The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP048344	Escherichia coli strain 124 chromosome, complete genome	4731258	1058702	1071885	4731258		Escherichia_phage(50.0%)	12	NA	NA
WP_001374723.1|1058702_1059464_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	2.0e-59
WP_000254708.1|1059457_1060084_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272592.1|1060223_1061363_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|1061425_1062418_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104456.1|1062511_1063876_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136918.1|1063964_1064741_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|1064745_1065384_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|1065380_1066643_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|1066639_1067548_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001272549.1|1067713_1068511_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	5.9e-70
WP_001141340.1|1068561_1069218_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	8.0e-49
WP_001272924.1|1069323_1071885_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 2
NZ_CP048344	Escherichia coli strain 124 chromosome, complete genome	4731258	1434291	1445320	4731258	lysis	Enterobacteria_phage(25.0%)	19	NA	NA
WP_000194515.1|1434291_1435725_-	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
WP_001274871.1|1435940_1436855_+	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_124039053.1|1436926_1438174_+	oligosaccharide MFS transporter	NA	NA	NA	NA	NA
WP_001163428.1|1438703_1438904_-	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_122633558.1|1439012_1439312_-	hypothetical protein	NA	G9L655	Escherichia_phage	98.0	3.0e-51
WP_106504540.1|1439411_1439654_-	DUF551 domain-containing protein	NA	A0A2I6PID9	Escherichia_phage	94.9	1.4e-43
WP_060621064.1|1439992_1440547_-	hypothetical protein	NA	Q9G078	Enterobacteria_phage	66.5	2.8e-63
WP_122641386.1|1440543_1441089_-	ead/Ea22-like family protein	NA	K7P6T4	Enterobacteria_phage	68.0	3.0e-81
WP_077896452.1|1441085_1441505_-	hypothetical protein	NA	G8C7K9	Escherichia_phage	81.9	7.9e-66
WP_122641387.1|1441501_1441666_-	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	96.3	1.2e-22
WP_162676756.1|1441749_1442019_+|lysis	lysis protein	lysis	Q716B4	Shigella_phage	96.5	2.6e-38
WP_032181221.1|1442006_1442159_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	94.0	1.5e-19
WP_000807785.1|1442523_1442766_+	DUF2560 family protein	NA	A0A0M4R322	Salmonella_phage	100.0	7.5e-37
WP_162676750.1|1442845_1443076_+	hypothetical protein	NA	Q716G8	Shigella_phage	100.0	4.7e-20
WP_122641402.1|1443514_1443700_+	hypothetical protein	NA	I6RSG3	Salmonella_phage	98.4	3.3e-08
WP_001036007.1|1443674_1443884_-	hypothetical protein	NA	I6R975	Salmonella_phage	98.6	5.9e-30
WP_001549440.1|1443880_1444117_-	Arc family DNA-binding protein	NA	G0ZNE9	Cronobacter_phage	59.2	2.2e-17
WP_001549438.1|1444205_1444379_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_122641400.1|1444441_1445320_+	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.6	2.9e-94
>prophage 3
NZ_CP048344	Escherichia coli strain 124 chromosome, complete genome	4731258	1698304	1707746	4731258		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569361.1|1698304_1699231_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
WP_000783120.1|1699235_1699967_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1699947_1700055_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1700114_1700846_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1701067_1702753_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1702749_1703469_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1703515_1703986_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1704026_1704488_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001374182.1|1704612_1706613_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.3	0.0e+00
WP_001292773.1|1706609_1707746_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
>prophage 4
NZ_CP048344	Escherichia coli strain 124 chromosome, complete genome	4731258	2265540	2283285	4731258	integrase,lysis,tail	Enterobacteria_phage(21.43%)	21	2257930:2257943	2284545:2284558
2257930:2257943	attL	AAACATCTTCATCA	NA	NA	NA	NA
WP_000598292.1|2265540_2265867_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|2266072_2267287_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836058.1|2267298_2268318_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001360138.1|2268375_2268486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000877001.1|2268505_2269786_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	6.6e-156
WP_001296941.1|2269820_2270057_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_001372999.1|2270144_2272616_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	59.8	6.1e-57
WP_001083281.1|2272709_2272901_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854559.1|2272897_2273086_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_072163420.1|2273169_2273412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054501.1|2273392_2274358_+	hypothetical protein	NA	U5P0A0	Shigella_phage	63.9	9.7e-59
WP_001373616.1|2274398_2274821_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	85.6	2.0e-61
WP_124039036.1|2274956_2275895_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_001678529.1|2276442_2277792_-	hypothetical protein	NA	A0A1W6JNS5	Morganella_phage	98.0	5.7e-259
