The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP048376	Escherichia coli strain 38 chromosome, complete genome	4738863	248206	256801	4738863	integrase,transposase	Shigella_phage(50.0%)	7	236659:236673	262021:262035
236659:236673	attL	ATTGATAAAGCAATC	NA	NA	NA	NA
WP_000090707.1|248206_249049_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_085947917.1|249145_250419_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_000169527.1|250855_251155_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000878218.1|251151_252018_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_099975594.1|252136_253756_+|integrase	integrase core domain protein	integrase	NA	NA	NA	NA
WP_001049180.1|253755_255204_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_001324699.1|255244_256801_+|transposase	transposase	transposase	NA	NA	NA	NA
262021:262035	attR	ATTGATAAAGCAATC	NA	NA	NA	NA
>prophage 2
NZ_CP048376	Escherichia coli strain 38 chromosome, complete genome	4738863	1057615	1070798	4738863		Escherichia_phage(50.0%)	12	NA	NA
WP_001374723.1|1057615_1058377_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	2.0e-59
WP_000254708.1|1058370_1058997_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272592.1|1059136_1060276_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|1060338_1061331_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104456.1|1061424_1062789_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136918.1|1062877_1063654_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|1063658_1064297_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|1064293_1065556_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|1065552_1066461_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001272549.1|1066626_1067424_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	5.9e-70
WP_001141340.1|1067474_1068131_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	8.0e-49
WP_001272924.1|1068236_1070798_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 3
NZ_CP048376	Escherichia coli strain 38 chromosome, complete genome	4738863	1685008	1694450	4738863		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569361.1|1685008_1685935_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
WP_000783120.1|1685939_1686671_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1686651_1686759_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1686818_1687550_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1687771_1689457_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1689453_1690173_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1690219_1690690_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1690730_1691192_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001374182.1|1691316_1693317_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.3	0.0e+00
WP_001292773.1|1693313_1694450_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
>prophage 4
NZ_CP048376	Escherichia coli strain 38 chromosome, complete genome	4738863	2250215	2272782	4738863	integrase,tail,lysis	Escherichia_phage(26.67%)	26	2247427:2247440	2274042:2274055
2247427:2247440	attL	AAACATCTTCATCA	NA	NA	NA	NA
WP_000041556.1|2250215_2252642_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	7.7e-214
WP_001307224.1|2252840_2253146_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|2253253_2253964_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2253966_2254527_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|2254561_2254903_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|2255037_2255364_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|2255569_2256784_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836058.1|2256795_2257815_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001360138.1|2257872_2257983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000877001.1|2258002_2259283_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	6.6e-156
WP_001296941.1|2259317_2259554_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_001372999.1|2259641_2262113_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	59.8	6.1e-57
WP_001083281.1|2262206_2262398_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854559.1|2262394_2262583_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_072163420.1|2262666_2262909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054501.1|2262889_2263855_+	hypothetical protein	NA	U5P0A0	Shigella_phage	63.9	9.7e-59
WP_001373616.1|2263895_2264318_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	85.6	2.0e-61
WP_001678528.1|2264447_2265392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001678529.1|2265939_2267289_-	hypothetical protein	NA	A0A1W6JNS5	Morganella_phage	98.0	5.7e-259
WP_023147793.1|2267606_2268209_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E036	Clostridioides_phage	31.2	3.7e-08
WP_023147794.1|2268568_2269549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122083109.1|2270068_2270176_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
WP_001013632.1|2270220_2270433_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	2.0e-25
WP_000980999.1|2270648_2270900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023147795.1|2270966_2271245_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	7.4e-12
