The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP022378	Citrobacter portucalensis strain IOMTU157	4987090	271590	306017	4987090	head,transposase,tail,plate	Vibrio_phage(65.71%)	46	NA	NA
WP_164563296.1|271590_273036_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	31.1	4.1e-45
WP_175310230.1|273327_273972_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_109862726.1|274142_274373_+	helix-turn-helix domain-containing protein	NA	M1PVU4	Vibrio_phage	54.8	2.5e-13
WP_164562392.1|274377_276459_+|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A2D1GNK9	Pseudomonas_phage	49.3	8.2e-180
WP_046275139.1|276497_277445_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	78.5	6.0e-138
WP_097471204.1|277447_277687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097471205.1|277689_277977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097471227.1|277999_278617_+	DUF3164 family protein	NA	A0A2I7S9B0	Vibrio_phage	61.5	4.3e-68
WP_046275143.1|278702_279194_+	hypothetical protein	NA	A0A0A7RUP4	Clostridium_phage	35.7	5.3e-05
WP_046275144.1|279183_279732_+	regulatory protein GemA	NA	A0A0C4UQU3	Shigella_phage	49.4	6.3e-39
WP_164562393.1|279728_280121_+	transcriptional regulator	NA	A0A0C4UR27	Shigella_phage	60.2	3.9e-35
WP_164562394.1|280126_280450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164562395.1|280546_281128_+	peptidoglycan-binding protein	NA	A0A2I7S9B9	Vibrio_phage	47.2	1.9e-38
WP_164562396.1|281130_281349_+	hypothetical protein	NA	A0A0C4UQR6	Shigella_phage	69.4	1.7e-24
WP_164562397.1|281341_281749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046275150.1|281736_282342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046275151.1|282338_282569_+	TraR/DksA C4-type zinc finger protein	NA	NA	NA	NA	NA
WP_097471209.1|282549_282852_+	DUF2730 family protein	NA	M1Q558	Vibrio_phage	39.4	5.6e-13
WP_046275180.1|282863_283151_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	58.5	6.0e-25
WP_046275153.1|283153_283429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046275154.1|283418_284000_+	DUF3486 family protein	NA	M4MCR3	Vibrio_phage	57.1	9.9e-51
WP_164562398.1|283996_285589_+	hypothetical protein	NA	M4MHG0	Vibrio_phage	69.7	4.8e-204
WP_164562399.1|285588_287163_+	DUF935 family protein	NA	A0A2I7S9K0	Vibrio_phage	54.8	5.6e-157
WP_164562400.1|287152_287995_+	hypothetical protein	NA	M4M9M5	Vibrio_phage	56.4	3.3e-87
WP_164562401.1|288202_289174_+	peptidase	NA	M1Q578	Vibrio_phage	49.8	7.2e-78
WP_164562402.1|289173_290070_+|head	Mu-like prophage major head subunit gpT family protein	head	M4MB71	Vibrio_phage	58.6	2.3e-94
WP_164562403.1|290154_290631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164562404.1|290630_291071_+	DUF1320 family protein	NA	A0A2I7S9E9	Vibrio_phage	50.0	5.2e-36
WP_161623357.1|291070_291613_+	phage virion morphogenesis protein	NA	A0A2I7S9D7	Vibrio_phage	62.6	1.2e-58
WP_164562405.1|291609_292212_+	hypothetical protein	NA	M4MHF0	Vibrio_phage	39.2	2.1e-35
WP_046275164.1|292208_292406_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_164562406.1|292408_293887_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1Q565	Vibrio_phage	57.7	2.1e-158
WP_164562407.1|293896_294253_+|tail	phage tail tube protein	tail	A0A2I7S9D5	Vibrio_phage	39.0	1.6e-19
WP_046275167.1|294256_294640_+|tail	phage tail assembly protein	tail	M4MB64	Vibrio_phage	46.7	1.0e-19
WP_164562408.1|294738_296526_+|tail	phage tail tape measure protein	tail	M4MHE6	Vibrio_phage	29.8	6.4e-56
WP_164562409.1|296525_297794_+	DNA circularization N-terminal domain-containing protein	NA	A0A2I7S9E8	Vibrio_phage	39.5	6.5e-79
WP_164562410.1|297793_298897_+|tail	phage tail protein	tail	M4M9L5	Vibrio_phage	47.7	1.0e-88
WP_164562411.1|298887_299430_+|plate	phage baseplate assembly protein V	plate	A0A2I7S9F6	Vibrio_phage	40.7	1.0e-28
WP_164562412.1|299426_299879_+	phage GP46 family protein	NA	A0A2I7S9F0	Vibrio_phage	46.1	3.1e-23
WP_164562413.1|299868_300945_+|plate	baseplate J/gp47 family protein	plate	M4MHE1	Vibrio_phage	54.9	3.5e-102
WP_164562414.1|300929_301505_+	DUF2313 domain-containing protein	NA	M1NVS6	Vibrio_phage	49.7	1.6e-53
WP_175310231.1|301516_302401_+	hypothetical protein	NA	A0A1B0V7G4	Salmonella_phage	44.0	2.8e-12
WP_164562415.1|302400_302808_+|tail	tail fiber assembly protein	tail	A0A0M4S6V4	Salmonella_phage	40.4	2.6e-13
WP_164562416.1|302957_303527_+	recombinase family protein	NA	K7PJT4	Enterobacteria_phage	70.3	1.1e-70
WP_003827479.1|303789_304971_-	mannonate dehydratase	NA	NA	NA	NA	NA
WP_003827481.1|304991_306017_-	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L7I1	Tupanvirus	23.6	2.3e-10
>prophage 2
NZ_AP022378	Citrobacter portucalensis strain IOMTU157	4987090	1624099	1756744	4987090	lysis,tRNA,protease,transposase,integrase	Escherichia_phage(20.69%)	106	1664847:1664906	1678492:1679312
