The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP019817	Enterobacter hormaechei subsp. hoffmannii strain OIPH-N069	4689117	919525	929159	4689117	integrase	Streptococcus_phage(33.33%)	10	918562:918575	929404:929417
918562:918575	attL	GCCTGAAGGTTTTG	NA	NA	NA	NA
WP_015571369.1|919525_920629_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.9	1.0e-59
WP_022647151.1|920640_921894_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.6	2.3e-97
WP_022647152.1|922234_923407_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	49.5	3.8e-110
WP_071785223.1|923403_923580_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_022647154.1|923588_924983_-	DEAD/DEAH box helicase	NA	Q3LZN8	Bacteriophage	73.7	1.7e-213
WP_022647155.1|925015_925723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032621500.1|925719_925995_-	VRR-NUC domain-containing protein	NA	B6SD64	Bacteriophage	64.7	2.3e-26
WP_022647157.1|925984_926206_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032621498.1|926271_927030_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_022647159.1|927086_929159_-	hypothetical protein	NA	Q775A3	Bordetella_phage	67.7	3.1e-272
929404:929417	attR	GCCTGAAGGTTTTG	NA	NA	NA	NA
>prophage 2
NZ_AP019817	Enterobacter hormaechei subsp. hoffmannii strain OIPH-N069	4689117	936028	942100	4689117	holin	Shigella_phage(33.33%)	7	NA	NA
WP_022647167.1|936028_937723_+	hypothetical protein	NA	A0A0A6Z575	Enterobacter_phage	38.4	1.0e-50
WP_022647168.1|938068_939529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022647169.1|939521_940445_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	88.1	2.4e-155
WP_022647170.1|940441_940804_-	GtrA family protein	NA	U5P0S6	Shigella_phage	56.7	8.7e-29
WP_022647171.1|940990_941221_+|holin	class II holin family protein	holin	A5LH82	Enterobacteria_phage	71.0	2.2e-22
WP_022647172.1|941201_941741_+	lysozyme	NA	H6WRZ4	Salmonella_phage	89.9	9.7e-93
WP_022647173.1|941737_942100_+	hypothetical protein	NA	R9TPM9	Aeromonas_phage	46.2	6.0e-14
>prophage 3
NZ_AP019817	Enterobacter hormaechei subsp. hoffmannii strain OIPH-N069	4689117	2022909	2030012	4689117		Escherichia_phage(83.33%)	8	NA	NA
WP_022647975.1|2022909_2023569_+	type A chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	62.1	2.4e-77
WP_022647976.1|2023625_2023937_-	YebG family protein	NA	NA	NA	NA	NA
WP_022647977.1|2024045_2024660_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	33.7	2.8e-27
WP_022647978.1|2024705_2025560_-	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	34.6	5.8e-23
WP_022647979.1|2025561_2026179_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.6	4.0e-74
WP_022647980.1|2026189_2028619_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.9	2.4e-215
WP_006808860.1|2028749_2029055_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_022647981.1|2029157_2030012_-	beta-1,4-mannosyl-glycoprotein beta-1,4-N-acetylglucosaminyltransferase	NA	M1I711	Paramecium_bursaria_Chlorella_virus	32.5	3.1e-24
>prophage 4
NZ_AP019817	Enterobacter hormaechei subsp. hoffmannii strain OIPH-N069	4689117	2036344	2047709	4689117		Morganella_phage(33.33%)	12	NA	NA
WP_022647989.1|2036344_2037808_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	30.3	1.9e-45
WP_003857405.1|2037852_2038056_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	56.7	4.4e-14
WP_022647990.1|2038343_2038775_+	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	35.2	1.5e-16
WP_003857403.1|2038810_2039497_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_022647991.1|2039587_2040334_-	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_022647992.1|2040477_2042511_+	peptidyl-dipeptidase Dcp	NA	A0A1V0SIU1	Klosneuvirus	20.5	1.1e-19
WP_071785206.1|2043125_2043353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022647994.1|2043915_2044134_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	62.7	8.3e-19
WP_022647995.1|2044501_2045191_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.5	2.2e-81
WP_006808847.1|2045453_2045693_-	DinI family protein	NA	K7PKM2	Enterobacterial_phage	91.1	1.5e-32
WP_022647996.1|2046019_2046439_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	56.7	7.2e-35
WP_032622206.1|2046440_2047709_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	90.8	2.1e-226
>prophage 5
NZ_AP019817	Enterobacter hormaechei subsp. hoffmannii strain OIPH-N069	4689117	3136061	3219133	4689117	capsid,holin,terminase,integrase,portal,head,tRNA,protease,tail	Enterobacterial_phage(27.78%)	90	3168312:3168326	3208087:3208101
WP_001286071.1|3136061_3136874_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_022648855.1|3136873_3137887_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_022648856.1|3137954_3139091_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	27.3	5.2e-19
WP_022648857.1|3139202_3140207_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_022648858.1|3140291_3141470_-	MFS transporter	NA	NA	NA	NA	NA
