The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	0	32512	4695344	transposase,integrase,tail,plate,capsid	Burkholderia_virus(51.52%)	46	914:929	32094:32109
WP_162648073.1|481_1060_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	64.2	7.1e-65
914:929	attL	TGGCAGCGCAGAGCTG	NA	NA	NA	NA
WP_162648074.1|1052_2156_-|plate	baseplate protein	plate	A4JWL6	Burkholderia_virus	55.1	1.1e-109
WP_054181147.1|2146_2494_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	62.4	1.0e-34
WP_162648075.1|2549_3146_-|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	44.2	1.0e-26
WP_162648076.1|3142_4312_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	49.2	3.9e-86
WP_054181144.1|4299_4515_-	hypothetical protein	NA	Q6QIA3	Burkholderia_phage	58.6	7.0e-18
WP_162648077.1|4511_5396_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.5	1.5e-50
WP_162648078.1|5395_7861_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	43.4	2.7e-174
WP_054181141.1|8033_8354_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_054181140.1|8452_8734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054181139.1|8736_9258_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	69.4	1.0e-67
WP_162648079.1|9257_10685_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	78.2	2.8e-216
WP_162648080.1|10674_10929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162648081.1|10925_11390_-	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	52.3	3.7e-40
WP_162648082.1|11389_11836_-	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	49.7	7.9e-32
WP_162648083.1|11837_12194_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_162648084.1|12204_13158_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	42.7	3.7e-63
WP_162648085.1|13171_14269_-	peptidase	NA	A4JWJ9	Burkholderia_virus	49.6	5.0e-96
WP_000135510.1|14483_14942_-	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	43.0	3.8e-29
WP_111763638.1|14944_15766_-|capsid	minor capsid protein	capsid	Q6QIB9	Burkholderia_phage	61.9	2.6e-97
WP_111763637.1|15746_17243_-	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	61.5	1.7e-174
WP_111763636.1|17242_18766_-	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.2	5.8e-183
WP_011410682.1|18762_19308_-	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	67.6	1.2e-58
WP_006122433.1|19307_19619_-	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	63.6	3.2e-32
WP_000175096.1|19611_19944_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	47.7	1.1e-17
WP_111763635.1|19940_20594_-	hypothetical protein	NA	J9SVN7	Pseudomonas_phage	32.6	3.4e-07
WP_111763634.1|20583_21306_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.3	2.4e-62
WP_016191696.1|21308_21659_-	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.9	1.2e-22
WP_094948385.1|22013_22613_-	DUF2441 domain-containing protein	NA	NA	NA	NA	NA
WP_111763633.1|22860_23631_+	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	65.3	2.6e-99
WP_001569386.1|23678_24212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001569385.1|24247_24658_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001041677.1|24746_24971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000042842.1|24967_25273_+	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	58.0	9.2e-24
WP_006687266.1|25282_26191_+	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	55.4	6.3e-76
WP_089438549.1|26194_27964_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	67.8	2.4e-228
WP_089438548.1|27974_29141_+	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	60.9	2.2e-121
WP_000835317.1|29143_29413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006118595.1|29430_30042_+	DUF3164 family protein	NA	A0A2D1GNM4	Pseudomonas_phage	68.5	1.2e-75
WP_111763632.1|30121_30310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001569383.1|30306_30603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111763631.1|30589_31279_+	DUF2786 domain-containing protein	NA	A0A1W6DYA0	Aeromonas_phage	33.3	2.5e-24
WP_057060307.1|31275_31503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111763630.1|31492_31708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162648086.1|31697_32126_+	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	49.6	3.7e-26
32094:32109	attR	TGGCAGCGCAGAGCTG	NA	NA	NA	NA
WP_001281697.1|32122_32512_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	53.4	3.8e-30
>prophage 2
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	35947	36721	4695344		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_071698180.1|35947_36721_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	27.7	2.8e-08
>prophage 3
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	41077	42595	4695344		Mollivirus(100.0%)	1	NA	NA
WP_003028127.1|41077_42595_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	1.4e-88
>prophage 4
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	49092	50229	4695344		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_162648089.1|49092_50229_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	26.9	2.7e-20
>prophage 5
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	58709	59795	4695344		Pandoravirus(100.0%)	1	NA	NA
WP_003028170.1|58709_59795_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.0	5.9e-89
>prophage 6
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	68934	72752	4695344		Enterobacteria_phage(50.0%)	3	NA	NA
WP_003028193.1|68934_69876_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	89.3	1.7e-148
WP_003839291.1|70049_70679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032936544.1|70853_72752_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.3	8.4e-14
>prophage 7
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	80809	81730	4695344		Morganella_phage(100.0%)	1	NA	NA
WP_096878701.1|80809_81730_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	53.9	2.4e-75
>prophage 8
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	86207	86942	4695344		Clostridioides_phage(100.0%)	1	NA	NA
WP_032936528.1|86207_86942_+	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	25.8	1.6e-13
>prophage 9
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	111666	121533	4695344		Lactobacillus_phage(25.0%)	9	NA	NA
WP_046670126.1|111666_112593_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.9	2.6e-08
WP_003038103.1|112682_113681_+	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_003038102.1|113677_113896_-	DUF3820 family protein	NA	NA	NA	NA	NA
WP_003838570.1|113897_115913_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.4	1.5e-149
WP_003038097.1|115984_116992_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_003838567.1|117222_117984_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_003038091.1|118147_119119_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	3.3e-75
WP_003038086.1|119502_119760_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_003038080.1|119805_121533_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	7.4e-17
>prophage 10
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	125443	134928	4695344		Streptococcus_phage(20.0%)	11	NA	NA
WP_003838552.1|125443_126355_-	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	43.8	4.8e-60
WP_003038066.1|126422_127520_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	33.7	9.4e-26
WP_003038064.1|127509_128385_-	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_003038061.1|128384_129218_-	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_003038059.1|129218_130235_-	thiosulfate/sulfate ABC transporter substrate-binding protein CysP	NA	NA	NA	NA	NA
WP_003038057.1|130392_131184_-	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.8	6.8e-18
WP_003838547.1|131356_132256_-	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.4	1.5e-24
WP_046670129.1|132349_132925_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_003847269.1|132984_133434_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_003038048.1|133420_133846_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_003038046.1|134058_134928_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	A0A0N9SGH1	Paenibacillus_phage	33.3	1.5e-18
>prophage 11
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	170808	171522	4695344		Synechococcus_phage(100.0%)	1	NA	NA
WP_046670138.1|170808_171522_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3HWF9	Synechococcus_phage	35.7	9.1e-38
>prophage 12
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	181368	186967	4695344		Enterobacteria_phage(33.33%)	5	NA	NA
WP_049002454.1|181368_182658_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	36.7	1.7e-63
WP_003037929.1|182754_183381_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_061548989.1|183564_184995_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_003838485.1|185291_186329_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	42.4	6.3e-72
WP_003838482.1|186325_186967_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	40.6	4.5e-28
>prophage 13
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	193394	199574	4695344		Escherichia_phage(33.33%)	5	NA	NA
WP_049002457.1|193394_193598_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	71.4	5.6e-17
WP_003838477.1|193962_194841_+	small-conductance mechanosensitive channel MscS	NA	NA	NA	NA	NA
WP_003037760.1|194938_196516_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_003037756.1|196579_198046_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.5	5.7e-87
WP_046670144.1|198206_199574_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.0	3.4e-41
>prophage 14
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	210878	212420	4695344		Acinetobacter_phage(100.0%)	1	NA	NA
WP_003037736.1|210878_212420_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	57.6	2.4e-160
>prophage 15
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	221397	221829	4695344		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_003037710.1|221397_221829_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.1	5.3e-17
>prophage 16
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	231673	238028	4695344		Mycoplasma_phage(20.0%)	8	NA	NA
WP_003037696.1|231673_232957_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	35.4	9.9e-35
WP_003037694.1|233018_233219_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_003037690.1|233230_233566_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_003838439.1|233567_235418_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.9	1.4e-103
WP_003037683.1|235433_235949_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_003037681.1|236057_236381_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	47.7	9.2e-22
WP_002913991.1|236401_236788_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	77.3	2.7e-52
WP_003838433.1|236813_238028_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.6	1.2e-34
>prophage 17
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	243648	245157	4695344		Bacillus_virus(100.0%)	1	NA	NA
WP_048217267.1|243648_245157_+	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.4	4.6e-15
>prophage 18
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	264449	275775	4695344		Bacillus_phage(50.0%)	7	NA	NA
WP_003037627.1|264449_265703_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.4	3.9e-100
WP_016150774.1|266029_267220_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_002914032.1|267321_267660_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_003838398.1|267720_269058_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	34.1	1.4e-10
WP_003847079.1|269054_269798_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_003847077.1|269820_271251_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	25.6	2.0e-12
WP_071698715.1|271887_275775_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.0	3.8e-130
>prophage 19
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	282076	282337	4695344		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_003037590.1|282076_282337_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	54.7	1.7e-18
>prophage 20
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	285353	289093	4695344		Tupanvirus(50.0%)	3	NA	NA
WP_003037579.1|285353_286034_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	1.6e-20
WP_003838377.1|286303_287278_-	signal peptidase I	NA	NA	NA	NA	NA
WP_003037577.1|287293_289093_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.1	3.8e-24
>prophage 21
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	294069	389476	4695344	terminase,transposase,integrase,tail,plate,portal,tRNA,head,capsid,lysis	Salmonella_phage(72.92%)	87	353924:353969	390670:390715
WP_003847060.1|294069_294807_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_003037569.1|294937_296266_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	29.1	2.5e-41
WP_003037563.1|297381_297765_-	autonomous glycyl radical cofactor GrcA	NA	A0A1W5N098	Cronobacter_phage	70.9	3.6e-33
WP_096890244.1|298082_298772_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	4.6e-55
WP_003037560.1|298805_299885_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_003037559.1|300092_300512_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	36.5	8.3e-15
WP_003847051.1|300581_301280_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_054528661.1|301316_303977_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_008319601.1|304091_305447_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_003838356.1|305491_305815_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_016150786.1|305811_307110_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.6	3.1e-44
WP_003845841.1|312944_315518_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.2	1.5e-127
WP_044699543.1|315647_316379_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_003031246.1|316375_317356_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_003031245.1|317487_318225_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_003031244.1|318494_318833_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_100250063.1|318936_318984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162648102.1|319083_320244_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_003826456.1|320340_321462_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_003031241.1|321472_322543_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	50.9	4.5e-89
WP_003845849.1|322757_323132_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_162648103.1|323290_323809_+	YfiR family protein	NA	NA	NA	NA	NA
WP_003839838.1|323801_325028_+	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	37.6	1.1e-06
WP_003031234.1|325040_325523_+	OmpA family protein	NA	NA	NA	NA	NA
WP_002914145.1|325654_326002_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_003031232.1|326041_326809_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_003031230.1|326853_327402_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_003031228.1|327420_327669_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_003031226.1|327922_329284_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_003031224.1|329449_330241_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_008324538.1|330259_331549_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_003031221.1|331598_332192_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_003031220.1|332314_333193_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_162648104.1|333278_334940_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_003826401.1|335089_335434_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_003839823.1|335484_335781_-	RnfH family protein	NA	NA	NA	NA	NA
WP_071524313.1|335764_336220_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_003031211.1|336362_336845_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	1.2e-28
WP_162648105.1|337427_348668_+	BapA prefix-like domain-containing protein	NA	NA	NA	NA	NA
WP_003845860.1|348768_350178_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_162648106.1|350174_352361_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	29.4	3.2e-17
WP_085951585.1|352368_353532_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
353924:353969	attL	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAA	NA	NA	NA	NA
WP_162648107.1|354143_354860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162648108.1|354938_355154_-	late control protein B	NA	Q53ZE7	Salmonella_virus	70.8	2.1e-22
WP_162648109.1|355222_356323_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	94.3	6.7e-189
WP_162648110.1|356319_356805_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	92.5	2.7e-70
WP_162648111.1|356801_359867_-|tail	phage tail tape measure protein	tail	A0A1S6L010	Salmonella_phage	84.4	0.0e+00
WP_162648112.1|359859_359979_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	94.9	3.3e-14
WP_162648113.1|359993_360296_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	97.0	3.6e-44
WP_001397630.1|360350_360866_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	96.5	1.3e-89
WP_162648114.1|360875_362048_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	92.8	1.5e-207
WP_162648115.1|362156_362720_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	84.9	2.4e-86
WP_162648116.1|362772_363864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162648117.1|364238_364667_+|tail	tail fiber assembly protein	tail	A0A0M4S6V4	Salmonella_phage	71.1	2.6e-24
WP_162648118.1|364638_364989_-|tail	tail fiber assembly protein	tail	A0A0M4QWM3	Salmonella_phage	57.6	4.3e-09
WP_162648119.1|366313_366919_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	96.0	1.2e-112
WP_016150802.1|366911_367820_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	94.4	5.0e-150
WP_016150803.1|367806_368166_-	hypothetical protein	NA	E5G6N7	Salmonella_phage	95.8	2.3e-58
WP_162648120.1|368162_368741_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	85.9	1.2e-93
WP_162648121.1|368835_369402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063841712.1|369502_370483_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	5.2e-185
WP_162648122.1|370932_371379_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	85.0	1.7e-63
WP_001039964.1|371371_371803_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	95.1	4.0e-73
WP_001648763.1|371898_372327_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	95.0	2.6e-64
WP_000871620.1|372323_372698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162648123.1|372702_373212_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	96.4	1.3e-91
WP_000171565.1|373192_373408_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_000868184.1|373411_373615_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_076009148.1|373614_374079_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	95.5	3.9e-82
WP_000059169.1|374172_374823_-	hypothetical protein	NA	A0A1S6KZX1	Salmonella_phage	98.6	1.6e-113
WP_162648124.1|374826_375894_-|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	97.7	8.1e-192
WP_162648125.1|375910_376744_-|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	86.3	4.3e-124
WP_001098459.1|376886_378653_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	96.8	0.0e+00
WP_162648126.1|378652_379684_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	91.0	8.7e-183
WP_162648127.1|379701_380664_-	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_162648128.1|380826_381750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001749760.1|382051_382240_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	91.7	5.7e-24
WP_162648129.1|382377_382605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162648130.1|382624_385033_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	94.5	0.0e+00
WP_162648131.1|385026_385881_-	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	80.6	1.6e-129
WP_001244238.1|386103_386337_-	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	98.7	2.9e-33
WP_060855046.1|386404_386746_-	DUF5347 domain-containing protein	NA	A0A1S6L019	Salmonella_phage	99.1	4.6e-56
WP_162648132.1|386709_386910_-	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	97.0	2.7e-32
WP_162648133.1|386917_387427_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	98.8	6.2e-89
WP_000102106.1|387459_387702_-	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
WP_162648134.1|387821_388454_+	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	60.0	6.3e-67
WP_162648135.1|388456_389476_+|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	94.7	1.3e-191
390670:390715	attR	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAA	NA	NA	NA	NA
>prophage 22
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	393193	393865	4695344		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_162648138.1|393193_393865_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	58.6	4.5e-79
>prophage 23
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	400106	404462	4695344		Escherichia_phage(100.0%)	1	NA	NA
WP_162648141.1|400106_404462_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	38.9	1.4e-149
>prophage 24
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	410507	416331	4695344		Staphylococcus_phage(50.0%)	4	NA	NA
WP_003839789.1|410507_412055_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.2	8.6e-09
WP_162648143.1|412106_413036_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003845960.1|413074_414061_-	inositol 2-dehydrogenase	NA	NA	NA	NA	NA
WP_137348052.1|414405_416331_-	3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing)	NA	E5EQ70	Micromonas_sp._RCC1109_virus	23.1	1.6e-25
>prophage 25
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	426526	429769	4695344		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
WP_162648147.1|426526_429769_-	transporter substrate-binding domain-containing protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	30.3	1.2e-33
>prophage 26
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	441130	446351	4695344		Tupanvirus(50.0%)	5	NA	NA
WP_046670409.1|441130_442147_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.5	7.2e-81
WP_046670408.1|442193_443585_-	DUF4832 domain-containing protein	NA	NA	NA	NA	NA
WP_046670407.1|443615_444023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142710184.1|444025_445138_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_044699634.1|445139_446351_-	glycosyltransferase family 4 protein	NA	A0A2P0VNG4	Tetraselmis_virus	31.6	1.3e-12
>prophage 27
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	473721	474702	4695344	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_063841712.1|473721_474702_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	5.2e-185
>prophage 28
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	478792	482813	4695344		Klosneuvirus(50.0%)	4	NA	NA
WP_162648151.1|478792_480076_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.6	1.1e-28
WP_003839698.1|480218_481619_+	GABA permease	NA	NA	NA	NA	NA
WP_003037236.1|481664_482351_+	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_003037241.1|482363_482813_-	peptidoglycan-binding protein LysM	NA	A0A1V0DZX0	Clostridioides_phage	38.2	3.7e-05
>prophage 29
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	488574	493871	4695344		Lactobacillus_phage(20.0%)	5	NA	NA
WP_003037270.1|488574_488820_+	glutaredoxin-like protein NrdH	NA	A0A0M7REK7	Lactobacillus_phage	42.5	3.8e-12
WP_003037273.1|488816_489227_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	41.0	6.6e-17
WP_048217215.1|489199_491344_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	49.0	6.9e-198
WP_016150870.1|491354_492314_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	71.5	5.0e-132
WP_003037282.1|492668_493871_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	38.1	1.9e-27
>prophage 30
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	504051	505032	4695344	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_063841712.1|504051_505032_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	5.2e-185
>prophage 31
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	509572	514993	4695344	tRNA	Vibrio_phage(25.0%)	5	NA	NA
WP_000906486.1|509572_509758_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_016150875.1|509995_512623_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.8	8.4e-81
WP_003037326.1|512751_513252_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_003037330.1|513338_514403_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.8	4.0e-114
WP_016150876.1|514495_514993_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	51.0	3.4e-31
>prophage 32
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	520553	521519	4695344		Tetraselmis_virus(100.0%)	1	NA	NA
WP_003037353.1|520553_521519_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	1.8e-36