WP_032934607.1|1624099_1624597_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_063940544.1|1625010_1625502_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_003027560.1|1625491_1625755_+	chaperone NapD	NA	NA	NA	NA	NA
WP_063940543.1|1625751_1628238_+	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_003834629.1|1628244_1628940_+	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_003027552.1|1628926_1629790_+	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_164562577.1|1629786_1630236_+	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_003027548.1|1630245_1630848_+	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_003834625.1|1630868_1631489_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.0	1.7e-11
WP_003027542.1|1631485_1632145_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_003027538.1|1632221_1632959_+	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_020996676.1|1632955_1633168_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_003834619.1|1633164_1633644_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_063940542.1|1633640_1635596_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_003834613.1|1635592_1636150_+	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_164562578.1|1636146_1637196_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_003834605.1|1637292_1637940_-	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_003834602.1|1638417_1638915_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_164562579.1|1638917_1639250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003834597.1|1639246_1639810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003834595.1|1640682_1642443_-	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
WP_003027506.1|1642474_1642702_-	YejL family protein	NA	NA	NA	NA	NA
WP_003027504.1|1642836_1643844_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	47.6	1.0e-82
WP_003027502.1|1643963_1644248_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_164562580.1|1644372_1646133_-	DEAD/DEAH box helicase family protein	NA	M4Q3N1	Vibrio_phage	41.6	7.1e-100
WP_003834586.1|1646284_1646992_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_003834584.1|1647007_1648198_+	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.4	1.4e-19
WP_085951589.1|1648531_1648876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164562581.1|1648879_1650469_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.4	1.6e-18
WP_164562582.1|1650470_1651496_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_164562583.1|1651495_1652590_-	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_164562584.1|1652590_1654405_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_164562585.1|1654505_1656065_-	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_003834567.1|1656232_1656802_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	S5MM68	Bacillus_phage	37.6	2.3e-12
WP_063940535.1|1657215_1657929_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_164562586.1|1657962_1658949_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_149335135.1|1659068_1660535_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	29.8	5.8e-39
1664847:1664906	attL	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTT	NA	NA	NA	NA
WP_001067855.1|1664898_1665603_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_078310596.1|1665863_1666061_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q716C2	Shigella_phage	57.4	1.2e-11
WP_013851373.1|1666424_1667066_-	tetracycline resistance transcriptional repressor TetR	NA	NA	NA	NA	NA
WP_031942321.1|1667193_1668393_+	tetracycline efflux MFS transporter Tet(A)	NA	A0A2H4UVM2	Bodo_saltans_virus	22.4	8.2e-07
WP_013851371.1|1668907_1669411_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_001067855.1|1669447_1670152_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_071886840.1|1670210_1670678_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_001749967.1|1670682_1670889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072094655.1|1671300_1672704_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	9.0e-106
WP_004098817.1|1672737_1673952_-	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_001389365.1|1674212_1674977_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001144737.1|1675119_1675386_-	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_004201280.1|1675606_1676080_-	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	A0A140HLG8	Bacillus_phage	33.8	5.3e-18
WP_000845039.1|1676235_1677249_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001067855.1|1677794_1678499_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_014386481.1|1679371_1680016_-	quinolone resistance pentapeptide repeat protein QnrB1	NA	NA	NA	NA	NA