WP_022648859.1|3141538_3142756_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_022648860.1|3142914_3144912_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_022648861.1|3144977_3145253_-	YfcL family protein	NA	NA	NA	NA	NA
WP_022648862.1|3145266_3145812_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_022648863.1|3145811_3146621_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_003861385.1|3146620_3147445_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_022648864.1|3147447_3148533_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.6	3.2e-87
WP_022648865.1|3148593_3149526_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_022648866.1|3149671_3150223_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_003861375.1|3150269_3150755_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_022648867.1|3150964_3153112_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_022648868.1|3153111_3154422_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_022648869.1|3154659_3154944_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_022648870.1|3155316_3156600_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_022648871.1|3156644_3157397_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_022648872.1|3157711_3158641_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	83.6	4.8e-140
WP_032623294.1|3158901_3159168_+	DinI family protein	NA	K7P797	Enterobacteria_phage	95.5	1.4e-39
WP_032623293.1|3159261_3160545_-	hypothetical protein	NA	K7PHF0	Enterobacteria_phage	62.1	1.1e-150
WP_022648876.1|3160948_3161626_-	hypothetical protein	NA	K7PGV3	Enterobacterial_phage	96.4	6.0e-116
WP_022648877.1|3161625_3161928_-	hypothetical protein	NA	K7PJS1	Enterobacterial_phage	97.0	1.3e-49
WP_164597139.1|3161927_3165479_-	DUF1983 domain-containing protein	NA	Q9MCU0	Escherichia_phage	71.3	0.0e+00
WP_022648879.1|3165531_3166116_-|tail	tail assembly protein	tail	A0A1P8DTG7	Proteus_phage	52.6	1.9e-54
WP_022648880.1|3166115_3166826_-	C40 family peptidase	NA	F1C573	Cronobacter_phage	69.8	1.5e-96
WP_022648881.1|3166828_3167587_-|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	63.6	2.3e-95
WP_022648882.1|3167583_3167922_-|tail	phage tail protein	tail	K7PKL8	Enterobacterial_phage	59.8	7.3e-38
WP_058671105.1|3167924_3171416_-|tail	phage tail tape measure protein	tail	A0A2H4JHR1	uncultured_Caudovirales_phage	84.0	0.0e+00
3168312:3168326	attL	CGCGCCAGCATTCTG	NA	NA	NA	NA
WP_022648884.1|3171462_3171798_-	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	92.8	3.4e-51
WP_032619858.1|3171853_3172132_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	95.7	1.8e-42
WP_001549114.1|3172140_3172524_-|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	93.7	4.4e-63
WP_006809155.1|3172532_3172976_-	hypothetical protein	NA	K7PHL2	Enterobacterial_phage	93.8	4.6e-72
WP_022648886.1|3173035_3173383_-	DUF3168 domain-containing protein	NA	Q9MCS8	Enterobacteria_phage	99.1	3.8e-58
WP_022648887.1|3173379_3173829_-	HK97 gp10 family phage protein	NA	K7P6X4	Enterobacteria_phage	98.7	2.9e-74
WP_022648888.1|3173825_3174164_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	73.2	6.0e-40
WP_022648889.1|3174172_3174499_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	81.5	1.3e-47
WP_022648890.1|3174541_3175753_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	85.5	1.7e-193
WP_022648891.1|3175762_3176611_-|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	92.9	3.7e-139
WP_022648892.1|3176624_3177929_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	94.0	4.3e-235
WP_042889604.1|3177928_3179665_-|terminase	terminase large subunit	terminase	K7PKT2	Enterobacteria_phage	99.5	0.0e+00
WP_022648894.1|3179664_3180162_-|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	85.5	1.6e-73
WP_042889602.1|3180319_3180670_-	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	81.9	9.2e-52
WP_042889601.1|3180669_3181248_-	hypothetical protein	NA	S4TR53	Salmonella_phage	71.7	8.0e-77
WP_157843586.1|3181241_3181823_-	HNH endonuclease	NA	A0A1W6DXY0	Salmonella_phage	37.0	1.5e-14
WP_042889600.1|3181881_3183339_-	glycosyl transferase	NA	K7PKP3	Enterobacterial_phage	94.4	1.6e-278
WP_032671404.1|3183529_3183820_+	lipoprotein bor	NA	C6ZCX3	Enterobacteria_phage	62.9	6.3e-30
WP_042889599.1|3183929_3184211_-	hypothetical protein	NA	G8C7W3	Escherichia_phage	95.7	3.0e-45
WP_032622297.1|3184416_3184686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022648900.1|3184693_3185323_-	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	87.1	1.5e-100
WP_022648766.1|3185322_3185604_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	93.5	4.1e-42
WP_022648767.1|3185590_3185986_-	phage membrane protein	NA	K7PHB9	Enterobacterial_phage	99.2	9.1e-64
WP_022648901.1|3186141_3186720_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	52.8	2.8e-45
WP_032622304.1|3186732_3187722_-	DUF968 domain-containing protein	NA	K7PJS6	Enterobacterial_phage	89.7	1.9e-179
