The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP022373	Providencia rettgeri strain BML2531	4696377	585446	593879	4696377		Escherichia_phage(50.0%)	8	NA	NA
WP_164564482.1|585446_587864_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	36.2	7.6e-137
WP_004261008.1|587860_588499_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	55.3	1.2e-62
WP_094961424.1|588495_589395_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_004260986.1|589433_590000_+	twin-arginine leader-binding protein DmsD	NA	A0A077SLS7	Escherichia_phage	31.6	8.6e-15
WP_036958333.1|590206_590629_+	DoxX family protein	NA	NA	NA	NA	NA
WP_004260980.1|590712_591507_-	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	43.0	1.2e-43
WP_110592488.1|591531_592758_-	RtcB family protein	NA	A0A1V0EEW8	Caulobacter_phage	62.9	9.5e-136
WP_004260972.1|592760_593879_-	slipin family protein	NA	A0A2P1EMF1	Moumouvirus	26.9	4.9e-14
>prophage 2
NZ_AP022373	Providencia rettgeri strain BML2531	4696377	1758794	1804040	4696377	integrase,tail,lysis,head,tRNA,terminase	Pectobacterium_phage(17.07%)	59	1744039:1744052	1765285:1765298
1744039:1744052	attL	TCAATCATTTTTTC	NA	NA	NA	NA
WP_164565049.1|1758794_1760036_-|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	48.3	1.4e-105
WP_164565051.1|1760350_1761751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164565053.1|1761889_1763074_-	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	68.7	2.8e-153
WP_068445436.1|1763028_1763238_-	excisionase	NA	I6PBM8	Cronobacter_phage	60.9	6.8e-18
WP_164565056.1|1763282_1763489_-	hypothetical protein	NA	H9C154	Pectobacterium_phage	47.5	2.0e-06
WP_164565059.1|1763731_1763902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164565064.1|1763931_1764111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110732079.1|1764156_1764657_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	66.3	3.5e-52
WP_164565067.1|1764656_1766627_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	37.7	3.1e-120
1765285:1765298	attR	TCAATCATTTTTTC	NA	NA	NA	NA
WP_164565068.1|1766639_1766972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048607774.1|1767525_1768683_-	type I restriction enzyme R protein	NA	A0A1S5SAB0	Streptococcus_phage	27.8	2.2e-33
WP_048607772.1|1768692_1769385_-	helix-turn-helix transcriptional regulator	NA	M9NZE3	Enterobacteria_phage	54.9	8.2e-68
WP_048607770.1|1769489_1769699_+	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	64.2	1.3e-16
WP_068445417.1|1769770_1770226_+|tRNA	tRNA-(guanine-N1)-methyltransferase	tRNA	H9C162	Pectobacterium_phage	52.1	9.2e-28
WP_164565069.1|1770243_1770468_+	hypothetical protein	NA	H9C163	Pectobacterium_phage	48.6	9.2e-13
WP_164565070.1|1770469_1771426_+	hypothetical protein	NA	U5P0A0	Shigella_phage	54.2	8.7e-44
WP_164565071.1|1771422_1772160_+	DNA replication protein	NA	A0A2H4J1B6	uncultured_Caudovirales_phage	36.9	4.8e-34
WP_164565690.1|1772214_1772385_+	palmdelphin	NA	NA	NA	NA	NA
WP_164565072.1|1772387_1772618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164565073.1|1772731_1772902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164565074.1|1772929_1773268_+	hypothetical protein	NA	H9C172	Pectobacterium_phage	63.0	4.2e-33
WP_164565075.1|1773345_1773939_+	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	58.2	2.3e-63
WP_164565076.1|1773950_1774265_+	DUF968 domain-containing protein	NA	A0A1I9KFA7	Aeromonas_phage	69.8	1.2e-34
WP_164565077.1|1774252_1774783_+	DUF1133 family protein	NA	I6S672	Salmonella_phage	53.3	2.6e-37
WP_164565078.1|1774946_1775141_+	TrmB family transcriptional regulator	NA	Q8SBE3	Shigella_phage	60.8	5.0e-07
WP_164565691.1|1775296_1776334_+	site-specific DNA-methyltransferase	NA	A0A1W6JP25	Morganella_phage	73.9	1.0e-138
WP_164565079.1|1777038_1777308_+	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	64.4	4.8e-24
WP_164565080.1|1777307_1777778_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	55.9	9.5e-44
WP_164565081.1|1777759_1777933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164565082.1|1777953_1778403_+|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	42.6	1.4e-12