1678492:1679312	attR	AAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCTTAATTACCGGTGGGGATTCAGGGATTGGTCGTGCTGTTGCTATTGCCTATGCTCGTGAAGGCGCTGATGTTGCGATTAACTATTTACCTGAAGAAGAAGACGATGCGCGTGAAGTGGTCGATCTGATAAAAAAAGCAGGCAGAAATGTTTTGGCCATCCCCGGAGATATCCGTGATGAGGCTTTTTGCGGTCATCTGGTAACACAGGCGGTAAAAGGACTGGGAGGGTTGGATATCCTCGTCAATAATGCGGGTCGTCAGCAATTTTGTGAGTCAATTGAGGAACTCACCACAGAAGACTTCGACGCAACATTCAAAACCAATGTTTACGCTATGTTTTGGATCACCAAAGCGGCCATACCCCATCTTTCACCAGACAGCGTGATAATTAATACCTCCTCCGTACAGGCTTATGAGCCAAGTGAAATCTTGCTTGATTATGCTCAGACTAAAGCAGCTATCGTGGCATTTACTAAATCGCTGGCGAAACAGCTGGCCCCGAAAGGGATCCGTGTCAATGCCGTCGCGCCGGGTCCATACTGGACTGTACTGCAGTGCTGTGGTGGTCAACCGCAGGAAAAGGTGGAGAAATTTGGGGCAAATGCGCCGCTGGGACGCCCTGGTCAACCGGTGGAAATCGCGCCGCTTTATGTCACCCTGGCCGCTCGGGAGAACAGCTATACGTCTGGTCAGGTCTGGTGTTCTGATGGGGGGACCGGAACCCTCTAACGTTTACGATCTGTGCGTCGAAAGTGACTTTT	NA	NA	NA	NA
WP_004199413.1|1680588_1683606_-|transposase	Tn3-like element IS3000 family transposase	transposase	NA	NA	NA	NA
WP_001334766.1|1686014_1686845_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_002063889.1|1689154_1689697_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_151295361.1|1690909_1691593_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	4.6e-132
WP_142437948.1|1693910_1694243_+	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_000608644.1|1695419_1696682_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_001143771.1|1696862_1697081_-	DUF4158 domain-containing protein	NA	Q1MVP5	Enterobacteria_phage	100.0	4.4e-36
WP_001235713.1|1697244_1697802_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|1697984_1698845_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_000480968.1|1699565_1700402_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|1700401_1701205_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_001043260.1|1701265_1702081_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_000954592.1|1702410_1702587_+	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_164562587.1|1702797_1703772_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_124036660.1|1705668_1706364_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	6.2e-132
WP_164562588.1|1715343_1716816_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_164562589.1|1716980_1718114_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_164562590.1|1718123_1720622_+	trimethylamine-N-oxide reductase TorA	NA	NA	NA	NA	NA
WP_164562591.1|1720611_1721244_+	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_003027452.1|1721299_1721872_-	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_081364641.1|1722029_1722284_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_003834548.1|1722280_1723462_-	sugar efflux transporter SetB	NA	NA	NA	NA	NA
WP_175310228.1|1723564_1723810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003834546.1|1723830_1724961_+	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_003834544.1|1724960_1725899_+	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_003834542.1|1725915_1727604_+	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_063940523.1|1727710_1729009_-	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_020996671.1|1729084_1729804_-	amino acid racemase	NA	NA	NA	NA	NA
WP_020996669.1|1730156_1731068_+	hypochlorite stress DNA-binding transcriptional regulator HypT	NA	NA	NA	NA	NA
WP_003834523.1|1731100_1731958_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	33.3	4.4e-23
WP_003834521.1|1732029_1733079_-	YeiH family protein	NA	NA	NA	NA	NA
WP_003834519.1|1733323_1734205_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003834517.1|1734400_1735870_+	lysine-specific permease	NA	NA	NA	NA	NA
WP_003834514.1|1735935_1737921_-	ligand-gated channel protein	NA	A0A0P0I887	Acinetobacter_phage	32.6	4.5e-10
WP_003834512.1|1738200_1739037_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_003027410.1|1739359_1740028_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.8	4.1e-56
WP_164562592.1|1740042_1741200_+	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_003834506.1|1741344_1742370_+	HTH-type transcriptional regulator GalS	NA	NA	NA	NA	NA
WP_003027399.1|1742663_1743662_+	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_003027396.1|1743733_1745254_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	32.8	3.4e-10
WP_003027393.1|1745269_1746280_+	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_003834502.1|1746331_1746571_-	DUF2542 family protein	NA	NA	NA	NA	NA
WP_003027383.1|1746573_1747293_-	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_164562593.1|1747456_1748341_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_003027380.1|1748489_1749185_-|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_003834497.1|1749181_1749586_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_164562594.1|1749717_1750626_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003834494.1|1750752_1752111_+	aromatic acid/H+ symport family MFS transporter	NA	NA	NA	NA	NA
