-	insulinase family protein	NA	A0A1E1EST3	Acanthamoeba_castellanii_mimivirus	29.9	5.1e-15
WP_163957715.1|1012827_1013016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163957716.1|1013018_1014155_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	49.5	2.5e-90
WP_166753188.1|1014221_1014386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163957717.1|1014402_1014858_-	EF-hand domain-containing protein	NA	NA	NA	NA	NA
WP_163957718.1|1014860_1015892_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_163957719.1|1015888_1016617_-	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	48.3	2.7e-29
>prophage 80
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	1024535	1025651	3356547		Rhizobium_phage(100.0%)	1	NA	NA
WP_163957728.1|1024535_1025651_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	44.5	1.7e-70
>prophage 81
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	1039187	1040492	3356547		Agrobacterium_phage(100.0%)	1	NA	NA
WP_163957738.1|1039187_1040492_+	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	53.8	1.5e-131
>prophage 82
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	1047769	1048699	3356547		Staphylococcus_phage(100.0%)	1	NA	NA
WP_163957745.1|1047769_1048699_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.7	3.1e-22
>prophage 83
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	1053895	1057752	3356547		Acinetobacter_phage(33.33%)	5	NA	NA
WP_163957749.1|1053895_1055023_+	peptide chain release factor 2	NA	G0YKC3	Acinetobacter_phage	49.1	5.5e-05
WP_163957750.1|1055019_1055754_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_163957751.1|1055959_1056349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163957752.1|1056457_1057252_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	64.4	1.2e-99
WP_163957753.1|1057248_1057752_+	dihydrofolate reductase	NA	J9PU01	Bacillus_phage	41.7	7.9e-20
>prophage 84
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	1075657	1084718	3356547		Brazilian_cedratvirus(25.0%)	9	NA	NA
WP_163957767.1|1075657_1077235_+	phosphoglycerate dehydrogenase	NA	A0A2R8FDS8	Brazilian_cedratvirus	36.7	1.4e-43
WP_163957768.1|1077306_1078413_+	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_163957769.1|1078522_1079812_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	33.2	2.2e-58
WP_163957770.1|1079896_1080358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163957771.1|1080427_1081498_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.0	3.5e-78
WP_163959685.1|1081494_1082016_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_166753239.1|1082018_1082822_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_163957773.1|1082818_1083769_-	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_163957774.1|1083776_1084718_-	DnaJ domain-containing protein	NA	A0A0P0YNN4	Yellowstone_lake_phycodnavirus	28.0	1.5e-11
>prophage 85
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	1088765	1091225	3356547		Rhizobium_phage(100.0%)	1	NA	NA
WP_163957777.1|1088765_1091225_-	DNA ligase D	NA	A0A068CDF3	Rhizobium_phage	37.1	1.8e-48
>prophage 86
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	1106403	1107300	3356547		Pithovirus(100.0%)	1	NA	NA
WP_163957788.1|1106403_1107300_+	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	28.2	1.2e-10
>prophage 87
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	1111188	1112367	3356547		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_163957792.1|1111188_1112367_-	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A0K0KVL7	Prochlorococcus_phage	24.6	4.4e-05
>prophage 88
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	1116366	1120675	3356547		Acinetobacter_phage(50.0%)	2	NA	NA
WP_163957796.1|1116366_1119654_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	23.0	3.6e-20
WP_163957797.1|1119709_1120675_+	2OG-Fe(II) oxygenase	NA	A0A2K9KZL4	Tupanvirus	34.6	1.6e-16
>prophage 89
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	1126460	1129253	3356547		Acinetobacter_phage(100.0%)	1	NA	NA
WP_163957800.1|1126460_1129253_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	25.6	5.7e-27
>prophage 90
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	1144291	1147680	3356547	transposase	Vibrio_phage(50.0%)	2	NA	NA
WP_163957810.1|1144291_1146199_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	30.5	9.6e-26
WP_163957038.1|1146514_1147680_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.6	8.7e-46
>prophage 91
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	1168836	1169607	3356547		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_163957827.1|1168836_1169607_+	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.4	7.3e-09
>prophage 92
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	1183062	1183776	3356547		Bacillus_phage(100.0%)	1	NA	NA
WP_163957836.1|1183062_1183776_-	response regulator	NA	W8CYM9	Bacillus_phage	37.1	6.5e-36
>prophage 93
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	1195915	1200344	3356547		Acanthamoeba_polyphaga_mimivirus(50.0%)	3	NA	NA
WP_163957848.1|1195915_1198492_-	type I DNA topoisomerase	NA	A0A0G2Y787	Acanthamoeba_polyphaga_mimivirus	30.8	5.0e-94
WP_163957849.1|1198601_1199246_+	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_163957850.1|1199261_1200344_-	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	42.0	5.4e-26
>prophage 94
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	1204520	1205831	3356547		Aeromonas_phage(100.0%)	1	NA	NA
WP_163957854.1|1204520_1205831_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	54.4	5.3e-108
>prophage 95
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	1210572	1212455	3356547		Paramecium_bursaria_Chlorella_virus(100.0%)	2	NA	NA
WP_163957861.1|1210572_1211538_+	agmatine deiminase family protein	NA	M1H3B1	Paramecium_bursaria_Chlorella_virus	32.1	2.6e-43
WP_163957862.1|1211594_1212455_+	N-carbamoylputrescine amidase	NA	M1H5W0	Paramecium_bursaria_Chlorella_virus	43.1	6.4e-62
>prophage 96
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	1218802	1219801	3356547		Tupanvirus(100.0%)	1	NA	NA
WP_163959719.1|1218802_1219801_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	33.1	5.7e-38
>prophage 97
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	1223379	1224246	3356547		Pseudomonas_phage(100.0%)	1	NA	NA
WP_163957872.1|1223379_1224246_-	lytic transglycosylase domain-containing protein	NA	F8SJ56	Pseudomonas_phage	36.8	4.8e-25
>prophage 98
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	1238025	1243143	3356547		Erythrobacter_phage(50.0%)	3	NA	NA
WP_163957889.1|1238025_1238520_-	MucR family transcriptional regulator	NA	A0A1P8VVG0	Erythrobacter_phage	48.8	1.4e-24
WP_163959724.1|1238803_1240024_-	aspartyl/asparaginyl beta-hydroxylase domain-containing protein	NA	NA	NA	NA	NA
WP_163957890.1|1240152_1243143_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	23.2	2.3e-18
>prophage 99
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	1250798	1260110	3356547		Pseudomonas_phage(25.0%)	7	NA	NA
WP_163959726.1|1250798_1251404_+	NAD-dependent DNA ligase	NA	A0A0U4J8W4	Pseudomonas_phage	46.1	6.7e-42
WP_163957898.1|1251437_1251713_+	BrnT family toxin	NA	K4NX81	Burkholderia_phage	51.9	1.1e-15
WP_163957899.1|1251675_1251990_+	BrnA antitoxin family protein	NA	NA	NA	NA	NA
WP_163957900.1|1252050_1253274_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_163957901.1|1253285_1256165_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	60.4	0.0e+00
WP_163957902.1|1256288_1256678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163957903.1|1256777_1260110_+	class I SAM-dependent DNA methyltransferase	NA	Q6NE04	Leptospira_phage	22.4	1.4e-27
>prophage 100
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	1296359	1299176	3356547	tRNA	Klosneuvirus(100.0%)	1	NA	NA
WP_163957928.1|1296359_1299176_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	23.7	1.7e-63
>prophage 101
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	1303527	1305547	3356547		Cafeteria_roenbergensis_virus(50.0%)	2	NA	NA
WP_163957933.1|1303527_1305072_-	cryptochrome/photolyase family protein	NA	E3T4R9	Cafeteria_roenbergensis_virus	33.6	1.2e-58
WP_163957934.1|1305100_1305547_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	53.3	7.2e-25
>prophage 102
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	1318594	1329950	3356547		uncultured_Mediterranean_phage(25.0%)	9	NA	NA
WP_163957944.1|1318594_1320157_+	Do family serine endopeptidase	NA	A0A1B1IT49	uncultured_Mediterranean_phage	32.1	2.7e-18
WP_163957945.1|1320269_1321934_+	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	44.4	8.2e-82
WP_163957946.1|1322005_1323220_+	amidohydrolase	NA	NA	NA	NA	NA
WP_163959736.1|1323256_1324213_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_163957947.1|1324514_1325669_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A8ATH6	Listeria_phage	50.9	1.6e-23