WP_048607741.1|1779469_1779601_-	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_164565083.1|1780002_1780245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110592070.1|1780649_1780922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110592069.1|1781003_1782032_+|terminase	terminase small subunit	terminase	C5IHM0	Burkholderia_virus	40.6	5.0e-37
WP_110592068.1|1782028_1782664_-	response regulator	NA	NA	NA	NA	NA
WP_110592067.1|1782902_1784300_+|terminase	phage terminase large subunit	terminase	A0A2K9V3I6	Faecalibacterium_phage	40.3	3.0e-85
WP_164565084.1|1784304_1785807_+	DUF1073 domain-containing protein	NA	A0A2H4P6S9	Pseudomonas_phage	43.4	6.9e-104
WP_110592065.1|1785844_1786573_+|head	phage head morphogenesis protein	head	Q6IWU3	Burkholderia_phage	39.4	3.5e-37
WP_110592064.1|1786569_1787826_+	DUF2213 domain-containing protein	NA	A0A2H5BG39	Pseudoalteromonas_phage	45.6	1.6e-37
WP_110592063.1|1787825_1788323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042844781.1|1788322_1789390_+	DUF2184 domain-containing protein	NA	A0A088C493	Shewanella_sp._phage	36.6	4.4e-52
WP_105881054.1|1789444_1789786_+	hypothetical protein	NA	Q6IWU7	Burkholderia_phage	34.5	1.0e-07
WP_110592606.1|1789788_1790220_+	DUF4054 domain-containing protein	NA	Q6IWU8	Burkholderia_phage	33.8	2.0e-11
WP_164565085.1|1790219_1790678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110592061.1|1790677_1791046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110592060.1|1791035_1791551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110592059.1|1791560_1793048_+	DUF3383 domain-containing protein	NA	A0A088C3U1	Shewanella_sp._phage	37.0	2.0e-79
WP_068445366.1|1793057_1793510_+	hypothetical protein	NA	I7ATP4	Escherichia_phage	38.9	1.8e-23
WP_109911397.1|1793560_1794019_+	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	47.7	3.7e-24
WP_110592605.1|1794485_1796612_+	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	26.8	3.0e-20
WP_110592058.1|1796608_1797136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096863415.1|1797139_1797433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110592057.1|1797425_1798241_+	hypothetical protein	NA	B5M9T8	Pseudomonas_phage	28.5	6.3e-19
WP_110592056.1|1798244_1798937_+	hypothetical protein	NA	A0A2H4P6V3	Pseudomonas_phage	40.8	1.4e-30
WP_110592055.1|1798933_1799278_+	hypothetical protein	NA	Q6IWQ2	Burkholderia_phage	36.6	2.4e-12
WP_110592054.1|1799270_1800458_+	hypothetical protein	NA	A0A2H5BG53	Pseudoalteromonas_phage	38.9	2.2e-76
WP_110592053.1|1800454_1801114_+	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	41.3	2.1e-41
WP_110592052.1|1801119_1802640_+|tail	phage tail protein	tail	A0A0F6R6B6	Escherichia_coli_O157_typing_phage	40.6	5.1e-30
WP_004265004.1|1803557_1804040_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	8.0e-30
>prophage 3
NZ_AP022373	Providencia rettgeri strain BML2531	4696377	1953928	2001484	4696377	terminase,capsid,lysis,integrase	Salmonella_phage(28.85%)	82	1953074:1953133	2001595:2001662
1953074:1953133	attL	GATTGGCTTGATGAGGTTTTTGTTTAGGTGGGAATAGCTGGGTTTAGCTTGCTGTGGTGT	NA	NA	NA	NA
WP_154633739.1|1953928_1954117_-	lipoprotein	NA	E9NIE1	Enterobacter_phage	67.8	6.1e-18
WP_164565103.1|1954109_1954283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164565104.1|1954282_1954837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164565105.1|1954823_1954988_-	hypothetical protein	NA	A0A1P8DTI7	Proteus_phage	90.0	1.1e-18
WP_164565106.1|1955252_1955519_-	hypothetical protein	NA	A0A1P8DTI8	Proteus_phage	39.6	7.6e-06
WP_164565107.1|1955518_1955806_-	hypothetical protein	NA	A0A109QIR8	Bacillus_phage	35.4	2.5e-07
WP_164565108.1|1955805_1956096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164565694.1|1956130_1956253_-	hook protein	NA	NA	NA	NA	NA
WP_164565109.1|1956443_1956611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164565110.1|1956627_1957176_-	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	58.8	6.9e-54
WP_164565111.1|1957168_1957798_-	YqaJ viral recombinase family protein	NA	S0A2A9	Cellulophaga_phage	48.8	9.4e-47
