The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	0	145817	4652776	head,tRNA,lysis,tail,holin,terminase,transposase,integrase	Escherichia_phage(25.71%)	124	54015:54031	147294:147310
WP_000122426.1|1674_2103_-	universal stress protein UspC	NA	NA	NA	NA	NA
WP_000906327.1|3935_4823_+	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_000795952.1|4819_5746_+	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000147298.1|7442_7946_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_000610395.1|8090_9506_+	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	35.0	4.2e-10
WP_000204335.1|11112_11973_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000036408.1|11975_13025_+	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	33.6	4.6e-06
WP_000763866.1|13039_13429_+	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	31.7	1.0e-06
WP_000983609.1|13439_14084_+	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_001259583.1|17340_17733_+	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_001297434.1|17852_18341_-	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
WP_129592873.1|18517_20251_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	1.2e-86
WP_004982864.1|20466_21033_+	VOC family protein	NA	NA	NA	NA	NA
WP_001185757.1|21046_21793_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001214302.1|22956_24057_+	NapC/NirT family cytochrome c	NA	NA	NA	NA	NA
WP_000564739.1|26674_27646_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000019618.1|27642_28386_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_094112582.1|28827_29995_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.0	1.4e-181
WP_000620691.1|30121_30346_+	hypothetical protein	NA	A5LH70	Enterobacteria_phage	98.6	7.5e-39
WP_129592872.1|30342_31179_+	helix-turn-helix domain-containing protein	NA	A0A291AWW0	Escherichia_phage	99.6	6.3e-123
WP_000055050.1|31162_31651_+	PerC family transcriptional regulator	NA	U5P0U0	Shigella_phage	97.5	2.7e-86
WP_000066914.1|31650_32304_+	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	99.1	1.2e-126
WP_001061419.1|32709_33519_+	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	98.1	1.3e-149
WP_005041034.1|33526_34516_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.8	6.2e-194
WP_001204806.1|34533_34914_+	antitermination protein Q	NA	S5M7R9	Escherichia_phage	100.0	4.9e-67
WP_000024336.1|35478_36528_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	89.6	1.0e-183
WP_000874453.1|37330_37564_+	DUF1737 domain-containing protein	NA	A0A0P0ZBH7	Stx2-converting_phage	84.4	1.3e-30
WP_134800470.1|37597_39292_+	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	S5MDQ7	Escherichia_phage	61.9	4.4e-200
WP_000142784.1|39427_39562_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	93.2	3.1e-16
WP_129592871.1|39602_40759_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	7.5e-66
WP_001289722.1|40914_41184_+	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	74.2	8.2e-08
WP_000284492.1|41259_41475_+|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	98.6	1.0e-32
WP_000193278.1|41479_41824_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.8e-37
WP_000369850.1|41789_42062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992061.1|42167_42701_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	92.1	1.3e-94
WP_000675931.1|42921_43035_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_001082565.1|43036_43504_+|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	95.5	1.1e-73
WP_000828072.1|43842_44169_+	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	3.4e-56
WP_000095744.1|44300_44501_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000829198.1|44542_44908_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	93.4	6.2e-59
WP_001487956.1|45198_45759_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	83.9	6.4e-71
WP_001063100.1|49461_49683_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	97.3	1.9e-34
WP_000125990.1|52047_52374_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001007893.1|52383_52734_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	99.1	6.0e-59
WP_000569977.1|52730_53177_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	97.3	4.9e-74
WP_000133373.1|53173_53518_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	98.2	2.1e-56
WP_024259601.1|53582_53939_+	hypothetical protein	NA	A0A0P0ZDV1	Stx2-converting_phage	99.1	4.5e-54
54015:54031	attL	GAAGGCGTGGTGCGTAA	NA	NA	NA	NA
WP_114142276.1|54662_55076_+	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	99.2	1.5e-64
WP_000710953.1|55090_55465_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	3.0e-64
WP_128566924.1|55560_55770_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	97.1	4.4e-33
WP_000224021.1|55817_56078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077897571.1|56212_57814_-|transposase	IS66-like element ISEc49 family transposase	transposase	A0A218MNE7	uncultured_virus	36.4	7.7e-77
WP_000950648.1|57820_58213_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_000042910.1|58199_58529_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_073817468.1|58573_61834_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	96.7	0.0e+00
WP_005046106.1|62166_62865_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	94.8	6.6e-126
WP_073817952.1|62875_63619_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	6.6e-148
WP_064732876.1|63516_64197_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	98.2	7.7e-111
WP_162281785.1|64539_68013_+	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	96.4	0.0e+00
WP_001233150.1|68080_68680_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	98.0	9.7e-110
WP_000216457.1|68744_70304_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZGT8	Escherichia_phage	98.5	2.2e-68
WP_000539253.1|70389_70902_+	receptor recognizing protein Gp38	NA	A0A0P0ZFL3	Escherichia_phage	92.9	1.1e-85
WP_001114260.1|70977_71190_+	DUF4376 domain-containing protein	NA	Q9LA61	Enterobacterial_phage	63.6	7.1e-15
WP_129592869.1|71494_72691_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001217553.1|73244_73493_-	DinI-like family protein	NA	K7PLW4	Enterobacteria_phage	100.0	1.8e-38
WP_005025039.1|74221_75418_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000891627.1|75608_75863_-	isochorismatase family protein	NA	NA	NA	NA	NA
WP_001258662.1|76171_77944_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001300367.1|78061_78514_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000907247.1|78542_79283_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000974711.1|79317_79839_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_005029473.1|79840_79993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_134805288.1|80400_81629_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_001386853.1|82219_82285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580323.1|82423_83035_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_000568519.1|83043_84054_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000571464.1|84103_84889_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000203002.1|84885_85641_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_005040893.1|85719_86652_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_001184045.1|86667_87990_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_000448394.1|88109_89081_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_024259592.1|89169_91140_-	alpha-mannosidase	NA	NA	NA	NA	NA
WP_119183832.1|91556_92246_-	glycosyl hydrolase family 38	NA	NA	NA	NA	NA
WP_000581610.1|95016_95826_-	TrmB family transcriptional regulator	NA	NA	NA	NA	NA
WP_000741727.1|96231_97353_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	NA	NA	NA	NA
WP_001307257.1|97435_97924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000490374.1|98026_98983_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000357160.1|103611_104445_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_134800471.1|104462_105647_+	alpha-glycosidase	NA	NA	NA	NA	NA
WP_001213808.1|105647_106262_+	neopullulanase	NA	NA	NA	NA	NA
WP_039059824.1|106283_107081_+	amidohydrolase	NA	NA	NA	NA	NA
WP_000546444.1|108021_108864_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_000091148.1|108923_110366_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_001056706.1|110493_111363_-	DNA-binding transcriptional regulator HexR	NA	NA	NA	NA	NA
WP_000301720.1|111700_113176_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.3	9.9e-79
WP_001069475.1|113410_115222_+	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_000800512.1|115258_115900_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_000173486.1|115954_117133_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_001295500.1|117626_117983_+	protein YebF	NA	NA	NA	NA	NA
WP_000024738.1|119086_119746_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000936901.1|119955_122016_+	oligopeptidase B	NA	NA	NA	NA	NA
WP_000944260.1|122012_122675_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_000011658.1|122698_123355_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000916761.1|123456_123687_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	2.9e-14
WP_000168747.1|123825_124200_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_088895425.1|124256_125485_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_046891729.1|125590_126412_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000976476.1|126424_126766_+	YebY family protein	NA	NA	NA	NA	NA
WP_071821702.1|127158_127629_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.3	6.6e-37
WP_129592867.1|127751_128907_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	3.4e-66
WP_094112582.1|129463_130631_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.0	1.4e-181
WP_001333468.1|131095_131476_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_046891812.1|131472_131820_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	7.5e-62
WP_000099181.1|131868_133407_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.2	2.8e-294
WP_001277359.1|133563_133860_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	83.5	6.2e-41
WP_005029490.1|133837_135778_-	exodeoxyribonuclease VIII	NA	V5UQJ3	Shigella_phage	57.0	1.9e-186
WP_001063816.1|136426_137554_+|transposase	IS110-like element ISSso6 family transposase	transposase	NA	NA	NA	NA
WP_134806767.1|137787_139000_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	97.6	8.7e-166
WP_001171522.1|139221_139602_+|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	98.4	3.5e-65
WP_000612610.1|139598_139946_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	2.8e-61
WP_024259614.1|141899_142523_+	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	75.9	2.1e-78
WP_001039895.1|142522_142702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000026175.1|142702_144418_-	T3SS effector E3 ubiquitin-protein ligase IpaH3	NA	NA	NA	NA	NA
WP_000812724.1|145160_145817_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	3.1e-56
147294:147310	attR	TTACGCACCACGCCTTC	NA	NA	NA	NA
>prophage 2
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	153313	196381	4652776	tRNA,protease,transposase	Stx2-converting_phage(27.27%)	44	NA	NA
WP_024259617.1|153313_155362_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
WP_000984517.1|155553_156435_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001127216.1|156480_157854_-	MFS transporter	NA	NA	NA	NA	NA
WP_001262182.1|158030_158822_+	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_001211011.1|158964_159204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000714550.1|159362_159506_+	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
WP_001006852.1|159580_159868_+	YebO family protein	NA	NA	NA	NA	NA
WP_001295496.1|161193_161337_+	YobF family protein	NA	NA	NA	NA	NA
WP_001062678.1|161349_161559_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
WP_000010113.1|161724_162534_+	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_001296134.1|162530_163097_-	manganese efflux pump MntP	NA	NA	NA	NA	NA
WP_000156259.1|163524_163983_-	DUF986 domain-containing protein	NA	NA	NA	NA	NA
WP_000228655.1|164036_164888_-	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
WP_000406926.1|164900_165701_-	PTS mannose transporter subunit IIC	NA	NA	NA	NA	NA
WP_000150543.1|165763_166735_-	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_000394983.1|167197_168754_+	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
WP_001063816.1|168880_170008_+|transposase	IS110-like element ISSso6 family transposase	transposase	NA	NA	NA	NA
WP_094112617.1|171164_172321_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.4	5.7e-66
WP_000624300.1|173272_174637_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000456725.1|174820_175399_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_000855021.1|175402_176764_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	5.8e-41
WP_000457334.1|176837_177017_+	YoaH family protein	NA	NA	NA	NA	NA
WP_005042226.1|177962_178307_-	RidA family protein	NA	NA	NA	NA	NA
WP_129592864.1|178438_180349_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	5.9e-92
WP_001220988.1|180406_181102_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000290573.1|181141_181723_+	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_005042122.1|181927_183613_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	2.0e-35
WP_005030798.1|183694_184810_+	ribonuclease D	NA	NA	NA	NA	NA
WP_129592863.1|185032_186571_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.0	1.8e-293
WP_000612626.1|186619_186967_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_001333468.1|186963_187344_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_001063816.1|187698_188826_-|transposase	IS110-like element ISSso6 family transposase	transposase	NA	NA	NA	NA
WP_000513737.1|189392_189575_+	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_000512153.1|189722_189971_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_001386836.1|190029_190104_-	protein YoaJ	NA	NA	NA	NA	NA
WP_032324829.1|190106_190208_-	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_000691934.1|191108_191363_+	DUF333 domain-containing lipoprotein YoaF	NA	NA	NA	NA	NA
WP_005029159.1|191384_191732_-	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_119178568.1|191771_192968_-	2-nitroimidazole transporter	NA	NA	NA	NA	NA
WP_000972249.1|193064_193886_+	DNA-binding transcriptional regulator NimR	NA	NA	NA	NA	NA
WP_000460714.1|193842_194289_-	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_032193887.1|194457_194562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000138054.1|194562_195066_-|tRNA	mischarged aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
WP_094110543.1|195224_196381_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	8.9e-67
>prophage 3
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	201714	202998	4652776		Bacillus_phage(100.0%)	1	NA	NA
WP_000219706.1|201714_202998_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
>prophage 4
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	206316	207171	4652776		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001186351.1|206316_207171_+	methylglyoxal reductase YeaE	NA	A0A2H4PQR8	Staphylococcus_phage	32.0	2.9e-22
>prophage 5
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	210414	211056	4652776		Tupanvirus(100.0%)	1	NA	NA
WP_001120535.1|210414_211056_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	34.9	2.2e-19
>prophage 6
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	215982	365814	4652776	tail,tRNA,transposase	Enterobacteria_phage(26.0%)	114	NA	NA
WP_001235799.1|215982_217935_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	3.1e-40
WP_001333468.1|219171_219552_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612626.1|219548_219896_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_129592825.1|219944_221483_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	98.8	1.8e-293
WP_000373055.1|222444_223788_-	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_000085238.1|224023_224296_+	YnjH family protein	NA	NA	NA	NA	NA
WP_000781878.1|224261_224669_-	CTP pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_004983358.1|224755_225367_+	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_001299561.1|227526_228180_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.7	3.8e-14
WP_165850853.1|228179_228833_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000524080.1|230864_231413_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_000977129.1|231412_232120_-	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_000673918.1|234470_235277_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_000081975.1|235722_236943_+	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.6	4.2e-27
WP_000989446.1|236939_237974_+	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_000994988.1|239429_240773_+	N-succinylarginine dihydrolase	NA	NA	NA	NA	NA