WP_072163404.1|2272656_2272782_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	82.5	1.5e-12
2274042:2274055	attR	TGATGAAGATGTTT	NA	NA	NA	NA
>prophage 5
NZ_CP048376	Escherichia coli strain 38 chromosome, complete genome	4738863	2675403	2686181	4738863	integrase	Enterobacteria_phage(40.0%)	11	2673376:2673399	2684884:2684907
2673376:2673399	attL	AACGGGCGTGTTATACGCCCGTTG	NA	NA	NA	NA
WP_000379042.1|2675403_2677359_-	AAA domain-containing protein	NA	K4I1H4	Acidithiobacillus_phage	28.6	7.5e-26
WP_001753331.1|2679723_2680263_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	65.6	7.5e-61
WP_072163463.1|2680445_2680757_+	recombinase	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	2.4e-43
WP_001372461.1|2680753_2681434_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	98.7	5.1e-131
WP_000149533.1|2681430_2681589_+	DUF1317 family protein	NA	M1FJ61	Enterobacteria_phage	88.5	6.4e-21
WP_001678641.1|2681585_2682650_+	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	64.8	1.7e-133
WP_001678640.1|2682803_2683022_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	94.4	3.2e-34
WP_000488406.1|2683069_2683309_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	94.9	3.9e-38
WP_000088653.1|2683448_2683685_+	excisionase	NA	NA	NA	NA	NA
WP_000741339.1|2683674_2684817_+|integrase	tyrosine-type recombinase/integrase	integrase	O21929	Phage_21	99.7	8.1e-206
WP_000444487.1|2684930_2686181_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
2684884:2684907	attR	CAACGGGCGTATAACACGCCCGTT	NA	NA	NA	NA
>prophage 6
NZ_CP048376	Escherichia coli strain 38 chromosome, complete genome	4738863	2814988	2856536	4738863	integrase,transposase	Stx2-converting_phage(37.5%)	32	2853961:2853975	2860152:2860166
WP_021513032.1|2814988_2815447_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	5.5e-12
WP_000976514.1|2816175_2817321_-	class C beta-lactamase CMY-2	NA	NA	NA	NA	NA
WP_000608644.1|2817644_2818907_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_000483766.1|2819172_2820519_-|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_000179884.1|2820874_2821051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032262852.1|2821294_2822074_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.2	1.3e-138
WP_122950705.1|2823806_2825345_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.2	2.1e-297
WP_000612601.1|2825394_2825742_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	99.1	1.1e-60
WP_021566758.1|2825738_2826119_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	1.2e-65
WP_000107485.1|2826573_2827587_-	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_000998346.1|2827598_2828915_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_000350265.1|2828942_2829863_-	ribokinase	NA	NA	NA	NA	NA
WP_001295538.1|2830168_2830951_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001387298.1|2830952_2831051_-	acetolactate synthase	NA	NA	NA	NA	NA
WP_121372241.1|2831663_2832892_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.3	9.1e-171
WP_154761740.1|2833194_2833332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032180018.1|2833494_2834130_+	galactarate dehydratase	NA	NA	NA	NA	NA
WP_001335688.1|2834211_2834649_+	galactarate dehydratase	NA	NA	NA	NA	NA
WP_000072197.1|2834711_2835536_-	aga operon transcriptional regulator AgaR	NA	NA	NA	NA	NA
WP_001544449.1|2835784_2836123_+	tagatose-1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000192271.1|2836236_2837808_+	PTS maltose transporter subunit IICB	NA	NA	NA	NA	NA
WP_032180015.1|2837819_2838995_+	putative C-S lyase	NA	NA	NA	NA	NA
WP_000757210.1|2839008_2840898_+	enterotoxin	NA	NA	NA	NA	NA
WP_024167628.1|2841066_2841273_-	methyltransferase	NA	NA	NA	NA	NA
WP_000622487.1|2841377_2842814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001333439.1|2842810_2847769_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_032180014.1|2848443_2849007_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000335695.1|2849827_2851261_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_032141622.1|2851479_2851677_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_001303889.1|2851921_2852218_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_100608376.1|2853329_2855147_+	hypothetical protein	NA	NA	NA	NA	NA
2853961:2853975	attL	AAAAAATAATTTCTG	NA	NA	NA	NA
WP_000279872.1|2855333_2856536_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	2.9e-44
WP_000279872.1|2855333_2856536_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	2.9e-44
2860152:2860166	attR	AAAAAATAATTTCTG	NA	NA	NA	NA
>prophage 7
NZ_CP048376	Escherichia coli strain 38 chromosome, complete genome	4738863	3073320	3082090	4738863	integrase	Salmonella_phage(90.0%)	12	3072990:3073003	3082132:3082145
3072990:3073003	attL	AAAACAATAAGTTA	NA	NA	NA	NA
WP_001376441.1|3073320_3073509_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	95.2	2.0e-24
WP_001376443.1|3073667_3076061_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	93.7	0.0e+00
WP_001544405.1|3076057_3076915_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.8	9.5e-159
WP_000752610.1|3076911_3077139_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	7.8e-36
WP_001244224.1|3077138_3077372_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	1.9e-32