WP_163957948.1|1325929_1326268_+	iron-sulfur cluster insertion protein ErpA	NA	NA	NA	NA	NA
WP_163957949.1|1326271_1327042_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_163957950.1|1327038_1327830_+	transporter	NA	NA	NA	NA	NA
WP_163957951.1|1327916_1329950_+	M13 family metallopeptidase	NA	A0A1V0SHG2	Klosneuvirus	32.6	9.5e-64
>prophage 103
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	1352642	1353626	3356547		Cyanophage(100.0%)	1	NA	NA
WP_163957966.1|1352642_1353626_+	decarboxylating 6-phosphogluconate dehydrogenase	NA	H6WFR9	Cyanophage	45.4	1.5e-78
>prophage 104
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	1362510	1364160	3356547		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_163957978.1|1362510_1364160_-	thiamine pyrophosphate-binding protein	NA	G9E4W7	Ostreococcus_lucimarinus_virus	38.9	1.4e-09
>prophage 105
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	1381837	1386549	3356547		Bacillus_virus(50.0%)	4	NA	NA
WP_163957987.1|1381837_1383907_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	32.2	1.1e-14
WP_163957988.1|1383891_1384554_-	cell wall hydrolase	NA	NA	NA	NA	NA
WP_163957989.1|1384758_1385049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163957990.1|1385193_1386549_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	1.4e-42
>prophage 106
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	1432144	1434592	3356547		Saudi_moumouvirus(100.0%)	1	NA	NA
WP_163958018.1|1432144_1434592_+	ATP-dependent helicase HrpB	NA	A0A1S5V1F0	Saudi_moumouvirus	23.4	4.1e-21
>prophage 107
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	1448630	1449392	3356547		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_163958030.1|1448630_1449392_-	glucose 1-dehydrogenase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	22.7	3.5e-11
>prophage 108
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	1483642	1487132	3356547		Rhizobium_phage(50.0%)	4	NA	NA
WP_163958056.1|1483642_1484662_+	cobaltochelatase subunit CobS	NA	L7TKP0	Rhizobium_phage	34.9	7.4e-41
WP_163958057.1|1484669_1484975_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_163958058.1|1484964_1485306_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_163958059.1|1485305_1487132_+	cobaltochelatase subunit CobT	NA	J9Q7G6	Salmonella_phage	30.2	1.3e-16
>prophage 109
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	1490807	1491491	3356547		Synechococcus_phage(100.0%)	1	NA	NA
WP_163958062.1|1490807_1491491_+	Fe2+-dependent dioxygenase	NA	Q5GQB0	Synechococcus_phage	29.6	2.7e-15
>prophage 110
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	1510059	1515244	3356547	tRNA	Bacillus_virus(50.0%)	3	NA	NA
WP_163958074.1|1510059_1512312_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.4	2.9e-74
WP_163958075.1|1512395_1514090_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_163958076.1|1514005_1515244_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	A0A2L0UZ92	Agrobacterium_phage	44.3	1.9e-30
>prophage 111
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	1524642	1525197	3356547		Pseudomonas_phage(100.0%)	1	NA	NA
WP_163958086.1|1524642_1525197_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	65.1	1.3e-63
>prophage 112
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	1536751	1537606	3356547		uncultured_virus(100.0%)	1	NA	NA
WP_163959787.1|1536751_1537606_-	metallophosphoesterase family protein	NA	A0A218MKA7	uncultured_virus	47.7	8.3e-62
>prophage 113
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	1554311	1555403	3356547		Stenotrophomonas_phage(100.0%)	1	NA	NA
WP_163958108.1|1554311_1555403_-	inositol-3-phosphate synthase	NA	A0A0H4IPK5	Stenotrophomonas_phage	46.8	9.8e-84
>prophage 114
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	1559638	1563141	3356547		Catovirus(50.0%)	2	NA	NA
WP_163959797.1|1559638_1561390_-	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	25.3	3.3e-41
WP_163959800.1|1561488_1563141_-	gamma-glutamyltransferase	NA	Q5GF27	Diachasmimorpha_longicaudata_entomopoxvirus	26.9	2.4e-09
>prophage 115
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	1566697	1570266	3356547		Cedratvirus(50.0%)	3	NA	NA
WP_163958115.1|1566697_1567456_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	27.8	3.2e-09
WP_163958116.1|1567736_1568795_+	SufD family Fe-S cluster assembly protein	NA	NA	NA	NA	NA
WP_163958117.1|1569057_1570266_+	SufS family cysteine desulfurase	NA	Q2XUY6	environmental_halophage	42.7	7.0e-91
>prophage 116
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	1578639	1582236	3356547		Emiliania_huxleyi_virus(50.0%)	4	NA	NA
WP_166753218.1|1578639_1579866_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	31.0	6.1e-34
WP_163958124.1|1579903_1580146_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_163958125.1|1580189_1581092_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_163958126.1|1581132_1582236_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	1.5e-42
>prophage 117
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	1590612	1591191	3356547	integrase	Caulobacter_virus(100.0%)	1	1583862:1583876	1592839:1592853
1583862:1583876	attL	AGATGCTGCCGTCGG	NA	NA	NA	NA
WP_163958133.1|1590612_1591191_-|integrase	tyrosine-type recombinase/integrase	integrase	K4K327	Caulobacter_virus	41.5	2.9e-26
WP_163958133.1|1590612_1591191_-|integrase	tyrosine-type recombinase/integrase	integrase	K4K327	Caulobacter_virus	41.5	2.9e-26
1592839:1592853	attR	AGATGCTGCCGTCGG	NA	NA	NA	NA
>prophage 118
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	1594687	1596378	3356547		uncultured_virus(50.0%)	2	NA	NA
WP_163958139.1|1594687_1595113_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A218MND2	uncultured_virus	40.7	1.5e-16
WP_163958140.1|1595109_1596378_+	DUF4113 domain-containing protein	NA	F1C5A5	Cronobacter_phage	43.3	2.3e-84
>prophage 119
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	1599753	1600380	3356547		Sinorhizobium_phage(100.0%)	1	NA	NA
WP_163958142.1|1599753_1600380_+	SOS response-associated peptidase family protein	NA	A0A291AUP1	Sinorhizobium_phage	31.7	7.0e-18
>prophage 120
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	1607257	1608223	3356547		Mycobacterium_phage(100.0%)	1	NA	NA
WP_163958147.1|1607257_1608223_-	alpha/beta hydrolase fold domain-containing protein	NA	A0A088FQA2	Mycobacterium_phage	28.1	4.7e-13
>prophage 121
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	1616592	1624161	3356547	transposase	Brevibacterium_phage(33.33%)	6	NA	NA
WP_163958154.1|1616592_1617579_+	hypothetical protein	NA	A0A249XNQ1	Brevibacterium_phage	40.0	5.6e-46
WP_163958155.1|1617584_1620155_-	DEAD/DEAH box helicase	NA	A0A076FHE1	Aureococcus_anophage	21.3	6.0e-07
WP_163958156.1|1620151_1620988_-	DUF1837 domain-containing protein	NA	NA	NA	NA	NA
WP_163958157.1|1621970_1622606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163958158.1|1622602_1622968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163957038.1|1622996_1624161_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.6	8.7e-46
>prophage 122
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	1633773	1634766	3356547		Catovirus(100.0%)	1	NA	NA
WP_163958165.1|1633773_1634766_-	D-glycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	31.3	4.8e-29
>prophage 123
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	1650071	1654959	3356547		Hokovirus(33.33%)	5	NA	NA
WP_166753118.1|1650071_1652510_+	hypothetical protein	NA	A0A1V0SGX0	Hokovirus	37.9	2.1e-33
WP_163958173.1|1652568_1652958_+	response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	27.7	3.3e-10
WP_163958174.1|1652976_1653867_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_163959843.1|1653926_1654670_+	ComF family protein	NA	NA	NA	NA	NA
WP_163958175.1|1654701_1654959_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	48.6	2.6e-11
>prophage 124
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	1661182	1661803	3356547		Pneumococcus_phage(100.0%)	1	NA	NA
WP_163958181.1|1661182_1661803_+	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	51.1	4.9e-48
>prophage 125
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	1669824	1671570	3356547		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_163958191.1|1669824_1671570_-	acetolactate synthase 3 large subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	31.4	2.7e-59
>prophage 126
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	1674789	1675512	3356547		Vibrio_phage(100.0%)	1	NA	NA
WP_163958194.1|1674789_1675512_+	AAA family ATPase	NA	D4HTX7	Vibrio_phage	26.1	2.4e-14
>prophage 127
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	1678624	1679608	3356547		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_163958197.1|1678624_1679608_-	aspartate carbamoyltransferase catalytic subunit	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	36.3	1.0e-23