WP_023147793.1|2278109_2278712_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E036	Clostridioides_phage	31.2	3.7e-08
WP_023147794.1|2279071_2280052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122083109.1|2280571_2280679_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
WP_001013632.1|2280723_2280936_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	2.0e-25
WP_000980999.1|2281151_2281403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023147795.1|2281469_2281748_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	7.4e-12
WP_072163404.1|2283159_2283285_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	82.5	1.5e-12
2284545:2284558	attR	TGATGAAGATGTTT	NA	NA	NA	NA
>prophage 5
NZ_CP048344	Escherichia coli strain 124 chromosome, complete genome	4731258	2689945	2696675	4731258	integrase	Enterobacteria_phage(37.5%)	9	2683879:2683902	2695378:2695401
2683879:2683902	attL	AACGGGCGTGTTATACGCCCGTTG	NA	NA	NA	NA
WP_162676751.1|2689945_2690227_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	85.4	2.6e-12
WP_162676757.1|2690940_2691252_+	recombinase	NA	A0A0N7KZJ3	Stx2-converting_phage	98.9	1.2e-42
WP_000149533.1|2691924_2692083_+	DUF1317 family protein	NA	M1FJ61	Enterobacteria_phage	88.5	6.4e-21
WP_001678641.1|2692079_2693144_+	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	64.8	1.7e-133
WP_001678640.1|2693297_2693516_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	94.4	3.2e-34
WP_000488406.1|2693563_2693803_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	94.9	3.9e-38
WP_000088653.1|2693942_2694179_+	excisionase	NA	NA	NA	NA	NA
WP_000741339.1|2694168_2695311_+|integrase	tyrosine-type recombinase/integrase	integrase	O21929	Phage_21	99.7	8.1e-206
WP_000444487.1|2695424_2696675_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
2695378:2695401	attR	CAACGGGCGTATAACACGCCCGTT	NA	NA	NA	NA
>prophage 6
NZ_CP048344	Escherichia coli strain 124 chromosome, complete genome	4731258	2825482	2867030	4731258	integrase,transposase	Stx2-converting_phage(37.5%)	32	2864455:2864469	2870646:2870660
WP_021513032.1|2825482_2825941_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	5.5e-12
WP_000976514.1|2826669_2827815_-	class C beta-lactamase CMY-2	NA	NA	NA	NA	NA
WP_000608644.1|2828138_2829401_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_000483766.1|2829666_2831013_-|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_000179884.1|2831368_2831545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032262852.1|2831788_2832568_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.2	1.3e-138
WP_124039032.1|2834300_2835839_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.0	3.5e-297
WP_000612591.1|2835888_2836236_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_021566758.1|2836232_2836613_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	1.2e-65
WP_000107485.1|2837067_2838081_-	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_000998346.1|2838092_2839409_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_000350265.1|2839436_2840357_-	ribokinase	NA	NA	NA	NA	NA
WP_001295538.1|2840662_2841445_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001387298.1|2841446_2841545_-	acetolactate synthase	NA	NA	NA	NA	NA
WP_121372241.1|2842157_2843386_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.3	9.1e-171
WP_154761740.1|2843688_2843826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032180018.1|2843988_2844624_+	galactarate dehydratase	NA	NA	NA	NA	NA
WP_001335688.1|2844705_2845143_+	galactarate dehydratase	NA	NA	NA	NA	NA
WP_000072197.1|2845205_2846030_-	aga operon transcriptional regulator AgaR	NA	NA	NA	NA	NA
WP_001544449.1|2846278_2846617_+	tagatose-1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000192271.1|2846730_2848302_+	PTS maltose transporter subunit IICB	NA	NA	NA	NA	NA
WP_032180015.1|2848313_2849489_+	putative C-S lyase	NA	NA	NA	NA	NA
WP_000757210.1|2849502_2851392_+	enterotoxin	NA	NA	NA	NA	NA
WP_024167628.1|2851560_2851767_-	methyltransferase	NA	NA	NA	NA	NA
WP_000622487.1|2851871_2853308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001333439.1|2853304_2858263_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_032180014.1|2858937_2859501_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000335695.1|2860321_2861755_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_032141622.1|2861973_2862171_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_001303889.1|2862415_2862712_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_042002566.1|2863823_2865641_+	hypothetical protein	NA	NA	NA	NA	NA
2864455:2864469	attL	AAAAAATAATTTCTG	NA	NA	NA	NA
WP_000279872.1|2865827_2867030_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	2.9e-44
WP_000279872.1|2865827_2867030_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	2.9e-44
2870646:2870660	attR	AAAAAATAATTTCTG	NA	NA	NA	NA
>prophage 7
NZ_CP048344	Escherichia coli strain 124 chromosome, complete genome	4731258	3156380	3183093	4731258	integrase,lysis,tail	Enterobacteria_phage(48.48%)	42	3158296:3158310	3183167:3183181
WP_001356070.1|3156380_3157670_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	3.4e-19
WP_000767389.1|3157728_3158205_+	kinase inhibitor	NA	NA	NA	NA	NA
3158296:3158310	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001753290.1|3158950_3160282_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	1.4e-20
WP_072163407.1|3160355_3160532_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	84.5	9.4e-21