WP_003834492.1|1752122_1753160_+	gentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_003834490.1|1753175_1753877_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_003834489.1|1753885_1754530_+	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_063940515.1|1754544_1755738_+	3-hydroxybenzoate 6-monooxygenase	NA	NA	NA	NA	NA
WP_003834483.1|1755799_1756744_+|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
>prophage 3
NZ_AP022378	Citrobacter portucalensis strain IOMTU157	4987090	1768573	1777200	4987090	tRNA	Enterobacteria_phage(66.67%)	9	NA	NA
WP_003834466.1|1768573_1769521_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	25.3	1.7e-07
WP_003834464.1|1769504_1770236_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003027354.1|1770216_1770324_-	protein YohO	NA	NA	NA	NA	NA
WP_003027351.1|1770583_1771315_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	93.5	1.0e-105
WP_003834458.1|1771540_1773226_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.6	6.7e-281
WP_003834456.1|1773222_1773942_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_003834454.1|1773988_1774459_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	77.4	1.8e-63
WP_003834453.1|1774502_1774961_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	69.3	1.6e-51
WP_164562595.1|1775166_1777200_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	5.2e-54
>prophage 4
NZ_AP022378	Citrobacter portucalensis strain IOMTU157	4987090	1815614	1825182	4987090	protease,tRNA	Bacillus_phage(28.57%)	8	NA	NA
WP_003834285.1|1815614_1817561_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.8	1.4e-40
WP_003834283.1|1817635_1817860_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.7	3.6e-17
WP_003036810.1|1818182_1818503_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	3.5e-13
WP_003036804.1|1818533_1820810_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	1.4e-164
WP_003834280.1|1821078_1822440_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	92.9	1.8e-204
WP_003834279.1|1822599_1822932_-	YegP family protein	NA	NA	NA	NA	NA
WP_164562605.1|1823059_1823782_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	32.7	9.2e-30
WP_003834277.1|1823778_1825182_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.2	2.3e-32
>prophage 5
NZ_AP022378	Citrobacter portucalensis strain IOMTU157	4987090	1867023	1875196	4987090		Enterobacteria_phage(50.0%)	7	NA	NA
WP_164562620.1|1867023_1868418_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	34.2	2.8e-22
WP_125112554.1|1868583_1869477_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	39.7	1.6e-44
WP_125112553.1|1869846_1870932_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.6	7.4e-100
WP_125112552.1|1870931_1871831_+	dTDP-4-dehydrorhamnose reductase	NA	A0A140G5S3	Enterobacteria_phage	34.6	2.6e-29
WP_125112551.1|1871881_1872748_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.4	1.0e-104
WP_125112550.1|1872858_1874088_+	flippase	NA	NA	NA	NA	NA
WP_125112549.1|1874101_1875196_+	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	62.0	2.3e-133
>prophage 6
NZ_AP022378	Citrobacter portucalensis strain IOMTU157	4987090	2079843	2088753	4987090		Organic_Lake_phycodnavirus(16.67%)	8	NA	NA
WP_175310235.1|2079843_2081898_+	oligopeptidase B	NA	F2Y2Z7	Organic_Lake_phycodnavirus	36.3	6.2e-31
WP_164562673.1|2081888_2082551_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	32.4	5.3e-08
WP_063940873.1|2082574_2083231_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_003034925.1|2083337_2083568_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	1.0e-14
WP_019076528.1|2083716_2085468_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	33.3	7.2e-44
WP_164563304.1|2085912_2086635_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_115601972.1|2086918_2087497_-	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	37.7	1.1e-17
WP_003844140.1|2087850_2088753_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	34.0	5.5e-16
>prophage 7
NZ_AP022378	Citrobacter portucalensis strain IOMTU157	4987090	2249639	2364209	4987090	coat,transposase,tail,terminase,integrase	Escherichia_phage(34.38%)	122	2300612:2300671	2350093:2350912
WP_003833361.1|2249639_2250476_+	ion transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	40.0	1.4e-08
WP_003020691.1|2250513_2250843_-	YciU family protein	NA	NA	NA	NA	NA
WP_003833359.1|2250877_2252338_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_003020684.1|2252480_2252654_+	YciY family protein	NA	NA	NA	NA	NA
WP_164562695.1|2252909_2254103_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PGY1	Enterobacteria_phage	84.4	6.7e-203
WP_008322518.1|2254095_2254296_-	hypothetical protein	NA	K7PM28	Enterobacteria_phage	82.5	1.9e-25
WP_164562696.1|2254341_2254584_-	DUF4060 family protein	NA	K7PHF4	Enterobacteria_phage	87.3	4.3e-32