WP_000368526.1|240765_241734_+	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_001228966.1|242063_242534_+	ATP-independent periplasmic protein-refolding chaperone	NA	NA	NA	NA	NA
WP_004983350.1|242736_243312_+	environmental stress-induced protein Ves	NA	NA	NA	NA	NA
WP_000252396.1|243271_244159_-	excinuclease Cho	NA	NA	NA	NA	NA
WP_000175034.1|244388_245216_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	7.7e-73
WP_001039044.1|245417_245756_+	osmotically-inducible lipoprotein OsmE	NA	NA	NA	NA	NA
WP_000412169.1|246053_246374_+	PTS N,N'-diacetylchitobiose transporter subunit IIB	NA	NA	NA	NA	NA
WP_001010702.1|249185_250577_-	cystine/sulfocysteine:cation symporter	NA	NA	NA	NA	NA
WP_004983374.1|250709_251300_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000106834.1|251462_252131_-	hexitol phosphatase HxpB	NA	NA	NA	NA	NA
WP_000222172.1|252277_252814_+	YniB family protein	NA	NA	NA	NA	NA
WP_000267654.1|252854_253715_-	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_000146159.1|253820_254111_-	type V toxin-antitoxin system endoribonuclease antitoxin GhoS	NA	NA	NA	NA	NA
WP_000251738.1|254211_255141_-	6-phosphofructokinase II	NA	NA	NA	NA	NA
WP_001144196.1|256690_258619_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	1.6e-129
WP_032155788.1|258622_259165_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	8.2e-15
WP_001124225.1|259261_259459_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124852.1|259511_259868_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|259990_260035_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000018583.1|260317_261301_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.0	3.2e-33
WP_000672350.1|261315_263703_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_001229265.1|263707_264007_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000078916.1|264310_264451_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_088895425.1|264802_266030_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_032324284.1|266001_266238_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_046891725.1|266373_267477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_134800681.1|271785_272970_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.2	2.9e-222
WP_114142759.1|273008_273878_+	tagaturonate reductase	NA	A0A0A7NPV8	Enterobacteria_phage	62.5	1.0e-06
WP_005025442.1|274074_274989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024258604.1|274992_275751_-	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
WP_005044864.1|275813_277160_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_001074427.1|277213_277597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000483770.1|277742_279089_-|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_001264267.1|279402_279990_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	75.5	1.6e-72
WP_000287959.1|280389_281076_+	Ig-like domain-containing protein	NA	A0A291AWU6	Escherichia_phage	94.3	8.8e-115
WP_000478929.1|281134_281521_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	90.6	2.0e-60
WP_000371977.1|281829_284871_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	84.8	0.0e+00
WP_000447385.1|284870_285200_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	93.5	2.9e-55
WP_001152578.1|285199_285898_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	91.8	4.8e-124
WP_000194737.1|285902_286646_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.7	6.8e-145
WP_001063816.1|288491_289619_-|transposase	IS110-like element ISSso6 family transposase	transposase	NA	NA	NA	NA
WP_001233102.1|292311_292911_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	93.5	5.5e-105
WP_134800736.1|292974_294258_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q8W611	Enterobacteria_phage	34.4	2.1e-37
WP_129592861.1|294208_294832_+	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	74.3	9.6e-76
WP_001039895.1|294831_295011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001397278.1|297876_298002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073817362.1|298090_299551_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.7	2.3e-43
WP_000214712.1|299586_299790_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_073817359.1|299967_300654_-	DNA-binding transcriptional regulator YdfH	NA	NA	NA	NA	NA
WP_000636571.1|300742_301489_-	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_000210377.1|301625_303671_+	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_129592855.1|305044_306201_-|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.4	2.0e-66
WP_000428998.1|306721_307252_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000731833.1|307496_307670_+	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_001320773.1|307741_307891_-	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_032335682.1|309966_310896_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000013794.1|311105_312449_+	VOC family protein	NA	NA	NA	NA	NA
WP_000375956.1|312673_314329_+	glucan biosynthesis protein OpgD	NA	NA	NA	NA	NA
WP_004983724.1|314468_314693_+	YdcH family protein	NA	NA	NA	NA	NA
WP_000140882.1|314755_315292_+	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
WP_004983796.1|316389_317382_+	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
WP_000586728.1|317378_317972_+	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
WP_167544914.1|319270_320484_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.0	7.1e-168
WP_088895425.1|322201_323429_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_001333468.1|325398_325779_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612610.1|325775_326123_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	2.8e-61
WP_129592858.1|326171_327710_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	98.8	2.4e-293
WP_129592857.1|327956_329570_+	murein tripeptide ABC transporter substrate-binding protein MppA	NA	NA	NA	NA	NA
WP_000559900.1|329620_330652_-	low conductance mechanosensitive channel YnaI	NA	NA	NA	NA	NA
WP_000605090.1|331671_331929_+	DUF2534 family protein	NA	NA	NA	NA	NA
WP_001262123.1|331979_332930_-	universal stress protein UspE	NA	NA	NA	NA	NA
WP_000611911.1|333081_333834_-	fumarate/nitrate reduction transcriptional regulator Fnr	NA	NA	NA	NA	NA
WP_000945012.1|334028_334544_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	8.3e-25
WP_001156464.1|336116_337562_-	p-aminobenzoyl-glutamate hydrolase subunit AbgB	NA	NA	NA	NA	NA
WP_000444944.1|337561_338872_-	p-aminobenzoyl-glutamate hydrolase subunit AbgA	NA	NA	NA	NA	NA
WP_000885469.1|339047_339956_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001046827.1|340285_340849_+	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_000628065.1|340869_342102_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|342356_343340_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123759.1|343815_345189_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157397.1|345317_346253_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.1	4.2e-144
WP_129592856.1|347698_348867_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	98.7	1.4e-181
WP_012421537.1|349035_349701_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_000882658.1|349871_350084_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	88.6	1.2e-25
WP_000687450.1|350333_350543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129592855.1|350594_351750_+|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.4	2.0e-66
WP_129592854.1|352316_353483_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.0	9.9e-183
WP_089519923.1|354151_354334_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_167544906.1|355580_356794_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	97.3	4.3e-165
WP_000435424.1|357136_357556_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	76.3	8.5e-36
WP_000624671.1|357552_357903_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	4.7e-40
WP_001072392.1|357933_359526_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.2	4.8e-172
WP_000968134.1|360099_360957_-	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_001101727.1|360953_361811_-	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000983723.1|361807_362635_-	iron/manganese ABC transporter ATP-binding protein SitB	NA	G9BWD6	Planktothrix_phage	29.0	4.9e-11
WP_000555620.1|362634_363549_-	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_005040947.1|364105_364540_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_000837912.1|364680_365814_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	3.1e-117
>prophage 7
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	371550	372540	4652776		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762229.1|371550_372540_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
>prophage 8
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	376898	378127	4652776	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_171764166.1|376898_378127_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	2.9e-177
>prophage 9
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	383926	388772	4652776		Stx2-converting_phage(66.67%)	3	NA	NA
WP_129592852.1|383926_387829_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.7	7.6e-54
WP_001333468.1|388047_388428_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612610.1|388424_388772_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	2.8e-61
>prophage 10
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	394581	411704	4652776	integrase,transposase	Salmonella_phage(22.22%)	17	387931:387955	424318:424342
387931:387955	attL	ATGCTGCCAACTTACTGATTTAGTG	NA	NA	NA	NA
WP_094112601.1|394581_395723_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	1.1e-66
WP_134806767.1|395760_396973_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	97.6	8.7e-166
WP_001151410.1|397230_397509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000904672.1|397605_397914_+	helix-turn-helix domain-containing protein	NA	A0A0M5M1I9	Salmonella_phage	53.1	1.3e-22
WP_000336262.1|398002_398941_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	50.8	4.3e-80
WP_000668483.1|398943_399306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000997174.1|399413_399743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001154172.1|400992_401544_+	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000029458.1|401543_402293_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	27.2	1.0e-07
WP_001209786.1|402370_402835_+	C40 family peptidase	NA	A0A217EQL1	Bacillus_phage	35.3	1.1e-12
WP_001300634.1|403081_403795_+	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_073817138.1|403857_405294_+	YdiU family protein	NA	NA	NA	NA	NA
WP_001270810.1|405297_405489_-	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_001082226.1|405620_406667_-	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
WP_000368051.1|406823_407657_-	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_088895425.1|407947_409175_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_000069326.1|409325_411704_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	9.4e-172
424318:424342	attR	ATGCTGCCAACTTACTGATTTAGTG	NA	NA	NA	NA
>prophage 11
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	431135	436219	4652776		Lake_Baikal_phage(33.33%)	5	NA	NA
WP_000367160.1|431135_431504_+	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	4.3e-15
WP_005041956.1|431512_433000_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000948855.1|433009_433756_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	32.0	3.8e-10
WP_000907993.1|433730_435002_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000144559.1|434998_436219_+	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.2	4.2e-91
>prophage 12
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	447626	456418	4652776		Orpheovirus(20.0%)	9	NA	NA
WP_000493947.1|447626_448268_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
WP_000098888.1|448307_449456_-	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.2	2.1e-84
WP_001182329.1|449746_450958_-	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000269501.1|451070_452003_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_112031589.1|451999_453025_-	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.3	6.3e-32
WP_000102278.1|453323_453413_+	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000701024.1|453578_454748_+	MFS transporter	NA	NA	NA	NA	NA
WP_000007283.1|454893_455475_-	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000101193.1|455602_456418_-	peptidoglycan DD-endopeptidase MepH	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
>prophage 13
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	464953	466452	4652776		Indivirus(50.0%)	2	NA	NA
WP_000250656.1|464953_465850_+	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	4.7e-07
WP_004983569.1|465930_466452_+	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.2	1.7e-46
>prophage 14
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	473361	474636	4652776	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_005042099.1|473361_474636_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	6.7e-84
>prophage 15
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	496632	498444	4652776		Vaccinia_virus(100.0%)	1	NA	NA
WP_134800678.1|496632_498444_+	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	98.8	0.0e+00
>prophage 16
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	509958	511260	4652776		Bacillus_phage(100.0%)	1	NA	NA
WP_000732524.1|509958_511260_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.9	9.5e-17
>prophage 17
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	534040	535212	4652776	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_129592843.1|534040_535212_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.0	3.8e-182
>prophage 18
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	546339	553275	4652776		Bacillus_phage(50.0%)	3	NA	NA
WP_000628540.1|546339_548025_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	23.8	2.2e-10
WP_129592841.1|548062_550435_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_024259606.1|550491_553275_+	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	24.0	3.3e-19
>prophage 19
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	559932	562167	4652776		Klosneuvirus(100.0%)	1	NA	NA
WP_114142745.1|559932_562167_+	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.8	2.8e-08
>prophage 20
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	565795	566866	4652776		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_000193532.1|565795_566866_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	22.3	8.6e-08
>prophage 21
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	571296	571581	4652776		Escherichia_phage(100.0%)	1	NA	NA
WP_000781370.1|571296_571581_+	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
>prophage 22
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	577592	581443	4652776	transposase	Enterobacteria_phage(50.0%)	2	NA	NA
WP_000768384.1|577592_577883_+	lipoprotein	NA	Q1MVN1	Enterobacteria_phage	65.1	2.1e-25
WP_171765930.1|580215_581443_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	1.5e-176
>prophage 23
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	589714	595028	4652776	transposase	Stx2-converting_phage(75.0%)	4	NA	NA
WP_129592825.1|589714_591253_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	98.8	1.8e-293
WP_000612626.1|591301_591649_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_001333468.1|591645_592026_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000558057.1|593609_595028_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
>prophage 24
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	603538	606789	4652776	transposase	Streptococcus_phage(33.33%)	4	NA	NA
WP_000091199.1|603538_603922_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000803659.1|603953_604172_+	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000398461.1|604228_605581_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.1	1.8e-26
WP_129592836.1|605620_606789_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.0	3.8e-182
>prophage 25
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	621049	622315	4652776		Klosneuvirus(100.0%)	1	NA	NA
WP_000069213.1|621049_622315_-	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.2	1.2e-24
>prophage 26
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	635229	640887	4652776		Bacillus_virus(50.0%)	4	NA	NA
WP_000573407.1|635229_636036_+	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
WP_000968844.1|636103_636457_+	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_000506490.1|636824_637613_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_000484972.1|638952_640887_+	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.9	5.3e-32
>prophage 27
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	649479	650070	4652776		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176295.1|649479_650070_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 28