>prophage 128
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	1692120	1694202	3356547	protease	Agrobacterium_phage(50.0%)	2	NA	NA
WP_163958207.1|1692120_1692810_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	56.9	6.5e-57
WP_163958208.1|1692930_1694202_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.4	3.6e-130
>prophage 129
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	1699825	1702647	3356547		Moraxella_phage(50.0%)	2	NA	NA
WP_163958215.1|1699825_1702219_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	49.3	2.6e-206
WP_163958216.1|1702374_1702647_+	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	48.3	9.1e-15
>prophage 130
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	1708318	1708984	3356547		Erwinia_phage(100.0%)	1	NA	NA
WP_163958220.1|1708318_1708984_-	2OG-Fe(II) oxygenase	NA	A0A1S6L2V5	Erwinia_phage	37.0	1.1e-26
>prophage 131
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	1730021	1731944	3356547		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_163958239.1|1730021_1731944_+	KUP/HAK/KT family potassium transporter	NA	M1IBC2	Acanthocystis_turfacea_Chlorella_virus	35.1	4.6e-76
>prophage 132
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	1737130	1744904	3356547		Acinetobacter_phage(33.33%)	6	NA	NA
WP_163959867.1|1737130_1740145_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	37.9	8.3e-16
WP_163958244.1|1740267_1741236_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.8	1.1e-67
WP_163958245.1|1741583_1742357_-	hydrolase 1, exosortase A system-associated	NA	NA	NA	NA	NA
WP_163958246.1|1742344_1743037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163959870.1|1743050_1743323_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_163958247.1|1743407_1744904_+	AMP-binding protein	NA	A0A2K9KZV5	Tupanvirus	23.2	5.1e-14
>prophage 133
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	1757505	1759392	3356547		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_163958257.1|1757505_1759392_+	amidotransferase 1, exosortase A system-associated	NA	A0A0G2Y369	Acanthamoeba_polyphaga_mimivirus	28.8	1.9e-18
>prophage 134
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	1766564	1770605	3356547		Pacmanvirus(33.33%)	6	NA	NA
WP_166753156.1|1766564_1767623_+	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A1X6WFP1	Pacmanvirus	26.7	6.7e-13
WP_163959877.1|1767619_1768699_+	aminotransferase class V-fold PLP-dependent enzyme	NA	H7BUW1	unidentified_phage	36.3	1.4e-21
WP_163958265.1|1768695_1769004_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_163958266.1|1769111_1769417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163958267.1|1769439_1769688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163958268.1|1769927_1770605_-	2OG-Fe(II) oxygenase	NA	A0A1S6L2V5	Erwinia_phage	37.0	4.1e-24
>prophage 135
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	1784663	1785281	3356547		Pseudomonas_phage(100.0%)	1	NA	NA
WP_163958281.1|1784663_1785281_+	S24 family peptidase	NA	A0A1C6ZDG7	Pseudomonas_phage	38.3	9.7e-12
>prophage 136
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	1797197	1803192	3356547		Shigella_phage(50.0%)	5	NA	NA
WP_163958288.1|1797197_1800569_+	glycosyltransferase	NA	U5P087	Shigella_phage	30.3	7.9e-07
WP_163958289.1|1800641_1801052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163958290.1|1801143_1801908_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_163958291.1|1801907_1802597_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_163958292.1|1802586_1803192_+	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	29.1	3.4e-09
>prophage 137
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	1814462	1815254	3356547		Streptococcus_phage(100.0%)	1	NA	NA
WP_163958305.1|1814462_1815254_+	NAD(P)-binding domain-containing protein	NA	A0A1X9I6T5	Streptococcus_phage	32.7	2.5e-20
>prophage 138
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	1857523	1858549	3356547		Enterobacteria_phage(100.0%)	1	NA	NA
WP_163958332.1|1857523_1858549_-	substrate-binding domain-containing protein	NA	C6ZCU4	Enterobacteria_phage	29.9	5.7e-33
>prophage 139
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	1868713	1870228	3356547		Synechococcus_phage(100.0%)	1	NA	NA
WP_163958337.1|1868713_1870228_+	tryptophan 7-halogenase	NA	A0A1Z1LWL6	Synechococcus_phage	30.1	6.0e-47
>prophage 140
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	1876915	1879196	3356547		Mollivirus(100.0%)	2	NA	NA
WP_163958342.1|1876915_1877677_-	glucose 1-dehydrogenase	NA	A0A0M4JSW6	Mollivirus	29.1	2.7e-08
WP_163958343.1|1877690_1879196_-	carboxylesterase family protein	NA	A0A0M4JT58	Mollivirus	33.9	5.8e-26
>prophage 141
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	1887783	1888395	3356547		Rhizobium_phage(100.0%)	1	NA	NA
WP_163958352.1|1887783_1888395_+	sigma-70 family RNA polymerase sigma factor	NA	A0A076YQ50	Rhizobium_phage	31.0	1.5e-09
>prophage 142
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	1893168	1952356	3356547	integrase,portal,plate,head,tRNA,tail,capsid	Stenotrophomonas_phage(17.65%)	66	1901304:1901323	1944514:1944533
WP_017978269.1|1893168_1893375_+	30S ribosomal protein S21	NA	M1HLV7	Pelagibacter_phage	50.8	1.3e-05
WP_163958355.1|1893481_1894057_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_163959909.1|1894513_1894759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163958356.1|1894926_1895721_-	metallophosphoesterase	NA	V9QL63	Rhizobium_phage	32.2	2.3e-18
WP_163958357.1|1895802_1897101_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HFY9	Paramecium_bursaria_Chlorella_virus	27.6	8.8e-23
WP_166753132.1|1897084_1898245_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	NA	NA	NA	NA
WP_163958358.1|1898357_1899227_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	48.8	1.9e-66
WP_163958359.1|1899291_1900041_-	molybdopterin-synthase adenylyltransferase MoeB	NA	A0A1V0SAV8	Catovirus	27.2	1.0e-07
WP_163958360.1|1900037_1900433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163958361.1|1900429_1900876_-	dUTP diphosphatase	NA	K4JSC8	Caulobacter_phage	54.4	1.1e-36
WP_163958362.1|1900907_1902086_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.8	1.4e-38
1901304:1901323	attL	GGCGCCAGCGACGGCGTCGG	NA	NA	NA	NA
WP_163958363.1|1902082_1903201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163958364.1|1903206_1904742_-	2-polyprenylphenol 6-hydroxylase	NA	A0A0R6PKQ6	Moraxella_phage	25.9	6.5e-25
WP_163958365.1|1904791_1905538_-	ubiquinone/menaquinone biosynthesis methyltransferase	NA	NA	NA	NA	NA
WP_163958366.1|1905593_1906409_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	G3MA33	Bacillus_virus	30.0	1.3e-27
WP_163958367.1|1906509_1906773_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_163958368.1|1907195_1908644_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_163958369.1|1908861_1909878_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_163958370.1|1909888_1911466_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_163958371.1|1911490_1912015_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_163958372.1|1912203_1912854_+	Tim44/TimA family putative adaptor protein	NA	NA	NA	NA	NA
WP_163958373.1|1913016_1914378_+	MltA domain-containing protein	NA	NA	NA	NA	NA
WP_163959913.1|1914403_1914928_+	Smr/MutS family protein	NA	NA	NA	NA	NA
WP_163958374.1|1915301_1916519_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_163958375.1|1916424_1917087_-	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_163959915.1|1917315_1917996_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_163958376.1|1918022_1919729_-	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_163959917.1|1919748_1920039_-	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_163959919.1|1919957_1920323_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_017978410.1|1920358_1920493_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_163959921.1|1920580_1920859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163958377.1|1920987_1922496_+	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_163958378.1|1922850_1924134_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A2L0V119	Agrobacterium_phage	42.6	8.8e-92
WP_163958379.1|1924177_1924843_+	replication protein A	NA	NA	NA	NA	NA
WP_017980146.1|1925386_1925812_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A218MND2	uncultured_virus	42.1	4.2e-14
WP_163958380.1|1925808_1927077_+	DUF4113 domain-containing protein	NA	F1C5A5	Cronobacter_phage	42.7	2.0e-80
WP_163958381.1|1927097_1928321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163959923.1|1928454_1929477_-|portal	phage portal protein	portal	E5E3X1	Burkholderia_phage	54.3	9.2e-100