WP_022648903.1|3187718_3188444_-	hypothetical protein	NA	G0ZND1	Cronobacter_phage	52.7	6.4e-55
WP_022648904.1|3188459_3188849_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PKN5	Enterobacterial_phage	95.2	1.2e-65
WP_022648905.1|3188845_3189166_-	hypothetical protein	NA	K7PHB4	Enterobacterial_phage	79.2	7.6e-45
WP_022648906.1|3189162_3189390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022648907.1|3189386_3190046_-	adenine-specific DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	81.3	2.9e-99
WP_022648908.1|3190045_3190540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022648909.1|3190536_3191463_-	hypothetical protein	NA	K7PLZ7	Enterobacterial_phage	56.7	5.8e-69
WP_164597142.1|3191419_3191632_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	63.5	2.5e-12
WP_100170040.1|3191873_3192344_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	96.8	2.6e-78
WP_023337114.1|3192385_3192604_-	hypothetical protein	NA	A0A2K8HL98	Pseudomonas_phage	60.3	4.9e-11
WP_063618115.1|3192702_3193422_+	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	62.5	6.9e-78
WP_100170740.1|3193947_3194127_-	hypothetical protein	NA	S5FM78	Shigella_phage	55.9	6.2e-12
WP_113652471.1|3194973_3195801_+	chromosome partitioning protein ParB	NA	K7PKM7	Enterobacterial_phage	88.5	1.6e-126
WP_113652473.1|3196492_3196885_+	ead/Ea22-like family protein	NA	B9UDM4	Salmonella_phage	41.4	5.0e-22
WP_022648919.1|3196886_3197129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080396514.1|3197648_3198086_+	DUF550 domain-containing protein	NA	K7PGV7	Enterobacterial_phage	78.0	1.2e-48
WP_063132000.1|3198143_3198353_+	hypothetical protein	NA	G3CFG7	Escherichia_phage	59.6	4.5e-14
WP_022648923.1|3198336_3199506_-|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	84.6	4.0e-200
WP_168713920.1|3200021_3200942_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.3	1.8e-75
WP_099458937.1|3201301_3201373_+	membrane protein YpdK	NA	NA	NA	NA	NA
WP_022648925.1|3201430_3202666_-	alanine transaminase	NA	NA	NA	NA	NA
WP_022648926.1|3203052_3204750_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_022648927.1|3204763_3205495_+	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	25.1	8.5e-15
WP_022648928.1|3205530_3206496_-	glucokinase	NA	NA	NA	NA	NA
WP_022648929.1|3206701_3207937_+	ion channel protein	NA	NA	NA	NA	NA
WP_022648930.1|3207937_3209596_-	indolepyruvate decarboxylase	NA	NA	NA	NA	NA
3208087:3208101	attR	CGCGCCAGCATTCTG	NA	NA	NA	NA
WP_022648931.1|3209782_3210781_+	L-glyceraldehyde 3-phosphate reductase	NA	NA	NA	NA	NA
WP_022648932.1|3210907_3211255_+	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_022648933.1|3211288_3212527_-	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_022648934.1|3212872_3214060_+	nucleoside permease NupC	NA	NA	NA	NA	NA
WP_022648935.1|3214105_3216295_-	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
WP_022648936.1|3216915_3217278_+	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_022648937.1|3217300_3217666_+	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_022648938.1|3217717_3219133_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 6
NZ_AP019817	Enterobacter hormaechei subsp. hoffmannii strain OIPH-N069	4689117	3847159	3855649	4689117	transposase	uncultured_Caudovirales_phage(57.14%)	11	NA	NA
WP_022649396.1|3847159_3847927_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
WP_007898888.1|3848025_3848319_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.9	4.7e-49
WP_007898884.1|3848649_3848928_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000427623.1|3849189_3850194_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_007898882.1|3850368_3850794_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	71.4	1.9e-51
WP_007898880.1|3850806_3852096_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.1	4.4e-168
WP_022649397.1|3852140_3852461_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	44.8	8.5e-20
WP_007898876.1|3852546_3853245_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	69.4	7.7e-90
WP_004206574.1|3853373_3853679_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004206572.1|3853689_3854895_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_016151342.1|3855070_3855649_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	35.5	5.7e-22
>prophage 7
NZ_AP019817	Enterobacter hormaechei subsp. hoffmannii strain OIPH-N069	4689117	3942594	3979318	4689117	capsid,terminase,lysis,integrase,portal,head,tRNA,tail,plate	Salmonella_phage(86.84%)	43	3942563:3942591	3989388:3989416
3942563:3942591	attL	CCCGGTAAGCGCAGCGCCACCGGGCAAAA	NA	NA	NA	NA
WP_022649449.1|3942594_3943608_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.6	5.3e-108
WP_001144069.1|3943844_3944060_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_003862574.1|3944175_3945921_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	39.0	1.4e-76