WP_164562697.1|2254623_2255715_-	recombinase RecT	NA	K7P7N5	Enterobacteria_phage	58.8	7.0e-114
WP_164562698.1|2255727_2258580_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	K7P6V4	Enterobacteria_phage	58.5	1.6e-279
WP_164562699.1|2258719_2258881_-	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	92.5	1.3e-21
WP_016156718.1|2258892_2259099_-	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	98.5	1.6e-32
WP_019076927.1|2259426_2259651_+	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	64.7	1.2e-15
WP_065554613.1|2259681_2260443_-	KilA-N domain-containing protein	NA	A0A1L2BWW1	Bacteriophage	46.3	8.5e-10
WP_047418097.1|2260511_2261267_-	helix-turn-helix transcriptional regulator	NA	A0A2I6PIE7	Escherichia_phage	54.3	1.1e-70
WP_019076923.1|2261302_2261530_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	56.3	2.4e-16
WP_060643426.1|2261561_2262101_+	regulator	NA	K7PJT7	Enterobacteria_phage	84.4	1.0e-78
WP_008322485.1|2262268_2263216_+	phage protein	NA	G9L6A8	Escherichia_phage	30.1	6.4e-23
WP_054528491.1|2263218_2263968_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	87.1	2.5e-123
WP_164562700.1|2263986_2264298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164562701.1|2264674_2265058_+	ead/Ea22-like family protein	NA	K7PJQ4	Enterobacteria_phage	46.0	3.0e-11
WP_164562702.1|2265261_2265549_+	hypothetical protein	NA	A0A1I9LJM1	Stx_converting_phage	78.9	4.0e-37
WP_171859136.1|2265861_2266401_+	DUF551 domain-containing protein	NA	K7P7E4	Enterobacteria_phage	56.5	2.8e-39
WP_016156704.1|2266629_2266887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_175310237.1|2268961_2269144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164562703.1|2269143_2269317_+	hypothetical protein	NA	G8C7V1	Escherichia_phage	52.8	3.8e-06
WP_175310238.1|2269336_2269843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057064565.1|2270017_2270218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164562705.1|2270318_2270921_+	DUF1367 family protein	NA	A0A0M4QX23	Salmonella_phage	92.5	1.2e-104
WP_164562706.1|2270920_2271127_+	hypothetical protein	NA	K7PJT9	Enterobacteria_phage	78.8	8.7e-26
WP_164562707.1|2271129_2271738_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	67.2	1.3e-48
WP_164562708.1|2271870_2272653_+	antitermination protein	NA	K7PKS8	Enterobacteria_phage	76.1	1.3e-114
WP_016150024.1|2273086_2273365_+	hypothetical protein	NA	K7PGZ9	Enterobacteria_phage	97.8	5.1e-45
WP_175310254.1|2273342_2273909_+	lysozyme	NA	K7P7Q3	Enterobacteria_phage	92.6	5.6e-99
WP_164562710.1|2273908_2274427_+	DUF2514 family protein	NA	NA	NA	NA	NA
WP_164562711.1|2274456_2274681_+	hypothetical protein	NA	A0A2H4J182	uncultured_Caudovirales_phage	57.5	1.1e-18
WP_164562712.1|2275186_2275657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164562713.1|2275679_2276252_+|terminase	terminase small subunit	terminase	I6PDJ6	Cronobacter_phage	83.2	1.3e-66
WP_164562714.1|2276248_2277820_+|terminase	terminase	terminase	G8C7P3	Escherichia_phage	92.7	3.9e-307
WP_164562715.1|2277824_2279228_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	89.4	3.3e-241
WP_164562716.1|2279229_2280336_+	hypothetical protein	NA	G8C7P5	Escherichia_phage	90.5	2.7e-190
WP_158513308.1|2280338_2280482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164562717.1|2280607_2281360_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	80.8	2.2e-106
WP_126957528.1|2281377_2282517_+|coat	P22 coat - protein 5 family protein	coat	G8C7P7	Escherichia_phage	84.8	1.5e-175
WP_164562718.1|2282556_2282742_+	hypothetical protein	NA	G8C7P8	Escherichia_phage	95.1	1.2e-26
WP_164562719.1|2282744_2283227_+	hypothetical protein	NA	G8C7P9	Escherichia_phage	87.5	3.5e-78
WP_164562720.1|2283228_2283582_+	hypothetical protein	NA	G8C7Q0	Escherichia_phage	90.5	6.4e-53
WP_164562721.1|2283583_2284183_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	87.4	1.9e-97
WP_038641028.1|2284172_2284622_+	DUF4128 domain-containing protein	NA	G8C7Q2	Escherichia_phage	76.5	6.3e-61
WP_164562722.1|2284668_2285601_+	immunoglobulin domain-containing protein	NA	G8C7Q3	Escherichia_phage	91.3	7.0e-155
WP_164562723.1|2285642_2285981_+	hypothetical protein	NA	G8C7Q5	Escherichia_phage	88.4	2.6e-51
WP_164562724.1|2285998_2286286_+	DUF1799 domain-containing protein	NA	I6PD79	Cronobacter_phage	66.2	2.2e-19
WP_164562725.1|2286285_2289333_+|tail	phage tail tape measure protein	tail	G8C7Q6	Escherichia_phage	63.3	0.0e+00
WP_164562726.1|2289435_2289918_+	hypothetical protein	NA	M9NZH8	Enterobacteria_phage	59.2	1.7e-40
WP_175310239.1|2289925_2290549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016156674.1|2291025_2291205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164562728.1|2291215_2291713_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_164562729.1|2291791_2292142_+|tail	phage tail protein	tail	G8C7R0	Escherichia_phage	91.4	2.6e-54