WP_163958382.1|1929502_1931308_-	oxidoreductase	NA	A4JWU9	Burkholderia_virus	54.6	1.4e-175
WP_163959925.1|1931477_1932278_+|capsid	GPO family capsid scaffolding protein	capsid	A0A2H4JGC7	uncultured_Caudovirales_phage	37.4	1.7e-24
WP_163958383.1|1932323_1933424_+|capsid	P2 family phage major capsid protein	capsid	E5G6M6	Salmonella_phage	47.7	3.5e-81
WP_163959928.1|1933513_1934326_+	hypothetical protein	NA	A0A1S5NNA5	Burkholderia_phage	39.2	1.4e-26
WP_163958384.1|1934322_1934658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163958385.1|1934654_1935137_+|head	head completion/stabilization protein	head	E5E3S2	Burkholderia_phage	49.4	4.0e-29
WP_163958386.1|1935136_1935364_+|tail	tail protein X	tail	A0A2H4J946	uncultured_Caudovirales_phage	47.8	8.1e-09
WP_017980156.1|1935369_1935717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163958387.1|1935713_1936370_+	glycoside hydrolase family protein	NA	A4JX20	Burkholderia_virus	42.1	3.2e-21
WP_163958388.1|1936530_1936830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163958389.1|1936846_1937080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163958390.1|1937076_1937532_+|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	43.1	1.1e-23
WP_163958391.1|1937528_1938194_+	phage virion morphogenesis protein	NA	V9IQH0	Stenotrophomonas_phage	41.7	2.1e-12
WP_163958392.1|1938274_1939174_+|plate	baseplate J/gp47 family protein	plate	V9IQV9	Stenotrophomonas_phage	46.4	5.5e-64
WP_163958393.1|1939163_1939820_+|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	42.9	4.4e-31
WP_163958394.1|1939816_1940722_+|tail	tail fiber protein	tail	V9IQX0	Stenotrophomonas_phage	43.5	8.8e-30
WP_163958395.1|1940725_1942564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163958396.1|1942574_1943426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163958397.1|1943488_1944043_+|plate	phage baseplate assembly protein V	plate	V5YUM9	Pseudomonas_phage	39.3	3.4e-16
WP_163958398.1|1944039_1944402_+	GPW/gp25 family protein	NA	V9IQW0	Stenotrophomonas_phage	53.5	1.1e-20
WP_163958399.1|1944413_1945586_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	Q9ZXK4	Pseudomonas_virus	49.4	1.9e-85
1944514:1944533	attR	CCGACGCCGTCGCTGGCGCC	NA	NA	NA	NA
WP_163958400.1|1945627_1946137_+|tail	phage major tail tube protein	tail	V9IQX1	Stenotrophomonas_phage	50.6	2.4e-40
WP_163958401.1|1946217_1946553_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_163958402.1|1946561_1946681_+|tail	GpE family phage tail protein	tail	Q9ZXK1	Pseudomonas_virus	56.4	4.4e-06
WP_163958403.1|1949417_1949804_+|tail	phage tail protein	tail	Q9ZXJ9	Pseudomonas_virus	50.0	4.4e-31
WP_163958404.1|1949800_1950835_+	phage late control D family protein	NA	S4TRX8	Salmonella_phage	38.2	7.2e-60
WP_163958405.1|1950812_1951220_-	DNA mismatch endonuclease Vsr	NA	I6NSG0	Burkholderia_phage	49.6	2.5e-32
WP_163958406.1|1951267_1952356_-	DNA (cytosine-5-)-methyltransferase	NA	A0A0R6PG08	Moraxella_phage	51.5	1.7e-91
>prophage 143
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	1976185	1976851	3356547		Lactococcus_phage(100.0%)	1	NA	NA
WP_163958439.1|1976185_1976851_+	guanylate kinase	NA	V9VFN5	Lactococcus_phage	33.3	1.2e-10
>prophage 144
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	1991563	1994221	3356547		Stenotrophomonas_phage(100.0%)	1	NA	NA
WP_163958455.1|1991563_1994221_+	pyruvate, phosphate dikinase	NA	A0A2D2W2B1	Stenotrophomonas_phage	42.9	4.2e-88
>prophage 145
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2011946	2012225	3356547		Geobacillus_virus(100.0%)	1	NA	NA
WP_163958469.1|2011946_2012225_-	integration host factor subunit beta	NA	A0A0H3UZA0	Geobacillus_virus	43.7	5.7e-12
>prophage 146
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2018199	2018415	3356547		Lactococcus_phage(100.0%)	1	NA	NA
WP_037534615.1|2018199_2018415_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	43.5	6.5e-08
>prophage 147
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2024736	2025735	3356547		Pseudomonas_phage(100.0%)	1	NA	NA
WP_163958478.1|2024736_2025735_-	PhoH family protein	NA	H6X2N1	Pseudomonas_phage	45.2	1.1e-44
>prophage 148
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2033201	2034047	3356547		Pandoravirus(100.0%)	1	NA	NA
WP_163958485.1|2033201_2034047_-	aspartyl/asparaginyl beta-hydroxylase domain-containing protein	NA	S4VR59	Pandoravirus	36.1	1.2e-23
>prophage 149
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2045803	2051852	3356547		Microbacterium_phage(50.0%)	6	NA	NA
WP_163958495.1|2045803_2048023_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.0	3.1e-153
WP_163958496.1|2048202_2048514_+	polyhydroxyalkanoic acid system family protein	NA	NA	NA	NA	NA
WP_163958497.1|2048599_2049436_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_163958498.1|2049432_2050302_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_163958499.1|2050301_2050685_-	VOC family protein	NA	NA	NA	NA	NA
WP_163958500.1|2050745_2051852_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	27.9	4.7e-33
>prophage 150
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2062082	2065618	3356547		Streptococcus_virus(50.0%)	2	NA	NA
WP_163958511.1|2062082_2063744_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	36.8	2.7e-40
WP_163958512.1|2063863_2065618_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.5	4.8e-48
>prophage 151
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2077582	2082179	3356547		Cronobacter_phage(66.67%)	4	NA	NA
WP_163958526.1|2077582_2080060_-	Hsp70 family protein	NA	A0A1V0SAK3	Catovirus	30.4	1.7e-27
WP_163958527.1|2080064_2080415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163959963.1|2080521_2081790_-	DUF4113 domain-containing protein	NA	F1C5A5	Cronobacter_phage	41.9	3.4e-80
WP_163959965.1|2081786_2082179_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	F1C5A6	Cronobacter_phage	43.5	7.0e-16
>prophage 152
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2089681	2090371	3356547		Agrobacterium_phage(100.0%)	1	NA	NA
WP_163958535.1|2089681_2090371_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A223VZK2	Agrobacterium_phage	31.3	8.5e-17
>prophage 153
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2096491	2100768	3356547	tRNA	Bacillus_thuringiensis_phage(33.33%)	5	NA	NA
WP_163958546.1|2096491_2097097_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	47.6	4.3e-49
WP_163959967.1|2097212_2097848_-	septation protein IspZ	NA	NA	NA	NA	NA
WP_163958547.1|2098005_2098944_-	signal recognition particle-docking protein FtsY	NA	D6PHS7	uncultured_phage	38.7	2.9e-15
WP_163958548.1|2098940_2100194_-|tRNA	tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))- methylthiotransferase MtaB	tRNA	NA	NA	NA	NA
WP_163958549.1|2100234_2100768_+	DUF924 family protein	NA	E3T4R4	Cafeteria_roenbergensis_virus	29.5	5.2e-14
>prophage 154
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2104097	2113636	3356547	tRNA	Vibrio_phage(40.0%)	8	NA	NA
WP_163958553.1|2104097_2105003_-	FAD-dependent oxidoreductase	NA	A0A2I2L5E1	Orpheovirus	27.5	6.8e-14
WP_163958554.1|2105170_2105905_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_163958555.1|2105901_2106294_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_163959969.1|2106895_2107561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163958556.1|2107639_2109676_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	36.6	2.2e-36
WP_163958557.1|2109675_2111556_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	39.9	3.9e-96
WP_163958558.1|2111830_2112283_-	GatB/YqeY domain-containing protein	NA	A0A2I7SAL1	Vibrio_phage	32.5	3.6e-08
WP_163958559.1|2112427_2113636_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	33.0	1.9e-40
>prophage 155
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2118483	2119761	3356547		Streptococcus_phage(100.0%)	1	NA	NA
WP_163958564.1|2118483_2119761_-	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	61.2	1.8e-145
>prophage 156
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2142031	2144368	3356547		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_163958581.1|2142031_2144368_-	family 20 glycosylhydrolase	NA	A0A2H4UUW7	Bodo_saltans_virus	27.9	2.4e-10
>prophage 157
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2151442	2160286	3356547		Herpes_simplex_virus(25.0%)	5	NA	NA
WP_166753160.1|2151442_2154343_+	DUF4982 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	28.5	1.0e-23
WP_163958588.1|2154478_2156977_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	27.4	1.1e-05
WP_163959971.1|2156997_2158677_+	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	37.6	5.7e-06
WP_163958589.1|2158827_2159217_-	MAPEG family protein	NA	NA	NA	NA	NA
WP_163958590.1|2159284_2160286_-	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	29.1	8.9e-15
>prophage 158