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	656499	726940	4652776	head,lysis,tail,portal,holin,terminase,transposase,integrase,protease,capsid	Escherichia_phage(39.34%)	82	693249:693263	734099:734113
WP_001297122.1|656499_659097_-	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.7	1.7e-86
WP_001031530.1|659476_659728_+	YciN family protein	NA	NA	NA	NA	NA
WP_129592830.1|659763_660813_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	29.0	7.9e-22
WP_000559290.1|661032_661791_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	2.0e-06
WP_001291216.1|662418_663291_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_005041692.1|663501_665397_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|665424_666045_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285651.1|666041_666923_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001386774.1|667060_667105_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_046891713.1|667196_668759_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763539.1|668758_670354_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	1.7e-52
WP_000983895.1|670354_671716_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	39.8	5.6e-36
WP_073817177.1|671727_672921_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443080.1|672920_673727_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000251936.1|675208_675379_-	hypothetical protein	NA	A0A0U2RK60	Escherichia_phage	62.5	9.4e-10
WP_000240999.1|675818_676487_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000885580.1|676541_677126_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	1.5e-102
WP_119178572.1|677125_680101_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	88.0	2.7e-51
WP_001228225.1|680165_680765_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.5	3.7e-101
WP_129592827.1|680832_684312_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.3	0.0e+00
WP_153933134.1|684378_684717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050546148.1|684789_685392_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	84.7	6.8e-87
WP_000140704.1|685328_686072_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	2.5e-147
WP_001152648.1|686076_686775_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	3.6e-132
WP_000847332.1|686774_687104_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	99.1	5.6e-59
WP_000533402.1|689653_690067_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479095.1|690093_690525_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	6.2e-42
WP_001454438.1|690538_691144_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	7.6e-102
WP_000683079.1|691151_691547_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000974980.1|691543_692077_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	1.6e-58
WP_001204568.1|692092_692446_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	68.4	1.3e-40
WP_000201502.1|692438_692822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522661.1|692873_693902_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	59.8	2.3e-111
693249:693263	attL	CATTTTTTCGCGGAA	NA	NA	NA	NA
WP_000256823.1|693959_694307_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
WP_073817292.1|694343_695849_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	52.6	5.1e-99
WP_000831760.1|695838_697431_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	6.5e-185
WP_000259002.1|697427_697634_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_024259736.1|697617_699546_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.6	9.7e-260
WP_000867569.1|699517_700066_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_001082562.1|700507_700975_-|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	77.9	7.0e-55
WP_000992072.1|701273_701807_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	94.4	2.4e-99
WP_000369850.1|701912_702185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000193262.1|702150_702495_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	6.3e-37
WP_000284510.1|702499_702715_-|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_171764164.1|702826_704055_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	3.8e-177
WP_000874316.1|704201_706058_-	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	89.6	0.0e+00
WP_000871291.1|706317_706653_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_071782237.1|706723_706936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000226110.1|707401_707542_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	93.5	2.2e-12
WP_000935541.1|707801_708860_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.5	9.5e-201
WP_000762933.1|709433_710255_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	5.5e-79
WP_073817556.1|710251_710626_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.8	2.1e-33
WP_001265091.1|710638_711685_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	55.0	4.5e-110
WP_032335658.1|711686_711965_-	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	6.7e-05
WP_000980988.1|712031_712283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000967408.1|712499_712712_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
WP_000350274.1|712946_713180_-	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	100.0	2.8e-36
WP_167544911.1|713194_714423_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	3.8e-177
WP_000207997.1|714622_714790_-	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	2.1e-14
WP_000224216.1|714800_715064_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	73.6	3.9e-31
WP_001142588.1|715065_715284_-	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	93.1	3.6e-30
WP_000510387.1|715285_715501_-	hypothetical protein	NA	A0A222YWK2	Escherichia_phage	94.4	2.2e-35
WP_001289986.1|715501_715861_-	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	73.5	1.7e-37
WP_000753053.1|715857_716034_-	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	93.1	3.3e-26
WP_001224665.1|716026_716209_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	98.3	9.1e-27
WP_000403782.1|716304_716661_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.4e-58
WP_001209470.1|716638_717100_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	1.3e-37
WP_001266130.1|717096_717393_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	95.8	1.2e-47
WP_001141099.1|717389_717782_-	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	63.3	1.5e-39
WP_000450707.1|717797_718568_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	68.4	6.7e-87
WP_001309414.1|718601_719144_-	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	3.6e-79
WP_000020541.1|719055_720096_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	1.0e-90
WP_000705383.1|720067_720619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000476986.1|720602_720830_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001003379.1|720907_721315_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	7.2e-24
WP_000379596.1|721504_721657_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	2.3e-07
WP_005031383.1|721668_722043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000449172.1|722575_722764_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199480.1|722760_722949_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_073816805.1|723044_725519_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_000113189.1|725583_725832_+	excisionase	NA	NA	NA	NA	NA
WP_000113688.1|725809_726940_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.1	2.2e-102
734099:734113	attR	TTCCGCGAAAAAATG	NA	NA	NA	NA
>prophage 29
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	734873	736888	4652776		Planktothrix_phage(100.0%)	2	NA	NA
WP_000994889.1|734873_735878_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G9BWD6	Planktothrix_phage	35.6	8.0e-24
WP_000110967.1|735874_736888_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
>prophage 30
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	748537	758420	4652776		Citrobacter_phage(25.0%)	10	NA	NA
WP_000250447.1|748537_749155_-	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.1	3.9e-53
WP_001287378.1|749750_750164_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000718998.1|750307_751216_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	8.2e-60
WP_000193454.1|751417_752431_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_005024994.1|752522_753428_-	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_024259599.1|753540_753999_+	YchJ family protein	NA	NA	NA	NA	NA
WP_000555845.1|754048_754891_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	48.8	3.7e-14
WP_001160110.1|755497_756175_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000571699.1|756174_756885_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_000702660.1|756881_758420_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
>prophage 31
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	769676	860404	4652776	tRNA,lysis,holin,integrase,transposase	Stx2-converting_phage(28.12%)	89	832587:832604	860158:860175
WP_167544911.1|769676_770905_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	3.8e-177
WP_001146442.1|771010_771241_-	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	6.5e-06
WP_001295620.1|771511_772612_+	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_129592825.1|772995_774534_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	98.8	1.8e-293
WP_000612626.1|774582_774930_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_001333468.1|774926_775307_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000170926.1|775466_775574_+	type I toxin-antitoxin system toxin Ldr family protein	NA	NA	NA	NA	NA
WP_000811065.1|775722_776577_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
WP_001257043.1|776612_777422_-	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_073817969.1|777425_777818_-	SirB family protein	NA	NA	NA	NA	NA
WP_000456467.1|777814_778648_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000804740.1|778647_779730_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
WP_000173200.1|779771_781028_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_001130690.1|781241_781865_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_001260333.1|781864_782716_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_005028479.1|782866_783814_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	6.6e-44
WP_001033335.1|783938_785618_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.4	6.7e-23
WP_000823885.1|785672_785951_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_000152933.1|786228_786813_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_073817961.1|786929_788021_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_094110543.1|789243_790400_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	8.9e-67
WP_129592824.1|790653_791822_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.3	3.4e-183
WP_024259598.1|792032_793952_-	PTS-dependent dihydroxyacetone kinase operon transcriptional regulator DhaR	NA	NA	NA	NA	NA
WP_000733719.1|794172_795282_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_000059411.1|795253_795886_+	dihydroxyacetone kinase ADP-binding subunit DhaL	NA	NA	NA	NA	NA
WP_005024965.1|795896_797315_+	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
WP_000615071.1|799285_799726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005030587.1|799904_800159_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_000020161.1|800359_801094_+	flagellar brake protein	NA	NA	NA	NA	NA
WP_001295616.1|801095_801707_-	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_000051628.1|801806_802721_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_000340206.1|802815_804552_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_001063816.1|804883_806011_+|transposase	IS110-like element ISSso6 family transposase	transposase	NA	NA	NA	NA
WP_001266908.1|807526_808825_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_000190855.1|809154_810687_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_000234823.1|810738_811458_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_000406383.1|811679_813221_+	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_000943457.1|813366_813897_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_005041144.1|814953_816150_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_005042757.1|816407_817604_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000897381.1|818106_818526_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	61.3	3.4e-37
WP_000807613.1|819631_820093_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000284277.1|820169_820829_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001297679.1|820900_821194_-	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_000695219.1|821435_821792_+	pre-peptidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001056831.1|822584_822953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072536.1|823472_824168_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101055.1|824191_825004_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185665.1|825007_825274_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_001131446.1|825752_825872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001328621.1|825832_826018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000122462.1|826118_826292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158250343.1|826293_826440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032335708.1|827642_827963_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	64.7	5.3e-38
WP_000444500.1|828030_829281_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	3.2e-22
WP_073817020.1|829452_830106_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476089.1|830115_830577_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001297484.1|830630_831737_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_004984576.1|831772_832414_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423748.1|832417_833788_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
832587:832604	attL	CTGCTTTTGCTGCCGACG	NA	NA	NA	NA
WP_001265481.1|833955_834627_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735412.1|834626_836087_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_005027593.1|836162_837284_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_129593006.1|837332_838559_-	peptidase T	NA	NA	NA	NA	NA
WP_000531601.1|838808_839945_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
WP_000799406.1|839928_840792_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_129593017.1|841444_842572_+|transposase	IS110-like element ISSso6 family transposase	transposase	NA	NA	NA	NA
WP_129593005.1|842864_844457_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	60.6	9.1e-171
WP_050546149.1|844487_844823_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	60.8	1.2e-29
WP_129593004.1|844873_845254_+|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	98.4	3.5e-65
WP_000612610.1|845250_845598_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	2.8e-61
WP_046891815.1|845646_847071_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	92.0	2.3e-266
WP_000735655.1|847460_847685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032207510.1|847708_848176_-|lysis	lysis protein	lysis	Q6H9V3	Enterobacteria_phage	88.4	1.3e-69
WP_001151823.1|848324_848507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001092844.1|848663_849197_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	96.0	1.6e-100
WP_000731267.1|849247_849592_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	97.4	7.2e-57
WP_005042508.1|849596_849812_-|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	98.6	4.5e-33
WP_162281787.1|849888_850236_-	DUF826 domain-containing protein	NA	E7DYV2	Enterobacteria_phage	80.7	6.6e-26
WP_000111980.1|850479_851004_-	hypothetical protein	NA	A0A0N7CGH9	Escherichia_phage	42.9	1.9e-32
WP_044325913.1|851895_852105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088895425.1|852560_853788_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_024259622.1|853763_854528_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	50.8	7.1e-65
WP_000580316.1|854694_855489_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000759299.1|855485_856526_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000952743.1|856681_857503_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
WP_129593003.1|857518_858430_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_001251377.1|858458_859703_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_001033695.1|859702_860404_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.9e-35
860158:860175	attR	CTGCTTTTGCTGCCGACG	NA	NA	NA	NA
>prophage 32
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	867691	867949	4652776		Erwinia_phage(100.0%)	1	NA	NA
WP_000800121.1|867691_867949_-	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 33
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	880207	881850	4652776		Streptococcus_virus(50.0%)	2	NA	NA