WP_006812010.1|3946074_3947919_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_022649450.1|3948025_3948532_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_015386379.1|3948868_3949087_-	DNA-binding transcriptional regulator	NA	Q53ZE7	Salmonella_virus	72.2	1.6e-25
WP_045261913.1|3949156_3950257_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	92.6	8.4e-184
WP_045261914.1|3950253_3950739_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	87.6	5.0e-72
WP_045261915.1|3950735_3953894_-|tail	phage tail tape measure protein	tail	A0A1S6L010	Salmonella_phage	75.1	0.0e+00
WP_007848878.1|3953886_3954006_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	92.3	3.3e-14
WP_045261916.1|3954020_3954323_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	95.0	2.3e-43
WP_024552851.1|3954377_3954893_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	98.2	5.1e-91
WP_023226484.1|3954902_3956075_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.6	5.0e-211
WP_045261917.1|3956208_3956631_-|tail	tail fiber assembly protein	tail	A0A1B0V844	Salmonella_phage	52.2	2.3e-28
WP_023306990.1|3958816_3959422_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	94.0	3.1e-111
WP_023306991.1|3959414_3960323_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	95.7	5.4e-152
WP_045261918.1|3960309_3960669_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	92.4	4.1e-55
WP_023223445.1|3960665_3961244_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	97.9	2.6e-107
WP_045261919.1|3961312_3961759_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	79.7	1.1e-57
WP_039025357.1|3961751_3962183_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	88.1	1.3e-68
WP_045261920.1|3962278_3962707_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	83.6	2.6e-56
WP_045261921.1|3962703_3963219_-	lysozyme	NA	E5G6N1	Salmonella_phage	76.5	3.1e-72
WP_014884902.1|3963199_3963415_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	66.2	2.0e-20
WP_000868184.1|3963418_3963622_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_014884903.1|3963621_3964089_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	58.7	1.3e-48
WP_006777754.1|3964187_3964841_-|terminase	Small terminase subunit	terminase	E5G6M7	Salmonella_phage	56.1	5.2e-56
WP_045261922.1|3964844_3965993_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	67.6	3.2e-133
WP_045261923.1|3966008_3966836_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	63.5	1.7e-72
WP_017382378.1|3966985_3968749_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	87.7	3.2e-312
WP_058655653.1|3968748_3969798_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	78.9	1.6e-155
WP_096147830.1|3970237_3970915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045261943.1|3971248_3971437_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	88.3	1.8e-22
WP_045261942.1|3971590_3973999_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	94.1	0.0e+00
WP_045261941.1|3973989_3974850_-	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	82.2	1.0e-131
WP_045261940.1|3974846_3975074_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	90.7	2.1e-33
WP_001744223.1|3975073_3975307_-	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	80.5	5.4e-24
WP_045261939.1|3975374_3975716_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	86.7	3.4e-51
WP_032442472.1|3975679_3975880_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	92.4	6.7e-31
WP_045261938.1|3975887_3976397_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	90.5	2.6e-79
WP_045261937.1|3976431_3976668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045261936.1|3976769_3977384_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	41.4	5.4e-39
WP_087878623.1|3977389_3978295_+	NAD-dependent DNA ligase	NA	NA	NA	NA	NA
WP_032642186.1|3978304_3979318_+|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	60.5	1.3e-117
3989388:3989416	attR	CCCGGTAAGCGCAGCGCCACCGGGCAAAA	NA	NA	NA	NA
>prophage 1
NZ_AP019818	Enterobacter hormaechei subsp. hoffmannii strain OIPH-N069 plasmid pN069_1, complete sequence	136816	70302	102763	136816	transposase,integrase	Salmonella_phage(50.0%)	26	84890:84906	110168:110184
WP_011787737.1|70302_72207_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_099368947.1|72920_74007_+|transposase	IS3-like element ISKpn10 family transposase	transposase	S5WIU1	Leptospira_phage	36.0	3.8e-43
WP_164597215.1|74070_74643_+	NERD domain-containing protein	NA	A0A2R2ZH57	Clostridioides_phage	46.0	2.9e-18
WP_164597217.1|74786_78989_+	type IV secretion protein Rhs	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	53.4	1.7e-22
WP_151819923.1|78994_79477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151819922.1|79509_79983_+	hypothetical protein	NA	T1S9H7	Salmonella_phage	71.7	4.3e-12
WP_151819921.1|80156_80621_+	DUF2247 family protein	NA	NA	NA	NA	NA