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2170069	2181403	3356547		Vibrio_phage(33.33%)	3	NA	NA
WP_163958601.1|2170069_2174359_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.8	1.5e-66
WP_163958602.1|2174522_2178677_-	DNA-directed RNA polymerase subunit beta	NA	A0A2P0VMZ3	Tetraselmis_virus	26.5	2.2e-19
WP_163958603.1|2180326_2181403_+	PAS domain S-box protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	51.4	4.8e-06
>prophage 159
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2186198	2187044	3356547		Tetraselmis_virus(100.0%)	1	NA	NA
WP_163958607.1|2186198_2187044_+	SDR family NAD(P)-dependent oxidoreductase	NA	A0A2P0VP75	Tetraselmis_virus	29.4	1.4e-05
>prophage 160
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2192590	2198516	3356547		Vibrio_phage(50.0%)	6	NA	NA
WP_163958614.1|2192590_2193169_+	nicotinamide mononucleotide transporter	NA	A0A2I7SAC7	Vibrio_phage	24.5	3.8e-10
WP_163958615.1|2193165_2193690_+	AAA family ATPase	NA	A0A2I7SAC6	Vibrio_phage	25.7	2.0e-05
WP_163958616.1|2193746_2195570_+	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	41.2	2.8e-22
WP_163959978.1|2195690_2196119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163958617.1|2196293_2196749_-	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_163958618.1|2196761_2198516_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.9	5.5e-44
>prophage 161
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2215624	2216789	3356547	transposase	Leptospira_phage(100.0%)	1	NA	NA
WP_163957038.1|2215624_2216789_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.6	8.7e-46
>prophage 162
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2240835	2242908	3356547		Klosneuvirus(100.0%)	1	NA	NA
WP_163958640.1|2240835_2242908_-	peptidase M13	NA	A0A1V0SHG2	Klosneuvirus	27.0	1.3e-71
>prophage 163
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2246968	2249908	3356547		Acinetobacter_phage(100.0%)	1	NA	NA
WP_163959990.1|2246968_2249908_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	31.6	2.8e-16
>prophage 164
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2253035	2254145	3356547		Planktothrix_phage(100.0%)	1	NA	NA
WP_163958647.1|2253035_2254145_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	34.1	2.8e-25
>prophage 165
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2263521	2264334	3356547		Mollivirus(100.0%)	1	NA	NA
WP_163958656.1|2263521_2264334_+	glucose 1-dehydrogenase	NA	A0A0M4JSW6	Mollivirus	30.1	8.0e-14
>prophage 166
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2274159	2276379	3356547		Erythrobacter_phage(50.0%)	2	NA	NA
WP_163958664.1|2274159_2274672_-	MucR family transcriptional regulator	NA	A0A1P8VVG0	Erythrobacter_phage	49.2	3.5e-23
WP_163958665.1|2274990_2276379_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	29.9	5.9e-41
>prophage 167
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2281491	2282265	3356547		Escherichia_phage(100.0%)	1	NA	NA
WP_163960007.1|2281491_2282265_+	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	33.8	3.6e-24
>prophage 168
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2296066	2298004	3356547		Staphylococcus_phage(100.0%)	1	NA	NA
WP_163958676.1|2296066_2298004_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	37.8	2.2e-86
>prophage 169
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2305870	2309628	3356547	tRNA	Stx2-converting_phage(33.33%)	3	NA	NA
WP_163958681.1|2305870_2307037_+	serine hydrolase	NA	B6DZZ7	Stx2-converting_phage	33.2	6.9e-43
WP_163958682.1|2307056_2308031_+	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	27.9	1.3e-07
WP_163958683.1|2308071_2309628_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	35.8	9.1e-91
>prophage 170
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2315838	2318064	3356547		Bacillus_phage(100.0%)	1	NA	NA
WP_163958691.1|2315838_2318064_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	23.8	6.0e-11
>prophage 171
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2323351	2329284	3356547		Pseudomonas_phage(33.33%)	8	NA	NA
WP_163958697.1|2323351_2323852_+	nicotinamide-nucleotide amidohydrolase family protein	NA	B5TK85	Pseudomonas_phage	43.7	1.6e-17
WP_163958698.1|2323812_2324271_-	SRPBCC family protein	NA	NA	NA	NA	NA
WP_163958699.1|2324263_2325199_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_163958700.1|2325344_2325974_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_163958701.1|2326032_2326554_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_163960015.1|2326553_2326976_-	nucleoside-diphosphate kinase	NA	L7Y4C4	Megavirus	39.2	3.4e-16
WP_163960017.1|2327247_2327688_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_163958702.1|2327811_2329284_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.6	2.8e-49
>prophage 172
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2336820	2338278	3356547		Klosneuvirus(100.0%)	1	NA	NA
WP_163958708.1|2336820_2338278_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.5	1.4e-90
>prophage 173
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2342462	2347881	3356547		Staphylococcus_phage(33.33%)	5	NA	NA
WP_163958714.1|2342462_2344076_-	phosphoenolpyruvate carboxykinase	NA	A0A2H4PQN1	Staphylococcus_phage	48.9	4.4e-141
WP_163958715.1|2344263_2344971_+	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	30.3	1.1e-06
WP_163958716.1|2344939_2346514_+	stimulus-sensing domain-containing protein	NA	NA	NA	NA	NA
WP_163958717.1|2346527_2346962_+	aldolase	NA	NA	NA	NA	NA
WP_163958718.1|2346972_2347881_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	30.9	1.6e-07
>prophage 174
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2351674	2355797	3356547	tRNA	Synechococcus_phage(50.0%)	5	NA	NA
WP_163958723.1|2351674_2352196_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.8	7.4e-21
WP_163958724.1|2352243_2352840_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_163958725.1|2352896_2353823_+|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
WP_163958726.1|2353819_2354557_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_163958727.1|2354609_2355797_-	class I SAM-dependent RNA methyltransferase	NA	A0A2K5B251	Erysipelothrix_phage	37.1	2.3e-14
>prophage 175
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2360245	2361013	3356547		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_163958731.1|2360245_2361013_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.6	4.0e-15
>prophage 176
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2364207	2376230	3356547		Klosneuvirus(20.0%)	11	NA	NA
WP_163960027.1|2364207_2366271_-	M13 family peptidase	NA	A0A1V0SHG2	Klosneuvirus	27.2	2.3e-81
WP_163960029.1|2366362_2366917_-	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_163958734.1|2366937_2367420_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.6	1.0e-29
WP_163958735.1|2367507_2368014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163958736.1|2368010_2368895_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_163958737.1|2368973_2370998_+	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	39.8	3.2e-27
WP_163958738.1|2371002_2371488_+	transcription elongation factor GreB	NA	NA	NA	NA	NA
WP_163958739.1|2371537_2371780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163958740.1|2371833_2372634_+	NYN domain-containing protein	NA	A0A2P0VNQ4	Tetraselmis_virus	29.2	6.0e-06
WP_163958741.1|2373234_2374416_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_163960031.1|2374550_2376230_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.8	1.7e-42
>prophage 177
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2387129	2395020	3356547	tRNA	Bacillus_thuringiensis_phage(33.33%)	6	NA	NA
WP_163958749.1|2387129_2387831_+	SDR family NAD(P)-dependent oxidoreductase	NA	Q56AQ6	Bacillus_thuringiensis_phage	37.6	1.8e-30
WP_163958750.1|2387957_2388248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163958751.1|2388372_2391186_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.0	4.9e-95
WP_163958752.1|2391182_2391536_+	DUF952 domain-containing protein	NA	NA	NA	NA	NA
WP_163958753.1|2391632_2392208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163958754.1|2392359_2395020_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.4	6.3e-76
>prophage 178
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2400756	2401830	3356547		Bacillus_phage(100.0%)	1	NA	NA
WP_163958760.1|2400756_2401830_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	62.4	3.3e-116
>prophage 179
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2410105	2411698	3356547		Staphylococcus_phage(100.0%)	1	NA	NA
WP_163958765.1|2410105_2411698_+	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	24.7	4.1e-14
>prophage 180
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2425087	2433301	3356547		Streptococcus_phage(20.0%)	8	NA	NA