>prophage 33
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	557345	563683	4695344	holin	Pithovirus(33.33%)	6	NA	NA
WP_003840297.1|557345_558161_+	iron/manganese ABC transporter ATP-binding protein SitB	NA	W5SAS9	Pithovirus	28.1	1.2e-12
WP_016150894.1|558163_559021_+	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_016150895.1|559017_559869_+	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_003037438.1|560614_560965_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_008322725.1|560961_561291_+	multidrug efflux SMR transporter	NA	E5EPE2	Acinetobacter_phage	33.0	4.2e-06
WP_003840305.1|561304_563683_+|holin	choline trimethylamine-lyase	holin	A0A2C9CWX5	Yersinia_phage	37.5	8.1e-06
>prophage 34
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	572258	574820	4695344		Cafeteria_roenbergensis_virus(100.0%)	1	NA	NA
WP_016150901.1|572258_574820_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.9	4.1e-32
>prophage 35
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	578296	582000	4695344		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000081498.1|578296_579289_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_003034174.1|579351_580479_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.4	1.4e-05
WP_003034172.1|580618_581245_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	50.6	4.4e-36
WP_003825728.1|581238_582000_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	46.7	2.5e-57
>prophage 36
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	585173	587206	4695344		Tupanvirus(50.0%)	2	NA	NA
WP_003034157.1|585173_585779_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	37.9	6.1e-27
WP_044713391.1|585778_587206_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	25.8	7.9e-33
>prophage 37
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	594548	595220	4695344		Vibrio_phage(100.0%)	1	NA	NA
WP_003034139.1|594548_595220_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	24.6	3.9e-14
>prophage 38
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	598582	601606	4695344		Streptococcus_phage(50.0%)	2	NA	NA
WP_003034129.1|598582_599881_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	57.9	1.4e-129
WP_003034127.1|599968_601606_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.6	6.7e-153
>prophage 39
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	605080	613162	4695344		Erysipelothrix_phage(25.0%)	5	NA	NA
WP_003846544.1|605080_606379_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.9	5.3e-36
WP_003840349.1|606436_609193_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	29.5	1.0e-52
WP_003034114.1|609236_610379_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	40.7	4.8e-49
WP_003840351.1|610460_611801_-	glucarate dehydratase	NA	NA	NA	NA	NA
WP_032941178.1|611821_613162_-	glucarate dehydratase	NA	Q6A202	Oenococcus_phage	23.9	1.2e-06
>prophage 40
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	617687	618536	4695344		Vibrio_phage(100.0%)	1	NA	NA
WP_003034084.1|617687_618536_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.3	1.8e-40
>prophage 41
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	623451	624207	4695344		Bacillus_phage(100.0%)	1	NA	NA
WP_003840372.1|623451_624207_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	28.7	8.8e-07
>prophage 42
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	630958	632458	4695344		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003034052.1|630958_632458_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.6	4.7e-20
>prophage 43
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	640692	643228	4695344	tRNA	environmental_halophage(50.0%)	3	NA	NA
WP_086529894.1|640692_641898_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.2	7.3e-72
WP_003840390.1|641897_642344_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_003846496.1|642421_643228_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	32.8	2.2e-16
>prophage 44
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	651825	666043	4695344	transposase	Escherichia_phage(20.0%)	8	NA	NA
WP_063841712.1|651825_652806_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	5.2e-185
WP_003840934.1|653285_653843_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_003840935.1|653904_654507_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_003840937.1|654847_656101_-	N-acetylmuramoyl-L-alanine amidase AmiC	NA	E5DV68	Deep-sea_thermophilic_phage	28.4	2.7e-13
WP_003034012.1|656334_657666_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_003034009.1|657790_659620_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	34.4	1.9e-18
WP_162648164.1|659616_663162_-	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	20.1	2.0e-08
WP_048218530.1|663154_666043_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	24.9	2.6e-67
>prophage 45
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	671523	678347	4695344		Cronobacter_phage(33.33%)	6	NA	NA
WP_003033990.1|671523_672318_-	thymidylate synthase	NA	R4IFY1	Cronobacter_phage	62.0	1.9e-116
WP_003033987.1|672324_673200_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_003033984.1|673388_675635_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	24.6	5.1e-10
WP_003033982.1|675647_676178_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_003840955.1|676862_677558_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_003033961.1|677633_678347_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	5.3e-46
>prophage 46
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	684924	685935	4695344		Enterobacteria_phage(100.0%)	1	NA	NA
WP_054528747.1|684924_685935_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	30.4	2.5e-33
>prophage 47
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	689696	693135	4695344	transposase	Sodalis_phage(33.33%)	3	NA	NA
WP_003033929.1|689696_690584_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	45.8	1.4e-67
WP_003840970.1|690639_692058_-	arabinose-proton symporter AraE	NA	O13311	Aichi_virus	26.7	5.1e-24
WP_046670332.1|692373_693135_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	3.5e-19
>prophage 48
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	707869	708475	4695344		Canarypox_virus(100.0%)	1	NA	NA
WP_003033877.1|707869_708475_-	ankyrin repeat domain-containing protein	NA	Q6VZ28	Canarypox_virus	26.9	3.2e-07
>prophage 49
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	718301	725948	4695344	tRNA	Microcystis_virus(20.0%)	7	NA	NA
WP_016150941.1|718301_719060_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A7K9	Microcystis_virus	37.3	3.2e-09
WP_162648170.1|719226_719781_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_003026911.1|719858_721376_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	1.3e-86
WP_096878465.1|721385_722484_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_054528765.1|722575_724309_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.5	1.3e-61
WP_003825520.1|724314_725028_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_003026928.1|725051_725948_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	27.9	2.5e-29
>prophage 50
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	730647	735854	4695344		Pandoravirus(50.0%)	3	NA	NA
WP_162648171.1|730647_732081_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.9	3.1e-29
WP_032937431.1|732175_732919_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_044713822.1|732980_735854_-	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	51.0	3.4e-261
>prophage 51
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	744110	745343	4695344		Catovirus(100.0%)	1	NA	NA
WP_003026984.1|744110_745343_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.6	4.1e-102
>prophage 52
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	762853	763537	4695344		Bacillus_virus(100.0%)	1	NA	NA
WP_046670308.1|762853_763537_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	24.5	2.6e-10
>prophage 53
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	776307	779256	4695344		Staphylococcus_phage(50.0%)	2	NA	NA
WP_003027071.1|776307_777462_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	5.3e-128
WP_003027074.1|777861_779256_+	galactose/proton symporter	NA	O13311	Aichi_virus	25.5	1.4e-26
>prophage 54
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	792541	793627	4695344		Geobacillus_virus(100.0%)	1	NA	NA
WP_049001609.1|792541_793627_+	membrane-bound lytic murein transglycosylase MltC	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	4.5e-12
>prophage 55
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	811355	812996	4695344		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_046670294.1|811355_812996_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	54.7	7.5e-11
>prophage 56
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	822695	827940	4695344		Staphylococcus_phage(33.33%)	4	NA	NA
WP_003024520.1|822695_823523_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	46.0	1.1e-63
WP_162648176.1|823711_825166_+	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_003024529.1|825209_825665_+	HIT family protein	NA	Q5YEY9	Rock_bream_iridovirus	34.7	2.1e-19
WP_003024532.1|825768_827940_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	1.3e-103
>prophage 57
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	832048	834824	4695344		Bacillus_virus(50.0%)	2	NA	NA
WP_003024543.1|832048_834307_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.5	4.4e-86
WP_003024544.1|834425_834824_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	43.9	9.9e-18
>prophage 58
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	843458	851555	4695344		Bacillus_virus(25.0%)	8	NA	NA
WP_003024571.1|843458_845351_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	34.8	2.0e-92
WP_003024575.1|845379_845961_-	esterase YqiA	NA	NA	NA	NA	NA
WP_003838143.1|845960_846788_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_003024582.1|846812_847235_-	DUF1249 family protein	NA	NA	NA	NA	NA
WP_003024585.1|847231_847864_-	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	34.7	1.2e-20
WP_032937374.1|848069_849554_+	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_003024591.1|849711_850389_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	45.0	2.6e-34
WP_032937372.1|850394_851555_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	42.9	6.5e-86
>prophage 59
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	857247	857901	4695344		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003838130.1|857247_857901_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	1.1e-45
>prophage 60
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	861498	862932	4695344		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_003838125.1|861498_862932_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	28.8	2.2e-38
>prophage 61
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	868182	869424	4695344		Sinorhizobium_phage(100.0%)	1	NA	NA
WP_016150993.1|868182_869424_+	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	49.3	1.8e-94
>prophage 62
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	880816	886356	4695344	tRNA	Moraxella_phage(33.33%)	4	NA	NA
WP_162648178.1|880816_881830_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.8	5.7e-110
WP_001144069.1|882066_882282_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_162648179.1|882519_884265_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.8	1.4e-76
WP_003024699.1|884508_886356_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
>prophage 63
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	893840	898264	4695344	transposase,integrase	Erwinia_phage(66.67%)	4	892741:892788	898560:898607
892741:892788	attL	CTCATAATCGCTTGGTCGCTGGTTCAAGTCCAGCAGGGGCCACCAAAC	NA	NA	NA	NA
WP_162648180.1|893840_894422_+	phage repressor protein	NA	F1BUS8	Erwinia_phage	37.6	1.6e-29
WP_162648181.1|894423_895458_+|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	64.4	6.6e-122
WP_162648182.1|895457_897245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063841712.1|897283_898264_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	5.2e-185
898560:898607	attR	CTCATAATCGCTTGGTCGCTGGTTCAAGTCCAGCAGGGGCCACCAAAC	NA	NA	NA	NA
>prophage 64
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	912086	924133	4695344	tRNA	Tupanvirus(25.0%)	9	NA	NA
WP_003846231.1|912086_913241_-	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.8	1.6e-84
WP_003024755.1|913308_914157_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016151014.1|914153_914936_-	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_161799266.1|915172_915850_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003024763.1|915903_917424_-	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	49.3	2.9e-33
WP_048998748.1|917791_919234_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.7	2.7e-33
WP_003024768.1|919307_919640_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_003024771.1|919849_920833_+	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_048232833.1|921040_924133_+	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.0	7.7e-158
>prophage 65
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	935154	936123	4695344		Escherichia_phage(100.0%)	1	NA	NA
WP_003828551.1|935154_936123_+	TerC family protein	NA	A0A291LBC5	Escherichia_phage	31.8	3.5e-32
>prophage 66
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	956646	958941	4695344		Tetraselmis_virus(100.0%)	1	NA	NA
WP_003024871.1|956646_958941_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	40.4	5.3e-156
>prophage 67
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	965183	966329	4695344		Streptococcus_phage(100.0%)	1	NA	NA
WP_046670227.1|965183_966329_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	39.9	1.2e-47
>prophage 68
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	974895	976002	4695344		Bacillus_phage(100.0%)	1	NA	NA
WP_069219469.1|974895_976002_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	W8CYL7	Bacillus_phage	29.6	9.2e-13
>prophage 69
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	987855	993944	4695344		Streptococcus_phage(33.33%)	8	NA	NA
WP_003024942.1|987855_988719_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	5.6e-50
WP_046670219.1|988782_990834_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_003024946.1|990791_991187_+	YraN family protein	NA	NA	NA	NA	NA
WP_003024948.1|991221_991812_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.8	3.2e-12
WP_044701311.1|991821_992397_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_003024957.1|992490_993126_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_044714511.1|993163_993592_-	YhbP family protein	NA	NA	NA	NA	NA
WP_003844855.1|993644_993944_+	GIY-YIG nuclease family protein	NA	S6DF82	Invertebrate_iridovirus	53.2	4.2e-13
>prophage 70
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	999610	1001539	4695344		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_048218712.1|999610_1001539_-	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	4.6e-52
>prophage 71
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1007129	1013774	4695344		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
WP_003844847.1|1007129_1009820_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.4	2.5e-24
WP_003024992.1|1009844_1011332_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_003024996.1|1011360_1011813_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_003024998.1|1012430_1013774_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	93.7	4.8e-64
>prophage 72
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1019579	1022461	4695344	protease	Pandoravirus(50.0%)	2	NA	NA
WP_003025010.1|1019579_1020428_-	dihydropteroate synthase	NA	S4VNV0	Pandoravirus	31.2	1.3e-19
WP_003025013.1|1020526_1022461_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	4.1e-117
>prophage 73
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1029141	1030620	4695344		Indivirus(50.0%)	2	NA	NA
WP_003025033.1|1029141_1030113_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	26.2	1.6e-08
WP_003839952.1|1030335_1030620_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	65.7	6.0e-17
>prophage 74
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1034724	1048851	4695344		Staphylococcus_phage(25.0%)	16	NA	NA
WP_003025057.1|1034724_1035525_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	30.6	9.6e-20
WP_003839941.1|1035740_1036718_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_003025063.1|1036731_1037718_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_003025065.1|1037738_1038305_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	76.3	4.2e-54
WP_003025068.1|1038301_1038877_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_003025070.1|1038845_1039394_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_003025073.1|1039400_1040126_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_003025074.1|1040172_1041606_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_003025078.1|1041628_1041916_+	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	43.2	4.2e-10
WP_003025083.1|1041999_1042491_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_003025085.1|1042536_1043391_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.4e-05
WP_003025086.1|1043387_1043660_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_003839927.1|1043790_1044510_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_003839926.1|1044506_1045160_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_003025089.1|1045389_1047726_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	30.8	4.9e-40
WP_003025090.1|1047921_1048851_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	32.8	6.7e-17
>prophage 75
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1055626	1056709	4695344		Salmonella_phage(100.0%)	1	NA	NA
WP_162648197.1|1055626_1056709_+	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	90.7	9.8e-76
>prophage 76
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1060871	1062362	4695344		Burkholderia_virus(100.0%)	1	NA	NA
WP_003025119.1|1060871_1062362_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	23.9	2.4e-08
>prophage 77
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1066200	1066704	4695344	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_003025130.1|1066200_1066704_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	7.3e-26
>prophage 78
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1070606	1071974	4695344	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_162648199.1|1070606_1071974_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.4	5.6e-20
>prophage 79
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1089617	1090661	4695344		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|1089617_1090661_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 80
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1103317	1104202	4695344		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_046670188.1|1103317_1104202_+	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	32.8	2.8e-28
>prophage 81
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1110808	1114964	4695344		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_003025295.1|1110808_1111834_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.5	9.0e-71
WP_046670184.1|1111903_1113085_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003025299.1|1113094_1114198_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003025300.1|1114205_1114964_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	3.1e-20
>prophage 82
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1125415	1126887	4695344	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
WP_003031159.1|1125415_1125925_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
WP_162648204.1|1125939_1126887_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	39.8	2.0e-08
>prophage 83
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1146786	1152358	4695344		uncultured_Caudovirales_phage(50.0%)	7	NA	NA
WP_003031109.1|1146786_1147971_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	7.5e-13
WP_003023659.1|1148040_1150155_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.1	6.2e-58
WP_003023657.1|1150251_1150722_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_003023654.1|1150817_1151192_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_162648205.1|1151317_1151605_-	sulfurtransferase complex subunit TusB	NA	A0A2H4JG28	uncultured_Caudovirales_phage	39.2	3.1e-05
WP_003837966.1|1151612_1151972_-	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_003023646.1|1151971_1152358_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	40.6	6.7e-19
>prophage 84
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1158114	1163402	4695344		Tupanvirus(25.0%)	4	NA	NA
WP_003023627.1|1158114_1160016_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.9	1.5e-74
WP_162648206.1|1160125_1161616_-	nicotinate phosphoribosyltransferase	NA	A0A218KC49	Bacillus_phage	52.2	2.2e-142
WP_003023622.1|1161630_1162491_-	ribose-phosphate pyrophosphokinase	NA	G0X553	Salmonella_phage	40.6	5.6e-50
WP_162648207.1|1162682_1163402_+	NUDIX hydrolase	NA	G3MA14	Bacillus_virus	27.5	9.5e-19
>prophage 85
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1167137	1171187	4695344		environmental_Halophage(33.33%)	3	NA	NA
WP_162648813.1|1167137_1169225_+	hypothetical protein	NA	H9YQA8	environmental_Halophage	89.9	4.2e-67
WP_136397263.1|1169320_1170538_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.2	5.7e-32
WP_003847954.1|1170623_1171187_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	56.5	6.0e-61
>prophage 86
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1190192	1191029	4695344		Vibrio_phage(100.0%)	1	NA	NA
WP_003023558.1|1190192_1191029_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	8.4e-67
>prophage 87
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1207921	1212464	4695344		Bacillus_phage(66.67%)	5	NA	NA
WP_003023529.1|1207921_1209544_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	8.1e-143
WP_003847996.1|1209666_1209984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003837894.1|1210036_1210333_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003837891.1|1210389_1211742_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.6	4.3e-12
WP_135953044.1|1211738_1212464_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 88
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1218971	1219934	4695344	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_046671280.1|1218971_1219934_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	56.8	7.6e-72
>prophage 89
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1225930	1228324	4695344		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_162648213.1|1225930_1228324_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	41.4	7.3e-15
>prophage 90
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1235668	1238116	4695344		Dickeya_phage(100.0%)	1	NA	NA
WP_003023492.1|1235668_1238116_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	82.1	3.6e-33
>prophage 91
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1262319	1264130	4695344		Enterococcus_phage(50.0%)	2	NA	NA
WP_162648215.1|1262319_1263063_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.3	6.4e-10
WP_003837845.1|1263059_1264130_-	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	32.0	4.4e-20
>prophage 92
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1267909	1269408	4695344		Planktothrix_phage(50.0%)	2	NA	NA
WP_003827581.1|1267909_1268623_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	30.1	3.7e-15
WP_003023438.1|1268640_1269408_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.1	3.7e-13
>prophage 93
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1275151	1277981	4695344		Salicola_phage(50.0%)	3	NA	NA
WP_003023425.1|1275151_1276006_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	7.0e-45
WP_003023423.1|1276261_1277320_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_003023420.1|1277312_1277981_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	27.6	1.5e-13
>prophage 94
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1283319	1287392	4695344		Dickeya_phage(50.0%)	4	NA	NA
WP_016151123.1|1283319_1283946_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	60.2	2.3e-29
WP_134214918.1|1284020_1286219_+	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	37.6	8.0e-117
WP_003023404.1|1286312_1286558_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	4.7e-10
WP_003837818.1|1286726_1287392_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	54.9	3.3e-58
>prophage 95