WP_001267941.1|880207_881212_-	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	30.9	8.4e-05
WP_001257000.1|881208_881850_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
>prophage 34
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	885122	886304	4652776		Ralstonia_phage(50.0%)	2	NA	NA
WP_000103754.1|885122_885359_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
WP_001008535.1|885569_886304_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
>prophage 35
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	916931	917177	4652776		Salmonella_phage(100.0%)	1	NA	NA
WP_001217757.1|916931_917177_+	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	47.4	1.7e-12
>prophage 36
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	921618	925279	4652776	transposase	Acinetobacter_phage(50.0%)	2	NA	NA
WP_094110543.1|921618_922774_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	8.9e-67
WP_000183364.1|924358_925279_+	kdo(2)-lipid IV(A) lauroyltransferase	NA	A0A1W6JP29	Morganella_phage	41.5	8.6e-57
>prophage 37
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	936800	939343	4652776	transposase	Red_sea_bream_iridovirus(50.0%)	3	NA	NA
WP_000857405.1|936800_937334_-	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	5.9e-26
WP_000489579.1|937429_937741_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_094110543.1|938187_939343_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	8.9e-67
>prophage 38
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	949159	949948	4652776		Cronobacter_phage(100.0%)	1	NA	NA
WP_005042898.1|949159_949948_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	1.0e-90
>prophage 39
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	961599	966391	4652776	transposase	Shigella_phage(50.0%)	2	NA	NA
WP_094112608.1|961599_962767_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	98.7	3.2e-181
WP_000420617.1|965470_966391_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
>prophage 40
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	971224	974752	4652776		Bacillus_phage(50.0%)	3	NA	NA
WP_001120112.1|971224_971917_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001264960.1|971889_972879_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_129593016.1|972991_974752_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	38.6	8.0e-19
>prophage 41
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	977960	978173	4652776		Morganella_phage(100.0%)	1	NA	NA
WP_000066490.1|977960_978173_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
>prophage 42
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	997438	998098	4652776	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000375139.1|997438_998098_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	54.9	3.1e-48
>prophage 43
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	1002331	1004386	4652776		Bacillus_phage(100.0%)	1	NA	NA
WP_005043009.1|1002331_1004386_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	5.9e-21
>prophage 44
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	1016985	1018893	4652776		Tupanvirus(100.0%)	1	NA	NA
WP_000053101.1|1016985_1018893_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.5	4.9e-54
>prophage 45
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	1032531	1042691	4652776	tRNA	Acinetobacter_phage(25.0%)	7	NA	NA
WP_000193834.1|1032531_1035144_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	5.3e-19
WP_005043120.1|1035409_1036612_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000117881.1|1036780_1038181_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_000977920.1|1038783_1039872_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
WP_000462687.1|1040056_1041247_+	aspartate transaminase	NA	NA	NA	NA	NA
WP_001109487.1|1041468_1042116_-	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_001295932.1|1042142_1042691_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
>prophage 46
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	1059597	1064138	4652776		Bacillus_phage(100.0%)	3	NA	NA
WP_000551270.1|1059597_1061346_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
WP_000705691.1|1061382_1063647_-	ComEC family protein	NA	NA	NA	NA	NA
WP_000167336.1|1063853_1064138_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
>prophage 47
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	1069224	1070313	4652776		Streptococcus_phage(100.0%)	1	NA	NA
WP_000057140.1|1069224_1070313_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	4.5e-81
>prophage 48
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	1074411	1077626	4652776		Tetraselmis_virus(100.0%)	2	NA	NA
WP_001292820.1|1074411_1076694_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.3e-162
WP_000111043.1|1076885_1077626_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
>prophage 49
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	1081089	1202015	4652776	tRNA,lysis,tail,terminase,transposase,integrase,protease,capsid	Salmonella_phage(33.85%)	112	1121122:1121138	1182343:1182359
WP_088895425.1|1081089_1082317_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_004981937.1|1082288_1082438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000109297.1|1082647_1083796_-	MFS transporter	NA	NA	NA	NA	NA
WP_129592987.1|1085318_1086486_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.0	3.8e-182
WP_000213098.1|1086492_1087110_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000850321.1|1087120_1089565_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.7	4.3e-220
WP_000886683.1|1089803_1091096_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067768.1|1091186_1092530_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.6	8.1e-80
WP_001295343.1|1092540_1093152_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_073816505.1|1093306_1097335_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228475.1|1097469_1097964_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|1098508_1099474_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_001043614.1|1099596_1101363_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	5.4e-23
WP_001202167.1|1101363_1103085_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	1.4e-20
WP_129592997.1|1103126_1103831_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|1104115_1104334_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|1105018_1107295_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|1107325_1107646_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|1107968_1108193_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188202.1|1108265_1110212_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	8.5e-38
WP_000746468.1|1110208_1111324_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_001355621.1|1111474_1112431_+	VirK/YbjX family protein	NA	NA	NA	NA	NA
WP_000599794.1|1112427_1114086_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_005028000.1|1114511_1115207_+	aquaporin Z	NA	NA	NA	NA	NA
WP_005027998.1|1115701_1116601_+	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_000458822.1|1116744_1118397_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000178677.1|1118408_1119377_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000815362.1|1119509_1121228_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	5.2e-31
1121122:1121138	attL	TCAAACTCGAACAGGCC	NA	NA	NA	NA
WP_000566373.1|1121264_1122266_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_001136554.1|1122276_1123707_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005043094.1|1123805_1124819_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001255167.1|1124815_1125646_-	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001160737.1|1125642_1125966_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001270744.1|1126091_1126607_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027205.1|1126824_1127553_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_000756569.1|1127570_1128302_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001001705.1|1128308_1129025_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000464491.1|1129024_1129693_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_005027989.1|1129982_1130714_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001149699.1|1130888_1132016_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.3	3.9e-27
WP_000389260.1|1132056_1132545_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061649.1|1132604_1133450_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_001093857.1|1133446_1134400_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000995992.1|1134409_1135543_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.9e-29
WP_000126072.1|1135637_1136750_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|1137100_1137577_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684347.1|1137664_1138567_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.0	7.4e-37
WP_000189183.1|1138627_1139350_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201560.1|1139333_1139621_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195239.1|1139780_1140038_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
WP_000681113.1|1140067_1140445_-	membrane protein	NA	NA	NA	NA	NA
WP_001024873.1|1140714_1142400_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000972391.1|1142635_1142854_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_001011770.1|1142944_1144045_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.7	6.5e-176
WP_000980403.1|1144041_1144527_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	81.9	1.3e-67
WP_000763310.1|1147594_1147714_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.4e-12
WP_001281016.1|1147728_1148031_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	90.0	8.2e-41
WP_001207660.1|1148085_1148601_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_000046144.1|1148610_1149783_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.0	1.7e-203
WP_000905012.1|1149925_1150492_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	84.2	3.2e-86
WP_000983057.1|1150519_1151056_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	97.2	3.1e-99
WP_000829134.1|1151814_1152216_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	85.5	5.1e-54
WP_001039925.1|1152208_1152640_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.0	2.2e-71
WP_001442125.1|1152735_1153164_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	77.3	3.8e-47
WP_000727844.1|1153160_1153538_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.8	1.4e-16
WP_001069905.1|1153539_1154052_-	lysozyme	NA	E5G6N1	Salmonella_phage	92.3	3.1e-88
WP_000171568.1|1154032_1154248_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_000868179.1|1154251_1154455_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	91.0	4.0e-31
WP_000059202.1|1154996_1155647_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.4	1.6e-110
WP_000742516.1|1155650_1156709_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.9e-180
WP_000216257.1|1156725_1157559_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.3	2.2e-123
WP_001098464.1|1157701_1159468_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	98.5	0.0e+00
WP_004982020.1|1160606_1161488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000960487.1|1161471_1163121_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001217575.1|1163413_1163647_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|1163657_1163846_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_000099181.1|1164934_1166473_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.2	2.8e-294
WP_000612626.1|1166521_1166869_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_001333468.1|1166865_1167246_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_001063816.1|1167601_1168729_-|transposase	IS110-like element ISSso6 family transposase	transposase	NA	NA	NA	NA
WP_001144011.1|1169547_1169805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001063816.1|1170853_1171981_+|transposase	IS110-like element ISSso6 family transposase	transposase	NA	NA	NA	NA
WP_001072394.1|1172274_1173867_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.2	3.7e-172
WP_000624671.1|1173897_1174248_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	4.7e-40
WP_000435424.1|1174244_1174664_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	76.3	8.5e-36
WP_000379550.1|1176409_1176562_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	57.4	3.5e-08
WP_000787424.1|1176764_1177172_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	1.7e-28
WP_000702027.1|1177460_1177883_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.7	1.8e-70
WP_129592995.1|1178127_1179295_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.0	1.4e-181
WP_073692072.1|1179468_1179912_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	48.7	3.8e-34
WP_005040312.1|1180147_1180966_+	bifunctional pyridoxal phosphate/fructose-1,6-bisphosphate phosphatase	NA	NA	NA	NA	NA
WP_000891687.1|1180966_1182025_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.7	2.6e-20
WP_000604034.1|1182027_1182717_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
1182343:1182359	attR	GGCCTGTTCGAGTTTGA	NA	NA	NA	NA
WP_000102000.1|1182716_1183490_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000891515.1|1183655_1183805_-	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_001147440.1|1183933_1184722_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000096867.1|1184789_1186262_+	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.3	1.2e-12
WP_001265437.1|1186522_1187539_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	1.0e-79
WP_000191538.1|1187548_1188595_+	galactose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_000053437.1|1188598_1189747_+	galactokinase	NA	NA	NA	NA	NA
WP_129592994.1|1189740_1190781_+	galactose-1-epimerase	NA	NA	NA	NA	NA
WP_001295305.1|1190982_1191735_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001109196.1|1191892_1192945_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.4	3.4e-81
WP_000784361.1|1193260_1193641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000099181.1|1193766_1195305_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.2	2.8e-294
WP_000612626.1|1195353_1195701_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_001333468.1|1195697_1196078_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_094112582.1|1198274_1199443_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.0	1.4e-181
WP_000460904.1|1199512_1199692_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	94.9	1.5e-26
WP_001247707.1|1199724_1199946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047326.1|1200071_1200641_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	42.9	5.5e-38
WP_134805288.1|1200786_1202015_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
>prophage 50
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	1216773	1217942	4652776	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_129592987.1|1216773_1217942_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.0	3.8e-182
>prophage 51
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	1223355	1225227	4652776		Planktothrix_phage(100.0%)	1	NA	NA
WP_001120565.1|1223355_1225227_-	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	4.0e-16
>prophage 52
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	1228442	1236784	4652776		Synechococcus_phage(33.33%)	6	NA	NA
WP_004981835.1|1228442_1229105_-	fructose-6-phosphate aldolase	NA	C7BV14	Synechococcus_phage	32.7	4.3e-26
WP_005040550.1|1229235_1230135_+	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_000209328.1|1230140_1232573_+	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
WP_000114242.1|1232718_1233534_+	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
WP_000168811.1|1233685_1234951_+	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_000961466.1|1235191_1236784_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.5	1.5e-61
>prophage 53
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	1241781	1331220	4652776	tail,holin,transposase	Stx2-converting_phage(20.0%)	87	NA	NA
WP_001295296.1|1241781_1242297_-	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
WP_120795379.1|1242349_1242415_-	protein YliM	NA	NA	NA	NA	NA
WP_001295297.1|1242649_1243537_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_000100800.1|1243835_1244339_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_129592990.1|1244742_1245489_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_001159065.1|1245627_1246287_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000569084.1|1246283_1247006_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	42.7	5.6e-35
WP_005040459.1|1247441_1248638_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001267224.1|1248715_1250878_+	mechanosensitive channel protein	NA	NA	NA	NA	NA
WP_158250352.1|1250937_1251864_-	23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF	NA	NA	NA	NA	NA
WP_000710619.1|1252139_1252400_+	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