WP_163958778.1|2425087_2426008_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.5	1.2e-77
WP_163958779.1|2426139_2427453_+	cell wall hydrolase	NA	NA	NA	NA	NA
WP_163958780.1|2427491_2427743_-	Rho termination factor	NA	W8EJS8	Mycobacterium_phage	61.5	4.6e-05
WP_163958781.1|2427873_2429361_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.6	5.9e-47
WP_163958782.1|2429370_2430078_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_163958783.1|2430096_2431299_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_163958784.1|2431347_2432244_-	histone deacetylase	NA	A0A2K9L2T7	Tupanvirus	27.2	4.4e-13
WP_163958785.1|2432299_2433301_+	alpha/beta hydrolase fold domain-containing protein	NA	M1PGN2	Moumouvirus	26.6	7.3e-25
>prophage 181
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2439523	2441437	3356547		Hokovirus(100.0%)	1	NA	NA
WP_163958791.1|2439523_2441437_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	26.3	1.2e-28
>prophage 182
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2447777	2448656	3356547		Catovirus(100.0%)	1	NA	NA
WP_163958797.1|2447777_2448656_+	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	20.4	3.9e-06
>prophage 183
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2461125	2462040	3356547		Mycobacterium_phage(100.0%)	1	NA	NA
WP_163960057.1|2461125_2462040_-	tyrosine recombinase	NA	A0A1B1SGM4	Mycobacterium_phage	32.4	1.0e-17
>prophage 184
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2475716	2477036	3356547		Bacillus_virus(100.0%)	1	NA	NA
WP_163958819.1|2475716_2477036_+	AAA family ATPase	NA	G3MBE0	Bacillus_virus	37.2	5.7e-70
>prophage 185
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2495733	2498013	3356547		Bacillus_phage(100.0%)	1	NA	NA
WP_163958838.1|2495733_2498013_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	35.9	7.7e-107
>prophage 186
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2507361	2508111	3356547		Flavobacterium_phage(100.0%)	1	NA	NA
WP_163958848.1|2507361_2508111_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	37.8	1.5e-14
>prophage 187
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2512913	2513645	3356547		Indivirus(100.0%)	1	NA	NA
WP_163958854.1|2512913_2513645_-	phosphatidylserine decarboxylase	NA	A0A1V0SDU9	Indivirus	34.3	1.1e-14
>prophage 188
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2522908	2524267	3356547		Microcystis_phage(100.0%)	1	NA	NA
WP_163958864.1|2522908_2524267_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	40.1	8.2e-88
>prophage 189
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2530436	2536399	3356547		Streptomyces_phage(50.0%)	5	NA	NA
WP_163958872.1|2530436_2533937_-	DNA polymerase III subunit alpha	NA	A0A291AVG1	Streptomyces_phage	35.5	6.9e-163
WP_163958873.1|2534037_2534619_+	DUF308 domain-containing protein	NA	NA	NA	NA	NA
WP_163958874.1|2534640_2535168_-	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_163958875.1|2535116_2535707_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_163960071.1|2535703_2536399_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	39.7	1.0e-33
>prophage 190
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2540822	2546688	3356547		Prochlorococcus_phage(33.33%)	7	NA	NA
WP_163958878.1|2540822_2541284_+	Hsp20 family protein	NA	R9S5E2	Prochlorococcus_phage	39.5	3.6e-19
WP_163958879.1|2541328_2542963_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.3	3.1e-150
WP_163958880.1|2543052_2543406_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_163958881.1|2543639_2543960_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_163958882.1|2544012_2544279_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_163958883.1|2544275_2545205_+	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_163958884.1|2545224_2546688_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	38.2	9.8e-79
>prophage 191
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2555127	2555583	3356547		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_163958892.1|2555127_2555583_-	GxxExxY protein	NA	A0A0P0YNF4	Yellowstone_lake_phycodnavirus	33.0	1.6e-08
>prophage 192
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2559636	2561472	3356547		Wolbachia_phage(100.0%)	1	NA	NA
WP_163958897.1|2559636_2561472_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	36.6	8.2e-91
>prophage 193
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2576061	2578842	3356547		Acinetobacter_phage(100.0%)	1	NA	NA
WP_163958908.1|2576061_2578842_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	25.1	3.7e-18
>prophage 194
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2587061	2587892	3356547		Staphylococcus_phage(100.0%)	1	NA	NA
WP_163960080.1|2587061_2587892_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	27.9	1.3e-08
>prophage 195
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2592128	2598335	3356547	coat	uncultured_Mediterranean_phage(66.67%)	6	NA	NA
WP_163958917.1|2592128_2593160_-	substrate-binding domain-containing protein	NA	C6ZCU4	Enterobacteria_phage	30.3	6.5e-29
WP_163958918.1|2593311_2593968_+	FCD domain-containing protein	NA	NA	NA	NA	NA
WP_163958919.1|2593952_2594924_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_163958920.1|2595404_2595743_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	49.4	2.0e-11
WP_163958921.1|2595742_2597341_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_163958922.1|2597357_2598335_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	41.8	1.6e-48
>prophage 196
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2603641	2607242	3356547		Diadromus_pulchellus_ascovirus(50.0%)	3	NA	NA
WP_163958928.1|2603641_2604616_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	51.6	5.3e-73
WP_163958929.1|2604733_2605033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163958930.1|2605094_2607242_+	NAD-dependent DNA ligase LigA	NA	A0A0A8J9A9	Ralstonia_phage	38.7	2.3e-113
>prophage 197
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2610313	2611426	3356547		Enterobacteria_phage(100.0%)	1	NA	NA
WP_163958931.1|2610313_2611426_+	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	30.9	4.4e-23
>prophage 198
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2633032	2634697	3356547		Prochlorococcus_phage(50.0%)	2	NA	NA
WP_163958950.1|2633032_2634145_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	42.9	2.1e-57
WP_166753117.1|2634193_2634697_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	44.1	1.7e-22
>prophage 199
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2641217	2643677	3356547		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_163958957.1|2641217_2643677_+	glycogen/starch/alpha-glucan family phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	37.9	2.5e-10
>prophage 200
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2652678	2656099	3356547	holin	Klosneuvirus(50.0%)	3	NA	NA
WP_163958963.1|2652678_2654286_+|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	31.3	3.2e-59
WP_163958964.1|2654357_2654696_-	GCN5-related N-acetyltransferase	NA	NA	NA	NA	NA
WP_163958965.1|2654695_2656099_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.9	1.2e-38
>prophage 201
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2663108	2664173	3356547		Pseudomonas_phage(100.0%)	1	NA	NA
WP_163958969.1|2663108_2664173_-	acyltransferase family protein	NA	W6MVL2	Pseudomonas_phage	27.2	2.0e-09
>prophage 202
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2671414	2673097	3356547		Catovirus(100.0%)	1	NA	NA
WP_163958978.1|2671414_2673097_-	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	27.1	3.4e-27
>prophage 203
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2680615	2684815	3356547		Acinetobacter_phage(50.0%)	2	NA	NA
WP_163958985.1|2680615_2682835_+	molybdopterin-dependent oxidoreductase	NA	A0A0P0I429	Acinetobacter_phage	25.4	1.9e-33
WP_163958986.1|2683450_2684815_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	29.5	9.2e-39
>prophage 204
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2694163	2696761	3356547		Acinetobacter_phage(100.0%)	1	NA	NA
WP_163958994.1|2694163_2696761_-	ERAP1-like C-terminal domain-containing protein	NA	A0A0P0IY26	Acinetobacter_phage	25.8	2.1e-55
>prophage 205
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2702156	2705917	3356547	tRNA	uncultured_Mediterranean_phage(33.33%)	3	NA	NA
WP_163959002.1|2702156_2703437_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.4	9.7e-91
WP_163959003.1|2703448_2704585_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	39.5	3.2e-13
WP_163959004.1|2704672_2705917_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A2C9CYK4	Yersinia_phage	38.2	1.5e-59
>prophage 206
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2724681	2725005	3356547		Streptomyces_phage(100.0%)	1	NA	NA