WP_151819920.1|80824_81340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151819919.1|81403_81742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151819917.1|82953_83199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151819916.1|83202_83457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151819941.1|84315_84600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151819914.1|84602_84881_+	hypothetical protein	NA	NA	NA	NA	NA
84890:84906	attL	CAGCGGCCAAGTGGTTT	NA	NA	NA	NA
WP_164597220.1|85286_85679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089140437.1|86513_86864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089140436.1|86976_87276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025368620.1|88407_89283_-	class A extended-spectrum beta-lactamase CTX-M-2	NA	A0A1B0VBP7	Salmonella_phage	81.5	1.0e-123
WP_000608644.1|89539_90802_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_008126957.1|91016_94001_-|transposase	Tn3-like element ISKox2 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	24.7	8.8e-34
WP_001162012.1|96021_96579_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_000845039.1|96875_97889_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001261740.1|98034_98826_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_003159545.1|98911_99463_+	aminoglycoside 6'-N-acetyltransferase AAC(6')-Iae	NA	NA	NA	NA	NA
WP_000679427.1|99636_99984_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|99977_100817_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000050481.1|101221_102763_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
110168:110184	attR	CAGCGGCCAAGTGGTTT	NA	NA	NA	NA
>prophage 1
NZ_AP019819	Enterobacter hormaechei subsp. hoffmannii strain OIPH-N069 plasmid pN069_2, complete sequence	115150	0	13090	115150		Salmonella_phage(93.75%)	18	NA	NA
WP_016051671.1|0_1065_+	replication protein RepA	NA	J9Q7H0	Salmonella_phage	100.0	1.5e-190
WP_006812558.1|1674_1887_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	98.6	3.1e-34
WP_022649907.1|1886_2222_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	95.5	4.2e-54
WP_022649906.1|2218_2398_-	hypothetical protein	NA	J9Q6J1	Salmonella_phage	96.6	9.5e-21
WP_022649905.1|2438_2714_-	hypothetical protein	NA	J9Q738	Salmonella_phage	96.7	5.4e-47
WP_004110040.1|2782_3193_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	97.8	1.1e-75
WP_022649904.1|3176_3548_-	DUF2591 domain-containing protein	NA	J9Q7S7	Salmonella_phage	98.4	3.0e-69
WP_022649903.1|3698_6041_-	intein-containing recombinase RecA	NA	J9Q736	Salmonella_phage	87.8	6.0e-30
WP_000920226.1|6043_6310_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	100.0	1.6e-40
WP_022649902.1|6309_7254_-	hypothetical protein	NA	J9Q7S6	Salmonella_phage	99.7	4.0e-182
WP_004110098.1|7314_8343_-	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	99.7	1.3e-165
WP_022649901.1|8462_8894_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	99.3	4.4e-72
WP_071785233.1|9151_9376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022649900.1|9457_10015_+	hypothetical protein	NA	J9Q7G7	Salmonella_phage	70.9	8.9e-65
WP_022649899.1|10080_10725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161496785.1|10763_11189_-	hypothetical protein	NA	J9Q7S4	Salmonella_phage	99.3	3.7e-71
WP_022649897.1|11203_12373_-	hypothetical protein	NA	J9Q7Z2	Salmonella_phage	95.1	1.3e-211
WP_023330202.1|12394_13090_-	hypothetical protein	NA	S5YLC4	Mycobacterium_phage	36.0	4.1e-19
>prophage 2
NZ_AP019819	Enterobacter hormaechei subsp. hoffmannii strain OIPH-N069 plasmid pN069_2, complete sequence	115150	16968	114406	115150	integrase,tail,transposase,terminase	Salmonella_phage(89.8%)	112	15192:15207	36418:36433
15192:15207	attL	ATGATTCCATACATCC	NA	NA	NA	NA
WP_022649893.1|16968_19341_-	hypothetical protein	NA	J9Q7G6	Salmonella_phage	93.7	0.0e+00
WP_004110118.1|19450_19663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022649892.1|19926_20313_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_022649891.1|20304_21411_-|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	32.2	2.8e-25
WP_006812568.1|21582_21999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006812569.1|21989_22514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006812570.1|22610_22856_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	44.9	1.0e-12
WP_006812571.1|22855_23221_-	hypothetical protein	NA	K7PH35	Enterobacteria_phage	66.4	5.1e-37
WP_022649890.1|23236_23440_-	hypothetical protein	NA	A0A2P1CDD4	Klebsiella_phage	50.7	5.6e-09
WP_022649889.1|23450_24224_-	phosphate starvation-inducible protein PhoH	NA	W8D063	Erwinia_phage	63.6	4.7e-88
WP_000427623.1|24504_25509_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_001389365.1|26666_27431_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_000376623.1|27937_28438_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259031.1|28565_29405_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|29398_29746_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001355915.1|29946_30420_-	trimethoprim-resistant dihydrofolate reductase DfrA15	NA	G3MBI7	Bacillus_virus	30.8	6.9e-18