WP_164562730.1|2292150_2292924_+|tail	phage minor tail protein L	tail	G8C7R1	Escherichia_phage	88.6	5.3e-132
WP_164562731.1|2292936_2293668_+	Mov34/MPN/PAD-1 family protein	NA	G8C7R2	Escherichia_phage	89.7	4.2e-139
2300612:2300671	attL	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTT	NA	NA	NA	NA
WP_001067855.1|2300663_2301368_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000174662.1|2301844_2302609_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	52.4	1.9e-25
WP_000182008.1|2303073_2303751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001071437.1|2303781_2304405_-	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_000778342.1|2304935_2305631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007372356.1|2305806_2306064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000981293.1|2306090_2306918_-	ParA family protein	NA	B0ZSI1	Halomonas_phage	28.8	5.1e-08
WP_000151478.1|2307096_2308032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001804960.1|2308785_2309256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001804963.1|2309427_2309571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217270.1|2309777_2311607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000215804.1|2311776_2314464_-	hypothetical protein	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	19.7	8.2e-07
WP_001270901.1|2314615_2315446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085954987.1|2315561_2315750_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000139428.1|2316830_2317544_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000699996.1|2317592_2317859_+	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000103071.1|2318160_2320137_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_001120775.1|2320423_2320699_+	formaldehyde-responsive transcriptional repressor FrmR	NA	NA	NA	NA	NA
WP_000842119.1|2320757_2321867_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.3	1.8e-32
WP_000070400.1|2321917_2322316_+	VOC family protein	NA	NA	NA	NA	NA
WP_000664785.1|2322473_2323808_+	DUF3422 family protein	NA	NA	NA	NA	NA
WP_000440264.1|2323855_2324686_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000233327.1|2324703_2326014_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000038427.1|2326217_2328869_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	33.8	2.1e-156
WP_000765646.1|2329060_2329492_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_001141269.1|2329856_2330132_+	formaldehyde-responsive transcriptional repressor FrmR	NA	NA	NA	NA	NA
WP_007372360.1|2330817_2331969_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_000859348.1|2332129_2332276_-	DUF2474 domain-containing protein	NA	NA	NA	NA	NA
WP_007372361.1|2332301_2333312_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_007372362.1|2333311_2334721_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_164562732.1|2335700_2336081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007372364.1|2336612_2336903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022646506.1|2336899_2337937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022646507.1|2338212_2338476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022646508.1|2338472_2339039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042863091.1|2340144_2340627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052215425.1|2340637_2341390_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_042863090.1|2341666_2342272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042863089.1|2342399_2342729_-	multidrug transporter	NA	NA	NA	NA	NA
WP_171817557.1|2342863_2343304_-	SgcJ/EcaC family oxidoreductase	NA	NA	NA	NA	NA
WP_022646510.1|2344333_2344498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000831397.1|2344555_2344924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000896835.1|2345607_2346975_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.1	3.8e-16
WP_003026030.1|2346950_2347619_-	response regulator	NA	NA	NA	NA	NA
WP_001805638.1|2347704_2348481_-	membrane protein	NA	NA	NA	NA	NA
WP_001067855.1|2350144_2350849_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001572372.1|2351014_2351491_-	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
2350093:2350912	attR	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTTCAAAAACTCTGCTTACCAGGCGCATTTCGCCCAGGGGATCACCATAATAAAATGCTGAGGCCTGGCCTTTGCGTAGTGCACGCATCACCTCAATACCTTTGATGGTGGCGTAAGCCGTCTTCATGGATTTAAATCCCAGCGTGGCGCCGATTATCCGTTTCAGTTTGCCATGATCGCATTCAATCACGTTGTTCCGGTACTTAATCTGTCGGTGTTCAACGTCAGACGGGCACCGGCCTTCGCGTTTGAGCAGAGCAAGCGCGCGACCATAGGCGGGCGCTTTATCCGTGTTGATGAATCGCGGGATCTGCCACTTCTTCACGTTGTTGAGGATTTTACCCAGAAACCGGTATGCAGCTTTGCTGTTACGACGGGAGGAGAGATAAAAATCGACAGTGCGGCCCCGGCTGTCGACGGCCCGGTACAGATACGCCCAGCGGCCATTGACCTTCACGTAGGTTTCATCCATGTGCCACGGGCAAAGATCGGAAGGGTTACGCCAGTACCAGCGCAGCCGTTTTTCCATTTCAGGCGCATAACGCTGAACCCAGCGGTAAATCGTGGAGTGATCGACATTCACTCCGCGTTCAGCCAGCATCTCCTGCAGCTCACGGTAACTGATGCCGTATTTGCAGTACCAGCGTACGGCCCACAGAATGATGTCACGCTGAAAATGCCGGCCTTTGAATGGGTTCATGTGCAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCC	NA	NA	NA	NA