WP_000996717.1|3077439_3077781_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_000956192.1|3077898_3078195_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	88.5	1.9e-21
WP_000460892.1|3078202_3078712_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
WP_000188448.1|3078744_3078966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001680871.1|3079111_3079990_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.4	1.7e-30
WP_001678408.1|3080001_3080946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001372563.1|3081037_3082090_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.4e-106
3082132:3082145	attR	TAACTTATTGTTTT	NA	NA	NA	NA
>prophage 8
NZ_CP048376	Escherichia coli strain 38 chromosome, complete genome	4738863	3161673	3184078	4738863	integrase,tail,transposase,lysis	Enterobacteria_phage(46.43%)	35	3163589:3163603	3184152:3184166
WP_001356070.1|3161673_3162963_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	3.4e-19
WP_000767389.1|3163021_3163498_+	kinase inhibitor	NA	NA	NA	NA	NA
3163589:3163603	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001753290.1|3164243_3165575_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	1.4e-20
WP_072163407.1|3165648_3165825_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	84.5	9.4e-21
WP_000239881.1|3165974_3166643_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001372490.1|3167533_3168094_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.8	4.9e-87
WP_000105084.1|3168482_3168716_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	94.4	7.3e-21
WP_000079508.1|3168772_3169183_+	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_001139678.1|3169534_3169687_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
WP_001228702.1|3169715_3169922_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	98.5	5.3e-31
WP_001372488.1|3170138_3170636_-	lysozyme	NA	A0A1B5FP97	Escherichia_phage	97.0	1.6e-89
WP_000839582.1|3170635_3170851_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	1.2e-33
WP_085947917.1|3171991_3173265_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_000592543.1|3173456_3174416_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_000780581.1|3174608_3175133_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	1.1e-48
WP_001204777.1|3175288_3175666_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.2	7.3e-55
WP_000971068.1|3175751_3175892_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	5.5e-08
WP_001372483.1|3175888_3176251_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	97.4	1.5e-60
WP_001372487.1|3176247_3176538_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	91.7	4.8e-46
WP_000224914.1|3176530_3176701_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001372486.1|3176700_3177156_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	5.9e-59
WP_072157016.1|3177152_3177254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000825400.1|3177346_3177799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000720581.1|3177795_3178356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000145917.1|3178840_3179134_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_162665608.1|3179130_3179385_-	hypothetical protein	NA	A0A0K2FIT1	Enterobacteria_phage	100.0	3.7e-34
WP_001372450.1|3179913_3180594_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	98.7	3.0e-131
WP_072126246.1|3180590_3180773_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	2.2e-28
WP_023148020.1|3180745_3180937_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.8e-26
WP_001395510.1|3180947_3181229_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	100.0	2.5e-47
WP_000763365.1|3181327_3181549_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	97.3	1.4e-34
WP_000120065.1|3181759_3182362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545745.1|3182604_3182772_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
WP_001303849.1|3182811_3183030_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533646.1|3183007_3184078_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	99.7	1.9e-201
3184152:3184166	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 9
NZ_CP048376	Escherichia coli strain 38 chromosome, complete genome	4738863	3671569	3687257	4738863	integrase,tail	Shigella_phage(37.5%)	18	3668673:3668732	3683342:3683401
3668673:3668732	attL	CTTATTGATTTAAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_000355482.1|3671569_3672343_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	37.7	4.1e-36
WP_072195243.1|3672412_3672541_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	84.6	1.7e-11
WP_086711726.1|3672595_3675739_-	GntR family transcriptional regulator	NA	K7PGT9	Enterobacteria_phage	57.4	9.3e-260
WP_001250269.1|3675728_3675908_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515846.1|3676083_3676641_-	protein YmfL	NA	S5FXP0	Shigella_phage	96.2	1.5e-96
WP_000205494.1|3676678_3676879_-	cell division protein	NA	NA	NA	NA	NA
WP_000450738.1|3676976_3677603_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	2.5e-47
WP_001312635.1|3677833_3678331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000135680.1|3678824_3679187_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081269.1|3679252_3680077_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	6.0e-150