WP_000845048.1|30576_31590_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_003465043.1|32044_32401_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003100858.1|32655_32982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003100856.1|32978_33479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003100853.1|33475_33847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003100847.1|33840_34398_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	63.2	3.3e-59
WP_000427623.1|34476_35481_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_004110169.1|37002_37308_-	hypothetical protein	NA	J9Q7S1	Salmonella_phage	99.0	1.4e-48
36418:36433	attR	GGATGTATGGAATCAT	NA	NA	NA	NA
WP_000613550.1|37304_37457_-	hypothetical protein	NA	J9Q7Z1	Salmonella_phage	98.0	8.9e-20
WP_022649968.1|37456_37669_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	98.6	5.8e-33
WP_022649967.1|37828_39151_-	hypothetical protein	NA	J9Q7G5	Salmonella_phage	99.1	2.4e-257
WP_032623539.1|39185_39443_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	97.6	4.0e-36
WP_022649965.1|39743_40538_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	97.0	9.8e-142
WP_022649964.1|40618_41734_-	hypothetical protein	NA	J9Q720	Salmonella_phage	97.6	1.4e-215
WP_006812582.1|41892_43233_-	AAA family ATPase	NA	J9Q7G4	Salmonella_phage	99.8	1.3e-247
WP_022649963.1|43293_44019_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	99.6	2.6e-141
WP_022649962.1|44215_44974_-	DUF2971 domain-containing protein	NA	J9Q7Y9	Salmonella_phage	98.4	8.7e-148
WP_161496783.1|45019_45373_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	100.0	2.9e-45
WP_022649960.1|45378_46044_-	AAA family ATPase	NA	J9Q7R7	Salmonella_phage	99.5	1.4e-117
WP_032623541.1|46198_46900_-	hypothetical protein	NA	J9Q7Y8	Salmonella_phage	99.6	5.4e-136
WP_016051638.1|46932_47355_-	hypothetical protein	NA	J9Q6E9	Salmonella_phage	100.0	5.7e-72
WP_016051635.1|47703_47955_-	hypothetical protein	NA	J9Q7R6	Salmonella_phage	100.0	6.6e-36
WP_022649957.1|47956_48649_-	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	99.6	2.9e-129
WP_016051633.1|48661_48985_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	100.0	1.9e-51
WP_016051632.1|49077_49311_-	membrane lipoprotein lipid attachment site-containing protein	NA	J9Q714	Salmonella_phage	100.0	1.0e-38
WP_022649956.1|49322_49931_-	hypothetical protein	NA	J9Q7G0	Salmonella_phage	100.0	1.4e-103
WP_022649955.1|49930_50185_-	hypothetical protein	NA	J9Q7R5	Salmonella_phage	95.2	2.4e-41
WP_022649954.1|50228_50765_-	hypothetical protein	NA	J9Q7Y6	Salmonella_phage	98.9	1.0e-94
WP_022649953.1|50764_54319_-	hypothetical protein	NA	J9Q6E3	Salmonella_phage	64.4	2.0e-250
WP_022649952.1|54406_58564_-	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	99.6	0.0e+00
WP_016051626.1|58581_59172_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	100.0	2.1e-109
WP_022649951.1|59159_59957_-	hypothetical protein	NA	J9Q7R4	Salmonella_phage	99.2	1.2e-160
WP_016051624.1|59949_60648_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	100.0	3.7e-137
WP_016051623.1|60737_61073_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	100.0	1.4e-60
WP_022649950.1|61114_65686_-	tape measure protein	NA	J9Q712	Salmonella_phage	90.5	0.0e+00
WP_000952684.1|65693_65918_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	100.0	4.2e-34
WP_000163862.1|66043_66361_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	98.1	6.0e-50
WP_022649949.1|66420_67167_-	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	98.0	2.0e-128
WP_000469441.1|67241_67625_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	100.0	1.7e-67
WP_022649948.1|67626_68100_-	hypothetical protein	NA	J9Q711	Salmonella_phage	99.4	6.8e-82
WP_001027662.1|68090_68435_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	100.0	1.9e-57
WP_022649947.1|68532_69366_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	98.6	9.3e-151
WP_000801184.1|69365_69800_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	100.0	2.1e-74
WP_001130336.1|70103_70979_-	hypothetical protein	NA	J9Q710	Salmonella_phage	100.0	3.8e-163
WP_022649945.1|71005_71899_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	92.3	1.2e-135
WP_022649944.1|71921_73496_-	hypothetical protein	NA	J9Q7R1	Salmonella_phage	99.2	7.1e-301
WP_002211787.1|73529_74786_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	100.0	1.8e-251
WP_022649943.1|74788_75430_-	hypothetical protein	NA	J9Q6D4	Salmonella_phage	99.1	5.2e-109
WP_000176291.1|75625_75892_-	hypothetical protein	NA	J9Q757	Salmonella_phage	100.0	1.3e-42
WP_002211789.1|75901_76792_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	99.7	6.2e-169
WP_022649942.1|76797_77052_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	97.6	9.0e-41
WP_006812519.1|77044_77683_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	99.5	1.1e-111