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1291986	1296211	4695344		Burkholderia_phage(50.0%)	3	NA	NA
WP_046671263.1|1291986_1292262_-	type II toxin-antitoxin system HicA family toxin	NA	R4JMD3	Burkholderia_phage	47.6	3.2e-15
WP_061547457.1|1292339_1293464_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_162648218.1|1293463_1296211_-	ribosome-associated ATPase/putative transporter RbbA	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.6	8.7e-20
>prophage 96
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1307846	1309889	4695344		Indivirus(100.0%)	1	NA	NA
WP_046670978.1|1307846_1309889_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.3	8.9e-46
>prophage 97
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1341668	1343653	4695344		Bacillus_virus(50.0%)	2	NA	NA
WP_003846120.1|1341668_1342673_-	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	1.1e-17
WP_003846117.1|1342669_1343653_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.2	1.5e-14
>prophage 98
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1350907	1351888	4695344	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_063841712.1|1350907_1351888_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	5.2e-185
>prophage 99
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1355155	1357489	4695344		Escherichia_phage(100.0%)	1	NA	NA
WP_106107703.1|1355155_1357489_-	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	A0A077SK27	Escherichia_phage	30.7	1.2e-73
>prophage 100
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1362899	1365806	4695344		Paramecium_bursaria_Chlorella_virus(50.0%)	4	NA	NA
WP_016151146.1|1362899_1363874_+	glyoxylate/hydroxypyruvate reductase GhrB	NA	M1HST2	Paramecium_bursaria_Chlorella_virus	27.0	6.4e-18
WP_162648222.1|1363932_1364643_-	DUF3053 domain-containing protein	NA	NA	NA	NA	NA
WP_003024273.1|1365023_1365314_+	HTH-type transcriptional regulator	NA	NA	NA	NA	NA
WP_000014594.1|1365593_1365806_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 101
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1370164	1371160	4695344		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_046671082.1|1370164_1371160_+	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	24.8	3.5e-11
>prophage 102
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1396762	1397851	4695344		Streptococcus_phage(100.0%)	1	NA	NA
WP_003844556.1|1396762_1397851_+	hypothetical protein	NA	A0A1S5SAB0	Streptococcus_phage	43.0	9.8e-68
>prophage 103
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1400863	1402708	4695344		Tupanvirus(100.0%)	1	NA	NA
WP_032937191.1|1400863_1402708_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	25.5	5.3e-13
>prophage 104
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1420106	1429478	4695344		Rhizobium_phage(20.0%)	9	NA	NA
WP_003844542.1|1420106_1420358_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	53.4	2.2e-15
WP_003024148.1|1420410_1420842_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_046671018.1|1421091_1422636_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_003837638.1|1422645_1423929_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.8e-07
WP_003024138.1|1423932_1424868_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_003024135.1|1424868_1425906_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_003024132.1|1426098_1427124_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	80.8	2.3e-18
WP_003024131.1|1427133_1428330_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.1	9.2e-35
WP_003827312.1|1428545_1429478_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.1	1.0e-36
>prophage 105
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1441483	1446046	4695344		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_003024099.1|1441483_1441963_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.2	6.3e-27
WP_003024097.1|1442001_1442811_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	31.6	3.1e-26
WP_003024094.1|1442909_1443077_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_003024071.1|1443097_1443334_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_003837605.1|1443552_1444218_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_086538736.1|1444389_1445610_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.8	7.2e-43
WP_006687626.1|1445587_1446046_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	60.1	1.6e-48
>prophage 106
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1450127	1455155	4695344		Pseudomonas_phage(33.33%)	4	NA	NA
WP_048217415.1|1450127_1451807_-	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.5	7.1e-25
WP_003024042.1|1452068_1452692_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	35.6	2.2e-19
WP_000135058.1|1452746_1453022_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_003024038.1|1453040_1455155_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
>prophage 107
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1459415	1460807	4695344		environmental_Halophage(100.0%)	1	NA	NA
WP_003024026.1|1459415_1460807_+	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	95.9	2.5e-68
>prophage 108
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1473260	1474289	4695344		Wolbachia_phage(100.0%)	1	NA	NA
WP_162648227.1|1473260_1474289_+	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	45.8	6.4e-77
>prophage 109
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1480210	1483021	4695344		Escherichia_phage(100.0%)	1	NA	NA
WP_162648231.1|1480210_1483021_-	intestinal colonization autotransporter adhesin MisL	NA	A0A2L1IV18	Escherichia_phage	49.0	9.3e-102
>prophage 110
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1491713	1492628	4695344	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_119174668.1|1491713_1492628_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	47.2	3.4e-69
>prophage 111
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1515155	1519996	4695344		Micromonas_sp._RCC1109_virus(50.0%)	5	NA	NA
WP_003840646.1|1515155_1516844_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	30.4	2.9e-58
WP_003827118.1|1516951_1517050_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_003840643.1|1517571_1517661_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_003840641.1|1517784_1518618_+	EamA family transporter	NA	NA	NA	NA	NA
WP_003023905.1|1518811_1519996_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	25.1	5.0e-17
>prophage 112
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1528128	1529063	4695344		Synechococcus_phage(100.0%)	2	NA	NA
WP_003840609.1|1528128_1528557_-	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.7e-13
WP_003023882.1|1528649_1529063_-	heat shock chaperone IbpA	NA	A0A1D8KSJ6	Synechococcus_phage	35.2	4.6e-18
>prophage 113
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1533169	1540678	4695344		Bacillus_virus(33.33%)	7	NA	NA
WP_003844435.1|1533169_1535584_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.1	2.4e-114
WP_048217029.1|1535612_1536686_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_003023863.1|1536824_1537925_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	1.1e-53
WP_003023861.1|1537929_1539333_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_003023858.1|1539939_1540080_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_003844432.1|1540097_1540457_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_003023846.1|1540420_1540678_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
>prophage 114
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1547653	1558262	4695344		Moraxella_phage(20.0%)	9	NA	NA
WP_046671073.1|1547653_1548991_-	adenine permease AdeP	NA	A0A0R6PHV4	Moraxella_phage	37.8	1.6e-64
WP_032950596.1|1549158_1549824_+	6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_003023824.1|1549908_1550634_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_003023821.1|1550648_1551422_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	30.6	3.4e-14
WP_003023819.1|1551468_1552359_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_003023817.1|1552358_1553318_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_003023814.1|1553462_1554503_-	phosphate ABC transporter substrate-binding protein PstS	NA	M4QHS4	Cyanophage	35.8	2.0e-46
WP_003023813.1|1554837_1556667_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	41.4	1.1e-122
WP_003023811.1|1556891_1558262_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	37.6	2.1e-35
>prophage 115
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1570546	1571539	4695344		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_016151221.1|1570546_1571539_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	2.9e-50
>prophage 116
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1574813	1578807	4695344		Paramecium_bursaria_Chlorella_virus(50.0%)	3	NA	NA
WP_046671079.1|1574813_1576682_+	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.5	4.2e-66
WP_003023766.1|1576874_1577294_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_003023764.1|1577301_1578807_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2K9L0W2	Tupanvirus	21.9	1.7e-17
>prophage 117
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1594159	1595806	4695344		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_032938437.1|1594159_1595806_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.8	6.9e-65
>prophage 118
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1604927	1610356	4695344		Bacillus_phage(33.33%)	4	NA	NA
WP_003829018.1|1604927_1606949_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.8	2.2e-113
WP_003017996.1|1606996_1608478_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_003017994.1|1608614_1609883_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	8.3e-42
WP_001280776.1|1610026_1610356_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
>prophage 119
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1614409	1618608	4695344		Catovirus(33.33%)	4	NA	NA
WP_032950621.1|1614409_1615540_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	26.5	7.4e-26
WP_032950623.1|1615536_1616799_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.2	2.7e-24
WP_046671402.1|1616795_1617473_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_032938462.1|1617477_1618608_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	1.1e-18
>prophage 120
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1635027	1638873	4695344		Bacillus_phage(100.0%)	3	NA	NA
WP_003841210.1|1635027_1635930_+	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.5	1.9e-24
WP_003017925.1|1635929_1636646_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_046671398.1|1636710_1638873_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.6	1.0e-116
>prophage 121
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1642791	1646228	4695344	transposase	Catovirus(50.0%)	3	NA	NA
WP_003844630.1|1642791_1644621_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	38.5	2.5e-84
WP_046671397.1|1644684_1645305_+	threonine export protein RhtC	NA	NA	NA	NA	NA
WP_032950636.1|1645343_1646228_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	52.0	5.7e-66
>prophage 122
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1658191	1661511	4695344		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_003017891.1|1658191_1659832_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.5	1.3e-42
WP_003017888.1|1659910_1660165_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_003017886.1|1660168_1660717_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_046671394.1|1660719_1661511_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.0	3.0e-26
>prophage 123
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1672460	1673075	4695344		Streptococcus_phage(100.0%)	1	NA	NA
WP_046671388.1|1672460_1673075_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	45.7	1.4e-18
>prophage 124
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1685257	1688044	4695344		Enterococcus_phage(100.0%)	1	NA	NA
WP_003840413.1|1685257_1688044_+	DNA polymerase I	NA	A8E2B3	Enterococcus_phage	30.3	4.9e-47
>prophage 125
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1691957	1694427	4695344		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
WP_003028633.1|1691957_1693367_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	9.0e-05
WP_003028636.1|1693377_1694427_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.6	2.6e-09
>prophage 126
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1707135	1709932	4695344		Staphylococcus_phage(50.0%)	3	NA	NA
WP_046671353.1|1707135_1708032_-	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	93.8	4.6e-63
WP_003847909.1|1708198_1709095_+	sugar kinase	NA	NA	NA	NA	NA
WP_003847907.1|1709128_1709932_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	29.6	4.9e-24
>prophage 127
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1713073	1713982	4695344		Acanthamoeba_polyphaga_moumouvirus(100.0%)	1	NA	NA
WP_046671350.1|1713073_1713982_-	alpha/beta hydrolase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	30.8	4.6e-26
>prophage 128
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1717313	1720364	4695344		Escherichia_phage(100.0%)	1	NA	NA
WP_152659866.1|1717313_1720364_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.9	2.2e-08
>prophage 129
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1738041	1738662	4695344		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_003840480.1|1738041_1738662_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	57.4	1.0e-61
>prophage 130
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1741705	1743774	4695344		Bacillus_phage(50.0%)	2	NA	NA
WP_003840485.1|1741705_1743079_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	1.1e-15
WP_003028763.1|1743075_1743774_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	29.5	1.5e-05
>prophage 131
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1757251	1758097	4695344		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_003028793.1|1757251_1758097_-	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	29.5	1.8e-16
>prophage 132
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1761452	1762784	4695344		Erwinia_phage(100.0%)	1	NA	NA
WP_003028803.1|1761452_1762784_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.2	2.6e-46
>prophage 133
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1783949	1784612	4695344		Synechococcus_phage(100.0%)	1	NA	NA
WP_016151282.1|1783949_1784612_-	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	33.2	1.1e-29
>prophage 134
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1800619	1802476	4695344		Acinetobacter_phage(100.0%)	1	NA	NA
WP_003028868.1|1800619_1802476_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	29.3	1.0e-08
>prophage 135
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1811255	1831792	4695344		uncultured_Mediterranean_phage(14.29%)	17	NA	NA
WP_003031107.1|1811255_1812206_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
WP_003031109.1|1813153_1814338_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	7.5e-13
WP_003033128.1|1814568_1814952_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_003033125.1|1814953_1815499_+	transcription termination/antitermination protein NusG	NA	A0A291AUS6	Sinorhizobium_phage	29.6	1.1e-14
WP_003033122.1|1815653_1816082_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_162648242.1|1816085_1816793_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_001207203.1|1817207_1817705_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_003033114.1|1817771_1818137_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_003033111.1|1818457_1822486_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.4	1.6e-22
WP_003033107.1|1822562_1826786_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.4	1.0e-67
WP_003033104.1|1826897_1827215_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_003033102.1|1827219_1827525_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_003033098.1|1828618_1828831_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	78.6	2.2e-24
WP_046671422.1|1828962_1830084_-	2-iminoacetate synthase ThiH	NA	NA	NA	NA	NA
WP_161958354.1|1830080_1830944_-	thiazole synthase	NA	NA	NA	NA	NA
WP_003033088.1|1830852_1831053_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_046671421.1|1831033_1831792_-	HesA/MoeB/ThiF family protein	NA	A0A1V0SCZ9	Indivirus	32.1	2.0e-11
>prophage 136
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1837055	1838819	4695344		Klosneuvirus(50.0%)	3	NA	NA
WP_003033072.1|1837055_1837736_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	30.1	3.3e-21
WP_003842015.1|1837769_1838360_+	YjaG family protein	NA	NA	NA	NA	NA
WP_001044509.1|1838546_1838819_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	57.8	5.5e-20
>prophage 137
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1844273	1845863	4695344		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_046671416.1|1844273_1845863_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.4	1.2e-66
>prophage 138
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1859098	1862782	4695344		Dickeya_phage(100.0%)	1	NA	NA
WP_003031615.1|1859098_1862782_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	3.7e-26
>prophage 139
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1866194	1866473	4695344		Brucella_phage(100.0%)	1	NA	NA
WP_046671412.1|1866194_1866473_-	putative addiction module antidote protein	NA	A0A141GEX5	Brucella_phage	51.2	1.9e-12
>prophage 140
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1880589	1881375	4695344		Pseudomonas_phage(100.0%)	1	NA	NA
WP_003844703.1|1880589_1881375_+	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	45.9	7.4e-49
>prophage 141
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1897213	1898323	4695344		Mycoplasma_phage(100.0%)	1	NA	NA
WP_003031682.1|1897213_1898323_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
>prophage 142
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1905506	1906115	4695344		Lactococcus_phage(100.0%)	1	NA	NA
WP_003031703.1|1905506_1906115_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 143
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1911853	1920847	4695344		Escherichia_phage(25.0%)	7	NA	NA
WP_003826610.1|1911853_1913269_+	replicative DNA helicase	NA	O80281	Escherichia_phage	77.9	1.8e-199
WP_003844721.1|1913285_1914365_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.5	6.2e-30
WP_032938184.1|1914493_1915687_+	aromatic amino acid transaminase	NA	NA	NA	NA	NA
WP_003826615.1|1915935_1916649_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_003031719.1|1916776_1917133_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_003031720.1|1917248_1920071_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.6	0.0e+00
WP_003826621.1|1920322_1920847_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	94.5	1.1e-53
>prophage 144
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1927738	1929088	4695344		Moraxella_phage(100.0%)	1	NA	NA
WP_134216406.1|1927738_1929088_+	guanine/hypoxanthine transporter GhxP	NA	A0A0R6PHV4	Moraxella_phage	71.4	4.0e-159
>prophage 145
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1935308	1937267	4695344		Staphylococcus_phage(100.0%)	1	NA	NA
WP_162648247.1|1935308_1937267_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	41.1	2.3e-91
>prophage 146
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1954170	1956156	4695344		Tetraselmis_virus(100.0%)	1	NA	NA
WP_162648323.1|1954170_1956156_-	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	44.3	1.8e-147
>prophage 147
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1961965	1971552	4695344		Escherichia_phage(40.0%)	11	NA	NA
WP_003844755.1|1961965_1963489_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.9	7.2e-16
WP_044702173.1|1963603_1965868_+	response regulator	NA	NA	NA	NA	NA
WP_003031807.1|1965937_1966267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046671374.1|1966422_1966725_+	hypothetical protein	NA	A0A222YWE2	Escherichia_phage	76.0	4.1e-40
WP_046671375.1|1966751_1967093_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	83.6	1.4e-44
WP_046671376.1|1967145_1967904_-	phosphonate metabolism protein PhnP	NA	NA	NA	NA	NA
WP_003031809.1|1967912_1968347_-	aminoalkylphosphonate N-acetyltransferase	NA	NA	NA	NA	NA
WP_003844764.1|1968333_1968888_-	ribose 1,5-bisphosphokinase	NA	NA	NA	NA	NA
WP_003031811.1|1968890_1970027_-	alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_046671387.1|1970023_1970704_-	phosphonate C-P lyase system protein PhnL	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.7	1.1e-08
WP_003844769.1|1970793_1971552_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.2	1.8e-15
>prophage 148
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1977289	1978078	4695344		Pithovirus(100.0%)	1	NA	NA
WP_003841124.1|1977289_1978078_-	phosphonate ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	29.0	1.5e-12
>prophage 149
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	1984650	1987459	4695344		Burkholderia_virus(50.0%)	3	NA	NA
WP_003841133.1|1984650_1986153_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.5	2.4e-56
WP_008321468.1|1986302_1986392_+	LpxT activity modulator PmrR	NA	NA	NA	NA	NA
WP_161799280.1|1986385_1987459_-	two-component system sensor histidine kinase PmrB	NA	W8CYF6	Bacillus_phage	27.2	4.4e-12
>prophage 150
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2014282	2015944	4695344		Hepacivirus(100.0%)	1	NA	NA
WP_162648325.1|2014282_2015944_-	fatty acid--CoA ligase	NA	Q75ZG1	Hepacivirus	24.6	2.3e-31
>prophage 151
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2024647	2029020	4695344	transposase	Cronobacter_phage(33.33%)	4	NA	NA
WP_000027827.1|2024647_2024941_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	43.3	1.2e-12
WP_003025464.1|2024984_2026631_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.1	2.9e-188
WP_003025468.1|2026765_2027119_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_063841712.1|2028039_2029020_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	5.2e-185
>prophage 152
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2032684	2033218	4695344		Morganella_phage(100.0%)	1	NA	NA
WP_003025522.1|2032684_2033218_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.8	1.6e-47
>prophage 153
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2039120	2040098	4695344		Tupanvirus(100.0%)	1	NA	NA
WP_003830517.1|2039120_2040098_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	29.1	8.1e-29
>prophage 154
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2047431	2047977	4695344		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_003839477.1|2047431_2047977_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	41.0	2.2e-28
>prophage 155
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2051985	2055192	4695344		Vibrio_phage(50.0%)	2	NA	NA
WP_032937771.1|2051985_2053317_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	30.1	1.1e-17
WP_046670812.1|2053326_2055192_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	42.1	2.6e-60
>prophage 156
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2060715	2065275	4695344		Pithovirus(50.0%)	3	NA	NA
WP_003025606.1|2060715_2062014_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.6	2.9e-66
WP_003025609.1|2062230_2062656_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_046670813.1|2062812_2065275_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.5	9.4e-66
>prophage 157
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2084664	2086218	4695344		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_003844953.1|2084664_2086218_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.0	3.3e-08
>prophage 158
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2102091	2109843	4695344		uncultured_Caudovirales_phage(50.0%)	7	NA	NA
WP_003025726.1|2102091_2102619_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	9.3e-56
WP_003025728.1|2102928_2103885_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_016149467.1|2103987_2105490_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.4	3.6e-12
WP_008323019.1|2105503_2106526_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003025736.1|2106512_2107514_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_003839560.1|2107617_2108730_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.0	3.8e-14
WP_003025742.1|2108844_2109843_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.1	1.1e-68
>prophage 159
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2121751	2124981	4695344		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
WP_003839576.1|2121751_2121994_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	52.5	4.3e-16