WP_164565112.1|1957778_1958303_-	hypothetical protein	NA	A0A0F7L6F4	uncultured_marine_virus	37.2	5.1e-14
WP_129467336.1|1958302_1958527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164565113.1|1958523_1958724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164565114.1|1958944_1959514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164565115.1|1959576_1959798_-	hypothetical protein	NA	A0A1W6JNZ6	Morganella_phage	56.9	1.5e-15
WP_164565116.1|1959810_1960149_-	hypothetical protein	NA	A0A1P8DTE8	Proteus_phage	35.1	2.5e-06
WP_164564165.1|1960157_1960403_-	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	41.5	1.0e-09
WP_164565117.1|1960745_1960922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164565118.1|1960954_1961500_-	pentapeptide repeat-containing protein	NA	Q8HAH0	Salmonella_phage	77.3	1.5e-32
WP_164565119.1|1961602_1961773_-	hypothetical protein	NA	Q7Y3M0	Enterobacteria_phage	71.2	9.1e-13
WP_164565120.1|1961775_1962057_-	hypothetical protein	NA	A0A1P8DTK1	Proteus_phage	79.3	7.9e-30
WP_164565121.1|1962443_1963091_-	helix-turn-helix domain-containing protein	NA	A5VW98	Enterobacteria_phage	64.6	1.3e-75
WP_164565122.1|1963171_1963357_+	hypothetical protein	NA	A5VW97	Enterobacteria_phage	54.1	5.4e-11
WP_164565123.1|1963473_1963800_+	hypothetical protein	NA	A0A1W6JNY4	Morganella_phage	75.0	5.8e-40
WP_164565124.1|1963830_1963995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164565125.1|1963991_1964180_+	hypothetical protein	NA	G9L679	Escherichia_phage	52.7	3.0e-09
WP_164565126.1|1964172_1965042_+	replication protein	NA	A0A088CPU2	Enterobacteria_phage	61.0	6.8e-88
WP_164565127.1|1965156_1967043_+	AAA family ATPase	NA	I6S1U6	Salmonella_phage	69.3	1.8e-271
WP_164565128.1|1967068_1967272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164565129.1|1967303_1967573_+	hypothetical protein	NA	A0A1X9Y877	Proteus_phage	58.4	1.7e-21
WP_164565130.1|1967572_1967743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164565131.1|1967990_1968233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164565132.1|1968219_1968459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164565133.1|1968455_1968806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164565134.1|1968766_1969168_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	47.3	5.7e-21
WP_164565135.1|1969169_1969616_+	recombination protein NinB	NA	A0A1W6JNZ4	Morganella_phage	56.0	2.4e-36
WP_164565136.1|1969636_1969885_+	DUF3310 domain-containing protein	NA	A0A0A6Z5B6	Enterobacter_phage	72.5	2.2e-23
WP_164565137.1|1970133_1970508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164565138.1|1970576_1970879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164565139.1|1970878_1971169_+	DUF1364 domain-containing protein	NA	A0A220NQY2	Salmonella_phage	76.0	2.9e-35
WP_164565140.1|1971165_1971531_+	RusA family crossover junction endodeoxyribonuclease	NA	E5AGG1	Erwinia_phage	68.6	6.9e-42
WP_164565141.1|1971520_1971715_+	protein ninH	NA	Q777W6	Enterobacteria_phage	60.4	2.8e-10
WP_164565695.1|1971906_1972299_+	hypothetical protein	NA	F1C5D0	Cronobacter_phage	35.0	8.5e-14
WP_071548375.1|1972904_1973318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164565142.1|1973314_1973617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_140180794.1|1973579_1973972_+	M15 family metallopeptidase	NA	E7C9S9	Salmonella_phage	84.5	1.4e-56
WP_164565143.1|1973968_1974421_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	53.8	9.5e-33
WP_164565144.1|1974705_1975245_+	Rha family transcriptional regulator	NA	A0A0P0ZFJ1	Escherichia_phage	65.2	1.6e-63
WP_105881132.1|1975255_1975489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164565145.1|1975547_1975799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164565146.1|1975822_1976050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_126459730.1|1976118_1976364_+	DUF2560 family protein	NA	NA	NA	NA	NA
WP_164565147.1|1976420_1977053_+|terminase	terminase small subunit	terminase	A0A2R3UAN5	Myoviridae_environmental_samples	48.4	9.5e-39