WP_000430068.1|1252664_1252997_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_000483770.1|1253035_1254382_+|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_000990188.1|1256425_1257103_+	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.6	5.2e-19
WP_000146372.1|1257176_1257443_+	C4-type zinc finger protein YbiI	NA	A0A218M4I6	Erwinia_phage	50.9	5.2e-07
WP_000849301.1|1257707_1257968_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000443512.1|1258195_1259281_-	hydroxycarboxylate dehydrogenase HcXB	NA	NA	NA	NA	NA
WP_000386548.1|1259421_1260384_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_005040450.1|1260411_1262562_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.0	2.2e-42
WP_001145132.1|1262681_1263164_+	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.0	1.3e-35
WP_000007125.1|1263395_1264760_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.6	9.5e-52
WP_005028104.1|1264988_1265660_+	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_005007432.1|1265662_1266658_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_000996088.1|1266650_1268387_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
WP_000469031.1|1269522_1270629_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000871982.1|1270590_1271001_-	YbhQ family protein	NA	NA	NA	NA	NA
WP_001113369.1|1271133_1271895_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000650367.1|1271891_1273133_+	cardiolipin synthase ClsB	NA	NA	NA	NA	NA
WP_000045445.1|1273132_1274089_+	UPF0104 family protein	NA	NA	NA	NA	NA
WP_000446936.1|1274124_1274838_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000373624.1|1275043_1275748_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000852276.1|1275884_1276337_-	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
WP_000598619.1|1276338_1276584_-	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
WP_000080885.1|1276576_1277062_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_000084638.1|1277064_1277577_-	molybdenum cofactor biosynthesis protein B	NA	NA	NA	NA	NA
WP_001295301.1|1277598_1278588_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_001295302.1|1278984_1279893_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
WP_000042533.1|1280084_1282106_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_000044869.1|1282684_1283362_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000246800.1|1283354_1284110_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_000118842.1|1284096_1285251_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_000951205.1|1285247_1286288_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_011379130.1|1286374_1287664_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.8	4.5e-19
WP_000767390.1|1287722_1288199_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_129592989.1|1288350_1289634_+	putative acyl-CoA thioester hydrolase	NA	NA	NA	NA	NA
WP_073817516.1|1292993_1294427_-	anion permease	NA	NA	NA	NA	NA
WP_073817514.1|1294502_1295555_-	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_073817490.1|1296809_1297469_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000815427.1|1297509_1298505_-	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_071821614.1|1298784_1298895_-	DNA invertase	NA	A0A1S6L009	Salmonella_phage	87.5	3.3e-08
WP_011110613.1|1299385_1301212_+	invasion protein	NA	NA	NA	NA	NA
WP_001039895.1|1301212_1301392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001333468.1|1301699_1302080_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612626.1|1302076_1302424_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000099181.1|1302472_1304011_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.2	2.8e-294
WP_129592987.1|1304585_1305753_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.0	3.8e-182
WP_000839570.1|1306498_1306714_+|holin	class II holin family protein	holin	M1FN85	Enterobacteria_phage	95.8	1.0e-32
WP_000259035.1|1307249_1307588_+	hypothetical protein	NA	H9C0V9	Aeromonas_phage	41.2	3.8e-10
WP_000537609.1|1307593_1308049_+	DUF4054 domain-containing protein	NA	A0A068CGG9	Acinetobacter_phage	44.6	3.3e-17
WP_000247612.1|1308042_1308627_+	hypothetical protein	NA	H9C0W2	Aeromonas_phage	30.6	5.2e-15
WP_001009072.1|1308623_1308989_+	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	39.7	6.7e-21
WP_001139093.1|1308973_1309519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001122284.1|1309499_1309865_+	DUF3383 family protein	NA	A0A077KGV4	Edwardsiella_phage	50.0	1.8e-21
WP_001333468.1|1309940_1310321_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612626.1|1310317_1310665_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000099181.1|1310713_1312252_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.2	2.8e-294
WP_000016416.1|1313433_1313625_+	hypothetical protein	NA	Q2NPD1	Xanthomonas_phage	52.9	1.7e-07
WP_000101350.1|1314654_1315059_+	hypothetical protein	NA	H9C0W7	Aeromonas_phage	47.9	3.1e-19
WP_000228829.1|1315099_1315282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000079879.1|1315265_1317287_+	lytic transglycosylase domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	68.1	4.0e-46
WP_000010338.1|1317283_1317994_+	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	32.8	1.2e-21
WP_000890114.1|1317993_1318296_+	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	48.0	1.6e-23
WP_000122177.1|1318292_1319162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000068495.1|1319142_1319820_+	hypothetical protein	NA	A0A077KAY0	Edwardsiella_phage	34.1	2.8e-28
WP_001191863.1|1319832_1320189_+	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	48.1	2.1e-19
WP_005028613.1|1320185_1320638_+	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	63.1	1.2e-35
WP_005011144.1|1320640_1321423_+	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	43.6	6.4e-53
WP_167544917.1|1321720_1322949_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	3.8e-177
WP_000012213.1|1323012_1323366_+	DUF2612 domain-containing protein	NA	A0A2R3UAM9	Myoviridae_environmental_samples	45.0	1.3e-16
WP_077897081.1|1324216_1324738_+|tail	phage tail protein	tail	Q7Y4D4	Escherichia_virus	56.0	3.6e-44
WP_039059100.1|1324740_1325286_+|tail	tail fiber assembly protein	tail	Q8W612	Enterobacteria_phage	74.2	4.6e-74
WP_129592986.1|1325309_1326722_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q8W611	Enterobacteria_phage	51.3	5.4e-74
WP_000099181.1|1327125_1328664_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.2	2.8e-294
WP_000612626.1|1328712_1329060_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_001333468.1|1329056_1329437_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_129592985.1|1329562_1330504_+	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	27.9	6.4e-23
WP_000345414.1|1330500_1331220_-	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	5.4e-22
>prophage 54
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	1369309	1370101	4652776		Kaumoebavirus(100.0%)	1	NA	NA
WP_001114039.1|1369309_1370101_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	28.8	3.7e-08
>prophage 55
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	1373479	1379150	4652776		Acinetobacter_phage(33.33%)	5	NA	NA
WP_001032712.1|1373479_1374871_+	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	3.9e-45
WP_000207148.1|1375002_1376421_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.6	1.8e-61
WP_001053305.1|1376417_1376927_-	YbgA family protein	NA	NA	NA	NA	NA
WP_073817184.1|1377210_1377558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114142769.1|1378769_1379150_-	RHS repeat-associated core domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	43.4	2.5e-18
>prophage 56
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	1386201	1392153	4652776		Paramecium_bursaria_Chlorella_virus(33.33%)	3	NA	NA
WP_000087988.1|1386201_1388250_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	22.7	9.3e-27
WP_005026980.1|1388794_1391479_+	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.8	5.0e-12
WP_000186098.1|1391475_1392153_+	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	31.1	1.5e-26
>prophage 57
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	1405322	1409136	4652776	tRNA	Escherichia_phage(50.0%)	2	NA	NA
WP_001287154.1|1405322_1406987_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	99.1	0.0e+00
WP_001023109.1|1407189_1409136_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.6e-07
>prophage 58
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	1413901	1415566	4652776		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337090.1|1413901_1415566_+	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	38.9	5.2e-84
>prophage 59
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	1419702	1420743	4652776		Pseudomonas_phage(100.0%)	1	NA	NA
WP_004981284.1|1419702_1420743_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.1e-47
>prophage 60
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	1428639	1435294	4652776	transposase	Planktothrix_phage(33.33%)	4	NA	NA
WP_000631384.1|1428639_1429365_+	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
WP_001207515.1|1429482_1430418_+	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_000367922.1|1430501_1432196_+	molecular chaperone HscC	NA	E5ESM6	Bathycoccus_sp._RCC1105_virus	32.3	3.1e-76
WP_094096507.1|1434126_1435294_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.3	1.3e-182
>prophage 61
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	1439777	1442360	4652776	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_024259577.1|1439777_1442360_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.5	2.3e-184
>prophage 62
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	1449368	1451808	4652776		Synechococcus_phage(50.0%)	2	NA	NA
WP_001231411.1|1449368_1450457_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
WP_001092079.1|1450596_1451808_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
>prophage 63
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	1456623	1457271	4652776		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_000939749.1|1456623_1457007_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
WP_000034825.1|1457061_1457271_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
>prophage 64
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	1466621	1542892	4652776	tRNA,transposase	Shigella_phage(13.33%)	54	NA	NA
WP_129592981.1|1466621_1467778_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	3.4e-66
WP_000278511.1|1468910_1469339_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	38.5	3.3e-19
WP_000887629.1|1469459_1471025_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
WP_000052796.1|1471195_1471759_-	alkyl hydroperoxide reductase subunit C	NA	NA	NA	NA	NA
WP_167544904.1|1472631_1473859_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	5.0e-177
WP_000029804.1|1475717_1476938_+	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.8	1.6e-58
WP_000502945.1|1476910_1477540_+	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.8	2.9e-56
WP_073816739.1|1478798_1479887_+	hydroxycarboxylate dehydrogenase HcxA	NA	NA	NA	NA	NA
WP_000460431.1|1479896_1480094_-	YbdD/YjiX family protein	NA	NA	NA	NA	NA
WP_001043123.1|1480275_1482381_-	carbon starvation protein CstA	NA	NA	NA	NA	NA
WP_000637953.1|1482561_1482975_-	proofreading thioesterase EntH	NA	NA	NA	NA	NA
WP_000347664.1|1482977_1483724_-	2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase	NA	NA	NA	NA	NA
WP_001007131.1|1483723_1484581_-	enterobactin biosynthesis bifunctional isochorismatase/aryl carrier protein EntB	NA	NA	NA	NA	NA
WP_000026762.1|1484594_1486205_-	(2,3-dihydroxybenzoyl)adenylate synthase	NA	NA	NA	NA	NA
WP_005024896.1|1486214_1487390_-	isochorismate synthase EntC	NA	NA	NA	NA	NA
WP_001234317.1|1487764_1488721_+	Fe2+-enterobactin ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_073816746.1|1488724_1489975_-	enterobactin transporter EntS	NA	NA	NA	NA	NA
WP_005024900.1|1490085_1491090_+	Fe(3+)-siderophore ABC transporter permease	NA	NA	NA	NA	NA
WP_000640969.1|1491086_1492079_+	iron-enterobactin ABC transporter permease	NA	NA	NA	NA	NA
WP_000140632.1|1492075_1492891_+	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	1.2e-06
WP_000096749.1|1492887_1494021_-	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_000077778.1|1494235_1498117_-	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.1	4.6e-59
WP_000885782.1|1498113_1498332_-	enterobactin biosynthesis protein YbdZ	NA	NA	NA	NA	NA
WP_000125803.1|1498334_1499537_-	enterochelin esterase	NA	NA	NA	NA	NA
WP_001034867.1|1499779_1502020_+	siderophore enterobactin receptor FepA	NA	NA	NA	NA	NA
WP_001298903.1|1502194_1502815_+	enterobactin synthase subunit EntD	NA	NA	NA	NA	NA
WP_000956465.1|1502936_1503089_-	type I toxin-antitoxin system toxin HokE	NA	NA	NA	NA	NA
WP_000956455.1|1503439_1503592_-	type I toxin-antitoxin system toxin HokE	NA	NA	NA	NA	NA
WP_073816749.1|1504045_1505164_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_000682518.1|1505229_1505478_+	DUF1158 domain-containing protein	NA	NA	NA	NA	NA
WP_000360962.1|1505542_1505911_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000351470.1|1506004_1506658_+	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_001153160.1|1506765_1508013_+	mechanosensitive ion channel YbdG	NA	NA	NA	NA	NA
WP_000786312.1|1508080_1509457_-	phenylalanine transporter	NA	NA	NA	NA	NA
WP_000573978.1|1509558_1512702_-	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.3	4.9e-59
WP_088895425.1|1516651_1517879_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_073817115.1|1519892_1521152_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000152521.1|1521162_1521978_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855364.1|1521974_1522868_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815537.1|1523004_1524072_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001295318.1|1524068_1524578_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212252.1|1524695_1525418_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000256002.1|1525420_1525915_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912353.1|1526088_1527474_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143552.1|1527509_1528031_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|1528138_1528351_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729155.1|1528352_1529219_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000866436.1|1531030_1531171_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_000977516.1|1531170_1531437_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_001063816.1|1537606_1538734_+|transposase	IS110-like element ISSso6 family transposase	transposase	NA	NA	NA	NA
WP_001072394.1|1539026_1540619_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.2	3.7e-172
WP_000624671.1|1540649_1541000_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	4.7e-40
WP_000435415.1|1540996_1541416_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	77.3	2.9e-36
WP_001063816.1|1541764_1542892_-|transposase	IS110-like element ISSso6 family transposase	transposase	NA	NA	NA	NA
>prophage 65
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	1547583	1620786	4652776	tRNA,protease,transposase	Stx2-converting_phage(30.43%)	58	NA	NA
WP_000230709.1|1547583_1548039_+	hypothetical protein	NA	A0A1W6JPI4	Morganella_phage	65.7	1.1e-44
WP_001333468.1|1548151_1548532_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612626.1|1548528_1548876_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000099181.1|1548924_1550463_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.2	2.8e-294
WP_073817732.1|1551063_1551558_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	96.3	1.2e-84
WP_000066917.1|1551557_1552211_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_000210161.1|1552207_1552534_+	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	99.1	2.0e-53
WP_000767125.1|1552530_1552920_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	98.4	1.3e-67
WP_001061406.1|1552939_1553737_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.2	5.8e-150
WP_001047109.1|1554746_1555499_+	antitermination protein	NA	Q8SBE4	Shigella_phage	99.2	9.0e-137
WP_024259574.1|1556522_1558304_-	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	26.8	7.8e-38
WP_000141275.1|1558393_1559209_-	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_000776388.1|1559286_1559769_-	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000460156.1|1559998_1560901_+	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_001157963.1|1560969_1562064_+|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_088895425.1|1563555_1564783_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_075319160.1|1564872_1565214_-	type IV secretion protein Rhs	NA	NA	NA	NA	NA
WP_001110573.1|1571805_1572492_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_001295836.1|1572462_1573086_+|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_000148945.1|1573075_1573885_+	NADP(+)-dependent aldehyde reductase	NA	NA	NA	NA	NA