WP_001371719.1|3680204_3680741_+	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.3	2.0e-98
WP_024176184.1|3680731_3681610_+	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2R2Z314	Escherichia_phage	92.4	5.3e-165
WP_000206058.1|3681606_3681951_+	hypothetical protein	NA	U5P0J0	Shigella_phage	80.7	2.0e-30
WP_000433939.1|3681950_3682301_+	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	100.0	4.9e-61
WP_000051887.1|3682177_3683341_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_000893260.1|3683545_3684799_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	1.7e-95
3683342:3683401	attR	CTTATTGATTTAAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285288.1|3684810_3685914_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|3686201_3687257_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
>prophage 10
NZ_CP048376	Escherichia coli strain 38 chromosome, complete genome	4738863	4073136	4079695	4738863	transposase	uncultured_Caudovirales_phage(16.67%)	7	NA	NA
WP_000684856.1|4073136_4074093_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000175457.1|4074093_4074861_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000177060.1|4075418_4075676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001254876.1|4076727_4077879_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.0	2.6e-42
WP_000747102.1|4077798_4078149_-|transposase	transposase	transposase	Q716C1	Shigella_phage	97.7	8.9e-39
WP_000227281.1|4078249_4078822_+	hypothetical protein	NA	Q858R9	Enterobacteria_phage	69.0	2.2e-71
WP_000594911.1|4078870_4079695_-	hypothetical protein	NA	L7TR00	Rhizobium_phage	35.5	3.0e-16
>prophage 11
NZ_CP048376	Escherichia coli strain 38 chromosome, complete genome	4738863	4480328	4516237	4738863	protease,integrase,tail,lysis,transposase	Escherichia_virus(22.73%)	40	4496225:4496271	4513449:4513495
WP_000208242.1|4480328_4480859_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001293341.1|4480868_4482200_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000139496.1|4482266_4483193_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872908.1|4483285_4483771_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001296623.1|4483855_4484101_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084268.1|4484526_4485372_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_000136782.1|4485394_4486903_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_001250644.1|4487035_4488046_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000796320.1|4488142_4488889_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_000323556.1|4488893_4489322_-	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000655986.1|4489348_4489648_-	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000155257.1|4489859_4490300_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000802226.1|4490400_4491000_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_001216325.1|4491107_4491875_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_001324361.1|4491929_4492685_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001045690.1|4492791_4493781_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000591795.1|4494100_4495063_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001076748.1|4495243_4496146_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
4496225:4496271	attL	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_000468308.1|4496382_4496601_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000014361.1|4497848_4498748_-	hypothetical protein	NA	Q7Y4D2	Escherichia_virus	99.7	4.0e-168
WP_085947917.1|4498831_4500104_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_000972099.1|4500299_4500827_-|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	88.6	5.1e-86
WP_060621264.1|4500828_4501830_-	hypothetical protein	NA	A0A0C4UQV0	Shigella_phage	91.7	1.2e-176
WP_060621266.1|4502353_4503139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001695629.1|4503210_4503663_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	98.7	5.3e-76
WP_000917174.1|4503655_4504123_-|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.7	1.9e-81
WP_000040662.1|4504230_4504656_-|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	98.6	5.5e-67
WP_060621267.1|4504643_4505069_-	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	92.9	3.4e-56
WP_000368931.1|4506358_4507432_+	ParB N-terminal domain-containing protein	NA	Q7Y4B3	Escherichia_virus	100.0	1.2e-203
WP_000570053.1|4507424_4508462_+	hypothetical protein	NA	Q7Y4B4	Escherichia_virus	100.0	4.6e-200
WP_001143634.1|4508458_4509397_-	DNA cytosine methyltransferase	NA	Q7Y4B5	Escherichia_virus	100.0	3.1e-187
WP_000554771.1|4509639_4509846_-	hypothetical protein	NA	Q2P9X3	Enterobacteria_phage	97.0	2.4e-31
WP_001600138.1|4509845_4510298_-	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	96.7	1.4e-79
WP_000217670.1|4510894_4511395_-	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000453534.1|4511564_4511837_-	hypothetical protein	NA	Q1JS44	Enterobacteria_phage	100.0	1.5e-46
WP_001192857.1|4511989_4512283_+	helix-turn-helix domain-containing protein	NA	Q1JS45	Enterobacteria_phage	100.0	1.0e-48