WP_164565148.1|1977036_1978521_+	DNA-packaging protein	NA	G0ZND4	Cronobacter_phage	84.1	9.4e-247
WP_164565149.1|1978524_1979901_+	DUF1073 domain-containing protein	NA	I6R9A1	Salmonella_phage	65.7	8.1e-168
WP_164565150.1|1979836_1980766_+|capsid	minor capsid protein	capsid	A0A1V0E5Q2	Salmonella_phage	55.3	8.6e-89
WP_164565151.1|1980768_1982055_+	hypothetical protein	NA	G0ZND7	Cronobacter_phage	63.1	3.2e-150
WP_164565152.1|1982054_1982492_+	hypothetical protein	NA	I6S1Q2	Salmonella_phage	71.9	1.6e-48
WP_164565153.1|1982507_1983602_+	hypothetical protein	NA	G0ZND9	Cronobacter_phage	71.3	1.3e-149
WP_164565154.1|1983611_1983785_+	glycoprotein	NA	I6R9A3	Salmonella_phage	61.4	1.9e-10
WP_164565155.1|1983841_1984243_+	hypothetical protein	NA	I6S619	Salmonella_phage	77.4	2.3e-54
WP_164565156.1|1984239_1984608_+	hypothetical protein	NA	I6S1Q5	Salmonella_phage	60.7	4.4e-36
WP_164565157.1|1984609_1985047_+	HK97 gp10 family phage protein	NA	A0A1V0E5P5	Salmonella_phage	56.1	7.0e-33
WP_164565158.1|1985043_1985412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164565159.1|1985480_1986236_+	DNA breaking-rejoining protein	NA	A0A1W6JNT1	Morganella_phage	61.8	2.7e-80
WP_164565160.1|1986284_1986971_+	hypothetical protein	NA	A0A1W6JNX2	Morganella_phage	69.7	7.5e-90
WP_164565161.1|1986984_1987380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164565162.1|1987578_1988631_-	hypothetical protein	NA	I6S627	Salmonella_phage	58.4	1.7e-61
WP_081335999.1|1988701_1988860_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_164565163.1|1988973_1989219_+	Arc family DNA-binding protein	NA	A5VW60	Enterobacteria_phage	39.7	5.9e-05
WP_164565164.1|1989215_1989629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164565165.1|1989609_1990011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070929154.1|1990078_1990669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164565166.1|1990679_1991072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164565167.1|1991148_1994181_+	hypothetical protein	NA	A0A1V0E5N4	Salmonella_phage	53.7	5.0e-53
WP_006661951.1|1994190_1994673_+	hypothetical protein	NA	F1C5F0	Cronobacter_phage	66.9	5.7e-60
WP_164565696.1|1994669_1995137_+	DUF1833 family protein	NA	F1C5F1	Cronobacter_phage	51.7	1.2e-38
WP_164565168.1|1995136_1995529_+	peptidoglycan endopeptidase	NA	F1C5F2	Cronobacter_phage	56.1	2.5e-42
WP_164565169.1|1995515_1997993_+	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	48.6	1.3e-232
WP_164565170.1|1998053_2000258_+	hypothetical protein	NA	A0A2I7SAN2	Vibrio_phage	45.1	4.0e-100
WP_164565171.1|2000314_2001484_-|integrase	tyrosine-type recombinase/integrase	integrase	E5AGD0	Erwinia_phage	63.3	3.4e-143
2001595:2001662	attR	GATTGGCTTGATGAGGTTTTTGTTTAGGTGGGAATAGCTGGGTTTAGCTTGCTGTGGTGTCCCCTGCA	NA	NA	NA	NA
>prophage 4
NZ_AP022373	Providencia rettgeri strain BML2531	4696377	2160231	2178928	4696377		Morganella_phage(25.0%)	30	NA	NA
WP_164565202.1|2160231_2160954_+	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	42.0	5.0e-52
WP_071585886.1|2161154_2161229_+	DUF4113 domain-containing protein	NA	NA	NA	NA	NA
WP_164565203.1|2161494_2162226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164565204.1|2162229_2163408_-	recombinase	NA	A0A2H4J1K3	uncultured_Caudovirales_phage	30.0	1.8e-30
WP_164565205.1|2163409_2163625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164565206.1|2163654_2164452_-	DNA adenine methylase	NA	Q5QF26	Pseudomonas_virus	48.1	2.0e-65
WP_164565207.1|2164438_2164645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164565208.1|2164654_2165371_-	hypothetical protein	NA	A0A1W6JP41	Morganella_phage	62.8	8.8e-57
WP_164565209.1|2165423_2166251_-	YfdQ family protein	NA	A0A192Y6E5	Salmonella_phage	55.4	2.6e-84
WP_164565210.1|2166369_2166684_-	hypothetical protein	NA	A0A192Y6G0	Salmonella_phage	66.3	7.0e-35
WP_164565698.1|2166876_2167065_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	62.7	4.5e-13
WP_164564166.1|2167380_2167626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123382609.1|2168008_2168680_-	helix-turn-helix domain-containing protein	NA	K7PLZ5	Enterobacterial_phage	56.2	1.1e-61