WP_000164561.1|77679_78348_-	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	99.5	1.1e-114
WP_032623529.1|78347_79046_-	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	98.7	3.6e-124
WP_022649940.1|79110_80670_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	99.4	1.3e-294
WP_001291547.1|80672_80951_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	98.9	3.4e-41
WP_032623531.1|81010_81433_+	hypothetical protein	NA	J9Q806	Salmonella_phage	85.0	2.4e-62
WP_006812523.1|81437_81965_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	99.3	2.6e-82
WP_022649938.1|82288_82939_+	hypothetical protein	NA	J9Q754	Salmonella_phage	99.1	1.2e-113
WP_016051712.1|82989_83193_+	hypothetical protein	NA	J9Q7I3	Salmonella_phage	100.0	1.3e-29
WP_022649937.1|83837_84320_-	hypothetical protein	NA	J9Q805	Salmonella_phage	95.0	5.1e-85
WP_161496780.1|84525_84723_-	hypothetical protein	NA	J9Q753	Salmonella_phage	96.9	5.0e-31
WP_022649934.1|84934_85330_-	hypothetical protein	NA	J9Q7I1	Salmonella_phage	99.2	3.3e-66
WP_022649933.1|85457_85769_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	97.1	1.6e-47
WP_161496784.1|85909_86125_-	hypothetical protein	NA	J9Q804	Salmonella_phage	94.4	2.6e-33
WP_022649931.1|86356_86599_+	hypothetical protein	NA	J9Q751	Salmonella_phage	93.8	3.4e-37
WP_022649930.1|88025_88544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022649929.1|88627_89464_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_022649928.1|89545_89863_-	hypothetical protein	NA	J9Q750	Salmonella_phage	80.0	5.2e-46
WP_022649927.1|89947_90214_-	hypothetical protein	NA	J9Q7T5	Salmonella_phage	69.3	3.7e-29
WP_022649926.1|90401_90605_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	97.0	5.2e-31
WP_022649925.1|90660_91359_-	DUF1311 domain-containing protein	NA	J9Q6K3	Salmonella_phage	99.1	4.8e-124
WP_022649923.1|92318_94004_-	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	99.1	0.0e+00
WP_022649922.1|94145_94718_-	hypothetical protein	NA	J9Q7H6	Salmonella_phage	97.9	5.3e-97
WP_000462606.1|94826_95669_-	hypothetical protein	NA	J9Q7T3	Salmonella_phage	71.1	2.1e-70
WP_000872126.1|95777_95966_-	hypothetical protein	NA	J9Q800	Salmonella_phage	100.0	1.2e-26
WP_022649921.1|95975_96470_-	hypothetical protein	NA	J9Q6J9	Salmonella_phage	97.0	8.7e-80
WP_022649920.1|96612_97221_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	99.0	4.9e-117
WP_000262979.1|97814_98045_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	100.0	2.1e-36
WP_022649919.1|98247_98841_-	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	99.0	1.0e-111
WP_022649918.1|99026_99869_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	85.0	2.9e-107
WP_022649917.1|99997_100555_-	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	98.9	2.0e-101
WP_004109992.1|100564_100984_-	hypothetical protein	NA	J9Q743	Salmonella_phage	97.8	6.4e-68
WP_000386471.1|101047_101692_-	AAA family ATPase	NA	J9Q7H4	Salmonella_phage	100.0	5.2e-117
WP_161496782.1|101691_102162_-	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	99.4	1.3e-88
WP_160859100.1|102164_102560_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	96.9	3.9e-67
WP_022649915.1|102579_103683_-	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	99.2	1.1e-218
WP_022649914.1|103872_104742_-	hypothetical protein	NA	J9Q742	Salmonella_phage	98.3	3.9e-160
WP_002231164.1|104824_105967_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	100.0	1.7e-219
WP_022649913.1|106074_108390_-	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	99.7	0.0e+00
WP_022649912.1|108467_109037_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	98.9	8.4e-103
WP_004110014.1|109048_109795_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	98.8	2.6e-136
WP_022649911.1|109784_111701_-	AAA family ATPase	NA	J9Q741	Salmonella_phage	98.9	0.0e+00
WP_022649910.1|111930_113016_-	hypothetical protein	NA	J9Q7S9	Salmonella_phage	98.6	1.0e-205
WP_022649909.1|113191_113686_-	GNAT family N-acetyltransferase	NA	J9Q6J3	Salmonella_phage	98.2	7.8e-89
WP_022649908.1|113761_114406_-	hypothetical protein	NA	J9Q739	Salmonella_phage	99.1	2.2e-123
>prophage 1
NZ_AP019820	Enterobacter hormaechei subsp. hoffmannii strain OIPH-N069 plasmid pN069_3, complete sequence	47299	0	45055	47299	head,terminase,capsid,portal,tail	Escherichia_phage(54.9%)	57	NA	NA
WP_045308399.1|255_603_+|tail	phage tail protein	tail	K7P7G7	Enterobacteria_phage	93.0	1.6e-56
WP_045618221.1|599_1355_+|tail	phage minor tail protein L	tail	K7PGX3	Enterobacteria_phage	95.2	5.5e-142
WP_058676445.1|1356_2088_+	peptidase P60	NA	K7P7M8	Enterobacteria_phage	96.7	4.6e-146
WP_058676444.1|2075_2666_+|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	92.9	5.5e-97
WP_164597237.1|2716_6262_+	DUF1983 domain-containing protein	NA	Q9MCU0	Escherichia_phage	88.3	0.0e+00
WP_022648877.1|6261_6564_+	hypothetical protein	NA	K7PJS1	Enterobacterial_phage	97.0	1.3e-49