WP_164562733.1|2351567_2352905_-	phosphoethanolamine--lipid A transferase	NA	NA	NA	NA	NA
WP_072196614.1|2352978_2353947_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.8	1.1e-184
WP_004248839.1|2353985_2355332_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.6	8.8e-18
WP_000723070.1|2355549_2355984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001572377.1|2356241_2357357_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019951.1|2357479_2357752_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_003826224.1|2358362_2358677_+	hypothetical protein	NA	K7PHM8	Enterobacterial_phage	51.9	3.3e-24
WP_164562734.1|2358676_2359351_+	hypothetical protein	NA	K7PGV3	Enterobacterial_phage	49.8	1.8e-48
WP_164562735.1|2359459_2359699_+	cor protein	NA	K7PLZ0	Enterobacterial_phage	57.1	9.1e-19
WP_164562736.1|2359756_2361115_+|tail	phage tail protein	tail	A0A1V0E5M2	Salmonella_phage	50.5	3.6e-112
WP_008322426.1|2361249_2361492_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	76.6	4.4e-29
WP_003841689.1|2361570_2361903_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	54.2	2.3e-20
WP_048217473.1|2362094_2362505_+	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_126957515.1|2362590_2362830_-	DinI family protein	NA	K7P797	Enterobacteria_phage	93.7	2.6e-34
WP_008323363.1|2363150_2363540_+	DNA polymerase V	NA	Q1MVE7	Enterobacteria_phage	72.9	2.7e-52
WP_149335268.1|2363540_2364209_-	SOS response-associated peptidase family protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.4	1.4e-80
>prophage 8
NZ_AP022378	Citrobacter portucalensis strain IOMTU157	4987090	2845405	2886340	4987090	tRNA,coat,head,tail,terminase,integrase	Cronobacter_phage(37.84%)	49	2858992:2859014	2886521:2886543
WP_164562864.1|2845405_2846185_+	heme ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	7.2e-12
WP_003832593.1|2846181_2847624_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	35.3	1.0e-51
WP_164562865.1|2847685_2848399_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_164562866.1|2848717_2849182_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.2	3.5e-14
WP_164562867.1|2849259_2850009_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	30.3	9.3e-09
WP_003832585.1|2850008_2850560_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_003832584.1|2850620_2851601_-	vitamin B12 ABC transporter permease BtuC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	24.8	6.7e-15
WP_003030571.1|2851722_2852022_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_164562868.1|2852026_2854414_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003832580.1|2854429_2855413_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_001386830.1|2855612_2855657_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_003030578.1|2855782_2856139_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_003030583.1|2856194_2856392_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_048997935.1|2856488_2857031_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	8.2e-15
WP_164562869.1|2857034_2858963_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.8	4.4e-127
2858992:2859014	attL	ACACGTAAGATCACATACAAAGA	NA	NA	NA	NA
WP_164562870.1|2859217_2860462_+	acyltransferase family protein	NA	Q716G0	Shigella_phage	28.8	1.6e-18
WP_175310242.1|2860560_2861226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164562872.1|2861276_2862365_-	hypothetical protein	NA	A0A2H5BPB7	Salmonella_phage	51.1	4.7e-62
WP_126956207.1|2862422_2864909_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	56.2	2.7e-270
WP_126956205.1|2864868_2865288_-	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	61.9	1.3e-44
WP_109174257.1|2865280_2865751_-	hypothetical protein	NA	R9TPR6	Aeromonas_phage	56.4	1.3e-45
WP_164563318.1|2865750_2866251_-	hypothetical protein	NA	F1C5F0	Cronobacter_phage	64.9	1.0e-56
WP_164562873.1|2866250_2869190_-|tail	phage tail length tape measure family protein	tail	F1C5E9	Cronobacter_phage	42.7	9.3e-137
WP_164562874.1|2869202_2869874_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	48.9	2.2e-54
WP_164562875.1|2869931_2870705_-	hypothetical protein	NA	F1C5E5	Cronobacter_phage	82.7	1.3e-74
WP_164562876.1|2870765_2871149_-	hypothetical protein	NA	F1C5E4	Cronobacter_phage	65.4	6.1e-41
WP_164562877.1|2871145_2871610_-	HK97 gp10 family phage protein	NA	A0A2P1MXA4	Escherichia_phage	44.8	2.0e-30
WP_006808949.1|2871612_2871963_-	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	67.0	8.9e-39
WP_006820518.1|2871962_2872136_-	hypothetical protein	NA	Q5G8X7	Enterobacteria_phage	49.1	7.8e-12