WP_102140689.1|2168752_2168947_+	hypothetical protein	NA	K7PHB1	Enterobacterial_phage	64.9	3.8e-15
WP_109913327.1|2168984_2169440_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	56.7	3.1e-39
WP_164565211.1|2169501_2169669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164565212.1|2169665_2170793_+	replication protein 15	NA	K7PLZ7	Enterobacterial_phage	58.2	4.3e-50
WP_164565699.1|2170792_2171038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164565213.1|2171037_2171571_+	phage N-6-adenine-methyltransferase	NA	Q4A1M4	Enterobacteria_phage	64.7	5.5e-64
WP_164565214.1|2171567_2171915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164565215.1|2171911_2172091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164565216.1|2172087_2172471_+	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	49.2	3.0e-27
WP_164565217.1|2172486_2173155_+	phage regulatory protein/antirepressor Ant	NA	G0ZND1	Cronobacter_phage	54.5	9.4e-53
WP_164565218.1|2173147_2173690_+	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	67.8	7.6e-45
WP_164565219.1|2173720_2174377_+	hypothetical protein	NA	A0A1W6JP37	Morganella_phage	44.4	2.5e-42
WP_164565220.1|2174560_2174764_+	TrmB family transcriptional regulator	NA	Q9MC00	Enterobacteria_phage	57.7	2.8e-08
WP_164565221.1|2174896_2175940_+	site-specific DNA-methyltransferase	NA	A0A1W6JP25	Morganella_phage	71.1	1.4e-143
WP_164565222.1|2176087_2178016_+	NACHT domain-containing protein	NA	NA	NA	NA	NA
WP_006658152.1|2178177_2178378_+	hypothetical protein	NA	A0A1W6JNY9	Morganella_phage	73.7	1.4e-17
WP_164565223.1|2178358_2178928_+	lysozyme	NA	A0A1R3Y5W5	Salmonella_virus	60.9	6.3e-50
>prophage 5
NZ_AP022373	Providencia rettgeri strain BML2531	4696377	2182200	2196776	4696377	tail,head,protease,portal,terminase,capsid	Morganella_phage(33.33%)	19	NA	NA
WP_109913118.1|2182200_2182548_+	HNH endonuclease	NA	A0A1W6JP27	Morganella_phage	77.6	6.5e-50
WP_164561055.1|2182903_2183422_+	KilA-N domain-containing protein	NA	A0A2H4FQV0	Salmonella_phage	62.3	4.1e-56
WP_109913116.1|2183443_2183938_+|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	76.2	6.9e-69
WP_164565224.1|2183934_2185665_+|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	83.4	1.9e-291
WP_004911622.1|2185661_2185823_+	hypothetical protein	NA	A0A1W6JP78	Morganella_phage	71.7	2.4e-15
WP_004911621.1|2185812_2187045_+|portal	phage portal protein	portal	A0A1W6JP33	Morganella_phage	87.1	4.5e-210
WP_140170610.1|2187034_2187640_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1W6JP53	Morganella_phage	78.7	1.4e-87
WP_164565700.1|2187655_2188876_+|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	83.5	1.1e-189
WP_164561052.1|2188968_2189271_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	69.0	1.5e-34
WP_164565225.1|2189279_2189606_+|head	phage head closure protein	head	Q7Y406	Yersinia_phage	45.9	9.9e-16
WP_164565226.1|2189592_2189982_+	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	44.4	2.3e-27
WP_109913109.1|2189978_2190383_+	hypothetical protein	NA	Q7Y404	Yersinia_phage	59.5	5.9e-34
WP_140170607.1|2190409_2190874_+|tail	phage tail protein	tail	Q7Y403	Yersinia_phage	76.2	1.1e-60
WP_140170606.1|2190873_2191221_+|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	44.6	1.5e-17
WP_164565227.1|2191451_2194805_+|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	42.7	9.5e-170
WP_164565228.1|2194807_2195401_+	hypothetical protein	NA	A0A0E3GML3	Enterobacteria_phage	48.7	2.9e-45
WP_164565229.1|2195400_2195982_+	hypothetical protein	NA	Q7Y3Z7	Yersinia_phage	50.0	4.5e-51
WP_109913102.1|2196019_2196307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109913128.1|2196377_2196776_+	hypothetical protein	NA	A0A2H4IYI8	uncultured_Caudovirales_phage	50.0	4.4e-34
>prophage 6
NZ_AP022373	Providencia rettgeri strain BML2531	4696377	3553957	3564538	4696377		Mycobacterium_phage(25.0%)	11	NA	NA
WP_004257076.1|3553957_3555169_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	49.3	1.7e-105
WP_004257083.1|3555319_3555583_+	YbeD family protein	NA	NA	NA	NA	NA