WP_016149473.1|2121983_2122268_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	71.3	1.3e-32
WP_032937736.1|2122271_2122736_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.7	1.1e-52
WP_003025782.1|2122842_2124981_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.4	2.0e-266
>prophage 160
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2128666	2132712	4695344		Enterobacteria_phage(50.0%)	2	NA	NA
WP_003025788.1|2128666_2129614_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	3.5e-13
WP_044699140.1|2130003_2132712_+	magnesium-translocating P-type ATPase	NA	M1HM40	Paramecium_bursaria_Chlorella_virus	27.5	5.9e-45
>prophage 161
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2137110	2138046	4695344		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_046670831.1|2137110_2138046_-	aspartate carbamoyltransferase	NA	A7RB08	Paramecium_bursaria_Chlorella_virus	40.2	1.9e-51
>prophage 162
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2146466	2187744	4695344	transposase,tRNA,integrase	Moraxella_phage(20.0%)	34	2159399:2159416	2182467:2182484
WP_162648328.1|2146466_2147225_+|tRNA	tRNA isopentenyl-2-thiomethyl-A-37 hydroxylase MiaE	tRNA	NA	NA	NA	NA
WP_003839625.1|2147389_2148220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003025856.1|2148246_2148750_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_162648329.1|2148968_2151824_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.5	3.9e-140
WP_003025862.1|2151823_2152267_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_003025870.1|2152385_2153897_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.4	7.1e-48
WP_003839630.1|2154163_2155264_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_003025875.1|2155263_2156346_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_054528665.1|2156447_2157950_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.0	1.5e-82
WP_054528004.1|2158097_2159117_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	31.7	1.9e-44
2159399:2159416	attL	GTTCGAGTCCGGCCTTCG	NA	NA	NA	NA
WP_162648330.1|2159611_2160862_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	39.1	4.3e-83
WP_059236049.1|2160949_2162089_+	DNA cytosine methyltransferase	NA	A0A1P8CX13	Bacillus_phage	27.9	2.1e-28
WP_000019445.1|2162693_2163674_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
WP_162648331.1|2163731_2164301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162648332.1|2164442_2165252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059236045.1|2165417_2165624_+	AlpA family transcriptional regulator	NA	A0A0R6PGY4	Moraxella_phage	41.1	8.5e-05
WP_162648333.1|2165644_2165959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162648334.1|2166241_2167444_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_162648335.1|2167436_2168741_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_162648336.1|2168737_2170612_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_162648337.1|2170626_2171013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162648338.1|2171109_2171538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003845909.1|2171587_2171902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003845907.1|2171919_2172306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162648339.1|2172843_2174046_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_048272234.1|2174014_2174413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048271966.1|2175257_2176481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001106245.1|2176966_2177896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059236906.1|2178289_2179186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000936774.1|2179195_2180347_-	DUF3696 domain-containing protein	NA	NA	NA	NA	NA
WP_047075945.1|2180349_2182266_-	DUF262 domain-containing protein	NA	A0A0R6PKN1	Moraxella_phage	31.0	3.1e-16
WP_001254932.1|2184078_2185230_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
2182467:2182484	attR	GTTCGAGTCCGGCCTTCG	NA	NA	NA	NA
WP_162648340.1|2185647_2186340_+	endonuclease	NA	NA	NA	NA	NA
WP_162648341.1|2186632_2187744_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 163
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2202762	2207183	4695344		Ostreococcus_tauri_virus(50.0%)	4	NA	NA
WP_003837172.1|2202762_2204238_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	31.6	5.8e-47
WP_003033268.1|2204459_2205233_+	Uxu operon transcriptional regulator	NA	NA	NA	NA	NA
WP_008322159.1|2205881_2206085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046670863.1|2206205_2207183_+	porin	NA	Q1MVN1	Enterobacteria_phage	49.9	1.8e-81
>prophage 164
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2227189	2228851	4695344		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_003837223.1|2227189_2228851_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	72.3	6.0e-08
>prophage 165
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2232178	2234660	4695344		Tupanvirus(50.0%)	2	NA	NA
WP_003837229.1|2232178_2233201_+	zinc-binding alcohol dehydrogenase family protein	NA	A0A2K9L7I1	Tupanvirus	26.0	3.9e-10
WP_162648350.1|2233214_2234660_+	tagaturonate reductase	NA	G8DCZ3	Micromonas_pusilla_virus	26.0	5.0e-19
>prophage 166
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2237789	2239069	4695344		Shigella_phage(50.0%)	2	NA	NA
WP_003019133.1|2237789_2238527_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	51.2	2.9e-63
WP_003019130.1|2238529_2239069_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	61.7	4.9e-28
>prophage 167
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2245411	2246488	4695344		Bacillus_phage(100.0%)	1	NA	NA
WP_003837249.1|2245411_2246488_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	39.2	1.5e-20
>prophage 168
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2250310	2253115	4695344		Streptococcus_phage(50.0%)	3	NA	NA
WP_003019086.1|2250310_2251900_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.8	2.7e-29
WP_003837258.1|2252208_2252826_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_003019081.1|2252953_2253115_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	66.0	2.8e-11
>prophage 169
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2258658	2259981	4695344		Geobacillus_virus(100.0%)	1	NA	NA
WP_003845626.1|2258658_2259981_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.3	3.4e-78
>prophage 170
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2266491	2271757	4695344		Enterococcus_phage(33.33%)	3	NA	NA
WP_003019021.1|2266491_2267721_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	44.0	4.5e-85
WP_003845630.1|2267820_2269488_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	2.4e-41
WP_003019016.1|2269819_2271757_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	36.2	1.6e-12
>prophage 171
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2275715	2277140	4695344		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
WP_032937487.1|2275715_2277140_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	21.8	1.8e-08
>prophage 172
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2288337	2289291	4695344		Synechococcus_phage(100.0%)	1	NA	NA
WP_003018974.1|2288337_2289291_+	transaldolase	NA	A0A0E3G6C9	Synechococcus_phage	34.4	1.3e-10
>prophage 173
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2293705	2298220	4695344		Chrysochromulina_ericina_virus(33.33%)	3	NA	NA
WP_003018959.1|2293705_2295628_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.3	1.4e-146
WP_003837322.1|2295713_2296847_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	2.5e-29
WP_003018952.1|2297053_2298220_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	51.5	2.6e-90
>prophage 174
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2304692	2307509	4695344	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_016149528.1|2304692_2307509_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L9X8	Tupanvirus	25.5	3.0e-76
>prophage 175
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2311956	2313105	4695344		Halovirus(100.0%)	1	NA	NA
WP_003018918.1|2311956_2313105_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.4	2.2e-49
>prophage 176
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2318537	2324170	4695344		Tupanvirus(50.0%)	4	NA	NA
WP_003845685.1|2318537_2320091_-	crotonobetaine/carnitine-CoA ligase	NA	A0A2K9KZV5	Tupanvirus	22.3	7.1e-19
WP_003837364.1|2320152_2321370_-	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_003018898.1|2321475_2322618_-	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_003018896.1|2322652_2324170_-	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	22.1	2.5e-08
>prophage 177
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2332500	2333925	4695344		Bacillus_phage(50.0%)	2	NA	NA
WP_003018873.1|2332500_2332980_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	47.1	3.0e-29
WP_003845697.1|2333076_2333925_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A0A0YWI7	Pseudomonas_phage	45.3	4.9e-06
>prophage 178
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2341656	2347046	4695344		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_003837386.1|2341656_2344563_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	1.7e-21
WP_060855462.1|2344694_2347046_-	DNA polymerase II	NA	A0A1B2RW58	Lymphocystis_disease_virus	24.9	6.5e-16
>prophage 179
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2354198	2354897	4695344		Bacillus_virus(100.0%)	1	NA	NA
WP_162648364.1|2354198_2354897_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	38.2	4.4e-21
>prophage 180
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2371365	2373090	4695344		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_003845729.1|2371365_2373090_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.1	3.0e-34
>prophage 181
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2399109	2400153	4695344		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_003018732.1|2399109_2400153_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	55.0	3.4e-102
>prophage 182
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2404455	2405019	4695344		Thiobacimonas_phage(100.0%)	1	NA	NA
WP_003018719.1|2404455_2405019_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1B0T6G1	Thiobacimonas_phage	33.1	2.1e-13
>prophage 183
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2416085	2417510	4695344		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_003018686.1|2416085_2417510_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.9	4.6e-41
>prophage 184
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2424999	2431047	4695344		Mamastrovirus(25.0%)	5	NA	NA
WP_162648371.1|2424999_2426628_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.3	4.3e-19
WP_162648372.1|2426812_2428468_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.8	4.3e-14
WP_003018658.1|2428719_2429256_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	3.9e-17
WP_003018654.1|2429349_2430012_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_149911358.1|2430120_2431047_+	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	6.9e-22
>prophage 185
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2436495	2443318	4695344	tRNA	Bacillus_virus(50.0%)	6	NA	NA
WP_071524282.1|2436495_2437914_-	polynucleotide adenylyltransferase PcnB	NA	G3MAR3	Bacillus_virus	35.9	5.5e-26
WP_003837490.1|2437964_2438861_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_003018625.1|2438931_2439387_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_046670954.1|2439564_2440269_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_003018620.1|2440284_2440815_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_080953253.1|2440843_2443318_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	29.3	1.7e-38
>prophage 186
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2453962	2454760	4695344		Planktothrix_phage(100.0%)	1	NA	NA
WP_003845793.1|2453962_2454760_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	27.4	3.5e-14
>prophage 187
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2460695	2461040	4695344		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_003018581.1|2460695_2461040_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.5	5.9e-27
>prophage 188
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2465042	2466476	4695344	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_003018567.1|2465042_2466476_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.8	2.1e-25
>prophage 189
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2477901	2478660	4695344		Flavobacterium_phage(100.0%)	1	NA	NA
WP_003018543.1|2477901_2478660_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	41.5	7.2e-25
>prophage 190
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2487479	2491583	4695344		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
WP_003018518.1|2487479_2488076_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.8	1.3e-26
WP_003845818.1|2488100_2491583_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	37.0	7.7e-207
>prophage 191
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2503602	2504634	4695344		Planktothrix_phage(100.0%)	1	NA	NA
WP_003018468.1|2503602_2504634_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	5.5e-36
>prophage 192
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2511089	2511893	4695344		Indivirus(100.0%)	1	NA	NA
WP_016149586.1|2511089_2511893_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	35.0	3.9e-37
>prophage 193
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2515937	2520136	4695344		Lactobacillus_phage(33.33%)	5	NA	NA
WP_003031421.1|2515937_2517296_-	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	28.6	8.9e-10
WP_003031418.1|2517367_2518123_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_003031413.1|2518156_2518879_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003838896.1|2518875_2519343_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	60.1	6.5e-53
WP_032941271.1|2519398_2520136_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	40.7	4.1e-41
>prophage 194
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2535729	2539012	4695344		Caulobacter_phage(50.0%)	4	NA	NA
WP_003031390.1|2535729_2536311_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	30.8	5.7e-14
WP_003031388.1|2536422_2537190_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_003031387.1|2537160_2537901_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_003838866.1|2538250_2539012_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.5	2.0e-19
>prophage 195
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2553218	2558692	4695344		Hokovirus(50.0%)	4	NA	NA
WP_016149604.1|2553218_2553611_+	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SGE7	Hokovirus	47.0	4.7e-28
WP_162648377.1|2553683_2554853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016149606.1|2554905_2556102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046669750.1|2556130_2558692_-	glycosyltransferase	NA	A0A1V0SAN7	Catovirus	39.6	1.6e-31
>prophage 196
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2586936	2590650	4695344		Streptococcus_phage(66.67%)	3	NA	NA
WP_003031375.1|2586936_2587992_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	59.5	2.5e-116
WP_003031373.1|2588281_2589385_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.6	2.6e-60
WP_003031370.1|2589396_2590650_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	1.9e-99
>prophage 197
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2613236	2614142	4695344		Burkholderia_virus(100.0%)	1	NA	NA
WP_162648380.1|2613236_2614142_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	25.3	4.0e-14
>prophage 198
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2620875	2621703	4695344		Planktothrix_phage(100.0%)	1	NA	NA
WP_046669788.1|2620875_2621703_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.0	2.1e-17
>prophage 199
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2635352	2643301	4695344		Staphylococcus_phage(33.33%)	5	NA	NA
WP_046669792.1|2635352_2637239_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.8	4.1e-53
WP_003838662.1|2637283_2637556_-	YceK/YidQ family lipoprotein	NA	NA	NA	NA	NA
WP_003847667.1|2637708_2638962_-	MFS transporter	NA	NA	NA	NA	NA
WP_046669793.1|2639013_2642097_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	81.3	0.0e+00
WP_046669794.1|2642218_2643301_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	81.7	5.4e-159
>prophage 200
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2654060	2656021	4695344		Micromonas_sp._RCC1109_virus(100.0%)	2	NA	NA
WP_003838629.1|2654060_2655011_+	acetaldehyde dehydrogenase (acetylating)	NA	E5EQ71	Micromonas_sp._RCC1109_virus	36.3	6.2e-34
WP_003021379.1|2655007_2656021_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	3.2e-44
>prophage 201
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2660012	2661059	4695344		Bacillus_virus(100.0%)	1	NA	NA
WP_046669801.1|2660012_2661059_-	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.2	4.0e-34
>prophage 202
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2669119	2669887	4695344		Planktothrix_phage(100.0%)	1	NA	NA
WP_048233151.1|2669119_2669887_+	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	39.1	1.1e-25
>prophage 203
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2676697	2677666	4695344	transposase	Salmonella_phage(100.0%)	1	NA	NA
WP_023279773.1|2676697_2677666_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.6	2.9e-180
>prophage 204
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2688392	2689508	4695344		Bacillus_phage(100.0%)	1	NA	NA
WP_085954043.1|2688392_2689508_+	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.6	5.3e-16
>prophage 205
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2693259	2703112	4695344		Bacillus_phage(60.0%)	7	NA	NA
WP_003021479.1|2693259_2694171_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	64.3	2.7e-103
WP_162648388.1|2694157_2695171_+	fructokinase	NA	NA	NA	NA	NA
WP_032950792.1|2695178_2696351_-	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_032948677.1|2696543_2699687_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.4	1.7e-11
WP_032936985.1|2699683_2700886_-	exonuclease subunit SbcD	NA	A0A0A0PQ58	Bacillus_phage	25.6	2.0e-08
WP_003021496.1|2701076_2701766_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.9	2.0e-37
WP_016149692.1|2701816_2703112_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.3	1.4e-28
>prophage 206
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2715358	2724966	4695344	tRNA	uncultured_Mediterranean_phage(50.0%)	11	NA	NA
WP_003835982.1|2715358_2716486_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.3	1.6e-89
WP_003021544.1|2716508_2716841_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_003021547.1|2716868_2718716_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_003021550.1|2718726_2719698_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.8	1.4e-44
WP_044699354.1|2719866_2720232_+	VOC family protein	NA	NA	NA	NA	NA
WP_003835974.1|2720255_2720948_+	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	30.1	4.5e-18
WP_003021561.1|2720993_2721857_-	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_054528674.1|2722155_2722695_-	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_003021571.1|2722848_2723298_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_003021573.1|2723301_2724405_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.5	3.4e-52
WP_003021575.1|2724495_2724966_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	7.8e-30
>prophage 207
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2747605	2752650	4695344	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_003021624.1|2747605_2748229_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
WP_003831013.1|2748355_2749630_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	1.9e-131
WP_003021627.1|2749814_2752169_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.6	5.5e-225
WP_003021629.1|2752377_2752650_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.5e-20
>prophage 208
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2755931	2756627	4695344		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_003835948.1|2755931_2756627_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.4	6.5e-89
>prophage 209
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2761037	2764581	4695344		Bacillus_phage(100.0%)	2	NA	NA
WP_016149705.1|2761037_2762810_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.7	3.1e-47
WP_046669814.1|2762802_2764581_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.8	8.9e-42
>prophage 210
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2770169	2773729	4695344		uncultured_Mediterranean_phage(50.0%)	3	NA	NA
WP_003021675.1|2770169_2771123_+	hypothetical protein	NA	A0A1B1ITH5	uncultured_Mediterranean_phage	29.3	1.9e-27
WP_061547913.1|2771372_2772500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040236485.1|2772520_2773729_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0P0ZCT8	Stx2-converting_phage	45.6	1.2e-21
>prophage 211
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2787623	2790773	4695344		Leptospira_phage(100.0%)	1	NA	NA
WP_003021736.1|2787623_2790773_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.7	9.5e-55
>prophage 212
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2797692	2806322	4695344		Klosneuvirus(25.0%)	8	NA	NA
WP_003021759.1|2797692_2798244_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	46.6	7.0e-30
WP_162648393.1|2798454_2800386_+	DNA polymerase III subunit gamma/tau	NA	E7DN81	Pneumococcus_phage	41.5	2.3e-43
WP_003021764.1|2800443_2800773_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_003021767.1|2800772_2801378_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_003021770.1|2801488_2803363_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.4	2.0e-113
WP_003021773.1|2803595_2804240_+	adenylate kinase	NA	NA	NA	NA	NA
WP_003021775.1|2804403_2805366_+	ferrochelatase	NA	NA	NA	NA	NA
WP_046669819.1|2805362_2806322_-	acetyl esterase	NA	A0A167RJ59	Powai_lake_megavirus	29.0	1.9e-14
>prophage 213
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2814507	2817927	4695344		uncultured_virus(50.0%)	2	NA	NA
WP_162648394.1|2814507_2817009_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.2	3.4e-116
WP_003021801.1|2817156_2817927_-	heme ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	27.9	8.9e-15
>prophage 214
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2829478	2830156	4695344		Bacillus_virus(100.0%)	1	NA	NA
WP_003835797.1|2829478_2830156_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	35.2	3.1e-27
>prophage 215
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2833306	2833993	4695344		Planktothrix_phage(100.0%)	1	NA	NA
WP_044699413.1|2833306_2833993_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.2	6.1e-31
>prophage 216
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2838889	2839906	4695344		Planktothrix_phage(100.0%)	1	NA	NA
WP_003847503.1|2838889_2839906_+	virulence-associated ABC transporter ATP-binding protein SfbB	NA	G9BWD6	Planktothrix_phage	38.6	1.5e-33
>prophage 217
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2844945	2846331	4695344	tRNA	Moumouvirus(100.0%)	1	NA	NA
WP_003831109.1|2844945_2846331_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	1.6e-46
>prophage 218
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2850264	2851131	4695344		Enterococcus_phage(100.0%)	1	NA	NA
WP_003021887.1|2850264_2851131_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	36.5	1.2e-28
>prophage 219
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2857980	2871205	4695344	transposase	Escherichia_phage(40.0%)	9	NA	NA
WP_063841712.1|2857980_2858961_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	5.2e-185
WP_003021904.1|2859243_2859966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044699458.1|2860351_2860945_-	fimbria biosynthesis transcriptional regulator FimW	NA	NA	NA	NA	NA
WP_072053661.1|2861312_2864078_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.3	4.0e-33
WP_046669832.1|2864160_2865192_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_003021912.1|2865164_2865857_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.9	4.9e-20
WP_046669833.1|2867146_2869687_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	30.2	1.1e-72
WP_046669834.1|2869683_2870298_+	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_003835732.1|2870776_2871205_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	49.3	7.4e-27
>prophage 220
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2877583	2879708	4695344		Hokovirus(50.0%)	2	NA	NA