WP_000239881.1|3160681_3161350_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001372490.1|3162240_3162801_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.8	4.9e-87
WP_000105084.1|3163189_3163423_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	94.4	7.3e-21
WP_000079508.1|3163479_3163890_+	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_001139678.1|3164241_3164394_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
WP_001228702.1|3164422_3164629_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	98.5	5.3e-31
WP_001372488.1|3164845_3165343_-	lysozyme	NA	A0A1B5FP97	Escherichia_phage	97.0	1.6e-89
WP_000839582.1|3165342_3165558_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	1.2e-33
WP_000592543.1|3166827_3167787_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_000780581.1|3167979_3168504_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	1.1e-48
WP_001204777.1|3168659_3169037_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.2	7.3e-55
WP_000971068.1|3169122_3169263_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	5.5e-08
WP_001372483.1|3169259_3169622_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	97.4	1.5e-60
WP_001372487.1|3169618_3169909_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	91.7	4.8e-46
WP_000224914.1|3169901_3170072_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001372486.1|3170071_3170527_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	5.9e-59
WP_072157016.1|3170523_3170625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000825400.1|3170717_3171170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000720581.1|3171166_3171727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000145917.1|3172211_3172505_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001372464.1|3172501_3173203_-	replication P family protein	NA	K7P6G2	Enterobacteria_phage	99.6	3.8e-129
WP_162676758.1|3173199_3174075_-	replication protein	NA	M1FN81	Enterobacteria_phage	70.2	3.4e-87
WP_001067458.1|3174333_3174564_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_000259990.1|3174602_3175358_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	1.4e-92
WP_000389051.1|3175480_3176230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000210934.1|3176226_3177054_+	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
WP_000233576.1|3177562_3177769_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995439.1|3177844_3178141_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100847.1|3178146_3178932_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_001372450.1|3178928_3179609_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	98.7	3.0e-131
WP_072126246.1|3179605_3179788_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	2.2e-28
WP_023148020.1|3179760_3179952_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.8e-26
WP_001395510.1|3179962_3180244_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	100.0	2.5e-47
WP_000763365.1|3180342_3180564_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	97.3	1.4e-34
WP_000120065.1|3180774_3181377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545745.1|3181619_3181787_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
WP_001303849.1|3181826_3182045_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533646.1|3182022_3183093_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	99.7	1.9e-201
3183167:3183181	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 8
NZ_CP048344	Escherichia coli strain 124 chromosome, complete genome	4731258	4066874	4073433	4731258	transposase	uncultured_Caudovirales_phage(16.67%)	7	NA	NA
WP_000684856.1|4066874_4067831_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000175457.1|4067831_4068599_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000177060.1|4069156_4069414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001254876.1|4070465_4071617_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.0	2.6e-42
WP_000747102.1|4071536_4071887_-|transposase	transposase	transposase	Q716C1	Shigella_phage	97.7	8.9e-39
WP_000227281.1|4071987_4072560_+	hypothetical protein	NA	Q858R9	Enterobacteria_phage	69.0	2.2e-71
WP_000594911.1|4072608_4073433_-	hypothetical protein	NA	L7TR00	Rhizobium_phage	35.5	3.0e-16
>prophage 9
NZ_CP048344	Escherichia coli strain 124 chromosome, complete genome	4731258	4490113	4508632	4731258	integrase,lysis,tail	Escherichia_virus(26.32%)	21	4489956:4490002	4505844:4505890
4489956:4490002	attL	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_000468308.1|4490113_4490332_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000014361.1|4491579_4492479_-	hypothetical protein	NA	Q7Y4D2	Escherichia_virus	99.7	4.0e-168
WP_000972099.1|4492694_4493222_-|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	88.6	5.1e-86
WP_060621264.1|4493223_4494225_-	hypothetical protein	NA	A0A0C4UQV0	Shigella_phage	91.7	1.2e-176
WP_060621266.1|4494748_4495534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001695629.1|4495605_4496058_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	98.7	5.3e-76
WP_000917174.1|4496050_4496518_-|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.7	1.9e-81
WP_000040662.1|4496625_4497051_-|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	98.6	5.5e-67
WP_060621267.1|4497038_4497464_-	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	92.9	3.4e-56
WP_000368931.1|4498753_4499827_+	ParB N-terminal domain-containing protein	NA	Q7Y4B3	Escherichia_virus	100.0	1.2e-203