WP_036957959.1|3555798_3556428_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_004257088.1|3556551_3557517_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_004257099.1|3557660_3557870_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	3.5e-22
WP_004257101.1|3558086_3558545_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A2K9L300	Tupanvirus	46.7	7.1e-20
WP_036957963.1|3558833_3559061_+	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	56.2	3.6e-17
WP_004257105.1|3559069_3559483_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	33.9	1.4e-11
WP_004257107.1|3559494_3561627_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.2	1.5e-205
WP_004257109.1|3561639_3562611_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.9	3.5e-133
WP_004257111.1|3563338_3564538_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	38.5	2.6e-29
>prophage 7
NZ_AP022373	Providencia rettgeri strain BML2531	4696377	3783630	3828021	4696377	integrase,tail,lysis,protease,portal,terminase	Enterobacteria_phage(33.33%)	63	3783560:3783575	3831903:3831918
3783560:3783575	attL	AGACGCCTTTAACCAC	NA	NA	NA	NA
WP_004257995.1|3783630_3784425_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.0	6.2e-11
WP_164565484.1|3784436_3785228_+	aspartate dehydrogenase	NA	NA	NA	NA	NA
WP_004258002.1|3785241_3786711_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_140170641.1|3787034_3788243_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A291AWU1	Escherichia_phage	47.6	1.4e-107
WP_140170640.1|3788211_3788427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164565485.1|3788463_3789036_-	3'-5' exoribonuclease	NA	A0A1W6JP74	Morganella_phage	55.1	4.4e-51
WP_164565486.1|3789226_3789595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048606409.1|3789605_3789785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112308307.1|3790184_3790544_-	hypothetical protein	NA	Q7Y3W6	Yersinia_phage	48.1	5.4e-15
WP_112308308.1|3790545_3791001_-	hypothetical protein	NA	A0A248SL53	Klebsiella_phage	38.0	2.7e-27
WP_141240686.1|3791010_3791214_-	hypothetical protein	NA	A0A1U9ZAG7	Proteus_phage	48.1	1.2e-06
WP_094962331.1|3791227_3792004_-	hypothetical protein	NA	A0A248SL66	Klebsiella_phage	39.5	1.8e-39
WP_094962332.1|3792087_3792402_-	hypothetical protein	NA	A0A1W6JP69	Morganella_phage	53.4	1.4e-22
WP_094962333.1|3792388_3792991_-	recombination-associated protein RdgC	NA	A0A1W6JP69	Morganella_phage	46.7	3.3e-41
WP_071548870.1|3793141_3793330_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	70.6	9.1e-14
WP_141240664.1|3793437_3793656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164565487.1|3793633_3794176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094962334.1|3794203_3794413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096865216.1|3794568_3795453_+	NAD-dependent DNA ligase	NA	NA	NA	NA	NA
WP_164565719.1|3795438_3796128_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C1P9	Escherichia_phage	41.2	2.6e-42
WP_096865218.1|3796248_3796485_+	cytoplasmic chaperone TorD	NA	NA	NA	NA	NA
WP_164565488.1|3796561_3797020_+	hypothetical protein	NA	A0A1W6JP72	Morganella_phage	64.7	1.1e-49
WP_164528691.1|3797302_3797482_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_164528692.1|3797491_3798553_+	replication protein	NA	A0A248SL49	Klebsiella_phage	49.3	2.9e-32
WP_164565489.1|3798552_3798798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164565490.1|3798797_3799331_+	phage N-6-adenine-methyltransferase	NA	G8EYI1	Enterobacteria_phage	65.3	5.5e-64
WP_164565214.1|3799327_3799675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164565215.1|3799671_3799851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164565216.1|3799847_3800231_+	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	49.2	3.0e-27
WP_164565491.1|3800246_3800915_+	phage regulatory protein/antirepressor Ant	NA	G0ZND1	Cronobacter_phage	54.5	4.2e-53
WP_164565492.1|3800907_3801450_+	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	59.1	8.1e-39
WP_164565493.1|3801472_3802138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164565494.1|3802321_3802522_+	TrmB family transcriptional regulator	NA	Q8SBE3	Shigella_phage	60.8	2.7e-08