WP_003847479.1|2877583_2879035_-	Cu(+)/Ag(+) sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	26.8	2.5e-10
WP_003021940.1|2879024_2879708_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.6	6.0e-31
>prophage 221
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2883046	2889681	4695344	transposase	Leptospira_phage(33.33%)	4	NA	NA
WP_003835712.1|2883046_2886190_+	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.0	2.7e-57
WP_003021953.1|2886241_2887096_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_162648403.1|2887332_2888655_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	45.6	9.4e-105
WP_063841712.1|2888700_2889681_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	5.2e-185
>prophage 222
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2893727	2903066	4695344		Escherichia_phage(100.0%)	1	NA	NA
WP_162648405.1|2893727_2903066_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	24.7	3.5e-12
>prophage 223
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2919005	2927095	4695344		Tupanvirus(33.33%)	5	NA	NA
WP_162648407.1|2919005_2922896_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.8	2.1e-64
WP_162648408.1|2923124_2924258_+	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_003022023.1|2924304_2925102_-	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	23.0	6.4e-08
WP_003022026.1|2925098_2926091_-	iron-enterobactin ABC transporter permease	NA	NA	NA	NA	NA
WP_003835646.1|2926087_2927095_-	Fe(3+)-siderophore ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.0	2.2e-13
>prophage 224
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2939552	2941378	4695344		uncultured_marine_virus(50.0%)	2	NA	NA
WP_046669852.1|2939552_2940170_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	51.3	6.0e-54
WP_003835626.1|2940154_2941378_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	33.1	5.9e-61
>prophage 225
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2944490	2952620	4695344		Escherichia_phage(40.0%)	8	NA	NA
WP_003835619.1|2944490_2946056_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.0	1.1e-43
WP_069219714.1|2946279_2946834_+	dehydrogenase	NA	NA	NA	NA	NA
WP_003835615.1|2946830_2949101_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	25.0	4.9e-45
WP_003022094.1|2949097_2949655_+	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.7	6.2e-26
WP_046669855.1|2949654_2950422_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_003022101.1|2950491_2950920_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	38.5	1.1e-17
WP_003022104.1|2951103_2951514_-	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
WP_046669856.1|2951789_2952620_+	alpha/beta hydrolase	NA	A0A291AV30	Mycobacterium_phage	30.8	4.2e-18
>prophage 226
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2966453	2967099	4695344		Morganella_phage(50.0%)	2	NA	NA
WP_000034825.1|2966453_2966663_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
WP_016149775.1|2966715_2967099_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	52.6	5.8e-23
>prophage 227
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2970706	2973170	4695344		Stx2-converting_phage(50.0%)	2	NA	NA
WP_003022711.1|2970706_2971918_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.9	9.8e-101
WP_046669860.1|2972060_2973170_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	54.8	6.2e-09
>prophage 228
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2981335	2986510	4695344	tRNA	Staphylococcus_phage(50.0%)	4	NA	NA
WP_152659845.1|2981335_2983918_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.6	1.6e-185
WP_003022748.1|2984153_2984636_+	zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_003847389.1|2984732_2985668_-	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_003022754.1|2985784_2986510_-	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.1	1.1e-30
>prophage 229
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2992470	2993556	4695344		Pseudomonas_phage(100.0%)	1	NA	NA
WP_008784096.1|2992470_2993556_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	3.3e-47
>prophage 230
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	2998106	2999771	4695344		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_003835552.1|2998106_2999771_-	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.5	2.1e-85
>prophage 231
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	3004570	3021473	4695344	tRNA	Vibrio_phage(16.67%)	16	NA	NA
WP_003835548.1|3004570_3006520_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	48.6	1.1e-08
WP_003022809.1|3006706_3008374_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	94.2	0.0e+00
WP_003835544.1|3008809_3010216_+	chitoporin	NA	NA	NA	NA	NA
WP_003022817.1|3010265_3010598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136397779.1|3010649_3011945_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	34.7	6.9e-60
WP_162648410.1|3011998_3013138_-	tricarballylate utilization 4Fe-4S protein TcuB	NA	NA	NA	NA	NA
WP_096889492.1|3013124_3014528_-	FAD-dependent tricarballylate dehydrogenase TcuA	NA	A0A2P0ZL82	Lactobacillus_phage	25.9	1.0e-08
WP_049014685.1|3014625_3015552_-	tricarballylate utilization LysR family transcriptional regulator TcuR	NA	NA	NA	NA	NA
WP_003022836.1|3015681_3016128_-	ferric iron uptake transcriptional regulator	NA	NA	NA	NA	NA
WP_049259739.1|3016120_3016207_-	ryhB-regulated fur leader peptide	NA	NA	NA	NA	NA
WP_071593189.1|3016417_3017047_-	flavodoxin FldA	NA	NA	NA	NA	NA
WP_003022842.1|3017103_3017391_-	LexA regulated protein	NA	NA	NA	NA	NA
WP_003847362.1|3017519_3018293_-	esterase	NA	A0A1J0GVH7	Mycobacterium_phage	37.2	1.2e-06
WP_003022848.1|3018487_3019030_+	replication initiation negative regulator SeqA	NA	NA	NA	NA	NA
WP_162648411.1|3019054_3020695_+	alpha-D-glucose phosphate-specific phosphoglucomutase	NA	NA	NA	NA	NA
WP_003022856.1|3020795_3021473_-	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	32.0	2.6e-26
>prophage 232
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	3024739	3026788	4695344		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_003835530.1|3024739_3026788_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	24.7	1.6e-31
>prophage 233
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	3030155	3034181	4695344	transposase	Hokovirus(33.33%)	3	NA	NA
WP_046669872.1|3030155_3031574_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	33.8	3.9e-64
WP_016149795.1|3031734_3032649_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	48.0	4.1e-67
WP_003847348.1|3032699_3034181_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	27.5	1.3e-43
>prophage 234
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	3039972	3040764	4695344		Kaumoebavirus(100.0%)	1	NA	NA
WP_046669875.1|3039972_3040764_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	29.8	1.7e-08
>prophage 235
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	3083478	3086994	4695344		Vibrio_phage(33.33%)	4	NA	NA
WP_046669884.1|3083478_3084198_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	33.2	2.9e-23
WP_003022992.1|3084194_3085136_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	27.5	3.7e-23
WP_003022994.1|3085249_3085624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003837108.1|3085941_3086994_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	S4VUY9	Pandoravirus	47.3	1.7e-80
>prophage 236
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	3091289	3097855	4695344		Tupanvirus(33.33%)	7	NA	NA
WP_003837100.1|3091289_3092306_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	45.1	6.3e-77
WP_032938578.1|3092523_3093996_-	molybdate ABC transporter ATP-binding protein ModF	NA	W5SAS9	Pithovirus	27.1	1.0e-11
WP_003023018.1|3094063_3094852_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_003023026.1|3094982_3095132_+	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
WP_162648415.1|3095331_3096105_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003023032.1|3096104_3096794_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_003837092.1|3096796_3097855_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	33.8	2.6e-20
>prophage 237
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	3112205	3115723	4695344		Catovirus(50.0%)	3	NA	NA
WP_162648416.1|3112205_3113726_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	39.6	6.4e-81
WP_003845384.1|3113821_3114298_-	kinase inhibitor	NA	NA	NA	NA	NA
WP_162648822.1|3114355_3115723_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.8	4.3e-20
>prophage 238
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	3119311	3123856	4695344		Staphylococcus_phage(50.0%)	4	NA	NA
WP_003035181.1|3119311_3120034_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.5	1.4e-09
WP_135702046.1|3120051_3120393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003837055.1|3120803_3122825_+	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_046669894.1|3122947_3123856_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	3.5e-26
>prophage 239
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	3133574	3138538	4695344		Anomala_cuprea_entomopoxvirus(50.0%)	4	NA	NA
WP_003845404.1|3133574_3135311_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.5	1.1e-17
WP_071696426.1|3135303_3136299_-	secretion protein HlyD	NA	NA	NA	NA	NA
WP_003035216.1|3136295_3136973_-	transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_162648417.1|3137194_3138538_+	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.5	8.5e-53
>prophage 240
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	3142504	3148583	4695344		Bacillus_phage(33.33%)	6	NA	NA
WP_162648418.1|3142504_3144655_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	27.5	2.2e-42
WP_162648419.1|3144684_3145653_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_103848331.1|3145815_3146901_+	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_003035231.1|3146999_3147260_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_003035233.1|3147563_3147830_-	DksA/TraR family C4-type zinc finger protein	NA	A0A2C9CZU7	Yersinia_phage	51.1	3.6e-16
WP_162648420.1|3147905_3148583_-	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.6	2.6e-18
>prophage 241
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	3154955	3160146	4695344		Planktothrix_phage(33.33%)	6	NA	NA
WP_003035246.1|3154955_3155678_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.1	2.8e-34
WP_003035248.1|3155674_3156334_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_003837002.1|3156471_3157218_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_003035253.1|3157583_3158087_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	28.1	5.5e-05
WP_003035255.1|3158389_3159277_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_003035257.1|3159630_3160146_+	outer membrane protein OmpX	NA	A5LH44	Enterobacteria_phage	33.7	1.9e-16
>prophage 242
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	3165184	3174291	4695344		Tupanvirus(25.0%)	7	NA	NA
WP_003035269.1|3165184_3166780_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.5	8.5e-60
WP_048219222.1|3166923_3168186_-	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_044701108.1|3168339_3169155_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_032936392.1|3169322_3171755_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	50.9	2.3e-08
WP_003035278.1|3171760_3172660_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_162648424.1|3172792_3173455_+	fructose-6-phosphate aldolase	NA	A0A1D8KKK9	Synechococcus_phage	31.8	2.9e-22
WP_071687912.1|3173541_3174291_-	molybdopterin-synthase adenylyltransferase MoeB	NA	A0A1V0SCZ9	Indivirus	29.3	1.8e-12
>prophage 243
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	3177633	3179505	4695344		Planktothrix_phage(100.0%)	1	NA	NA
WP_003836972.1|3177633_3179505_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	27.2	3.7e-14
>prophage 244
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	3187107	3189113	4695344		Stx2-converting_phage(50.0%)	2	NA	NA
WP_003035316.1|3187107_3188310_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	47.1	2.9e-97
WP_003836960.1|3188354_3189113_-	DNA-binding transcriptional repressor DeoR	NA	A0A077SK06	Escherichia_phage	28.8	3.9e-15
>prophage 245
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	3197303	3210695	4695344		Salmonella_phage(20.0%)	14	NA	NA
WP_162648429.1|3197303_3198515_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	89.2	8.1e-188
WP_003035354.1|3199023_3200709_-	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_003035356.1|3200978_3201359_+	membrane protein	NA	NA	NA	NA	NA
WP_003035358.1|3201393_3201657_-	glutaredoxin, GrxA family	NA	A0A2I7SAE2	Vibrio_phage	67.9	3.8e-26
WP_003845523.1|3201829_3202120_+	YbjC family protein	NA	NA	NA	NA	NA
WP_003836934.1|3202103_3202826_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_003836932.1|3202885_3203788_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.0	2.0e-37
WP_003035368.1|3203878_3204355_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_003035370.1|3204788_3205901_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_003035373.1|3206039_3207173_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	1.1e-29
WP_103848614.1|3207182_3208136_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_003035376.1|3208132_3208978_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_003035378.1|3209037_3209526_+	YbjO family protein	NA	NA	NA	NA	NA
WP_044701666.1|3209567_3210695_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.4	1.6e-28
>prophage 246
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	3215342	3231923	4695344	tRNA	Bacillus_phage(25.0%)	10	NA	NA
WP_162648430.1|3215342_3217064_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	23.6	1.1e-15
WP_046669942.1|3217064_3218831_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.6	1.4e-23
WP_003035727.1|3218945_3219914_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.3	1.9e-62
WP_002439523.1|3220461_3220956_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_162648431.1|3221090_3225152_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.2	2.9e-88
WP_003831898.1|3225263_3225875_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_003836910.1|3225885_3227229_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	4.3e-81
WP_003836908.1|3227321_3228614_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.1	2.5e-94
WP_069219705.1|3228850_3231295_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.6	7.8e-222
WP_003836904.1|3231305_3231923_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
>prophage 247
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	3236736	3239945	4695344		Tetraselmis_virus(100.0%)	2	NA	NA
WP_003035751.1|3236736_3237477_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	1.0e-20
WP_003035753.1|3237662_3239945_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	42.0	3.8e-162
>prophage 248
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	3244069	3245158	4695344		Streptococcus_phage(100.0%)	1	NA	NA
WP_016149863.1|3244069_3245158_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	45.3	2.3e-80
>prophage 249
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	3250212	3254753	4695344		Bacillus_phage(100.0%)	3	NA	NA
WP_003035780.1|3250212_3250497_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	39.1	9.2e-10
WP_162648436.1|3250703_3252968_+	ComEC family protein	NA	NA	NA	NA	NA
WP_003035784.1|3253004_3254753_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.7	2.4e-60
>prophage 250
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	3260053	3355328	4695344	holin,terminase,transposase,integrase,tail,portal,protease,tRNA,head,capsid	Enterobacteria_phage(27.27%)	100	3253904:3253921	3318006:3318023
3253904:3253921	attL	GCTGACCAACGTCAACGC	NA	NA	NA	NA
WP_003035803.1|3260053_3260857_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_003836877.1|3260849_3262172_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_003035809.1|3262152_3262857_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_003846984.1|3262856_3267317_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_048241322.1|3267562_3269314_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_003035820.1|3269491_3270040_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	32.6	3.5e-05
WP_003035823.1|3270068_3270716_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_003035825.1|3270769_3271960_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_016149871.1|3272143_3273220_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	53.9	8.7e-101
WP_003035832.1|3273820_3275221_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	35.9	5.0e-80
WP_003836860.1|3275388_3276591_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_162648437.1|3276785_3278078_-|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	94.0	2.2e-239
WP_057064505.1|3278122_3278371_-	excisionase family protein	NA	S4TND0	Salmonella_phage	85.0	1.5e-35
WP_108361454.1|3278524_3278836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162648438.1|3278835_3279423_-	hypothetical protein	NA	A0A1B5FPC7	Escherichia_phage	71.8	3.8e-82
WP_162648823.1|3279419_3279533_-	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	81.1	1.4e-09
WP_032652477.1|3279628_3279853_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	55.4	6.1e-17
WP_162648439.1|3279971_3280550_-	hypothetical protein	NA	A0A088C4R7	Shewanella_sp._phage	27.4	3.7e-13
WP_162648440.1|3280560_3281139_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	58.9	1.2e-61
WP_162648441.1|3281135_3281558_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	64.3	2.7e-45
WP_162648070.1|3281550_3281712_-	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	73.5	3.5e-14
WP_162648442.1|3281779_3282136_-	hypothetical protein	NA	A0A1B5FPB3	Escherichia_phage	49.6	4.1e-23
WP_162648443.1|3282254_3282527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057064497.1|3282604_3282898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057064498.1|3283086_3283746_-	LexA family transcriptional regulator	NA	I6R0S2	Salmonella_phage	70.7	2.5e-90
WP_071886902.1|3283856_3284072_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_162648444.1|3284376_3285261_+	KilA-N domain-containing protein	NA	Q8W644	Enterobacteria_phage	70.7	3.8e-62
WP_057064499.1|3286168_3287050_+	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	61.6	2.0e-79
WP_108361635.1|3287046_3288405_+	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	69.1	1.4e-175
WP_005127643.1|3288415_3289231_+	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	72.3	1.3e-112
WP_032652457.1|3289546_3289759_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_162648445.1|3290295_3290508_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	79.4	1.2e-22
WP_143113773.1|3291982_3292369_+	hypothetical protein	NA	A0A192Y8P2	Salmonella_phage	92.2	1.4e-56
WP_072161075.1|3292355_3292637_+|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	47.1	7.0e-18
WP_162648446.1|3292636_3293254_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	74.1	4.0e-82
WP_162648447.1|3293261_3293531_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	70.1	5.8e-22
WP_162648448.1|3293952_3294516_+	hypothetical protein	NA	A0A0H4IQ87	Shigella_phage	76.9	3.6e-82
WP_162648449.1|3294717_3295269_+	HNH endonuclease	NA	A0A2I7RZ08	Vibrio_phage	46.1	4.4e-32
WP_162648450.1|3295282_3296011_+	Fur-regulated protein	NA	M9NZE9	Enterobacteria_phage	78.1	6.1e-90
WP_162648451.1|3296025_3296253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162648452.1|3296289_3296580_+	HNH endonuclease	NA	A0A286N2R3	Klebsiella_phage	89.6	1.2e-49
WP_162648453.1|3296677_3297112_+	hypothetical protein	NA	A0A286S1P9	Klebsiella_phage	90.3	1.9e-67
WP_162648454.1|3297121_3298654_+|terminase	terminase	terminase	A0A286S1M9	Klebsiella_phage	96.7	3.3e-287
WP_162648455.1|3298657_3299935_+|portal	phage portal protein	portal	A0A286S1N5	Klebsiella_phage	95.3	6.0e-234
WP_134216386.1|3299940_3300621_+|head,protease	HK97 family phage prohead protease	head,protease	A0A286S1N1	Klebsiella_phage	89.7	1.2e-111
WP_162648456.1|3300632_3301796_+|capsid	phage major capsid protein	capsid	A0A286S1R4	Klebsiella_phage	95.9	1.4e-205
WP_134216388.1|3301832_3302075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_134216389.1|3302043_3302349_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A286S294	Klebsiella_phage	77.2	4.9e-41
WP_162648457.1|3302409_3302595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_134216390.1|3302597_3302930_+|head	phage head closure protein	head	K7PH08	Enterobacteria_phage	61.8	5.9e-32
WP_134216391.1|3302922_3303462_+	HK97 gp10 family phage protein	NA	A0A286S249	Klebsiella_phage	63.5	4.6e-58
WP_134216392.1|3303458_3303824_+	DUF3168 domain-containing protein	NA	K7PHI9	Enterobacteria_phage	86.0	1.7e-56
WP_134216393.1|3303876_3304374_+|tail	phage tail protein	tail	K7PJH5	Enterobacteria_phage	89.7	5.6e-79
WP_134216394.1|3304411_3304897_+|tail	phage tail protein	tail	K7PJU9	Enterobacteria_phage	95.1	1.5e-60
WP_134216395.1|3305092_3307513_+|tail	phage tail tape measure protein	tail	K7PGX8	Enterobacteria_phage	93.4	0.0e+00
WP_134216396.1|3307512_3307851_+|tail	phage tail protein	tail	K7PHJ6	Enterobacteria_phage	92.0	7.5e-59
WP_134216397.1|3307847_3308603_+|tail	phage minor tail protein L	tail	K7PKU0	Enterobacteria_phage	94.8	5.7e-139
WP_162648458.1|3308604_3309315_+	peptidase P60	NA	K7PGR2	Enterobacteria_phage	92.8	1.3e-137
WP_162648459.1|3309344_3309686_+	hypothetical protein	NA	K7PLP0	Enterobacteria_phage	91.2	8.1e-53
WP_162648460.1|3309730_3310336_+|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	98.0	2.2e-101
WP_001254932.1|3311497_3312649_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_162648461.1|3313690_3316894_+	host specificity protein J	NA	O64335	Escherichia_phage	87.1	0.0e+00
WP_162648462.1|3316895_3317840_+	hypothetical protein	NA	H6WRW5	Salmonella_phage	65.5	4.5e-117
WP_049003685.1|3318638_3319007_+|tail	tail fiber domain-containing protein	tail	W6ASK4	Escherichia_phage	50.4	7.5e-28
3318006:3318023	attR	GCGTTGACGTTGGTCAGC	NA	NA	NA	NA
WP_162648463.1|3319344_3319539_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_162648464.1|3319565_3319877_+	helix-turn-helix domain-containing protein	NA	B6SCW9	Bacteriophage	50.0	9.8e-05
WP_049815105.1|3320221_3320413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162648465.1|3320902_3321142_-	DinI family protein	NA	K7PKM2	Enterobacterial_phage	94.9	1.2e-34
WP_096878894.1|3321567_3324180_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	21.6	7.0e-19
WP_003035840.1|3324251_3325019_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.1	1.7e-29
WP_003035843.1|3325015_3325807_-	aliphatic sulfonate ABC transporter permease SsuC	NA	NA	NA	NA	NA
WP_032936307.1|3325817_3326963_-	FMNH2-dependent alkanesulfonate monooxygenase	NA	NA	NA	NA	NA
WP_086529148.1|3326959_3327934_-	sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016149876.1|3327926_3328502_-	NADPH-dependent FMN reductase	NA	NA	NA	NA	NA
WP_003831973.1|3328869_3329880_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_003035852.1|3330045_3330588_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_162648466.1|3330584_3331691_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_003836848.1|3331789_3333898_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_162648467.1|3333910_3335818_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.5	4.3e-50
WP_003035862.1|3335832_3337086_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_003836843.1|3337090_3338731_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_032936292.1|3338727_3339291_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_003035871.1|3339547_3339715_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_003035875.1|3339822_3340341_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_162648468.1|3340409_3342170_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_003035881.1|3342355_3342808_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_003035883.1|3342897_3343944_-	porin OmpA	NA	NA	NA	NA	NA
WP_032936288.1|3344301_3344811_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_162648469.1|3345027_3345642_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_032939270.1|3345619_3347773_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_003035892.1|3347791_3348238_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_046671317.1|3348363_3350418_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	1.0e-20
WP_003035897.1|3350450_3350909_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_016149882.1|3351002_3351665_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_003035903.1|3351837_3352251_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_003035905.1|3352312_3352630_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_032936284.1|3352687_3353878_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_003035911.1|3353972_3354254_+	acylphosphatase	NA	NA	NA	NA	NA