WP_000023386.1|4512352_4513333_+|integrase	tyrosine-type recombinase/integrase	integrase	U5N0A8	Enterobacteria_phage	99.7	2.3e-185
WP_001223800.1|4513518_4514019_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
4513449:4513495	attR	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_001033722.1|4514168_4514867_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|4514863_4516237_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
>prophage 1
NZ_CP048377	Escherichia coli strain 38 plasmid p38_A-OXA140, complete sequence	86996	1262	64260	86996	integrase,transposase,protease	Macacine_betaherpesvirus(35.71%)	48	NA	NA
WP_001066942.1|1262_2003_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_032156742.1|2123_2249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001072355.1|3448_4618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086258557.1|4813_5008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000088605.1|5859_6483_-	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_001089068.1|6564_7770_+	tetracycline efflux MFS transporter Tet(B)	NA	NA	NA	NA	NA
WP_000428546.1|7882_8476_-	tetracyline resistance-associated transcriptional repressor TetC	NA	NA	NA	NA	NA
WP_001067855.1|8609_9314_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000376616.1|9888_10092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|10219_11059_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|11052_11400_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000503573.1|11605_12394_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_001389366.1|12524_12998_-	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_000845048.1|13155_14169_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001067855.1|14570_15275_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_023408309.1|15833_16646_+	subclass B1 metallo-beta-lactamase NDM-5	NA	NA	NA	NA	NA
WP_004201167.1|16649_17015_+	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_004201168.1|17019_17658_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_004201169.1|17668_18700_-	twin-arginine translocation (TAT) pathway signal sequence domain protein	NA	NA	NA	NA	NA
WP_000050481.1|19012_20554_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_162665611.1|23095_23335_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_162665609.1|28496_28862_+	replication protein RepA	NA	NA	NA	NA	NA
WP_000616807.1|29801_30455_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000557619.1|30547_30805_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_001398199.1|30737_31139_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_001067855.1|33683_34388_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_063840321.1|34531_35086_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001334766.1|35216_36047_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_162665610.1|36721_37378_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	98.6	3.1e-125
WP_001393253.1|39699_40032_+	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_000239590.1|40078_40954_-	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_031943482.1|42642_42717_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000083850.1|45532_45787_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_023144756.1|46083_46218_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_013023861.1|47088_47301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000139341.1|47431_47992_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_000218642.1|49767_49998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001027516.1|53366_53558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000271753.1|53554_53977_-	DUF1380 family protein	NA	NA	NA	NA	NA
WP_001671341.1|54023_54326_-	antirestriction protein	NA	NA	NA	NA	NA
WP_000274437.1|55692_56127_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001104873.1|56140_56362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000086185.1|56362_57046_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	5.1e-30
WP_001348615.1|57430_58333_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000817036.1|59199_60171_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	99.4	7.0e-174
WP_000772446.1|60170_61337_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_000852146.1|61924_62680_-	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	100.0	3.8e-143
WP_000016982.1|63453_64260_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	100.0	5.8e-57
>prophage 2
NZ_CP048377	Escherichia coli strain 38 plasmid p38_A-OXA140, complete sequence	86996	78434	85864	86996		Escherichia_phage(57.14%)	7	NA	NA
WP_031311986.1|78434_81551_-	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	24.0	2.9e-27
WP_001617890.1|81672_82956_-	restriction endonuclease subunit S	NA	F2Y1N5	Organic_Lake_phycodnavirus	26.5	2.2e-10
WP_001553856.1|82952_84509_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.5	7.1e-104
WP_001190712.1|84691_84913_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_001216034.1|84912_85293_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	100.0	1.1e-63
WP_001513661.1|85297_85477_+	hypothetical protein	NA	Q71TH5	Escherichia_phage	96.6	3.5e-23
WP_001513660.1|85504_85864_+	hypothetical protein	NA	A0A077SLM1	Escherichia_phage	98.9	5.0e-45