WP_164565495.1|3802654_3803713_+	site-specific DNA-methyltransferase	NA	A0A1W6JP25	Morganella_phage	71.6	1.4e-143
WP_164565496.1|3803766_3804117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164564168.1|3804226_3804622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164565497.1|3804618_3804846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164528703.1|3804998_3805412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110591879.1|3805411_3805780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164565498.1|3805776_3806259_+	TIGR02594 family protein	NA	A0A1U9ZAE8	Proteus_phage	73.1	4.2e-63
WP_164565720.1|3806284_3806731_+|lysis	lysis protein	lysis	I6PDF9	Cronobacter_phage	35.2	3.7e-13
WP_164565499.1|3806742_3806904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164564169.1|3806934_3807135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164565500.1|3807269_3807773_+	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	54.9	1.8e-40
WP_164565501.1|3807769_3809881_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	65.5	1.8e-283
WP_164565502.1|3809877_3810093_+	hypothetical protein	NA	K7PMB5	Enterobacterial_phage	56.5	8.0e-14
WP_164565503.1|3810089_3811595_+|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	66.0	2.4e-189
WP_164565721.1|3811632_3813603_+|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	63.1	3.2e-234
WP_164565504.1|3813687_3814035_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	45.4	7.3e-17
WP_164565505.1|3814038_3814335_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_094963142.1|3814318_3814876_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	46.8	3.1e-33
WP_164528403.1|3814875_3815274_+|tail	phage tail protein	tail	K7PJT1	Enterobacteria_phage	44.7	3.9e-30
WP_164565506.1|3815285_3815798_+|tail	phage tail protein	tail	O64327	Escherichia_phage	65.6	7.4e-58
WP_110591865.1|3815993_3816524_+	Rha family transcriptional regulator	NA	Q38450	Enterobacteria_phage	57.6	1.8e-51
WP_164565507.1|3816567_3816945_+|tail	phage minor tail protein G	tail	NA	NA	NA	NA
WP_164565508.1|3816968_3817283_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	46.9	4.4e-13
WP_164565509.1|3817257_3820323_+|tail	phage tail tape measure protein	tail	E4WL33	Enterobacteria_phage	35.2	3.0e-122
WP_094963150.1|3820372_3820702_+|tail	phage tail protein	tail	A0A1B5FPI1	Escherichia_phage	46.5	6.3e-10
WP_164565510.1|3820770_3821349_+	zinc ribbon domain-containing protein	NA	I6PDJ9	Cronobacter_phage	47.4	3.7e-21
WP_164565511.1|3821406_3822105_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	54.7	1.1e-69
WP_164565512.1|3822113_3822842_+|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	58.8	4.7e-82
WP_125892296.1|3822745_3823408_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	48.1	1.7e-51
WP_164565513.1|3823410_3828021_+	DUF1983 domain-containing protein	NA	A0A0K2FI38	Escherichia_phage	53.0	3.9e-267
3831903:3831918	attR	AGACGCCTTTAACCAC	NA	NA	NA	NA
>prophage 1
NZ_AP022376	Providencia rettgeri strain BML2531 plasmid pBML2531, complete sequence	84930	8521	55062	84930	integrase,transposase	Escherichia_phage(27.78%)	49	8470:8529	54306:55125
8470:8529	attL	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTT	NA	NA	NA	NA
WP_001067855.1|8521_9226_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_164565732.1|9272_9437_-	ParA family protein	NA	A0A219YAQ5	Aeromonas_phage	51.0	5.5e-07
WP_048609183.1|9897_10089_+	DUF5397 family protein	NA	NA	NA	NA	NA
WP_096865196.1|10091_10373_+	virulence factor	NA	NA	NA	NA	NA
WP_164565733.1|10686_11436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|12644_13349_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_114261019.1|13839_14700_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000287615.1|14750_16295_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	34.6	1.0e-38
WP_001324342.1|16417_17941_+|transposase	IS21-like element IS1326 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	24.2	1.2e-15
WP_001163403.1|17930_18713_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.0	2.5e-33