WP_003035914.1|3354250_3354580_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_162648470.1|3354668_3355328_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	54.9	1.5e-47
>prophage 251
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	3360610	3361426	4695344		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_049015964.1|3360610_3361426_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.3	6.8e-13
>prophage 252
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	3365063	3366032	4695344	transposase	Salmonella_phage(100.0%)	1	NA	NA
WP_023279773.1|3365063_3366032_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.6	2.9e-180
>prophage 253
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	3370164	3371085	4695344		Klosneuvirus(100.0%)	1	NA	NA
WP_003035957.1|3370164_3371085_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	39.0	3.6e-10
>prophage 254
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	3383898	3384594	4695344		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_003836817.1|3383898_3384594_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	33.2	3.9e-17
>prophage 255
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	3389796	3389970	4695344		Enterobacteria_phage(100.0%)	1	NA	NA
WP_003036022.1|3389796_3389970_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	92.6	1.4e-05
>prophage 256
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	3396737	3397718	4695344	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_063841712.1|3396737_3397718_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	5.2e-185
>prophage 257
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	3403949	3404858	4695344		Cronobacter_phage(100.0%)	1	NA	NA
WP_086529159.1|3403949_3404858_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	77.1	6.9e-91
>prophage 258
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	3410103	3413908	4695344		uncultured_Mediterranean_phage(50.0%)	5	NA	NA
WP_134215860.1|3410103_3411042_+	glyoxylate/hydroxypyruvate reductase GhrA	NA	A0A1B1IVB5	uncultured_Mediterranean_phage	28.5	3.2e-06
WP_003836800.1|3411128_3411866_+	phosphatase	NA	NA	NA	NA	NA
WP_003836798.1|3411889_3412444_+	molecular chaperone	NA	NA	NA	NA	NA
WP_044700707.1|3412545_3413028_+	DUF1097 domain-containing protein	NA	NA	NA	NA	NA
WP_003036082.1|3413074_3413908_-	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	39.7	3.0e-40
>prophage 259
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	3418097	3418640	4695344		Scale_drop_disease_virus(100.0%)	1	NA	NA
WP_046670455.1|3418097_3418640_+	O-acetyl-ADP-ribose deacetylase	NA	A0A0K1L687	Scale_drop_disease_virus	49.3	1.9e-27
>prophage 260
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	3426856	3430638	4695344		Bacillus_phage(50.0%)	3	NA	NA
WP_046670459.1|3426856_3428278_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.7	2.2e-19
WP_046670460.1|3428341_3429562_-	multidrug efflux MFS transporter MdtG	NA	NA	NA	NA	NA
WP_003036136.1|3429717_3430638_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	41.6	1.0e-57
>prophage 261
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	3435356	3435602	4695344		Enterobacteria_phage(100.0%)	1	NA	NA
WP_003036157.1|3435356_3435602_-	DNA damage-inducible protein I	NA	K7PM44	Enterobacteria_phage	50.0	1.1e-14
>prophage 262
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	3450838	3451789	4695344		Brevibacillus_phage(100.0%)	1	NA	NA
WP_003836755.1|3450838_3451789_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	30.9	1.6e-10
>prophage 263
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	3466526	3467653	4695344		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_003036255.1|3466526_3467261_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	7.7e-16
WP_000103754.1|3467416_3467653_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 264
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	3470939	3476951	4695344		Pseudomonas_phage(33.33%)	5	NA	NA
WP_003036268.1|3470939_3471581_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	38.2	1.3e-27
WP_162648479.1|3471577_3472582_+	DNA polymerase III subunit delta'	NA	A0A1V0DYC6	Dinoroseobacter_phage	34.8	8.1e-08
WP_003036276.1|3472592_3473390_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_003036277.1|3473683_3475117_+	PTS glucose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_162648480.1|3475172_3476951_-	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	33.3	2.4e-79
>prophage 265
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	3481991	3483716	4695344		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
WP_162648482.1|3481991_3482759_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.5	4.1e-12
WP_162648483.1|3482759_3483716_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.3	5.3e-17
>prophage 266
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	3521775	3522033	4695344		Erwinia_phage(100.0%)	1	NA	NA
WP_003030810.1|3521775_3522033_+	DUF1471 domain-containing protein	NA	A0A1B2IFR9	Erwinia_phage	35.7	2.8e-05
>prophage 267
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	3529316	3537027	4695344		Mycoplasma_phage(50.0%)	8	NA	NA
WP_003030805.1|3529316_3530018_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	4.9e-36
WP_003030804.1|3530017_3531262_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_003030802.1|3531351_3532263_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_003030799.1|3532278_3533100_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	36.1	3.3e-23
WP_003030797.1|3533199_3534246_-	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_003030794.1|3534273_3535053_-	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_046670510.1|3535049_3535907_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	25.8	4.3e-10
WP_003030791.1|3535890_3537027_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	40.3	7.2e-29
>prophage 268
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	3542119	3596990	4695344	holin,terminase,integrase,tail,portal,tRNA,head,capsid	Enterobacteria_phage(37.5%)	66	3548923:3548940	3595629:3595646
WP_003841884.1|3542119_3543490_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.6	4.7e-107
WP_003841885.1|3543493_3544135_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_003832402.1|3544169_3545276_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_003841887.1|3545329_3545791_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_052946586.1|3545800_3546733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162648487.1|3546767_3547385_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_003030769.1|3547587_3548838_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	94.4	9.4e-22
3548923:3548940	attL	AAAACTCTTCCCCAAAAC	NA	NA	NA	NA
WP_162648488.1|3548950_3550093_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	81.1	2.2e-174
WP_047497692.1|3550082_3550319_-	excisionase	NA	NA	NA	NA	NA
WP_162648825.1|3550622_3551702_-	RelA/SpoT domain-containing protein	NA	A0A1B0VBT5	Salmonella_phage	39.2	6.6e-56
WP_162648489.1|3552437_3552650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162648490.1|3552833_3553328_+	hypothetical protein	NA	K7P861	Enterobacteria_phage	91.5	2.8e-78
WP_162648491.1|3553678_3554305_-	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	49.3	3.2e-47
WP_003826141.1|3554407_3554635_+	cell division protein	NA	NA	NA	NA	NA
WP_003826142.1|3554645_3555197_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	68.4	6.1e-66
WP_003034732.1|3555369_3555549_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	73.1	3.0e-14
WP_008784459.1|3555538_3556396_+	GntR family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	96.7	3.7e-62
WP_162648492.1|3556392_3557274_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	75.3	4.7e-129
WP_162648493.1|3557266_3559273_+	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	52.6	2.9e-198
WP_162648494.1|3559269_3559656_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A192Y8N5	Salmonella_phage	88.4	1.6e-60
WP_003034743.1|3559669_3560356_+	phage regulatory protein/antirepressor Ant	NA	G0ZND1	Cronobacter_phage	53.8	9.9e-58
WP_162648495.1|3560352_3561348_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	69.3	1.1e-142
WP_162648496.1|3561369_3562059_+	antitermination protein	NA	NA	NA	NA	NA
WP_162648497.1|3562203_3562752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162648498.1|3562862_3563072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162648499.1|3563142_3563529_+	hypothetical protein	NA	A0A192Y8P2	Salmonella_phage	93.0	6.2e-57
WP_162648500.1|3563515_3563797_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	48.4	2.6e-20
WP_162648501.1|3563796_3564411_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	80.4	1.0e-90
WP_162648502.1|3564418_3564688_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	71.3	4.5e-22
WP_162648503.1|3565066_3565633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000453624.1|3566239_3566785_+|terminase	terminase small subunit	terminase	E4WL18	Enterobacteria_phage	100.0	1.2e-95
WP_162648504.1|3566759_3568682_+|terminase	phage terminase large subunit family protein	terminase	E4WL19	Enterobacteria_phage	97.8	0.0e+00
WP_003034782.1|3568681_3568888_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	95.5	3.2e-28
WP_047497651.1|3568884_3570477_+|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	92.1	1.7e-289
WP_162648505.1|3570457_3571795_+	S49 family peptidase	NA	O64320	Escherichia_phage	83.4	3.1e-188
WP_003034794.1|3571804_3572137_+|head	head decoration protein	head	E4WL24	Enterobacteria_phage	81.8	8.5e-47
WP_003034798.1|3572204_3573230_+|capsid	major capsid protein	capsid	K7PGW9	Enterobacteria_phage	92.7	1.9e-182
WP_049001735.1|3573274_3573679_+	DNA-packaging protein	NA	K7P7M3	Enterobacteria_phage	53.5	1.2e-23
WP_162648506.1|3573690_3574044_+|tail	phage tail protein	tail	K7P6U9	Enterobacteria_phage	74.4	5.8e-46
WP_162648507.1|3574053_3574608_+|tail	phage tail protein	tail	K7P7A8	Enterobacteria_phage	91.4	1.0e-73
WP_032938647.1|3574604_3575003_+|tail	tail protein	tail	K7P7G5	Enterobacteria_phage	81.8	6.1e-60
WP_162648508.1|3575010_3575748_+|tail	phage tail protein	tail	O64327	Escherichia_phage	66.5	3.1e-89
WP_162648509.1|3575784_3576192_+|tail	phage minor tail protein G	tail	K7PM17	Enterobacteria_phage	60.7	2.7e-26
WP_071524448.1|3576200_3576521_+|tail	phage tail assembly protein T	tail	K7PHE1	Enterobacteria_phage	69.8	2.7e-34
WP_162648510.1|3576498_3579027_+|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	66.9	7.4e-292
WP_162648511.1|3579027_3579243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162648512.1|3579326_3579674_+|tail	phage tail protein	tail	K7PJT2	Enterobacteria_phage	71.3	3.6e-40
WP_162648513.1|3579670_3580426_+|tail	phage minor tail protein L	tail	K7PGX3	Enterobacteria_phage	86.1	6.3e-130
WP_162648514.1|3580427_3581138_+	peptidase P60	NA	K7PGR2	Enterobacteria_phage	90.2	4.4e-133
WP_162648515.1|3581358_3582090_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_162648071.1|3582188_3582365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162648516.1|3582438_3583020_+	Bro-N domain-containing protein	NA	H6WRU8	Salmonella_phage	41.2	1.8e-28
WP_162648517.1|3583098_3583830_+	transcriptional regulator	NA	A0A0H5AUF7	Pseudomonas_phage	39.9	6.0e-37
WP_162648518.1|3583939_3584275_+	hypothetical protein	NA	Q6UAW3	Klebsiella_phage	40.5	3.2e-17
WP_048216425.1|3584328_3584931_+|tail	tail assembly protein	tail	K7PM97	Enterobacterial_phage	72.3	7.8e-75
WP_162648519.1|3588164_3588479_+	hypothetical protein	NA	O64336	Escherichia_phage	58.7	2.7e-26
WP_162648533.1|3588479_3589154_+	hypothetical protein	NA	O64337	Escherichia_phage	52.0	1.3e-54
WP_162648534.1|3589560_3591117_+|tail	tail fiber domain-containing protein	tail	O64338	Escherichia_phage	44.0	9.4e-88
WP_088731923.1|3591245_3591488_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	76.6	2.6e-29
WP_162648614.1|3591807_3592197_+	LexA family transcriptional regulator	NA	Q71TH8	Escherichia_phage	71.3	7.3e-50
WP_162648616.1|3592197_3592866_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.0	5.8e-79
WP_162648618.1|3593421_3594324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162648620.1|3594323_3595319_-	DGQHR domain-containing protein	NA	NA	NA	NA	NA
WP_162648622.1|3595715_3595928_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	94.4	9.3e-23
3595629:3595646	attR	AAAACTCTTCCCCAAAAC	NA	NA	NA	NA
WP_003030767.1|3596063_3596573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162648624.1|3596747_3596990_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	76.6	1.3e-28
>prophage 269
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	3600635	3603184	4695344		uncultured_Caudovirales_phage(75.0%)	4	NA	NA
WP_003030762.1|3600635_3600956_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	44.8	3.2e-19
WP_162648626.1|3601000_3602290_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	70.0	2.1e-165
WP_003030760.1|3602302_3602728_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	7.3e-51
WP_075206724.1|3602971_3603184_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	4.6e-22
>prophage 270
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	3622974	3624000	4695344		Bacillus_virus(100.0%)	1	NA	NA
WP_162648634.1|3622974_3624000_-	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	26.3	1.8e-10
>prophage 271
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	3628905	3632679	4695344		Bacillus_phage(100.0%)	3	NA	NA
WP_003846667.1|3628905_3630396_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	28.8	1.4e-11
WP_046670557.1|3630559_3631330_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003030708.1|3631395_3632679_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	26.6	1.9e-09
>prophage 272
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	3640644	3641898	4695344		Tupanvirus(100.0%)	1	NA	NA
WP_162648636.1|3640644_3641898_-	glycoside hydrolase family 18 protein	NA	A0A2K9L3D4	Tupanvirus	29.8	1.5e-24
>prophage 273
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	3645462	3646446	4695344		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003846646.1|3645462_3646446_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	23.4	4.3e-06
>prophage 274
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	3649654	3650299	4695344		Tupanvirus(100.0%)	1	NA	NA
WP_155267879.1|3649654_3650299_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	37.2	9.4e-18
>prophage 275
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	3655127	3657074	4695344		Streptococcus_phage(100.0%)	1	NA	NA
WP_044700023.1|3655127_3657074_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.7	5.3e-40
>prophage 276
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	3662153	3662786	4695344		Bacillus_phage(100.0%)	1	NA	NA
WP_046670561.1|3662153_3662786_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	32.3	2.6e-12
>prophage 277
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	3668320	3669541	4695344		Klosneuvirus(100.0%)	1	NA	NA
WP_003840894.1|3668320_3669541_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.6	4.2e-27
>prophage 278
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	3677087	3677918	4695344		Bacillus_virus(100.0%)	1	NA	NA
WP_032936096.1|3677087_3677918_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	2.0e-73
>prophage 279
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	3684066	3689816	4695344		Tupanvirus(33.33%)	5	NA	NA
WP_046670572.1|3684066_3686325_-	catalase HPII	NA	A0A2K9L572	Tupanvirus	47.6	1.7e-138
WP_080602219.1|3686526_3686781_+	cell division activator CedA	NA	NA	NA	NA	NA
WP_162648694.1|3686844_3688236_-	L-cystine transporter	NA	NA	NA	NA	NA
WP_085951595.1|3688371_3688971_-	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	34.3	7.7e-06
WP_046670573.1|3689054_3689816_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	3.1e-20
>prophage 280
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	3695083	3708671	4695344	tRNA	Tupanvirus(22.22%)	15	NA	NA
WP_003832572.1|3695083_3697012_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.8	4.4e-127
WP_048997935.1|3697015_3697558_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	8.2e-15
WP_003030583.1|3697654_3697852_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_003030578.1|3697907_3698264_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_152659856.1|3698302_3698434_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_003832580.1|3698633_3699617_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_003030574.1|3699632_3702020_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003030571.1|3702024_3702324_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_003832584.1|3702477_3703458_+	vitamin B12 ABC transporter permease BtuC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	24.8	6.7e-15
WP_003030569.1|3703518_3704070_+	glutathione peroxidase	NA	NA	NA	NA	NA
WP_003030567.1|3704069_3704819_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	30.3	9.3e-09
WP_003836644.1|3704896_3705361_+	lipoprotein nlpC	NA	A0A1V0DZX6	Clostridioides_phage	38.2	3.5e-14
WP_003836643.1|3705677_3706391_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_003843460.1|3706452_3707895_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	35.3	7.7e-52
WP_046670579.1|3707891_3708671_-	heme ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	26.8	1.3e-10
>prophage 281
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	3713969	3720387	4695344		Pandoravirus(33.33%)	4	NA	NA
WP_003030555.1|3713969_3715016_-	3-deoxy-7-phosphoheptulonate synthase AroH	NA	A0A0B5IW14	Pandoravirus	47.1	8.8e-82
WP_003030553.1|3715142_3715976_-	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_032935925.1|3716303_3718682_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.3	3.9e-170
WP_096890456.1|3718749_3720387_-	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	29.9	1.2e-32
>prophage 282
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	3740860	3745951	4695344		Lake_Baikal_phage(33.33%)	5	NA	NA
WP_003029385.1|3740860_3741229_+	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	5.6e-15
WP_003029384.1|3741237_3742725_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_003029383.1|3742741_3743488_+	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	25.0	3.0e-07
WP_003836582.1|3743462_3744734_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_046670591.1|3744730_3745951_+	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	42.6	5.6e-96
>prophage 283
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	3754739	3764973	4695344		Escherichia_phage(50.0%)	8	NA	NA
WP_046670595.1|3754739_3755762_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	34.2	6.1e-27
WP_003029361.1|3755754_3756423_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003029358.1|3756444_3757257_+	methionine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_046670596.1|3757465_3757882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003843488.1|3757850_3758819_-	hypothetical protein	NA	A0A2H4J6N0	uncultured_Caudovirales_phage	25.2	2.7e-16
WP_162648707.1|3760157_3763223_-	tetrathionate reductase subunit TtrA	NA	A0A077SK27	Escherichia_phage	26.4	9.4e-07
WP_086529208.1|3763215_3764238_-	tetrathionate reductase subunit TtrC	NA	NA	NA	NA	NA
WP_003029352.1|3764238_3764973_-	tetrathionate reductase subunit TtrB	NA	A0A077SL61	Escherichia_phage	40.0	8.5e-23
>prophage 284
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	3771865	3776412	4695344		Escherichia_phage(33.33%)	6	NA	NA
WP_046670786.1|3771865_3772534_+	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.8	4.1e-24
WP_162648709.1|3772530_3773316_+	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_032947969.1|3773319_3774132_+	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	32.5	6.8e-05
WP_162648711.1|3774141_3774819_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_048216513.1|3774808_3775594_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003029322.1|3775593_3776412_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	43.6	2.3e-37
>prophage 285
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	3786346	3792167	4695344		Streptococcus_phage(33.33%)	5	NA	NA
WP_162648714.1|3786346_3787822_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	27.8	1.5e-15
WP_162648715.1|3787928_3789191_+	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	25.4	2.3e-20
WP_003029285.1|3789371_3790427_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_162648716.1|3790413_3791418_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_162648717.1|3791414_3792167_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	2.3e-07
>prophage 286
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	3800808	3807847	4695344	transposase,tRNA	Escherichia_phage(33.33%)	5	NA	NA
WP_063841712.1|3800808_3801789_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	5.2e-185
WP_032935863.1|3802979_3803984_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003029251.1|3804185_3805970_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	35.0	2.8e-19
WP_044712332.1|3806089_3807199_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_003843523.1|3807364_3807847_-	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	41.4	1.9e-23
>prophage 287
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	3814466	3825508	4695344		Bodo_saltans_virus(16.67%)	11	NA	NA
WP_003836466.1|3814466_3815165_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	29.4	8.7e-09
WP_048216502.1|3815204_3816578_-	multidrug efflux MATE transporter MdtK	NA	NA	NA	NA	NA
WP_003832752.1|3816795_3817443_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	37.3	1.2e-23
WP_044699909.1|3817484_3818633_-	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	44.9	1.6e-84
WP_003836456.1|3818923_3820129_-	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_003029215.1|3820242_3821175_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003029211.1|3821171_3822197_-	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.3	8.2e-32
WP_003029209.1|3822494_3822584_+	stress response protein YnhF	NA	NA	NA	NA	NA
WP_003029207.1|3822759_3823929_+	MFS transporter	NA	NA	NA	NA	NA
WP_003029205.1|3823968_3824550_-	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	3.4e-43
WP_003029203.1|3824677_3825508_-	C40 family peptidase	NA	A0A2H5BM69	Streptomyces_phage	41.6	2.4e-18
>prophage 288
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	3830610	3831135	4695344		Salmonella_phage(100.0%)	1	NA	NA
WP_003029187.1|3830610_3831135_+	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	1.7e-46
>prophage 289
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	3838053	3839328	4695344	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_003029168.1|3838053_3839328_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.6	6.5e-87
>prophage 290
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	3864346	3865648	4695344		Bacillus_phage(100.0%)	1	NA	NA
WP_046670790.1|3864346_3865648_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.8	6.8e-15
>prophage 291
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	3886776	3888986	4695344		Bacillus_phage(100.0%)	2	NA	NA
WP_003028928.1|3886776_3887499_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.6	1.1e-35
WP_162648729.1|3887495_3888986_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	30.3	4.1e-24
>prophage 292
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	3895643	3907544	4695344		Escherichia_phage(42.86%)	13	NA	NA
WP_003028918.1|3895643_3896258_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.0	4.0e-26
WP_046670656.1|3896300_3897155_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_003843596.1|3897156_3897774_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.1	2.1e-75
WP_162648730.1|3897784_3900223_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.3	2.0e-214
WP_085954018.1|3900371_3900680_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_016150222.1|3900746_3901493_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_003032379.1|3901500_3902061_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_003032382.1|3902096_3902438_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_003032384.1|3902591_3902918_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.9	2.2e-23
WP_003032386.1|3903025_3904240_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.9	2.5e-48
WP_003836325.1|3904300_3905635_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_162648731.1|3905798_3907265_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.4	1.9e-45