WP_164562878.1|2872132_2872411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164562879.1|2872410_2872791_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	52.8	1.0e-27
WP_164562880.1|2872793_2873195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164562881.1|2873204_2874281_-|coat	phage coat protein	coat	F1C5E1	Cronobacter_phage	76.5	2.0e-158
WP_063159381.1|2874292_2874733_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	63.7	9.8e-43
WP_164562882.1|2874736_2876125_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	59.0	6.5e-149
WP_164562337.1|2876186_2877023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164562883.1|2876949_2877945_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	68.0	1.8e-113
WP_164562884.1|2877871_2879341_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	57.2	9.6e-151
WP_164562885.1|2879353_2880829_-|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	75.6	7.0e-226
WP_164562886.1|2880838_2881288_-	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	84.5	1.4e-55
WP_164562887.1|2881320_2881959_-	hypothetical protein	NA	I6S676	Salmonella_phage	89.6	5.0e-112
WP_164562888.1|2881962_2882169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059291152.1|2882284_2882713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164562889.1|2883422_2883584_+	TraR/DksA C4-type zinc finger protein	NA	A0A0N7C211	Escherichia_phage	60.9	2.6e-09
WP_164562890.1|2883583_2883808_+	hypothetical protein	NA	A0A222YYR6	Escherichia_phage	85.1	5.7e-31
WP_164562891.1|2883804_2884149_+	hypothetical protein	NA	I3PV00	Vibrio_phage	52.4	4.4e-22
WP_164562892.1|2884187_2884562_+	hypothetical protein	NA	A0A2I6PID6	Escherichia_phage	57.9	3.5e-33
WP_032936075.1|2884937_2885174_+	hypothetical protein	NA	A0A1P8DTG1	Proteus_phage	53.7	3.3e-13
WP_164562893.1|2885131_2886340_-|integrase	tyrosine-type recombinase/integrase	integrase	I6R9B6	Salmonella_phage	76.4	4.7e-180
2886521:2886543	attR	ACACGTAAGATCACATACAAAGA	NA	NA	NA	NA
>prophage 1
NZ_AP023051	Citrobacter portucalensis strain IOMTU157 plasmid pIOMTU157, complete sequence	174206	99833	130115	174206	transposase,integrase	Salmonella_phage(27.27%)	30	101984:101998	131009:131023
WP_000608644.1|99833_101096_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
101984:101998	attL	GAAGCAATGGAAGAA	NA	NA	NA	NA
WP_000050847.1|102625_102829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000071870.1|102900_103506_+	5'-deoxynucleotidase	NA	NA	NA	NA	NA
WP_000184110.1|103498_103768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000260293.1|103781_104000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000064432.1|104073_104631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000595210.1|104705_105557_+	hypothetical protein	NA	A0A219UQS0	Bacillus_phage	29.4	3.6e-09
WP_001077336.1|106015_106402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000122922.1|106579_108307_+	toprim domain-containing protein	NA	A0A0P0ZFY3	Escherichia_phage	32.6	9.9e-14
WP_000268337.1|108293_108572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000714163.1|108644_108866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000427620.1|109047_110052_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_001138073.1|110130_113103_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
WP_001162012.1|113105_113663_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_000845039.1|113968_114982_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001083725.1|115126_115624_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_001336345.1|115735_116026_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001206356.1|116031_116823_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_110498862.1|116986_117334_+	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
WP_000259031.1|117327_118167_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000050481.1|118571_120113_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_004201164.1|120438_121251_+	subclass B1 metallo-beta-lactamase NDM-1	NA	NA	NA	NA	NA
WP_004201167.1|121254_121620_+	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_004201168.1|121624_122263_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_004201169.1|122273_123305_-	protein-disulfide reductase DsbD N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004201171.1|123309_123639_-	divalent-cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_004201172.1|123832_124123_+	co-chaperone GroES	NA	A0A221S322	uncultured_virus	47.8	2.1e-17
WP_004201176.1|124178_125819_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	62.1	8.2e-175
WP_000259031.1|127329_128169_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000050481.1|128573_130115_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
131009:131023	attR	GAAGCAATGGAAGAA	NA	NA	NA	NA