WP_163959019.1|2724681_2725005_-	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	50.0	1.6e-21
>prophage 207
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2733776	2738999	3356547		Bacillus_phage(33.33%)	4	NA	NA
WP_163959024.1|2733776_2736128_-	PAS-domain containing protein	NA	W8CYF6	Bacillus_phage	25.8	1.2e-14
WP_163959025.1|2736314_2737751_-	adenosylhomocysteinase	NA	S4W1G4	Pandoravirus	31.9	7.7e-44
WP_163959026.1|2737837_2738398_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_163959027.1|2738519_2738999_+	redoxin family protein	NA	A0A0E3EN79	Synechococcus_phage	43.5	8.5e-24
>prophage 208
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2746723	2747440	3356547		Bacillus_virus(100.0%)	1	NA	NA
WP_163959035.1|2746723_2747440_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	40.3	7.8e-13
>prophage 209
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2757157	2759927	3356547		Mycobacterium_phage(50.0%)	2	NA	NA
WP_163959043.1|2757157_2758564_+	serine hydrolase	NA	A0A1D8EXR7	Mycobacterium_phage	24.8	7.3e-15
WP_163959044.1|2758565_2759927_+	leucyl aminopeptidase family protein	NA	Q6GYZ8	Mycoplasma_phage	30.4	2.6e-25
>prophage 210
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2766396	2771145	3356547		Acinetobacter_phage(75.0%)	6	NA	NA
WP_163959050.1|2766396_2766981_+	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	A0A0P0IKJ1	Acinetobacter_phage	47.7	2.4e-44
WP_163959051.1|2766977_2767973_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	37.5	2.1e-40
WP_163959052.1|2767969_2768761_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	48.8	4.3e-57
WP_163959053.1|2768757_2769225_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_163960099.1|2769221_2770403_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_163959054.1|2770461_2771145_+	transcriptional repressor LexA	NA	Q9AZQ8	Lactococcus_phage	39.8	3.2e-08
>prophage 211
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2804795	2805392	3356547		Gordonia_phage(100.0%)	1	NA	NA
WP_163959082.1|2804795_2805392_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2P1JY73	Gordonia_phage	34.1	2.6e-06
>prophage 212
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2815451	2817158	3356547		Catovirus(100.0%)	1	NA	NA
WP_163960110.1|2815451_2817158_-	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	23.6	2.0e-19
>prophage 213
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2827886	2828969	3356547		Synechococcus_phage(100.0%)	1	NA	NA
WP_163959103.1|2827886_2828969_-	alcohol dehydrogenase catalytic domain-containing protein	NA	E3SJ82	Synechococcus_phage	32.6	1.3e-35
>prophage 214
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2835580	2840728	3356547		Staphylococcus_phage(50.0%)	5	NA	NA
WP_163960114.1|2835580_2837113_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	27.0	2.3e-30
WP_163959108.1|2837109_2837880_+	thioesterase family protein	NA	NA	NA	NA	NA
WP_163960116.1|2838074_2838578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163960118.1|2838647_2839367_+	response regulator	NA	NA	NA	NA	NA
WP_163960121.1|2839402_2840728_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	22.4	2.1e-11
>prophage 215
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2847099	2848035	3356547		Staphylococcus_phage(100.0%)	1	NA	NA
WP_163959112.1|2847099_2848035_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.7	5.4e-22
>prophage 216
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2858594	2859759	3356547	transposase	Leptospira_phage(100.0%)	1	NA	NA
WP_163957038.1|2858594_2859759_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.6	8.7e-46
>prophage 217
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2864715	2867295	3356547		Cafeteria_roenbergensis_virus(100.0%)	1	NA	NA
WP_163960129.1|2864715_2867295_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	30.2	4.5e-18
>prophage 218
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2875359	2875893	3356547		Agrobacterium_phage(100.0%)	1	NA	NA
WP_163959129.1|2875359_2875893_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	31.3	4.1e-11
>prophage 219
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2886307	2893673	3356547		Bacillus_phage(50.0%)	6	NA	NA
WP_163959140.1|2886307_2887546_+	ATPase	NA	W8CYF6	Bacillus_phage	33.2	2.7e-29
WP_163959141.1|2887600_2888647_+	substrate-binding domain-containing protein	NA	A0A1B1IWY0	uncultured_Mediterranean_phage	48.4	4.8e-72
WP_163959142.1|2888849_2890226_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_163959143.1|2890218_2891517_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_163959144.1|2891513_2892272_+	phosphate ABC transporter ATP-binding protein	NA	M1IC18	Acanthocystis_turfacea_Chlorella_virus	27.4	1.3e-10
WP_163959145.1|2892980_2893673_+	phosphate regulon transcriptional regulator PhoB	NA	W8CYM9	Bacillus_phage	34.7	2.2e-33
>prophage 220
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2899052	2904185	3356547	protease	Erwinia_phage(25.0%)	5	NA	NA
WP_163960136.1|2899052_2900345_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A2H5BJT2	Erwinia_phage	31.7	3.9e-39
WP_163959153.1|2900421_2900967_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_163959154.1|2901342_2901588_-	hypothetical protein	NA	A0A2I6UG69	Salinibacter_virus	37.2	1.6e-05
WP_163959155.1|2901584_2902124_-	hypothetical protein	NA	A0A0D4DCJ5	Acinetobacter_phage	55.3	5.1e-49
WP_163959156.1|2902715_2904185_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	56.8	1.5e-135
>prophage 221
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2907354	2910085	3356547		uncultured_Caudovirales_phage(100.0%)	2	NA	NA
WP_163960138.1|2907354_2908701_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	63.2	1.9e-12
WP_163959160.1|2908720_2910085_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	45.2	1.1e-12
>prophage 222
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2918062	2920294	3356547		Acinetobacter_phage(100.0%)	1	NA	NA
WP_163960142.1|2918062_2920294_+	molybdopterin-dependent oxidoreductase	NA	A0A0P0I429	Acinetobacter_phage	24.9	9.1e-36
>prophage 223
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2950388	2952749	3356547		Vibrio_phage(50.0%)	3	NA	NA
WP_163959187.1|2950388_2951108_+	NAD-dependent deacylase	NA	A0A2I7S9Y2	Vibrio_phage	34.9	4.6e-21
WP_163959188.1|2951114_2952014_-	GTPase Era	NA	NA	NA	NA	NA
WP_163960162.1|2952080_2952749_-	ribonuclease III	NA	A0A2K9R4Y7	Dishui_lake_phycodnavirus	31.8	3.7e-17
>prophage 224
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2958986	2960093	3356547		Tupanvirus(100.0%)	1	NA	NA
WP_163959194.1|2958986_2960093_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L339	Tupanvirus	41.2	6.9e-77
>prophage 225
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2963930	2964692	3356547		Tetraselmis_virus(100.0%)	1	NA	NA
WP_163959197.1|2963930_2964692_+	glucose 1-dehydrogenase	NA	A0A2P0VP75	Tetraselmis_virus	31.3	1.7e-13
>prophage 226
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	2978334	2978538	3356547		Paenibacillus_phage(100.0%)	1	NA	NA
WP_163959210.1|2978334_2978538_-	hypothetical protein	NA	A0A0C5AEJ6	Paenibacillus_phage	58.2	2.8e-16
>prophage 227
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	3005073	3006453	3356547		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_163959226.1|3005073_3006453_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.7	1.1e-55
>prophage 228
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	3018172	3022912	3356547		Bodo_saltans_virus(50.0%)	5	NA	NA
WP_163959241.1|3018172_3021034_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.4	2.3e-23
WP_163959242.1|3021239_3021635_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_163959243.1|3021666_3021948_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_163959244.1|3021944_3022334_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_163959245.1|3022333_3022912_+	thymidine kinase	NA	A0A1Z1LZ42	Serratia_phage	54.5	2.0e-51
>prophage 229
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	3042589	3043285	3356547		Roseobacter_phage(100.0%)	1	NA	NA
WP_163959263.1|3042589_3043285_+	response regulator	NA	F4YXP8	Roseobacter_phage	52.7	1.5e-16
>prophage 230
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	3048758	3051926	3356547		Roseobacter_phage(50.0%)	2	NA	NA
WP_163960179.1|3048758_3049715_-	cell wall hydrolase	NA	A0A1B0UXM4	Roseobacter_phage	41.0	3.4e-16
WP_163959270.1|3049838_3051926_-	catalase	NA	A0A2K9L0T1	Tupanvirus	47.0	1.9e-131
>prophage 231
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	3064799	3065846	3356547		Dickeya_phage(100.0%)	1	NA	NA
WP_163959280.1|3064799_3065846_-	homocysteine S-methyltransferase family protein	NA	A0A140XBC7	Dickeya_phage	51.7	1.4e-10
>prophage 232
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	3076710	3078907	3356547		Rhodococcus_phage(50.0%)	2	NA	NA