WP_022648876.1|6563_7241_+	hypothetical protein	NA	K7PGV3	Enterobacterial_phage	96.4	6.0e-116
WP_164597240.1|7644_8934_+|tail	phage tail protein	tail	K7P6T0	Enterobacteria_phage	61.6	9.3e-142
WP_058676432.1|9302_9788_+	hypothetical protein	NA	K7P6I4	Enterobacteria_phage	77.6	1.8e-69
WP_058676427.1|10630_11212_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	78.6	6.8e-76
WP_127849842.1|11917_12937_-	ParB/RepB/Spo0J family plasmid partition protein	NA	O64340	Escherichia_phage	89.1	7.1e-169
WP_058676430.1|12939_14103_-	plasmid-partitioning protein SopA	NA	O03951	Escherichia_phage	99.2	1.5e-226
WP_063861734.1|14782_16678_+	protelomerase	NA	Q37967	Escherichia_phage	93.5	0.0e+00
WP_063861736.1|16851_17625_-	hypothetical protein	NA	O64341	Escherichia_phage	85.6	1.6e-125
WP_063861738.1|17621_17852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063861739.1|17848_18013_-	host cell division inhibitor Icd-like protein	NA	Q77WP0	Escherichia_phage	90.6	9.0e-18
WP_080472917.1|18056_18170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063861740.1|18366_18750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063861742.1|18752_19079_-	hypothetical protein	NA	O64345	Escherichia_phage	95.3	2.6e-56
WP_063861743.1|19154_19376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063861746.1|19368_23373_-	hypothetical protein	NA	A0A2I6TD01	Escherichia_phage	84.2	0.0e+00
WP_063147093.1|23623_24232_-	LexA family transcriptional regulator	NA	Q37962	Escherichia_phage	97.0	3.8e-109
WP_074143160.1|24313_24532_+	hypothetical protein	NA	Q37964	Escherichia_phage	94.4	1.6e-30
WP_063861748.1|24518_25265_+	phage antitermination protein	NA	Q37965	Escherichia_phage	96.0	1.6e-138
WP_161496775.1|25501_25675_+	hypothetical protein	NA	O21966	Escherichia_phage	86.0	2.2e-22
WP_063861750.1|25677_26592_+	hypothetical protein	NA	O64348	Escherichia_phage	81.7	3.3e-141
WP_063861751.1|26593_26953_+	hypothetical protein	NA	A0A1L7N114	Ralstonia_phage	48.1	2.5e-20
WP_127849834.1|26956_27199_+	hypothetical protein	NA	Q8HAA4	Salmonella_phage	63.9	5.1e-17
WP_063861754.1|27195_27807_+	hypothetical protein	NA	O64350	Escherichia_phage	73.4	4.5e-70
WP_045270122.1|27809_28058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063861756.1|28060_28387_+	hypothetical protein	NA	O64354	Escherichia_phage	90.7	1.6e-50
WP_045270124.1|28407_28629_+	hypothetical protein	NA	O64355	Escherichia_phage	98.6	3.0e-32
WP_063147084.1|29010_29298_-	helix-turn-helix transcriptional regulator	NA	O64356	Escherichia_phage	97.9	1.2e-44
WP_015979725.1|29297_29609_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	O64357	Escherichia_phage	100.0	6.3e-52
WP_063861757.1|29775_29997_+	hypothetical protein	NA	O64358	Escherichia_phage	97.3	3.2e-34
WP_063861758.1|30006_30234_+	hypothetical protein	NA	O64359	Escherichia_phage	90.7	1.5e-31
WP_063861759.1|30501_31590_+	site-specific DNA-methyltransferase	NA	A0A2I6TC96	Escherichia_phage	85.4	4.4e-161
WP_080472918.1|31724_32030_+	hypothetical protein	NA	O64361	Escherichia_phage	97.0	3.5e-47
WP_063861781.1|32029_32563_+	lysozyme	NA	K7PM52	Enterobacteria_phage	91.3	9.0e-91
WP_063861761.1|32562_33108_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_063861763.1|33144_33348_+	hypothetical protein	NA	O64364	Escherichia_phage	87.9	1.0e-26
WP_063861766.1|33347_33659_+	DUF4406 domain-containing protein	NA	Q6UAS4	Klebsiella_phage	92.9	2.0e-50
WP_080472920.1|34057_34633_+	DUF1983 domain-containing protein	NA	G8C7Q4	Escherichia_phage	50.4	4.0e-20
WP_080472919.1|34794_35301_+	DNA-packaging protein	NA	O64316	Escherichia_phage	97.0	7.5e-87
WP_127849836.1|35272_37195_+|terminase	phage terminase large subunit family protein	terminase	O64317	Escherichia_phage	99.1	0.0e+00
WP_063861771.1|37194_37401_+|tail	phage tail protein	tail	E4WL20	Enterobacteria_phage	94.1	1.2e-27
WP_063147076.1|37397_38987_+|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	92.5	2.8e-289
WP_063861774.1|38967_40311_+	S49 family peptidase	NA	O64320	Escherichia_phage	94.2	2.5e-206
WP_058676454.1|40320_40653_+|head	head decoration protein	head	E4WL24	Enterobacteria_phage	90.9	8.7e-52
WP_058676453.1|40720_41746_+|capsid	major capsid protein	capsid	K7PGW9	Enterobacteria_phage	97.1	3.1e-188
WP_058676452.1|41791_42199_+	DNA-packaging protein	NA	K7PM13	Enterobacteria_phage	86.7	1.8e-35
WP_058676451.1|42209_42563_+|tail	phage tail protein	tail	K7P6U9	Enterobacteria_phage	87.2	9.0e-55
WP_058676450.1|42572_43127_+|tail	phage tail protein	tail	K7P7A8	Enterobacteria_phage	98.9	2.6e-80
WP_058676449.1|43123_43522_+|tail	phage tail protein	tail	K7P7G5	Enterobacteria_phage	94.7	1.8e-67
WP_058676448.1|43529_44267_+|tail	phage tail protein	tail	O64327	Escherichia_phage	97.6	4.4e-128
WP_058676447.1|44303_44726_+|tail	phage minor tail protein G	tail	K7PM17	Enterobacteria_phage	85.0	1.4e-49
WP_045618219.1|44734_45055_+|tail	phage tail assembly protein T	tail	K7PHE1	Enterobacteria_phage	92.4	3.2e-51