WP_003032393.1|3907340_3907544_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	2.9e-13
>prophage 293
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	3912142	3913069	4695344		Bacillus_phage(100.0%)	1	NA	NA
WP_003836309.1|3912142_3913069_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.0	4.2e-19
>prophage 294
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	3917896	3922394	4695344		Cedratvirus(33.33%)	6	NA	NA
WP_061548256.1|3917896_3918694_+	urea ABC transporter ATP-binding protein UrtD	NA	A0A285PWH2	Cedratvirus	27.0	3.6e-11
WP_106107357.1|3918703_3919402_+	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	25.6	3.4e-13
WP_162648733.1|3919445_3920633_-	efflux MFS transporter YdeE	NA	NA	NA	NA	NA
WP_162648734.1|3920831_3921731_+	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
WP_003032422.1|3921761_3921980_-	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_003032424.1|3922010_3922394_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	3.6e-09
>prophage 295
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	3927696	3929274	4695344		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_046670672.1|3927696_3929274_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	21.1	1.6e-10
>prophage 296
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	3949466	3951206	4695344		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_110248477.1|3949466_3951206_+	type I secretion system permease/ATPase	NA	F2Y1V6	Organic_Lake_phycodnavirus	29.8	7.7e-14
>prophage 297
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	3956663	3958607	4695344		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_003019994.1|3956663_3958607_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.8	1.0e-11
>prophage 298
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	3964496	3966411	4695344		Planktothrix_phage(100.0%)	2	NA	NA
WP_003020012.1|3964496_3965483_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.5	7.2e-17
WP_048216466.1|3965475_3966411_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.2	1.8e-14
>prophage 299
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	3977285	3979683	4695344		Streptococcus_phage(50.0%)	2	NA	NA
WP_162648741.1|3977285_3979001_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1B0RXA0	Streptococcus_phage	26.1	3.2e-36
WP_054528391.1|3979080_3979683_-	inorganic diphosphatase	NA	A0A1B1ISK6	uncultured_Mediterranean_phage	39.1	4.5e-22
>prophage 300
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	3986037	3987120	4695344		Enterobacteria_phage(100.0%)	1	NA	NA
WP_003836220.1|3986037_3987120_+	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	70.4	4.2e-143
>prophage 301
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	3995210	3996755	4695344		Escherichia_phage(100.0%)	1	NA	NA
WP_003020103.1|3995210_3996755_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.5	1.1e-19
>prophage 302
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	4006836	4007610	4695344		Bacillus_virus(100.0%)	1	NA	NA
WP_003836184.1|4006836_4007610_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.0	1.7e-18
>prophage 303
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	4011510	4016702	4695344	transposase	Escherichia_phage(50.0%)	4	NA	NA
WP_000019445.1|4011510_4012491_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
WP_162648745.1|4012536_4013655_-	amidohydrolase	NA	NA	NA	NA	NA
WP_003836173.1|4013654_4014653_-	MsnO8 family LLM class oxidoreductase	NA	NA	NA	NA	NA
WP_046670710.1|4015160_4016702_+	methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	52.6	8.3e-36
>prophage 304
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	4037465	4041891	4695344		Mycoplasma_phage(50.0%)	4	NA	NA
WP_058842662.1|4037465_4038482_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.4	1.5e-25
WP_003020212.1|4038498_4039644_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003843728.1|4039972_4041382_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_123924900.1|4041474_4041891_-	type II toxin-antitoxin system HicB family antitoxin	NA	F1C593	Cronobacter_phage	55.6	6.9e-30
>prophage 305
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	4045339	4047301	4695344		Phage_TP(100.0%)	1	NA	NA
WP_048217777.1|4045339_4047301_-	U32 family peptidase	NA	Q6DW11	Phage_TP	27.8	2.1e-23
>prophage 306
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	4069159	4072136	4695344		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_046670731.1|4069159_4070848_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.2	1.4e-15
WP_003020293.1|4071017_4072136_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.6	3.6e-33
>prophage 307
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	4078890	4081284	4695344		Salmonella_phage(33.33%)	3	NA	NA
WP_046670733.1|4078890_4080159_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	77.9	2.9e-196
WP_003020321.1|4080161_4080581_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	58.5	3.9e-33
WP_044700084.1|4080753_4081284_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	1.4e-19
>prophage 308
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	4086086	4089989	4695344		Klosneuvirus(100.0%)	1	NA	NA
WP_046670738.1|4086086_4089989_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.7	7.6e-54
>prophage 309
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	4094930	4095920	4695344		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_003020354.1|4094930_4095920_+	2-hydroxyacid dehydrogenase	NA	M1HMI7	Paramecium_bursaria_Chlorella_virus	42.8	3.3e-70
>prophage 310
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	4100898	4113389	4695344	tRNA	Enterobacteria_phage(12.5%)	11	NA	NA
WP_032935630.1|4100898_4102053_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	56.7	1.5e-114
WP_003020366.1|4102198_4102411_+	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_003020369.1|4102492_4102927_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.1	9.4e-30
WP_046670740.1|4103125_4104061_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	93.8	1.4e-139
WP_046670742.1|4104154_4105528_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	5.1e-53
WP_003020379.1|4106000_4106984_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_016150306.1|4107136_4108246_-	hypothetical protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	23.0	2.8e-09
WP_003843936.1|4108657_4110772_+	bifunctional diguanylate cyclase/phosphodiesterase	NA	G3MA91	Bacillus_virus	31.0	3.4e-16
WP_003843938.1|4110839_4112072_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	34.4	9.0e-17
WP_003843940.1|4112084_4112648_-	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_003840811.1|4112873_4113389_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	54.5	1.2e-23
>prophage 311
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	4117059	4119016	4695344		Tupanvirus(50.0%)	3	NA	NA
WP_003843945.1|4117059_4117569_-	zinc-binding dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	42.9	2.1e-28
WP_046670747.1|4117741_4118125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003843948.1|4118245_4119016_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	29.1	6.6e-18
>prophage 312
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	4131303	4132386	4695344		Planktothrix_phage(100.0%)	1	NA	NA
WP_162648752.1|4131303_4132386_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	7.3e-23
>prophage 313
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	4151121	4152922	4695344		Planktothrix_phage(50.0%)	2	NA	NA
WP_003020556.1|4151121_4152114_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	24.7	4.7e-08
WP_003020558.1|4152115_4152922_+	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	27.4	1.3e-13
>prophage 314
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	4156312	4158247	4695344		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_016150330.1|4156312_4158247_+	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	24.5	4.5e-07
>prophage 315
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	4166148	4166739	4695344		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003020601.1|4166148_4166739_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.4	7.7e-43
>prophage 316
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	4171583	4176971	4695344	protease	Tupanvirus(50.0%)	4	NA	NA
WP_162648757.1|4171583_4174181_-	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.7	2.5e-85
WP_003020616.1|4174579_4174831_+	YciN family protein	NA	NA	NA	NA	NA
WP_003843986.1|4174941_4175988_-|protease	protease SohB	protease	NA	NA	NA	NA
WP_003843987.1|4176209_4176971_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.7	3.0e-07
>prophage 317
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	4181949	4188422	4695344		Acinetobacter_phage(66.67%)	5	NA	NA
WP_003020639.1|4181949_4183545_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.6	3.2e-51
WP_136397635.1|4183548_4184907_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	7.8e-38
WP_003020645.1|4184917_4186111_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_162648758.1|4186110_4186917_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_003841287.1|4186949_4188422_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.4	8.2e-17
>prophage 318
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	4197413	4200310	4695344		Lactobacillus_phage(33.33%)	3	NA	NA
WP_003020693.1|4197413_4198250_-	ion transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	40.0	1.4e-08
WP_003020696.1|4198295_4199300_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.2	6.8e-15
WP_003833364.1|4199296_4200310_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	29.4	4.5e-14
>prophage 319
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	4208741	4219162	4695344		Citrobacter_phage(25.0%)	10	NA	NA
WP_003020720.1|4208741_4209359_-	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	54.3	8.6e-53
WP_003020723.1|4209969_4210383_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_003020727.1|4210519_4211428_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.5	3.7e-60
WP_003020729.1|4211632_4212646_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_003020732.1|4212736_4213648_-	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_003020734.1|4213759_4214215_+	YchJ family protein	NA	NA	NA	NA	NA
WP_003020737.1|4214270_4215113_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	48.8	9.8e-15
WP_003020743.1|4216239_4216917_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_003020745.1|4216916_4217627_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_003020747.1|4217623_4219162_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.5	1.8e-19
>prophage 320
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	4232384	4236391	4695344		Cafeteria_roenbergensis_virus(50.0%)	5	NA	NA
WP_003020772.1|4232384_4233239_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	38.8	2.4e-45
WP_003020775.1|4233274_4234084_-	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_003020779.1|4234086_4234479_-	SirB family protein	NA	NA	NA	NA	NA
WP_162648760.1|4234475_4235309_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_106108095.1|4235308_4236391_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	38.8	4.3e-07
>prophage 321
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	4239638	4245378	4695344		Tupanvirus(33.33%)	4	NA	NA
WP_001518537.1|4239638_4240586_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	8.6e-44
WP_003020797.1|4240710_4242393_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	22.5	1.3e-21
WP_096878375.1|4242513_4243977_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_096878374.1|4243992_4245378_-	diaminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.6	3.0e-29
>prophage 322
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	4258286	4259018	4695344		Enterobacteria_phage(100.0%)	1	NA	NA
WP_003020862.1|4258286_4259018_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	50.3	2.4e-54
>prophage 323
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	4273091	4273853	4695344		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_046671111.1|4273091_4273853_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.1	7.5e-14
>prophage 324
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	4297211	4304561	4695344	tRNA	Staphylococcus_phage(25.0%)	7	NA	NA
WP_003020970.1|4297211_4298897_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	25.3	3.4e-35
WP_003020975.1|4299101_4299686_-	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_046671124.1|4299780_4300476_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	A0A0R6PI74	Moraxella_phage	35.4	5.8e-05
WP_003020980.1|4300534_4302445_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	33.1	9.1e-93
WP_003020984.1|4302585_4302930_+	RidA family protein	NA	NA	NA	NA	NA
WP_003020986.1|4302936_4303116_-	YoaH family protein	NA	NA	NA	NA	NA
WP_046671126.1|4303199_4304561_+	aminodeoxychorismate synthase component 1	NA	S4VNU7	Pandoravirus	40.2	8.3e-40
>prophage 325
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	4308429	4309989	4695344		Moraxella_phage(100.0%)	1	NA	NA
WP_003844070.1|4308429_4309989_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	5.1e-41
>prophage 326
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	4317486	4317696	4695344		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|4317486_4317696_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 327
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	4322969	4325018	4695344		Moraxella_phage(100.0%)	1	NA	NA
WP_003034960.1|4322969_4325018_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.7	1.2e-87
>prophage 328
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	4332464	4336951	4695344		Escherichia_phage(33.33%)	7	NA	NA
WP_003034937.1|4332464_4333106_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.5	8.7e-56
WP_003034934.1|4333518_4333857_-	YebY family protein	NA	NA	NA	NA	NA
WP_032935389.1|4333877_4334750_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_003034928.1|4334753_4335128_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_003034925.1|4335271_4335502_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	1.0e-14
WP_003841657.1|4335608_4336265_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_003833802.1|4336288_4336951_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	31.1	9.1e-08
>prophage 329
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	4344700	4346176	4695344		Cyanophage(100.0%)	1	NA	NA
WP_003034896.1|4344700_4346176_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.1	8.3e-78
>prophage 330
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	4350108	4356315	4695344		Bacillus_virus(50.0%)	7	NA	NA
WP_003034883.1|4350108_4351428_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	36.8	1.2e-14
WP_003844151.1|4351443_4352388_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_046671223.1|4352466_4353222_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	5.0e-18
WP_003034874.1|4353218_4354004_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_003034872.1|4354082_4355093_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.4	1.6e-08
WP_003844153.1|4355101_4355713_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_003034867.1|4355793_4356315_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.6e-10
>prophage 331
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	4360168	4366715	4695344	tRNA	Escherichia_coli_phage(33.33%)	7	NA	NA
WP_069219593.1|4360168_4360987_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	79.5	1.0e-56
WP_003034689.1|4361039_4361435_+	membrane protein	NA	NA	NA	NA	NA
WP_003034686.1|4361475_4362219_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	31.3	3.2e-25
WP_003839177.1|4362215_4363184_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_032936856.1|4363427_4364174_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_003034677.1|4364176_4364743_-	VOC family protein	NA	NA	NA	NA	NA
WP_162648773.1|4364981_4366715_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	34.1	7.5e-86
>prophage 332
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	4374727	4385788	4695344		Bacillus_thuringiensis_phage(40.0%)	7	NA	NA
WP_003034656.1|4374727_4375117_-	chemotaxis protein CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	31.3	1.3e-06
WP_003839158.1|4375134_4376184_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.0	1.8e-05
WP_003034649.1|4376180_4377053_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_003844172.1|4377072_4378674_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.9	1.2e-10
WP_032936849.1|4378717_4380373_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.8	1.2e-08
WP_003839151.1|4380779_4382051_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_162648774.1|4382161_4385788_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	24.7	1.3e-28
>prophage 333
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	4396181	4397696	4695344		Staphylococcus_phage(100.0%)	1	NA	NA
WP_032936845.1|4396181_4397696_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	26.6	6.2e-12
>prophage 334
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	4416304	4417057	4695344		Bacillus_virus(100.0%)	1	NA	NA
WP_003030477.1|4416304_4417057_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.4	6.4e-26
>prophage 335
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	4443775	4448040	4695344		Burkholderia_phage(50.0%)	4	NA	NA
WP_032936825.1|4443775_4444243_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	46.9	3.7e-32
WP_162648780.1|4444223_4445654_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.2	1.6e-102
WP_003839062.1|4445730_4446423_-	phosphohydrolase	NA	S4W232	Pandoravirus	27.1	8.0e-07
WP_069219584.1|4446864_4448040_+	porin	NA	Q1MVN1	Enterobacteria_phage	55.3	2.9e-105
>prophage 336
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	4453113	4453797	4695344		Bacillus_virus(100.0%)	1	NA	NA
WP_003030299.1|4453113_4453797_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.7	4.0e-27
>prophage 337
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	4458766	4459582	4695344		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
WP_003839037.1|4458766_4459582_-	energy-coupling factor ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	24.2	2.5e-07
>prophage 338
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	4473076	4473886	4695344		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_003030258.1|4473076_4473886_-	propanediol diffusion facilitator PduF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	27.8	1.7e-11
>prophage 339
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	4493542	4496197	4695344		Stx2-converting_phage(50.0%)	3	NA	NA
WP_032936755.1|4493542_4494715_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	86.7	1.1e-197
WP_003844268.1|4494854_4495622_-	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_003844270.1|4495618_4496197_-	thiosulfate reductase electron transport protein PhsB	NA	A0A077SL61	Escherichia_phage	38.0	2.1e-21
>prophage 340
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	4504161	4505061	4695344		Cellulophaga_phage(100.0%)	1	NA	NA
WP_003030161.1|4504161_4505061_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	97.4	4.8e-12
>prophage 341
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	4512644	4516480	4695344		Prochlorococcus_phage(33.33%)	3	NA	NA
WP_162648784.1|4512644_4513649_+	NAD-dependent epimerase	NA	A0A0K0KW07	Prochlorococcus_phage	31.7	3.3e-17
WP_151219744.1|4513708_4514875_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	55.3	1.5e-114
WP_162648785.1|4515073_4516480_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.5	1.8e-37
>prophage 342
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	4520808	4529520	4695344		Enterobacteria_phage(42.86%)	8	NA	NA
WP_162648789.1|4520808_4521930_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	28.3	3.2e-29
WP_162648790.1|4521943_4523182_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_162648791.1|4523229_4523778_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.2	1.2e-50
WP_162648792.1|4523779_4524658_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	5.1e-107
WP_162648793.1|4524708_4525608_-	dTDP-4-dehydrorhamnose reductase	NA	A0A140G5S3	Enterobacteria_phage	35.3	1.8e-30
WP_162648794.1|4525607_4526693_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.1	1.4e-98
WP_162648795.1|4527066_4527960_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	41.0	1.6e-44
WP_139935542.1|4528125_4529520_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	34.6	4.0e-21
>prophage 343
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	4534981	4541718	4695344		Bacillus_phage(25.0%)	6	NA	NA
WP_162648796.1|4534981_4536352_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	26.7	8.4e-32
WP_162648797.1|4536487_4537924_-	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	32.1	1.3e-54
WP_049002527.1|4537926_4539150_-	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_046670042.1|4539146_4539626_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_003841801.1|4539628_4540594_-	GDP-L-fucose synthase	NA	M1I5W5	Acanthocystis_turfacea_Chlorella_virus	51.6	6.9e-89
WP_088903297.1|4540596_4541718_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	65.5	2.4e-133
>prophage 344
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	4545464	4556103	4695344		Streptococcus_virus(20.0%)	9	NA	NA
WP_003844327.1|4545464_4545953_-	colanic acid biosynthesis acetyltransferase WcaB	NA	A0A191KBJ5	Streptococcus_virus	41.0	1.2e-09
WP_044711337.1|4545955_4546798_-	colanic acid biosynthesis glycosyltransferase WcaA	NA	NA	NA	NA	NA
WP_003841788.1|4546870_4549033_-	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.8	2.9e-18
WP_139935551.1|4549029_4549479_-	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_044711342.1|4549484_4550624_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_003841782.1|4551280_4552864_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	44.9	1.5e-37
WP_130714521.1|4552908_4554762_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_003036774.1|4554788_4555370_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	43.2	3.2e-33
WP_003036776.1|4555461_4556103_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	38.3	2.2e-35
>prophage 345
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	4566881	4580948	4695344	protease,tRNA	Bacillus_phage(25.0%)	10	NA	NA
WP_162648802.1|4566881_4569962_+	multidrug efflux RND transporter permease subunit MdtC	NA	S5VTK5	Leptospira_phage	22.7	7.6e-65
WP_049014337.1|4569958_4571371_+	MFS transporter	NA	NA	NA	NA	NA
WP_003844344.1|4571370_4572774_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.2	5.0e-32
WP_003036797.1|4572770_4573493_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	32.7	9.2e-30
WP_003841759.1|4573628_4573961_+	YegP family protein	NA	NA	NA	NA	NA
WP_003844346.1|4574120_4575482_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	92.9	4.1e-204
WP_003036804.1|4575751_4578028_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	1.4e-164
WP_003036810.1|4578058_4578379_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	3.5e-13
WP_003036813.1|4578702_4578927_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.7	3.6e-17
WP_003840216.1|4579001_4580948_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.8	2.4e-40
>prophage 346
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	4592197	4593916	4695344		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_003027264.1|4592197_4593916_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	23.8	8.9e-31
>prophage 347
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	4599629	4600358	4695344		Planktothrix_phage(100.0%)	1	NA	NA
WP_003027295.1|4599629_4600358_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.0	1.1e-27
>prophage 348
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	4603622	4608128	4695344		Catovirus(50.0%)	4	NA	NA
WP_003027310.1|4603622_4604522_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	28.6	2.8e-12
WP_003027312.1|4604544_4605597_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_162648805.1|4605849_4607127_+	MFS transporter	NA	NA	NA	NA	NA
WP_162648806.1|4607123_4608128_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	27.7	3.2e-12
>prophage 349
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	4619087	4627506	4695344	tRNA	Enterobacteria_phage(66.67%)	9	NA	NA
WP_003844377.1|4619087_4621121_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	4.0e-54
WP_046670055.1|4621327_4621786_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	67.3	1.5e-49