WP_001295322.1|1573945_1574800_+	chaperedoxin	NA	NA	NA	NA	NA
WP_005030189.1|1574862_1575642_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_001157540.1|1575628_1576306_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	1.4e-27
WP_000904502.1|1576451_1577369_+	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_000970323.1|1577365_1577824_+	NfeD family protein	NA	NA	NA	NA	NA
WP_001026747.1|1577824_1578232_-	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000982153.1|1578356_1579649_-	amino acid permease	NA	NA	NA	NA	NA
WP_000883032.1|1579651_1580584_-	glutaminase A	NA	NA	NA	NA	NA
WP_000083973.1|1580845_1583350_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.0	1.9e-114
WP_005039895.1|1583557_1583899_-	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	73.6	2.7e-40
WP_000365186.1|1584036_1584831_+	TraB/GumN family protein	NA	NA	NA	NA	NA
WP_000186627.1|1585033_1585513_+|tRNA	Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK	tRNA	NA	NA	NA	NA
WP_000771788.1|1585549_1587202_-	bifunctional UDP-sugar hydrolase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_000546228.1|1589654_1591331_+	Kef family K(+) transporter	NA	NA	NA	NA	NA
WP_000671574.1|1591463_1592768_-	inosine/guanosine kinase	NA	NA	NA	NA	NA
WP_000801834.1|1592919_1593879_+	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.0	5.5e-14
WP_001250119.1|1593875_1594838_-	ferrochelatase	NA	NA	NA	NA	NA
WP_001220233.1|1594969_1595614_-	adenylate kinase	NA	NA	NA	NA	NA
WP_000678201.1|1595794_1597669_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
WP_001195025.1|1597778_1598384_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_000467098.1|1598383_1598713_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_000122015.1|1598765_1600697_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000127356.1|1600825_1601377_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
WP_000844848.1|1601976_1602504_+	primosomal replication protein N''	NA	NA	NA	NA	NA
WP_000051146.1|1602517_1602679_+	pleiotropic regulatory protein RsmS	NA	NA	NA	NA	NA
WP_000177709.1|1602890_1606253_-	mechanosensitive channel MscK	NA	NA	NA	NA	NA
WP_000101737.1|1606380_1607028_-	multidrug efflux transporter transcriptional repressor AcrR	NA	NA	NA	NA	NA
WP_024258559.1|1607169_1608363_+	multidrug efflux RND transporter periplasmic adaptor subunit AcrA	NA	NA	NA	NA	NA
WP_001132469.1|1608385_1611535_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	6.2e-54
WP_000344809.1|1612080_1612455_+	Hha toxicity modulator TomB	NA	NA	NA	NA	NA
WP_001291435.1|1612480_1612699_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_000102546.1|1612870_1613422_+	maltose O-acetyltransferase	NA	NA	NA	NA	NA
WP_000136192.1|1613537_1614008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088895425.1|1614322_1615550_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_094110543.1|1615991_1617147_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	8.9e-67
WP_000878140.1|1618366_1618720_-	DUF1428 domain-containing protein	NA	NA	NA	NA	NA
WP_000409911.1|1619098_1619410_+	MGMT family protein	NA	NA	NA	NA	NA
WP_162281792.1|1619439_1620786_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 66
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	1624411	1760259	4652776	tRNA,protease,integrase,transposase	Bacillus_phage(19.44%)	116	1692339:1692398	1749019:1750470
WP_001256174.1|1624411_1626193_-	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	1.4e-42
WP_001163619.1|1626185_1626332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129592979.1|1626615_1627635_-|transposase	IS110-like element ISEc11 family transposase	transposase	NA	NA	NA	NA
WP_000884589.1|1629430_1629889_-	DNA-binding transcriptional regulator DecR	NA	NA	NA	NA	NA
WP_000113027.1|1630041_1630860_-	HMP-PP phosphatase	NA	NA	NA	NA	NA
WP_001238231.1|1630959_1632660_+	SgrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000817229.1|1632724_1633420_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.9e-88
WP_001063816.1|1633831_1634959_+|transposase	IS110-like element ISSso6 family transposase	transposase	NA	NA	NA	NA
WP_001333468.1|1635312_1635693_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612626.1|1635689_1636037_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000099181.1|1636085_1637624_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.2	2.8e-294
WP_000680312.1|1637931_1638303_-	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000969381.1|1638453_1640325_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_001043542.1|1640516_1640789_-	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
WP_004981092.1|1640997_1643352_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	3.6e-224
WP_000130306.1|1643539_1644814_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.6	2.3e-132
WP_000122253.1|1644939_1645563_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
WP_001198392.1|1645808_1647107_-	trigger factor	NA	NA	NA	NA	NA
WP_000973449.1|1647450_1647768_-	transcriptional regulator BolA	NA	NA	NA	NA	NA
WP_005030624.1|1648072_1648651_+	lipoprotein	NA	NA	NA	NA	NA
WP_000098438.1|1648694_1650170_+	muropeptide MFS transporter AmpG	NA	NA	NA	NA	NA
WP_000467180.1|1651599_1653591_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_000179812.1|1653580_1654195_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_000019869.1|1654194_1654524_+	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_000971338.1|1654535_1655426_+	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_001000997.1|1655574_1656933_+	MFS transporter	NA	NA	NA	NA	NA
WP_001138904.1|1657066_1657558_-	nucleotide binding protein YajQ	NA	NA	NA	NA	NA
WP_000705861.1|1657725_1658637_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_001276309.1|1658599_1659190_+	protein deglycase YajL	NA	NA	NA	NA	NA
WP_000668685.1|1659243_1660692_-|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_001124935.1|1660897_1661140_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_000347225.1|1661139_1662039_+	(2E,6E)-farnesyl diphosphate synthase	NA	NA	NA	NA	NA
WP_000006809.1|1662063_1663926_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_000154044.1|1664995_1665514_-	phosphatidylglycerophosphatase A	NA	NA	NA	NA	NA
WP_000742101.1|1665491_1666469_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_000801125.1|1666546_1666966_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_001021161.1|1666985_1667456_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
WP_001150462.1|1667544_1668648_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.5	3.1e-53
WP_000543535.1|1668651_1669101_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_005004736.1|1669251_1669791_+	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_005030662.1|1670089_1670974_+	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_000974813.1|1671150_1671498_-	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_167544911.1|1671586_1672815_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	3.8e-177
WP_000046637.1|1672962_1673934_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000934825.1|1673944_1675792_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000007629.1|1675819_1676152_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000667313.1|1676174_1677302_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	3.6e-89
WP_001266492.1|1677357_1678428_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_001009875.1|1678520_1679102_+	ACP phosphodiesterase	NA	NA	NA	NA	NA
WP_001295329.1|1680984_1682358_-	proline-specific permease ProY	NA	NA	NA	NA	NA
WP_000149651.1|1682433_1683753_-	branched-chain amino acid transporter carrier protein BrnQ	NA	NA	NA	NA	NA
WP_024259572.1|1684159_1685455_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	1.7e-26
WP_000113933.1|1685512_1686202_-	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_129592977.1|1686391_1687594_+	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
WP_000698910.1|1687590_1690734_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_001345723.1|1690859_1692044_+	MFS transporter AraJ	NA	NA	NA	NA	NA
1692339:1692398	attL	CCCCGTTACTTTATTCGTACCCCTTATAATGGGGTGTTAGCCAGCCAGACCCGGCATGAT	NA	NA	NA	NA
WP_129592976.1|1692569_1693766_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_005042757.1|1694021_1695218_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_128566910.1|1697110_1697194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000941942.1|1697679_1697964_-	pyrimidine/purine nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_001276420.1|1698035_1698713_-	AroM family protein	NA	NA	NA	NA	NA
WP_001142439.1|1698970_1699162_-	protein YaiA	NA	NA	NA	NA	NA
WP_000193394.1|1699211_1699736_-	shikimate kinase AroL	NA	NA	NA	NA	NA
WP_000158159.1|1699918_1700377_-	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_004981133.1|1700496_1701306_+	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_000484055.1|1701322_1702438_-	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.5e-18
WP_005039754.1|1702539_1702860_-	phosphate starvation-inducible protein PsiF	NA	NA	NA	NA	NA
WP_005029135.1|1702978_1704394_-	alkaline phosphatase	NA	NA	NA	NA	NA
WP_073816973.1|1704494_1704755_-	anti-adapter protein IraP	NA	NA	NA	NA	NA
WP_000413696.1|1705216_1706311_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_001295334.1|1706334_1706547_-	DUF2754 domain-containing protein	NA	NA	NA	NA	NA
WP_000763151.1|1706806_1707115_+	DUF2755 family protein	NA	NA	NA	NA	NA
WP_000092035.1|1707173_1708268_-	surface-exposed outer membrane lipoprotein YaiW	NA	NA	NA	NA	NA
WP_004980979.1|1708280_1709501_-	peptide antibiotic transporter SbmA	NA	NA	NA	NA	NA
WP_000830741.1|1709852_1711010_+	OXA-12 family class D beta-lactamase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	5.1e-06
WP_005029125.1|1711010_1711634_-	hydrogen peroxide resistance inhibitor IprA	NA	NA	NA	NA	NA
WP_088895425.1|1713904_1715133_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_001295337.1|1716576_1717551_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_000004025.1|1717656_1718508_-	taurine dioxygenase	NA	NA	NA	NA	NA
WP_000114611.1|1718504_1719332_-	taurine ABC transporter permease TauC	NA	NA	NA	NA	NA
WP_000939345.1|1719328_1720096_-	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	39.2	9.5e-25
WP_005039740.1|1720108_1721071_-	taurine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000362025.1|1721686_1722358_+	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_001095423.1|1724172_1724370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000370306.1|1724443_1725139_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023903.1|1725131_1726559_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102117.1|1726569_1727289_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339594.1|1727807_1728662_-	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
WP_001046306.1|1728887_1730213_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	1.1e-113
WP_134806767.1|1730365_1731578_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	97.6	8.7e-166
WP_000435415.1|1732751_1733171_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	77.3	2.9e-36
WP_000624671.1|1733167_1733518_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	4.7e-40
WP_001072392.1|1733548_1735141_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.2	4.8e-172
WP_001063816.1|1735433_1736561_-|transposase	IS110-like element ISSso6 family transposase	transposase	NA	NA	NA	NA
WP_000083332.1|1737025_1737223_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	48.1	3.9e-07
WP_000251023.1|1737420_1738302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000772640.1|1738444_1739659_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.2	3.7e-132
WP_000893276.1|1740014_1741268_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	4.9e-95
WP_001285290.1|1741279_1742383_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	6.3e-62
WP_000749890.1|1742670_1743726_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.3	8.5e-117
WP_000174671.1|1743764_1744166_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189552.1|1744223_1745468_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|1745559_1746018_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293009.1|1746278_1747736_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_000602112.1|1747792_1748407_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_129592976.1|1749249_1750446_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000528872.1|1750424_1750991_-	RNA ligase RtcB family protein	NA	U5PUG1	Bacillus_phage	30.3	2.0e-08
1749019:1750470	attR	CCCCGTTACTTTATTCGTACCCCTTATAATGGGGTGTTAGCCAGCCAGACCCGGCATGATTACTGCCCCCAGTCGTCCATGATCCGGGGGGGGATGTCACCGGGTCTGGTGGGGCGCTGGTAACCGCTAATAGGGGTCAGGTCAGGCACTTTTGCCGGGACCGTCTGTAACGTGGATGCCGGTACCTGCTCCCCGTGGTTATCTGGTTAACCCATATACAAGGGAGACAGAATGACCGAATCCAGCGATTACGAATCCGTCCAGGTCTTTATCGGCGTTGATGTCGGTAAAGATACGCATCACGCTGTTGCCATTAATCGTTCAGGTAAACGCCTGTTCGATAAAGCATTACCCAACGACGAAAACAAACTCAGATCGCTAATATCTGACCTGAAACAACATGGTCAGATACTGCTGGTTGTTGATCAGCCAGCTACCATCGGTGCGTTACCTGTCGCCGTTGCCCGCTCAGAAGGAGTCCTTGTCGGATACCTCCCTGGACTGGCCATGCGCCGCATAGCCGACTTACACGCCGGTGAAGCTAAAACTGATGCTCGTGACGCTGCCATCATTGCCGAAGCTGCCCGTACCCTGCCTCACGCGCTACGCACGCTGAAACTGGCTGACGAGCAAATCGCCGAACTCTCCATGCTCTGCGGCTTCGATGATGATCTTGCCGCACAGACAACGCAGGCCAGCAACCGTATCCGCGGCCTTCTGCCCCAGATACATCCGGCACTGGAGCGCGTTCTCGGTCCGAGACTTGAGCACCCGGCGGTACTCGCTCTTCTCCAGCGATATCCCTCACCAGAAAAACTCGCTTCGCTGGGTGAGAAGAAGCTGGCAGCCCAGCTCTGCAAACTTGCGCCTCGTCTGGGTAAACGCCTTGCAGCAGACATAGCTCAGGCACTGGCCGAACAAACCGTCGTCGTTCCCGGCACGAATGCCGCTGCCGTAGTACTGCCACGTCTGGCACTCCAGCTCATCACGCTGCGTAAGCAAAGAGACGAGGTGGCGCTTGAGGTAGAACAGCGAGTTATTGCTCACCCTCTTTACCCGGTCCTGACCAGTATGCCCGGAGTCGGTGTCAGGACCGCAGCCAGACTCCTCACCGAGGTCGCCTGCCGCGCCTTCGCCTCTGCCGCACATCTCGCTGCTTATGCTGGCCTTGCGCCGGTAACTCGGCGATCCGGCTCGTCAATACGCGGTAAGCATCCCTCGCGACGGGGTAATAAAGCTCTCAAACGGGCGTTGTTCCTGTCGGCCTTCGCCGCGCTCAGGGATCCGCTCTCCAGGGCTTACTACACCCGCAAAATGAGTCAGGGAAAACGACACAATCAGGCGCTTATCGCCCTGGCGAGACGACGCTGCGACGTTCTGTTCGCCATGATGCGCGACGGGACTTTTTATACCCCGCAGGGGTCATAACATGCTTGACAACTTAATAGGGGC	NA	NA	NA	NA
WP_001059855.1|1751236_1751689_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001226164.1|1751685_1752741_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000207568.1|1752811_1753597_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_129592973.1|1753541_1755281_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000006234.1|1755504_1756002_-|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_005025508.1|1756177_1756927_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	36.9	5.8e-19
WP_001225679.1|1757996_1758737_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000333380.1|1758707_1759475_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|1759680_1760259_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
>prophage 67
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	1765602	1769800	4652776		Bradyrhizobium_phage(33.33%)	4	NA	NA
WP_001297205.1|1765602_1766334_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_000917883.1|1766398_1766866_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001052720.1|1767614_1768370_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644682.1|1768441_1769800_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
>prophage 68
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	1779740	1780772	4652776		Planktothrix_phage(100.0%)	1	NA	NA
WP_000593994.1|1779740_1780772_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
>prophage 69
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	1793775	1797891	4652776		Saccharomonospora_phage(50.0%)	2	NA	NA
WP_001294777.1|1793775_1797258_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	37.0	5.7e-210
WP_000569419.1|1797294_1797891_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	3.9e-26
>prophage 70
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	1806719	1807478	4652776		Flavobacterium_phage(100.0%)	1	NA	NA
WP_005039433.1|1806719_1807478_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	1.7e-26
>prophage 71
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	1820076	1821501	4652776	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000753946.1|1820076_1821501_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
>prophage 72
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	1826206	1826551	4652776		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|1826206_1826551_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 73
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	1832462	1833260	4652776		Planktothrix_phage(100.0%)	1	NA	NA
WP_001400473.1|1832462_1833260_-	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	4.6e-14
>prophage 74
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	1838443	1845249	4652776	tRNA	Acanthamoeba_polyphaga_mimivirus(50.0%)	6	NA	NA
WP_073817204.1|1838443_1840873_-	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.1	1.5e-39