WP_000570053.1|4499819_4500857_+	hypothetical protein	NA	Q7Y4B4	Escherichia_virus	100.0	4.6e-200
WP_001143634.1|4500853_4501792_-	DNA cytosine methyltransferase	NA	Q7Y4B5	Escherichia_virus	100.0	3.1e-187
WP_000554771.1|4502034_4502241_-	hypothetical protein	NA	Q2P9X3	Enterobacteria_phage	97.0	2.4e-31
WP_001600138.1|4502240_4502693_-	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	96.7	1.4e-79
WP_000217670.1|4503289_4503790_-	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000453534.1|4503959_4504232_-	hypothetical protein	NA	Q1JS44	Enterobacteria_phage	100.0	1.5e-46
WP_001192857.1|4504384_4504678_+	helix-turn-helix domain-containing protein	NA	Q1JS45	Enterobacteria_phage	100.0	1.0e-48
WP_000023386.1|4504747_4505728_+|integrase	tyrosine-type recombinase/integrase	integrase	U5N0A8	Enterobacteria_phage	99.7	2.3e-185
WP_001223800.1|4505913_4506414_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
4505844:4505890	attR	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_001033722.1|4506563_4507262_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|4507258_4508632_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
>prophage 1
NZ_CP048345	Escherichia coli strain 124 plasmid p124_A, complete sequence	97111	1262	51907	97111	integrase,transposase	Salmonella_phage(35.29%)	41	NA	NA
WP_001066942.1|1262_2003_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_032156742.1|2123_2249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001072355.1|3448_4618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086258557.1|4813_5008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000088605.1|5859_6483_-	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_001089068.1|6564_7770_+	tetracycline efflux MFS transporter Tet(B)	NA	NA	NA	NA	NA
WP_000428546.1|7882_8476_-	tetracyline resistance-associated transcriptional repressor TetC	NA	NA	NA	NA	NA
WP_001067855.1|8609_9314_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000376616.1|9888_10092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|10219_11059_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|11052_11400_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000503573.1|11605_12394_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_001389366.1|12524_12998_-	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_000845048.1|13155_14169_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_162676759.1|17887_18754_-|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	99.6	1.9e-162
WP_000557454.1|19969_20830_+	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_000587837.1|20842_21385_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000951934.1|21866_22058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000248278.1|22081_22309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014837927.1|22359_23487_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|23523_24228_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000219391.1|24349_25255_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000004159.1|25251_26490_+	MFS transporter	NA	NA	NA	NA	NA
WP_001137892.1|26489_27074_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|27566_28331_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001393253.1|34475_34808_+	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_000239590.1|34854_35730_-	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_000027057.1|37395_38256_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_000147567.1|40876_41437_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_000134999.1|42009_42651_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_001067855.1|43610_44315_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000240536.1|45070_45922_+	replication protein	NA	NA	NA	NA	NA
WP_001043265.1|46229_47045_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	3.5e-09
WP_001082319.1|47105_47909_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000480968.1|47908_48745_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_162676760.1|49589_49736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162676761.1|49732_49984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162676762.1|50057_50975_+|transposase	transposase	transposase	A0A1B0V7H9	Salmonella_phage	32.8	5.6e-40
WP_162676763.1|50999_51383_+|transposase	transposase	transposase	A0A1B0V7H9	Salmonella_phage	50.0	9.8e-23
WP_162676768.1|51405_51621_+|transposase	transposase	transposase	A0A1B0V7H9	Salmonella_phage	62.5	2.3e-13
WP_162676764.1|51592_51907_+|transposase	transposase	transposase	A0A1B0V7H9	Salmonella_phage	50.0	2.2e-20
>prophage 2
NZ_CP048345	Escherichia coli strain 124 plasmid p124_A, complete sequence	97111	88549	95979	97111		Escherichia_phage(57.14%)	7	NA	NA
WP_031311986.1|88549_91666_-	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	24.0	2.9e-27
WP_001617890.1|91787_93071_-	restriction endonuclease subunit S	NA	F2Y1N5	Organic_Lake_phycodnavirus	26.5	2.2e-10
WP_001553856.1|93067_94624_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.5	7.1e-104
WP_001190712.1|94806_95028_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_001216034.1|95027_95408_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	100.0	1.1e-63
WP_001513661.1|95412_95592_+	hypothetical protein	NA	Q71TH5	Escherichia_phage	96.6	3.5e-23
WP_001513660.1|95619_95979_+	hypothetical protein	NA	A0A077SLM1	Escherichia_phage	98.9	5.0e-45