WP_003027346.1|4621828_4622299_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	76.9	4.9e-64
WP_003840155.1|4622345_4623065_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_003027348.1|4623061_4624747_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.6	6.7e-281
WP_003844381.1|4624972_4625704_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	93.5	1.8e-105
WP_003027354.1|4625755_4625863_+	protein YohO	NA	NA	NA	NA	NA
WP_162648807.1|4625843_4626575_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_071685240.1|4626558_4627506_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.2	7.1e-22
>prophage 350
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	4638271	4639006	4695344		Streptococcus_phage(100.0%)	1	NA	NA
WP_162648809.1|4638271_4639006_+	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	44.4	9.3e-54
>prophage 351
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	4653387	4654908	4695344		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_003027396.1|4653387_4654908_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	32.8	3.4e-10
>prophage 352
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	4658612	4662705	4695344		Cellulophaga_phage(50.0%)	3	NA	NA
WP_003027410.1|4658612_4659281_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.8	4.1e-56
WP_046670072.1|4659603_4660440_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_003840102.1|4660719_4662705_+	ligand-gated channel protein	NA	A0A0P0I887	Acinetobacter_phage	32.6	4.5e-10
>prophage 353
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	4666615	4667473	4695344		Catovirus(100.0%)	1	NA	NA
WP_016150659.1|4666615_4667473_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	32.8	4.4e-23
>prophage 354
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	4681159	4683076	4695344		Burkholderia_virus(100.0%)	1	NA	NA
WP_004864803.1|4681159_4683076_+	recombinase family protein	NA	Q6V7T7	Burkholderia_virus	29.9	9.0e-32
>prophage 355
NZ_CP048382	Citrobacter freundii strain 62 chromosome, complete genome	4695344	4687666	4694107	4695344	transposase	Streptococcus_phage(33.33%)	4	NA	NA
WP_099144804.1|4687666_4689805_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	33.0	8.4e-71
WP_023279773.1|4690547_4691516_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.6	2.9e-180
WP_001198019.1|4691858_4692797_-	cation transporter	NA	NA	NA	NA	NA
WP_007890845.1|4693492_4694107_+	recombinase family protein	NA	A0A0S2SXR4	Bacillus_phage	38.6	2.3e-05
>prophage 1
NZ_CP048383	Citrobacter freundii strain 62 plasmid p6_A, complete sequence	254268	0	7694	254268		Salmonella_phage(100.0%)	9	NA	NA
WP_007372340.1|1202_1688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009651680.1|1775_2093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016241545.1|2114_2513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007372341.1|2831_3059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007372342.1|3239_4163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007372343.1|4198_4522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007372345.1|4804_5023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016241542.1|5234_5501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007372347.1|6080_7694_+	HNH endonuclease	NA	A0A1S6KZY3	Salmonella_phage	37.0	2.2e-07
>prophage 2
NZ_CP048383	Citrobacter freundii strain 62 plasmid p6_A, complete sequence	254268	13553	49538	254268	integrase,transposase	Escherichia_phage(33.33%)	34	21687:21701	61718:61732
WP_162648829.1|13553_14534_-|transposase	IS5 family transposase	transposase	Q38213	Escherichia_phage	98.5	5.7e-184
WP_016241614.1|14641_15283_-	recombinase family protein	NA	NA	NA	NA	NA
WP_162648848.1|15450_15993_+	DUF4158 domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|15883_16588_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001000602.1|16780_17932_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	53.7	6.7e-99
WP_162648830.1|19119_20586_-	TolC family protein	NA	NA	NA	NA	NA
WP_162648831.1|20675_21290_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_162648832.1|21365_22475_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
21687:21701	attL	GTCGCTGCAGCAAAA	NA	NA	NA	NA
WP_162648833.1|22471_25582_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_162648834.1|25574_26405_+	oxidoreductase	NA	W8CYX9	Bacillus_phage	40.5	1.9e-07
WP_000019445.1|26505_27486_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
WP_000780222.1|27763_28045_-	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
WP_000493286.1|28025_28355_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
WP_000156887.1|29054_30077_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001114073.1|30766_31120_+	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.0	4.1e-23
WP_000783215.1|31167_31530_+	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_001556710.1|31547_33299_+	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_000922630.1|33346_34636_+	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	2.5e-171
WP_000065758.1|34648_35074_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.2e-50
WP_004118313.1|35104_35509_-	arsenic transporter ATPase	NA	NA	NA	NA	NA
WP_001556711.1|35517_36090_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	89.0	2.0e-83
WP_012817690.1|36253_39262_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	64.5	0.0e+00
WP_001752509.1|41163_41664_-	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_001067855.1|41990_42695_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_162648835.1|42731_43547_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_003132004.1|43543_43780_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_000995360.1|43776_44142_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_162648836.1|44159_45845_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	4.6e-40
WP_003131987.1|45916_46192_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_003131974.1|46204_46555_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_003131969.1|46626_47061_+	mercury resistance transcriptional regulator MerR	NA	NA	NA	NA	NA
WP_048227261.1|47884_48481_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_048227260.1|48531_48765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048227271.1|48761_49538_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.0	1.4e-52
61718:61732	attR	TTTTGCTGCAGCGAC	NA	NA	NA	NA
>prophage 3
NZ_CP048383	Citrobacter freundii strain 62 plasmid p6_A, complete sequence	254268	58550	60699	254268		Bacillus_phage(100.0%)	2	NA	NA
WP_106671846.1|58550_60026_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.5	3.6e-28
WP_001572351.1|60018_60699_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
>prophage 4
NZ_CP048383	Citrobacter freundii strain 62 plasmid p6_A, complete sequence	254268	64072	71320	254268		Leptospira_phage(33.33%)	5	NA	NA
WP_110246277.1|64072_67219_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
WP_106671853.1|67304_67745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143194471.1|67842_70311_+	Ag(+)-translocating P-type ATPase SilP	NA	E4ZFI9	Streptococcus_phage	34.5	1.4e-82
WP_000843494.1|70351_70549_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_106671857.1|70582_71320_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	31.9	1.3e-10
>prophage 5
NZ_CP048383	Citrobacter freundii strain 62 plasmid p6_A, complete sequence	254268	76373	79700	254268		Bacillus_phage(66.67%)	4	NA	NA
WP_008786781.1|76373_77054_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.8	1.3e-30
WP_008786782.1|77050_78451_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	27.3	6.4e-19
WP_008786783.1|78657_79092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008786784.1|79346_79700_+	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	51.9	2.8e-24
>prophage 6
NZ_CP048383	Citrobacter freundii strain 62 plasmid p6_A, complete sequence	254268	92634	98784	254268		Morganella_phage(50.0%)	8	NA	NA
WP_008786793.1|92634_93051_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	54.7	1.0e-36
WP_009652912.1|93050_94316_+	translesion error-prone DNA polymerase V subunit UmuC	NA	A0A1W6JNT0	Morganella_phage	60.6	9.8e-144
WP_007372144.1|94465_95356_+	DNA replication protein	NA	NA	NA	NA	NA
WP_127649377.1|95668_96049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001333498.1|96337_96595_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	65.7	8.3e-18
WP_000217395.1|96765_97257_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_007372145.1|97342_97834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008786797.1|98382_98784_+	hypothetical protein	NA	Q1MVE8	Enterobacteria_phage	69.9	3.5e-47
>prophage 7
NZ_CP048383	Citrobacter freundii strain 62 plasmid p6_A, complete sequence	254268	102067	170680	254268	integrase,transposase	Escherichia_phage(36.36%)	50	102158:102175	163805:163822
WP_063841712.1|102067_103048_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	5.2e-185
102158:102175	attL	ATTCTGCCATGGCAGAAT	NA	NA	NA	NA
WP_001548175.1|103908_106041_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_001549868.1|106042_107392_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_001549866.1|107388_108270_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000989158.1|108284_110204_-	TolC family protein	NA	NA	NA	NA	NA
WP_162648837.1|110280_123669_-	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_063841712.1|124216_125197_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	5.2e-185
WP_072146302.1|125800_125992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007372176.1|126198_126969_+	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_162648838.1|127072_128722_-	glycerone kinase	NA	NA	NA	NA	NA
WP_007372178.1|128796_130215_-	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
WP_007372179.1|130225_130858_-	dihydroxyacetone kinase ADP-binding subunit DhaL	NA	NA	NA	NA	NA
WP_007372180.1|130868_131939_-	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_007372182.1|132495_133593_+	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_007372183.1|133782_134061_-	dihydroxyacetone kinase	NA	NA	NA	NA	NA
WP_007372185.1|134621_135719_+	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_009653098.1|135808_137734_+	PTS-dependent dihydroxyacetone kinase operon transcriptional regulator DhaR	NA	NA	NA	NA	NA
WP_007372187.1|137711_138242_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_007372188.1|138242_138596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007372189.1|138612_139776_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_007372190.1|139798_140227_-	heme-binding protein	NA	NA	NA	NA	NA
WP_016241522.1|140619_142287_+	propanediol/glycerol family dehydratase large subunit	NA	NA	NA	NA	NA
WP_009652918.1|142298_142883_+	propanediol/glycerol family dehydratase medium subunit	NA	NA	NA	NA	NA
WP_007372193.1|142885_143314_+	diol dehydratase small subunit	NA	NA	NA	NA	NA
WP_007372194.1|143324_145136_+	diol dehydratase reactivase subunit alpha	NA	NA	NA	NA	NA
WP_007372195.1|145189_145993_+	aquaporin	NA	M1HJ75	Acanthocystis_turfacea_Chlorella_virus	31.5	2.1e-14
WP_024196074.1|146044_146374_-	acid-activated periplasmic chaperone HdeB	NA	NA	NA	NA	NA
WP_023157605.1|146612_147929_+|integrase	site-specific integrase	integrase	A0A248SL35	Klebsiella_phage	30.5	4.1e-36
WP_016154572.1|147993_148548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162648839.1|149175_150180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077695998.1|150457_150565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077695999.1|150598_150787_-	hypothetical protein	NA	Q71TE9	Escherichia_phage	51.2	4.1e-06
WP_006812027.1|150995_151232_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_111963071.1|151365_152775_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_162648840.1|152911_153538_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_006809979.1|153610_154105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162648841.1|154139_157271_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.5	1.2e-73
WP_162648842.1|157270_158695_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_021569984.1|158684_160394_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	27.9	8.5e-42
WP_019077728.1|160662_161124_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001581470.1|161186_161789_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_019077727.1|161832_162528_+	B3/4 domain-containing protein	NA	NA	NA	NA	NA
WP_000019445.1|162931_163912_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
163805:163822	attR	ATTCTGCCATGGCAGAAT	NA	NA	NA	NA
WP_162648843.1|163910_164171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049043034.1|164534_165743_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	48.9	5.1e-49
WP_001247776.1|166069_166333_-|transposase	transposase	transposase	A0A218MNG9	uncultured_virus	41.0	6.3e-05
WP_001295708.1|166347_166611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000643630.1|166839_167121_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000350437.1|167155_167725_+	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_162648844.1|167830_170680_+	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.4	2.4e-129
>prophage 8
NZ_CP048383	Citrobacter freundii strain 62 plasmid p6_A, complete sequence	254268	175208	211474	254268	protease,transposase	Escherichia_phage(27.27%)	39	NA	NA
WP_000786816.1|175208_175649_+	heat resistance system thioredoxin Trx-GI	NA	A0A023NHA9	Dinoroseobacter_phage	34.7	2.6e-11
WP_019077719.1|175652_177368_+	heat resistance system K+/H+ antiporter KefB-GI	NA	NA	NA	NA	NA
WP_000843382.1|177364_177862_+	heat resistance protein PsiE-GI	NA	NA	NA	NA	NA
WP_162648845.1|177839_178805_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_000323729.1|178829_179981_+|protease	trypsin-like serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.3	7.5e-26
WP_016154552.1|181896_182760_+	GTPase family protein	NA	NA	NA	NA	NA
WP_001548934.1|182851_183673_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.7	4.7e-46
WP_001548933.1|183889_184591_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_001115854.1|184627_184864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103468661.1|184863_185304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032200803.1|185329_185797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194654.1|185873_186113_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_000211838.1|186210_186669_+	antirestriction protein	NA	NA	NA	NA	NA
WP_000811693.1|186684_187161_+	RadC family protein	NA	NA	NA	NA	NA
WP_001548171.1|187169_187391_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	38.9	3.1e-05
WP_006812013.1|187410_187728_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_006812012.1|187748_188090_+	toxin	NA	NA	NA	NA	NA
WP_007372197.1|188291_188696_+	FCD domain-containing protein	NA	NA	NA	NA	NA
WP_009652914.1|188722_189109_-	plasmid stability protein	NA	NA	NA	NA	NA
WP_007372199.1|189122_190085_-	plasmid stabilization protein	NA	A0A222YXF2	Escherichia_phage	41.1	9.6e-59
WP_001254932.1|191332_192484_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_009652923.1|193403_193718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099531012.1|194004_194280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001515737.1|195933_197211_-	serine dehydratase subunit alpha family protein	NA	NA	NA	NA	NA
WP_000948259.1|197558_198200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449980.1|198199_199138_-	MCE family protein	NA	NA	NA	NA	NA
WP_000254595.1|199139_199943_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.7	1.8e-10
WP_001325018.1|199936_201082_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001515736.1|201195_201447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|201505_202210_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_162648846.1|202286_202454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063841712.1|203833_204814_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	5.2e-185
WP_016241569.1|204909_205341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009652897.1|206217_206907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007372259.1|207501_208065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007372260.1|208299_208494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007372261.1|208615_208867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001254932.1|210052_211204_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_001547737.1|211123_211474_-|transposase	transposase	transposase	Q716C1	Shigella_phage	97.7	5.2e-39
>prophage 9
NZ_CP048383	Citrobacter freundii strain 62 plasmid p6_A, complete sequence	254268	215410	224050	254268		Salmonella_phage(25.0%)	15	NA	NA
WP_007372267.1|215410_216004_+	hypothetical protein	NA	J9Q753	Salmonella_phage	34.5	1.4e-07
WP_007372268.1|216096_216363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007372269.1|216471_216930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007372270.1|216965_217442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007372271.1|217516_217792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007372272.1|217906_218179_+	hypothetical protein	NA	A0A192YCJ5	Morganella_phage	37.2	1.5e-09
WP_016241563.1|218333_218639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007372274.1|218651_218945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016241562.1|219039_221112_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	24.4	1.7e-44
WP_016241561.1|221132_221453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024196082.1|221540_221963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024196081.1|222235_222631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016241560.1|222812_223004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007372278.1|223134_223830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032155220.1|223852_224050_+	restriction alleviation protein, Lar family	NA	A0A0U2QQP4	Escherichia_phage	48.4	2.6e-11
>prophage 10
NZ_CP048383	Citrobacter freundii strain 62 plasmid p6_A, complete sequence	254268	227799	229354	254268		Erwinia_phage(50.0%)	3	NA	NA
WP_016241558.1|227799_227958_+	hypothetical protein	NA	A0A2P1JU39	Erwinia_phage	58.3	1.7e-05
WP_007372288.1|228112_228667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007372289.1|228736_229354_+	hypothetical protein	NA	A0A076G6Q2	Escherichia_phage	53.4	4.1e-63
>prophage 11
NZ_CP048383	Citrobacter freundii strain 62 plasmid p6_A, complete sequence	254268	238550	239393	254268		Salmonella_phage(100.0%)	1	NA	NA
WP_007372307.1|238550_239393_+	HNH endonuclease	NA	G0X580	Salmonella_phage	39.5	1.8e-16
>prophage 12
NZ_CP048383	Citrobacter freundii strain 62 plasmid p6_A, complete sequence	254268	243272	252411	254268	transposase	Salmonella_phage(71.43%)	9	NA	NA
WP_007372313.1|243272_244277_+	peptide transporter	NA	A0A1B0V750	Salmonella_phage	27.2	3.0e-18
WP_008786583.1|244400_244802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007372314.1|244773_246474_+	AAA family ATPase	NA	A0A172JHZ0	Bacillus_phage	36.7	3.5e-96
WP_162648847.1|246900_247101_+	hypothetical protein	NA	A0A1V0E5M0	Salmonella_phage	77.1	3.3e-14
WP_023279773.1|247126_248095_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.6	2.9e-180
WP_079828476.1|248147_248390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016241550.1|248501_248927_+	hypothetical protein	NA	A0A0K1YBA5	Cronobacter_phage	42.8	1.6e-26
WP_007372337.1|249080_249800_+	HNH endonuclease	NA	G0X580	Salmonella_phage	39.5	2.2e-07
WP_007372338.1|251328_252411_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	56.5	1.1e-79
>prophage 1
NZ_CP048384	Citrobacter freundii strain 62 plasmid p6_B, complete sequence	190655	105744	172702	190655	transposase,integrase	Escherichia_phage(23.08%)	56	170434:170449	175354:175369
WP_022542389.1|105744_106749_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|109666_110371_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|110560_111376_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|111526_112231_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000480968.1|112291_113128_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|113127_113931_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_001043265.1|113991_114807_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	3.5e-09
WP_162648852.1|115020_116451_+|transposase	IS4-like element IS50R family transposase	transposase	Q9JMP3	Wolbachia_phage	27.1	4.5e-36
WP_000240536.1|116657_117509_-	replication protein	NA	NA	NA	NA	NA
WP_001067855.1|118264_118969_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000381802.1|119144_119678_-	aminoglycoside nucleotidyltransferase ANT(2'')-Ia	NA	NA	NA	NA	NA
WP_113979304.1|119839_120757_-|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	59.5	7.4e-101
WP_000845048.1|120883_121897_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_162620314.1|122195_122561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162620312.1|123800_124364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111231099.1|125254_125773_-	DUF1566 domain-containing protein	NA	NA	NA	NA	NA
WP_012585400.1|126006_126255_+	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_003159185.1|126383_126950_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	54.3	7.9e-45
WP_000845048.1|127296_128310_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001083725.1|128454_128952_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_001336345.1|129063_129354_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001206356.1|129359_130151_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000679427.1|130314_130662_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001445937.1|131729_132686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152391.1|133220_134936_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_004152392.1|135045_138075_+|transposase	IS3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
WP_004199214.1|138181_139207_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_004152394.1|139203_139983_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004199234.1|140270_141152_+	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_004152397.1|141401_142721_-|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_004152398.1|142997_144182_-|transposase	ISAs1-like element ISKpn31 family transposase	transposase	NA	NA	NA	NA
WP_004152400.1|144685_145045_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	62.0	3.6e-19
WP_004152402.1|146210_146831_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	31.5	2.0e-09
WP_004152403.1|146919_149817_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.7	2.7e-181
WP_001067855.1|149889_150594_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_161469620.1|151644_152670_+|transposase	IS630 family transposase	transposase	M4M9P8	Vibrio_phage	67.4	2.1e-11
WP_000027057.1|153443_154304_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_000935452.1|154871_156176_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001300294.1|156214_156883_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000993386.1|156918_157155_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277456.1|157151_157514_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_162648853.1|157531_159217_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.5	9.6e-38
WP_000522996.1|159255_159681_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732275.1|159708_159984_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294656.1|159999_160365_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_001166628.1|160436_160892_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000787563.1|162238_162511_+	MafI family immunity protein	NA	NA	NA	NA	NA
WP_011872911.1|162805_163105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111231093.1|164387_165824_+|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	27.1	1.7e-35
WP_162648854.1|166455_167304_+	CTX-M family class A extended-spectrum beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	84.2	1.7e-123
WP_162648855.1|167391_168822_+|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	27.1	2.6e-36
WP_000791469.1|169240_169693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000278322.1|169708_170311_-	hypothetical protein	NA	NA	NA	NA	NA
170434:170449	attL	TAATTATGATAATTAC	NA	NA	NA	NA
WP_000575657.1|170572_170854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000949433.1|171152_171689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000543934.1|171691_172702_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K0N6I5	Gordonia_phage	31.9	3.1e-07
175354:175369	attR	TAATTATGATAATTAC	NA	NA	NA	NA