WP_001294699.1|1840946_1841477_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_000396054.1|1841491_1842196_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001155227.1|1842373_1842829_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_000937428.1|1842865_1843792_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_000174645.1|1843830_1845249_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
>prophage 75
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	1848425	1852646	4652776	transposase	Shigella_phage(50.0%)	4	NA	NA
WP_129592972.1|1848425_1849593_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.3	3.4e-183
WP_000805451.1|1849800_1850595_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
WP_073816679.1|1850606_1851458_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_000339949.1|1851749_1852646_-	recombination-promoting nuclease RpnC	NA	Q2A0A7	Sodalis_phage	49.2	5.6e-61
>prophage 76
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	1855908	1862376	4652776		Anomala_cuprea_entomopoxvirus(33.33%)	4	NA	NA
WP_000150637.1|1855908_1856835_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
WP_000651584.1|1856943_1857606_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_005030877.1|1857646_1858183_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	6.6e-17
WP_001189607.1|1860825_1862376_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.7e-18
>prophage 77
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	1869917	1871342	4652776		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102485.1|1869917_1871342_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 78
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	1879969	1880521	4652776		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923726.1|1879969_1880521_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	31.6	1.5e-11
>prophage 79
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	1885516	1886560	4652776		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217318.1|1885516_1886560_-	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.0	1.4e-103
>prophage 80
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	1912540	1914265	4652776		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_000425674.1|1912540_1914265_-	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	1.1e-36
>prophage 81
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	1926873	1927572	4652776		Planktothrix_phage(100.0%)	1	NA	NA
WP_073816495.1|1926873_1927572_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	37.2	2.8e-23
>prophage 82
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	1933934	1939356	4652776		Yellowstone_lake_phycodnavirus(50.0%)	2	NA	NA
WP_000035676.1|1933934_1936286_+	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.4	3.9e-37
WP_001117037.1|1936449_1939356_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
>prophage 83
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	1947100	1948500	4652776		Microcystis_phage(50.0%)	2	NA	NA
WP_000257192.1|1947100_1947943_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.0e-08
WP_000624375.1|1948020_1948500_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
>prophage 84
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	1956549	1957698	4652776		Halovirus(100.0%)	1	NA	NA
WP_005039063.1|1956549_1957698_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.7e-49
>prophage 85
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	1962085	1975405	4652776	tRNA,transposase	Tupanvirus(16.67%)	10	NA	NA
WP_001286855.1|1962085_1964902_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	2.7e-77
WP_000767329.1|1964944_1965886_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_001295417.1|1965893_1966112_-	DUF2575 family protein	NA	NA	NA	NA	NA
WP_001274021.1|1966214_1966478_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_088895425.1|1967520_1968749_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_001300855.1|1969311_1970211_-	transcriptional activator NhaR	NA	NA	NA	NA	NA
WP_000681373.1|1970276_1971443_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	53.5	1.2e-87
WP_000935262.1|1971971_1972181_+	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	73.9	8.0e-19
WP_001118451.1|1972284_1973400_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	37.4	2.4e-29
WP_000516135.1|1973488_1975405_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
>prophage 86
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	1979153	1980107	4652776		Cyanophage(100.0%)	1	NA	NA
WP_000130189.1|1979153_1980107_-	transaldolase	NA	A0A127KNC6	Cyanophage	30.9	4.8e-10
>prophage 87
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	1991820	1993934	4652776		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_001219621.1|1991820_1993245_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.0	6.1e-09
WP_024258074.1|1993244_1993934_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	32.6	6.5e-25
>prophage 88
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	1997217	2002572	4652776		Bacillus_phage(33.33%)	3	NA	NA
WP_005025092.1|1997217_1999155_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	31.5	1.4e-11
WP_000046749.1|1999365_2001033_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000093810.1|2001339_2002572_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.6e-82
>prophage 89
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	2009315	2013173	4652776	transposase	Geobacillus_virus(50.0%)	3	NA	NA
WP_000477790.1|2009315_2010638_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.5	6.8e-79
WP_001365356.1|2010764_2011544_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_129592968.1|2012025_2013173_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.0	2.7e-172
>prophage 90
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	2017567	2020443	4652776		Salmonella_phage(50.0%)	3	NA	NA
WP_000490275.1|2017567_2017729_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_005025113.1|2017855_2018461_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000175943.1|2018853_2020443_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
>prophage 91
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	2028337	2029617	4652776		Salmonella_phage(50.0%)	2	NA	NA
WP_000098818.1|2028337_2028877_+	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
WP_000799911.1|2028879_2029617_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
>prophage 92
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	2032843	2033866	4652776		Tupanvirus(100.0%)	1	NA	NA
WP_000106047.1|2032843_2033866_-	L-galactonate oxidoreductase	NA	A0A2K9L7I1	Tupanvirus	26.3	9.4e-12
>prophage 93
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	2037320	2038976	4652776		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000919572.1|2037320_2038976_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
>prophage 94
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	2055345	2104349	4652776	transposase	Stx2-converting_phage(30.77%)	35	NA	NA
WP_005025039.1|2055345_2056542_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_073817651.1|2058550_2058631_-	DUF1127 domain-containing protein	NA	NA	NA	NA	NA
WP_094096743.1|2059380_2060549_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.0	8.4e-182
WP_001137007.1|2062000_2063233_+	multidrug efflux MFS transporter MdtM	NA	NA	NA	NA	NA
WP_001037377.1|2063273_2064554_+	DUF445 domain-containing protein	NA	NA	NA	NA	NA
WP_000222495.1|2065832_2066600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000657676.1|2066596_2066854_+	DUF3343 domain-containing protein	NA	NA	NA	NA	NA
WP_162281793.1|2066807_2067779_+	YjiK family protein	NA	NA	NA	NA	NA
WP_001141187.1|2067846_2069025_+	MFS transporter	NA	NA	NA	NA	NA
WP_162281794.1|2069037_2069694_-	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	43.0	5.4e-37
WP_001295597.1|2069841_2070525_+	nucleoside recognition pore and gate family inner membrane transporter	NA	NA	NA	NA	NA
WP_000211971.1|2070521_2070983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000568428.1|2070995_2072168_+	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
WP_000340766.1|2072232_2073144_+	hypochlorite stress DNA-binding transcriptional regulator HypT	NA	NA	NA	NA	NA
WP_000986206.1|2073136_2073529_-	anti-adapter protein IraD	NA	NA	NA	NA	NA
WP_120795393.1|2073525_2073609_-	iraD leader peptide	NA	NA	NA	NA	NA
WP_000062561.1|2074200_2075031_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_000833687.1|2075946_2076723_-	Uxu operon transcriptional regulator	NA	NA	NA	NA	NA
WP_000208186.1|2076937_2078398_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	1.6e-49
WP_000438559.1|2078478_2079663_-	mannonate dehydratase	NA	NA	NA	NA	NA
WP_000872005.1|2081371_2081875_-	type 1 fimbria minor subunit FimG	NA	NA	NA	NA	NA
WP_001244838.1|2081887_2082418_-	type 1 fimbria minor subunit FimF	NA	NA	NA	NA	NA
WP_000824117.1|2087446_2087986_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000695563.1|2088050_2088599_-	metal ABC transporter substrate-binding lipoprotein/fibrin-binding adhesin FimA	NA	NA	NA	NA	NA
WP_000435415.1|2088874_2089294_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	77.3	2.9e-36
WP_000624671.1|2089290_2089641_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	4.7e-40
WP_001072394.1|2089671_2091264_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.2	3.7e-172
WP_001243643.1|2091294_2091588_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.9e-51
WP_129592825.1|2091636_2093175_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	98.8	1.8e-293
WP_129592824.1|2093422_2094591_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.3	3.4e-183
WP_000856939.1|2095376_2096060_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_088895425.1|2096271_2097499_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_129592965.1|2097424_2098605_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.4	6.1e-63
WP_000438158.1|2099237_2102651_+	DEAD/DEAH box helicase family protein	NA	Q6NDX2	Leptospira_phage	26.2	8.5e-17
WP_000627722.1|2102714_2104349_+	N-6 DNA methylase	NA	J7I0U9	Acinetobacter_phage	30.9	2.0e-32
>prophage 95
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	2107948	2119928	4652776	tRNA,integrase	Enterobacteria_phage(20.0%)	8	2094035:2094049	2115640:2115654
2094035:2094049	attL	CCCCAGCTCTTTCAT	NA	NA	NA	NA
WP_005045373.1|2107948_2109217_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	39.6	1.8e-81
WP_005028720.1|2109697_2110717_+	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	1.9e-44
WP_004988616.1|2110846_2112349_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	2.7e-84
WP_005045411.1|2112509_2113592_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_000584114.1|2113591_2114692_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_000397139.1|2114958_2116470_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.6	2.3e-46
2115640:2115654	attR	ATGAAAGAGCTGGGG	NA	NA	NA	NA
WP_000786399.1|2116629_2117073_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000416406.1|2117072_2119928_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
>prophage 96
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	2130362	2136477	4652776		Paramecium_bursaria_Chlorella_virus(66.67%)	6	NA	NA
WP_000013046.1|2130362_2131298_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_000148581.1|2131310_2131772_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_004988646.1|2131844_2132231_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000471882.1|2132436_2135133_-	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.3	1.3e-44
WP_001387276.1|2135273_2135327_-	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_001181346.1|2135511_2136477_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	6.1e-13
>prophage 97
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	2140097	2142799	4652776		Vibrio_phage(50.0%)	2	NA	NA
WP_000187785.1|2140097_2142236_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	3.1e-267
WP_001106233.1|2142334_2142799_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.7	3.8e-53
>prophage 98
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	2147042	2148041	4652776		Klosneuvirus(100.0%)	1	NA	NA
WP_000853753.1|2147042_2148041_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
>prophage 99
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	2152999	2153530	4652776		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000055075.1|2152999_2153530_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
>prophage 100
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	2195838	2395701	4652776	tRNA,protease,transposase	Stx2-converting_phage(26.67%)	156	NA	NA
WP_000811566.1|2195838_2196114_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_129592962.1|2196230_2197856_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000943998.1|2197939_2198998_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	39.8	1.1e-66
WP_073816939.1|2199000_2199639_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547762.1|2199648_2200047_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000012566.1|2200064_2200724_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511951.1|2200774_2201473_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_001034109.1|2205114_2208972_+|protease	serine protease autotransporter toxin SigA	protease	Q9LA58	Enterobacterial_phage	38.2	2.0e-224
WP_005045429.1|2210632_2212900_+	arginine decarboxylase	NA	NA	NA	NA	NA
WP_001217059.1|2213224_2213986_+	DNA-binding transcriptional activator AdiY	NA	NA	NA	NA	NA
WP_024259688.1|2216341_2217985_+	phosphoethanolamine transferase EptA	NA	NA	NA	NA	NA
WP_000697915.1|2217981_2218650_+	two-component system response regulator BasR	NA	NA	NA	NA	NA
WP_001052136.1|2218650_2219751_+	two-component system sensor histidine kinase PmrB	NA	NA	NA	NA	NA
WP_000797656.1|2219726_2219816_-	LpxT activity modulator PmrR	NA	NA	NA	NA	NA
WP_000919721.1|2219927_2221430_-	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.0	4.1e-56
WP_000169196.1|2221694_2222573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073817245.1|2222569_2224798_-	clamp-binding protein CrfC	NA	NA	NA	NA	NA
WP_001300891.1|2225975_2226311_+	phnA family protein	NA	NA	NA	NA	NA
WP_001131343.1|2226470_2226914_+	VOC family metalloprotein YjdN	NA	NA	NA	NA	NA
WP_001193422.1|2227046_2227835_+	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.4	1.5e-25
WP_073817442.1|2227859_2228876_+	phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001193503.1|2229001_2229781_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_001063816.1|2230455_2231583_+|transposase	IS110-like element ISSso6 family transposase	transposase	NA	NA	NA	NA
WP_001072394.1|2231876_2233469_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.2	3.7e-172
WP_000624671.1|2233499_2233850_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	4.7e-40
WP_000435415.1|2233846_2234266_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	77.3	2.9e-36
WP_001183287.1|2234451_2234769_+	RpiB/LacA/LacB family sugar-phosphate isomerase	NA	NA	NA	NA	NA
WP_000819746.1|2234837_2235167_+	protein YjdP	NA	NA	NA	NA	NA
WP_000059947.1|2235313_2236072_-	phosphonate metabolism protein PhnP	NA	NA	NA	NA	NA
WP_001110504.1|2236073_2236508_-	aminoalkylphosphonate N-acetyltransferase	NA	NA	NA	NA	NA
WP_000971894.1|2236494_2237052_-	ribose 1,5-bisphosphokinase	NA	NA	NA	NA	NA
WP_000586303.1|2237051_2238188_-	alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000611423.1|2238184_2238865_-	phosphonate C-P lyase system protein PhnL	NA	G9BWD6	Planktothrix_phage	33.6	1.7e-17
WP_001075525.1|2238975_2239734_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	27.8	1.0e-15
WP_000002283.1|2239730_2240576_-	alpha-D-ribose 1-methylphosphonate 5-phosphate C-P-lyase PhnJ	NA	NA	NA	NA	NA
WP_005045173.1|2240568_2241633_-	alpha-D-ribose 1-methylphosphonate 5-triphosphate synthase subunit PhnI	NA	NA	NA	NA	NA
WP_000171616.1|2241632_2242217_-	phosphonate C-P lyase system protein PhnH	NA	NA	NA	NA	NA
WP_000542751.1|2242213_2242666_-	phosphonate C-P lyase system protein PhnG	NA	NA	NA	NA	NA
WP_000099177.1|2242913_2244452_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.0	8.2e-294
WP_000612626.1|2244500_2244848_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_001333468.1|2244844_2245225_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_001063816.1|2245579_2246707_-|transposase	IS110-like element ISSso6 family transposase	transposase	NA	NA	NA	NA
WP_000950648.1|2247797_2248190_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_077897571.1|2248196_2249798_+|transposase	IS66-like element ISEc49 family transposase	transposase	A0A218MNE7	uncultured_virus	36.4	7.7e-77
WP_000221546.1|2250490_2251060_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000270997.1|2251226_2251610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001013309.1|2251606_2252065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167544922.1|2253867_2255096_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	4.2e-176