WP_163959291.1|3076710_3077622_+	neutral zinc metallopeptidase	NA	A0A1I9SA48	Rhodococcus_phage	41.8	2.6e-37
WP_163959292.1|3077659_3078907_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0N6W8I1	Bacillus_phage	48.8	1.1e-11
>prophage 233
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	3090122	3090659	3356547		Lambdina_fiscellaria_nucleopolyhedrovirus(100.0%)	1	NA	NA
WP_163959300.1|3090122_3090659_+	superoxide dismutase family protein	NA	A0A0E3Z7D4	Lambdina_fiscellaria_nucleopolyhedrovirus	39.5	1.2e-10
>prophage 234
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	3098623	3099190	3356547	protease	Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_163959307.1|3098623_3099190_-|protease	DJ-1/PfpI/YhbO family deglycase/protease	protease	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	33.8	7.5e-19
>prophage 235
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	3108593	3110363	3356547		Bacillus_phage(100.0%)	1	NA	NA
WP_163959315.1|3108593_3110363_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	29.1	1.6e-54
>prophage 236
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	3115844	3121920	3356547	tRNA	Prochlorococcus_phage(66.67%)	5	NA	NA
WP_163959319.1|3115844_3117374_-|tRNA	proline--tRNA ligase	tRNA	A0A2K9L3R9	Tupanvirus	39.0	6.9e-75
WP_163959320.1|3117488_3118391_+	EamA family transporter	NA	NA	NA	NA	NA
WP_163959321.1|3118387_3118891_-	DUF1453 family protein	NA	NA	NA	NA	NA
WP_163959322.1|3118990_3120565_-	aminomethyl-transferring glycine dehydrogenase subunit GcvPB	NA	E3ST28	Prochlorococcus_phage	37.6	4.3e-72
WP_163959323.1|3120561_3121920_-	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	33.1	1.2e-43
>prophage 237
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	3127041	3127503	3356547		Salmonella_phage(100.0%)	1	NA	NA
WP_163959328.1|3127041_3127503_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	49.0	1.4e-36
>prophage 238
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	3152097	3159869	3356547		Caulobacter_phage(66.67%)	8	NA	NA
WP_163960197.1|3152097_3154518_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	34.7	2.9e-19
WP_163959350.1|3154632_3155112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163959351.1|3155531_3157439_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A0K1LMZ5	Caulobacter_phage	68.0	4.6e-238
WP_163959352.1|3157582_3158011_+	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_163959353.1|3158082_3158334_-	DUF2171 domain-containing protein	NA	NA	NA	NA	NA
WP_163959354.1|3158414_3158615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163959355.1|3158611_3158791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163959356.1|3158807_3159869_+	ribonucleotide-diphosphate reductase subunit beta	NA	A0A0K1LM33	Caulobacter_phage	60.3	5.5e-116
>prophage 239
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	3170392	3171046	3356547		Rhizobium_phage(100.0%)	1	NA	NA
WP_163959368.1|3170392_3171046_-	sigma-70 family RNA polymerase sigma factor	NA	A0A076YQ50	Rhizobium_phage	29.8	3.0e-11
>prophage 240
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	3174646	3177686	3356547		uncultured_Mediterranean_phage(100.0%)	5	NA	NA
WP_163959372.1|3174646_3175432_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	40.4	7.1e-44
WP_163959373.1|3175428_3176094_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_163959374.1|3176124_3176364_-	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
WP_163959375.1|3176391_3176970_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	45.2	2.1e-37
WP_163959376.1|3176966_3177686_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	28.7	3.6e-26
>prophage 241
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	3208744	3211084	3356547		Streptococcus_phage(50.0%)	3	NA	NA
WP_163959398.1|3208744_3209713_-	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	39.0	1.0e-47
WP_163959399.1|3209872_3210256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163959400.1|3210376_3211084_+	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	26.1	3.5e-05
>prophage 242
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	3217927	3218398	3356547		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_163960207.1|3217927_3218398_-	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	43.7	1.1e-07
>prophage 243
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	3221608	3227221	3356547		Bacillus_phage(50.0%)	5	NA	NA
WP_163959408.1|3221608_3223966_+	EAL domain-containing protein	NA	A0A127AWB9	Bacillus_phage	32.1	1.0e-13
WP_166753091.1|3224107_3224455_-	DUF3140 domain-containing protein	NA	NA	NA	NA	NA
WP_163959410.1|3224510_3224789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163959411.1|3224785_3225676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163959412.1|3225826_3227221_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.3	5.7e-36
>prophage 244
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	3234583	3236077	3356547		Streptococcus_phage(100.0%)	1	NA	NA
WP_163959419.1|3234583_3236077_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	34.5	2.9e-62
>prophage 245
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	3243063	3246214	3356547		Enterobacteria_phage(50.0%)	4	NA	NA
WP_163959430.1|3243063_3243894_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	37.9	7.1e-42
WP_163959431.1|3243890_3244475_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_163959432.1|3244559_3244916_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_163959433.1|3244996_3246214_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	48.2	1.2e-98
>prophage 246
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	3275522	3285188	3356547	transposase	Moraxella_phage(25.0%)	10	NA	NA
WP_163959452.1|3275522_3276404_+|transposase	transposase	transposase	A0A0R6PHP9	Moraxella_phage	35.7	7.3e-21
WP_163959453.1|3276370_3277018_-	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_163959454.1|3277093_3277735_-	DUF2490 domain-containing protein	NA	NA	NA	NA	NA
WP_163959455.1|3277927_3278764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163959456.1|3278872_3279652_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A127KMU1	Cyanophage	40.4	6.0e-43
WP_163959457.1|3279653_3279884_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_163959458.1|3279885_3280554_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_163959459.1|3280937_3281678_-	queuosine precursor transporter	NA	A0A1W7AG82	Streptococcus_virus	36.6	8.6e-23
WP_163959460.1|3281901_3283449_-	alpha-N-arabinofuranosidase	NA	NA	NA	NA	NA
WP_163959461.1|3283631_3285188_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	29.9	6.9e-14
>prophage 247
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	3291641	3292286	3356547		Tupanvirus(100.0%)	1	NA	NA
WP_163959469.1|3291641_3292286_-	adenylate kinase	NA	A0A2K9L833	Tupanvirus	41.4	2.2e-06
>prophage 248
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	3304373	3310776	3356547		Bodo_saltans_virus(33.33%)	6	NA	NA
WP_037534177.1|3304373_3305567_-	elongation factor Tu	NA	A0A2H4UVR3	Bodo_saltans_virus	25.8	2.4e-14
WP_163959486.1|3305803_3307900_-	elongation factor G	NA	A0A1S5SF82	Streptococcus_phage	26.9	1.5e-59
WP_163959487.1|3307996_3308467_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_010185487.1|3308527_3308899_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_163959488.1|3309139_3309778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163959489.1|3309774_3310776_-	alpha/beta fold hydrolase	NA	A0A0S2MV32	Mycobacterium_phage	32.4	6.2e-08
>prophage 249
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	3318386	3322350	3356547		Paramecium_bursaria_Chlorella_virus(50.0%)	4	NA	NA
WP_163959493.1|3318386_3320210_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	39.7	7.8e-110
WP_163959494.1|3320223_3320604_-	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_163959495.1|3320600_3320972_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_166753074.1|3320997_3322350_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A1V0SFS6	Hokovirus	26.2	6.6e-13
>prophage 250
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	3326029	3327619	3356547		Orpheovirus(100.0%)	1	NA	NA
WP_163959502.1|3326029_3327619_+	alkyl hydroperoxide reductase subunit F	NA	A0A2I2L5E1	Orpheovirus	29.6	2.9e-28
>prophage 251
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	3333428	3334781	3356547		Bacillus_phage(100.0%)	1	NA	NA
WP_163959510.1|3333428_3334781_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	25.6	7.5e-09
>prophage 252
NZ_CP048422	Sphingomonas insulae strain KCTC 12872 chromosome, complete genome	3356547	3348645	3350127	3356547		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_163959522.1|3348645_3350127_+	DEAD/DEAH box helicase	NA	A0A1B1IS59	uncultured_Mediterranean_phage	32.8	1.6e-44