WP_000376623.1|18888_19389_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259031.1|19516_20356_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|20349_20697_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_003830719.1|20907_21240_-	quaternary ammonium compound efflux SMR transporter QacG2	NA	NA	NA	NA	NA
WP_013263788.1|21464_21923_-	aminoglycoside N-acetyltransferase AAC(6')-Il	NA	NA	NA	NA	NA
WP_001007673.1|21960_22788_-	oxacillin-hydrolyzing class D beta-lactamase OXA-2	NA	NA	NA	NA	NA
WP_063860573.1|22940_23678_-	subclass B1 metallo-beta-lactamase IMP-11	NA	NA	NA	NA	NA
WP_014714131.1|23742_24147_-	fosfomycin resistance thiol transferase FosI	NA	NA	NA	NA	NA
WP_002075255.1|24292_25306_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
WP_001162012.1|25611_26169_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_001138073.1|26171_29144_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
WP_011039612.1|29300_29738_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	56.0	1.5e-30
WP_011039613.1|29725_30763_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	54.5	5.8e-94
WP_109910753.1|31016_31292_+	formaldehyde-responsive transcriptional repressor FrmR	NA	NA	NA	NA	NA
WP_000842086.1|31322_32432_+	S-(hydroxymethyl)glutathione dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.1	3.7e-30
WP_006814898.1|32473_32872_+	VOC family protein	NA	NA	NA	NA	NA
WP_109910772.1|32937_33774_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000470623.1|33801_34437_-	recombinase family protein	NA	NA	NA	NA	NA
WP_011039616.1|34604_37592_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	53.5	5.5e-294
WP_011039617.1|37788_38673_+	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_011039618.1|38685_39009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011039619.1|39028_39907_+	MFS transporter	NA	NA	NA	NA	NA
WP_011039620.1|39926_40475_+	SDR family NAD(P)-dependent oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.7	8.6e-12
WP_109910752.1|40517_41662_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	37.5	2.7e-47
WP_039855103.1|41853_42447_+	fimbrial protein	NA	NA	NA	NA	NA
WP_006814879.1|42518_43220_+	molecular chaperone	NA	NA	NA	NA	NA
WP_164565734.1|43229_45713_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_164565735.1|45703_46711_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_039855100.1|46724_47342_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_164565736.1|47539_47848_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_164565737.1|49494_50847_-|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	48.1	1.1e-116
WP_082981382.1|51299_51608_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_082981383.1|51622_52171_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_109910748.1|52387_52597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082981384.1|52673_52988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109910747.1|53261_53480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109912806.1|53513_54038_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_164565738.1|54030_54324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|54357_55062_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
54306:55125	attR	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTTCAAAAACTCTGCTTACCAGGCGCATTTCGCCCAGGGGATCACCATAATAAAATGCTGAGGCCTGGCCTTTGCGTAGTGCACGCATCACCTCAATACCTTTGATGGTGGCGTAAGCCGTCTTCATGGATTTAAATCCCAGCGTGGCGCCGATTATCCGTTTCAGTTTGCCATGATCGCATTCAATCACGTTGTTCCGGTACTTAATCTGTCGGTGTTCAACGTCAGACGGGCACCGGCCTTCGCGTTTGAGCAGAGCAAGCGCGCGACCATAGGCGGGCGCTTTATCCGTGTTGATGAATCGCGGGATCTGCCACTTCTTCACGTTGTTGAGGATTTTACCCAGAAACCGGTATGCAGCTTTGCTGTTACGACGGGAGGAGAGATAAAAATCGACAGTGCGGCCCCGGCTGTCGACGGCCCGGTACAGATACGCCCAGCGGCCATTGACCTTCACGTAGGTTTCATCCATGTGCCACGGGCAAAGATCGGAAGGGTTACGCCAGTACCAGCGCAGCCGTTTTTCCATTTCAGGCGCATAACGCTGAACCCAGCGGTAAATCGTGGAGTGATCGACATTCACTCCGCGTTCAGCCAGCATCTCCTGCAGCTCACGGTAACTGATGCCGTATTTGCAGTACCAGCGTACGGCCCACAGAATGATGTCACGCTGAAAATGCCGGCCTTTGAATGGGTTCATGTGCAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCC	NA	NA	NA	NA