WP_005024678.1|2255106_2255541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000074489.1|2255990_2257184_-	MFS transporter	NA	NA	NA	NA	NA
WP_001403387.1|2257319_2259044_+	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_001287501.1|2259044_2259992_+	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_001015718.1|2259991_2261734_+	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_000750143.1|2261730_2263068_+	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_001387241.1|2263073_2265269_+	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_001063816.1|2265673_2266801_+|transposase	IS110-like element ISSso6 family transposase	transposase	NA	NA	NA	NA
WP_001072394.1|2267094_2268687_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.2	3.7e-172
WP_000624671.1|2268717_2269068_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	4.7e-40
WP_000435415.1|2269064_2269484_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	77.3	2.9e-36
WP_001188520.1|2271304_2271880_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000068980.1|2271916_2273614_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_000883402.1|2273589_2273928_-	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_000961959.1|2274043_2275345_-	anaerobic C4-dicarboxylate transporter DcuA	NA	NA	NA	NA	NA
WP_000069437.1|2275462_2276899_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_001267448.1|2277235_2277712_+	membrane protein FxsA	NA	NA	NA	NA	NA
WP_000015870.1|2277727_2278984_-	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_001026276.1|2279259_2279553_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|2279596_2281243_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_000558209.1|2281380_2281734_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_001008051.1|2281936_2282806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000940527.1|2283956_2285006_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_000257278.1|2285047_2285614_+	elongation factor P	NA	NA	NA	NA	NA
WP_000977757.1|2285665_2285791_+	lipoprotein antitoxin entericidin A	NA	NA	NA	NA	NA
WP_000239596.1|2285901_2286048_+	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_000118482.1|2286229_2286547_+	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_001238381.1|2286543_2287077_-	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	54.4	1.4e-46
WP_005025617.1|2287165_2288296_-	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
WP_024259702.1|2288358_2288718_-	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_000208757.1|2288728_2289124_-	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_000829495.1|2289134_2289869_-	fumarate reductase iron-sulfur protein	NA	NA	NA	NA	NA
WP_001192965.1|2289861_2291670_-	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_000004772.1|2291994_2292972_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	4.0e-28
WP_000445058.1|2294512_2294827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001236856.1|2294977_2298301_-	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_000934908.1|2298322_2299291_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_000041970.1|2299387_2300440_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_001295188.1|2300534_2301080_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
WP_010723271.1|2301818_2301872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005045663.1|2301854_2302994_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_073816951.1|2302992_2304540_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_000981977.1|2304511_2304973_+|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_000990330.1|2304991_2306329_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_001122503.1|2306338_2308186_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.4e-60
WP_001280345.1|2308178_2309129_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|2309214_2309523_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460348.1|2309599_2310880_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312488.1|2310965_2312225_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|2312227_2313232_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|2313313_2313511_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_032274120.1|2313614_2314913_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	36.1	4.5e-67
WP_001177640.1|2315117_2315543_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076296.1|2315581_2318023_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	1.7e-67
WP_001293267.1|2318203_2318935_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_001063816.1|2319186_2320314_+|transposase	IS110-like element ISSso6 family transposase	transposase	NA	NA	NA	NA
WP_001333468.1|2320668_2321049_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_134800715.1|2321045_2321393_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	2.2e-61
WP_129592825.1|2321441_2322980_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	98.8	1.8e-293
WP_129592959.1|2324265_2325422_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.4	7.5e-66
WP_001223346.1|2326219_2328310_-	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
WP_088895425.1|2328764_2329992_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_000477614.1|2331098_2331425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088895425.1|2331592_2332821_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_000435415.1|2333780_2334200_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	77.3	2.9e-36
WP_000624671.1|2334196_2334547_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	4.7e-40
WP_001072392.1|2334577_2336170_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.2	4.8e-172
WP_001063816.1|2336462_2337590_-|transposase	IS110-like element ISSso6 family transposase	transposase	NA	NA	NA	NA
WP_001066003.1|2337881_2339867_+	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.1	8.7e-147
WP_004988094.1|2340075_2340351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001275142.1|2341399_2343451_+	multidrug efflux transporter permease subunit MdtO	NA	NA	NA	NA	NA
WP_000610556.1|2343447_2344914_+	multidrug efflux transporter outer membrane subunit MdtP	NA	NA	NA	NA	NA
WP_077897533.1|2345111_2347259_+	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.9	2.7e-32
WP_000789585.1|2348231_2349545_-	glutamate/aspartate:proton symporter GltP	NA	NA	NA	NA	NA
WP_073816844.1|2349886_2350483_-	heme lyase NrfEFG subunit NrfG	NA	NA	NA	NA	NA
WP_001032546.1|2350479_2350863_-	heme lyase NrfEFG subunit NrfF	NA	NA	NA	NA	NA
WP_071821661.1|2350855_2352574_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_000195158.1|2352593_2353550_-	cytochrome c nitrite reductase subunit NrfD	NA	NA	NA	NA	NA
WP_000220281.1|2353546_2354218_-	cytochrome c nitrite reductase Fe-S protein	NA	NA	NA	NA	NA
WP_001296647.1|2354214_2354781_-	cytochrome c nitrite reductase pentaheme subunit	NA	NA	NA	NA	NA
WP_005045745.1|2354825_2356262_-	ammonia-forming nitrite reductase cytochrome c552 subunit	NA	NA	NA	NA	NA
WP_001014565.1|2358812_2359127_+	DUF485 domain-containing protein	NA	NA	NA	NA	NA
WP_000832577.1|2359123_2360773_+	cation/acetate symporter ActP	NA	NA	NA	NA	NA
WP_000402207.1|2361985_2363635_-	Na+/H+ antiporter	NA	NA	NA	NA	NA
WP_000106873.1|2363786_2365136_-	guanine/hypoxanthine transporter GhxP	NA	A0A0R6PHV4	Moraxella_phage	71.4	3.7e-157
WP_000412428.1|2365680_2366145_-	redox-sensitive transcriptional activator SoxR	NA	NA	NA	NA	NA
WP_000019358.1|2366230_2366554_+	superoxide response transcriptional regulator SoxS	NA	NA	NA	NA	NA
WP_000019553.1|2368575_2369316_-	CSS-motif domain-containing protein	NA	NA	NA	NA	NA
WP_001295689.1|2369745_2370027_+	YjcB family protein	NA	NA	NA	NA	NA
WP_000168305.1|2370125_2370662_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
WP_000357691.1|2370915_2373738_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
WP_000155655.1|2373772_2374129_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000270377.1|2374132_2374549_-	YjbQ family protein	NA	NA	NA	NA	NA
WP_005026022.1|2374659_2375373_-	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_001063816.1|2378896_2380024_-|transposase	IS110-like element ISSso6 family transposase	transposase	NA	NA	NA	NA
WP_001295693.1|2380567_2381065_+	chorismate lyase	NA	NA	NA	NA	NA
WP_000455227.1|2381077_2381950_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_004988121.1|2382104_2384528_-	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000002907.1|2384698_2385067_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000646078.1|2385176_2385785_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_005029179.1|2385857_2387183_+	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_001030593.1|2387298_2387508_+	CsbD family protein	NA	NA	NA	NA	NA
WP_005029183.1|2387549_2388065_-	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_004988151.1|2390507_2391545_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000891404.1|2391678_2391921_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000235537.1|2392087_2393071_-	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000918363.1|2393153_2394569_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
WP_001147344.1|2394621_2395701_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	3.1e-29
>prophage 101
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	2438664	2440254	4652776		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187566.1|2438664_2440254_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	1.3e-68
>prophage 102
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	2445621	2447385	4652776		Bacillus_phage(50.0%)	3	NA	NA
WP_001044513.1|2445621_2445894_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
WP_000941113.1|2446080_2446671_-	YjaG family protein	NA	NA	NA	NA	NA
WP_000362392.1|2446713_2447385_-	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
>prophage 103
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	2456602	2464931	4652776		Vibrio_phage(50.0%)	2	NA	NA
WP_000653944.1|2456602_2460826_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	2.5e-66
WP_000263098.1|2460902_2464931_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
>prophage 104
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	2469048	2472101	4652776		Tupanvirus(50.0%)	2	NA	NA
WP_000031784.1|2469048_2470233_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000023091.1|2471150_2472101_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
>prophage 105
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	2499454	2506701	4652776		Serratia_phage(33.33%)	5	NA	NA
WP_129592952.1|2499454_2501752_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	7.8e-06
WP_000161265.1|2501802_2502123_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_001004458.1|2502137_2503217_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_073816614.1|2503525_2506027_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_000424845.1|2506038_2506701_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
>prophage 106
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	2529253	2533757	4652776		Erwinia_phage(50.0%)	5	NA	NA
WP_001293341.1|2529253_2530585_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_001307494.1|2530651_2531578_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872908.1|2531670_2532156_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001296623.1|2532240_2532486_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_129592948.1|2532911_2533757_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	27.6	2.9e-14
>prophage 107
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	2547341	2552201	4652776		Feldmannia_irregularis_virus(33.33%)	4	NA	NA
WP_001033722.1|2547341_2548040_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|2548036_2549410_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001270260.1|2549515_2550190_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_001297064.1|2551580_2552201_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
>prophage 108
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	2568476	2571527	4652776		Escherichia_phage(100.0%)	1	NA	NA
WP_011310337.1|2568476_2571527_+	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
>prophage 109
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	2575040	2576196	4652776	transposase	Acinetobacter_phage(100.0%)	1	NA	NA
WP_094096479.1|2575040_2576196_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	1.2e-66
>prophage 110
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	2583709	2589814	4652776	transposase	Shigella_phage(25.0%)	6	NA	NA
WP_088895425.1|2583709_2584937_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_000357973.1|2585083_2586094_-	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A0K0KVL7	Prochlorococcus_phage	22.5	4.5e-06
WP_000881591.1|2586126_2586951_-	aldolase	NA	NA	NA	NA	NA
WP_000190781.1|2587038_2587917_-	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	73.6	1.6e-47
WP_000196715.1|2588089_2588986_+	sugar kinase	NA	NA	NA	NA	NA
WP_000022286.1|2589025_2589814_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	1.3e-21
>prophage 111
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	2593697	2596168	4652776		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_000190585.1|2593697_2594747_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	25.7	1.2e-06
WP_001188776.1|2594758_2596168_+	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
>prophage 112
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	2600245	2603032	4652776		uncultured_virus(100.0%)	1	NA	NA
WP_073816808.1|2600245_2603032_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	1.7e-71
>prophage 113
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	2616722	2617337	4652776		Streptococcus_phage(100.0%)	1	NA	NA
WP_001296979.1|2616722_2617337_-	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	1.6e-19
>prophage 114
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	2625782	2629069	4652776		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000109943.1|2625782_2626559_-	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
WP_000459584.1|2626561_2627077_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_005025412.1|2627080_2627350_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000187530.1|2627428_2629069_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	8.2e-42
>prophage 115
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	2633993	2635222	4652776	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_088895425.1|2633993_2635222_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
>prophage 116
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	2644933	2646763	4652776		Catovirus(100.0%)	1	NA	NA
WP_000035581.1|2644933_2646763_-	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	7.4e-84
>prophage 117
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	2657568	2661427	4652776		Bacillus_phage(100.0%)	3	NA	NA
WP_000383386.1|2657568_2659731_-	DNA helicase II	NA	A7KV33	Bacillus_phage	36.8	3.9e-116
WP_001213587.1|2659814_2660531_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000130700.1|2660530_2661427_-	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	5.0e-25
>prophage 118
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	2681425	2687569	4652776		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000612041.1|2681425_2682556_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
WP_001145189.1|2682560_2683235_-	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000676056.1|2683212_2684094_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
WP_001226584.1|2684112_2685180_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.7	4.6e-102
WP_000006625.1|2685179_2686442_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.0e-23
WP_000866664.1|2686438_2687569_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	31.3	3.9e-27
>prophage 119
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	2691611	2698622	4652776	transposase	Indivirus(25.0%)	5	NA	NA
WP_001280776.1|2691611_2691941_-	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
WP_000047518.1|2692071_2693337_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	7.0e-41
WP_005026661.1|2693470_2694955_+	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001238896.1|2695001_2697023_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.5	9.3e-112
WP_088895425.1|2697393_2698622_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
>prophage 120
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	2706774	2708421	4652776		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001012626.1|2706774_2708421_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.8	5.7e-67
>prophage 121
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	2731123	2732116	4652776		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845107.1|2731123_2732116_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	2.2e-50
>prophage 122
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	2744067	2766403	4652776	transposase	Stx2-converting_phage(33.33%)	17	NA	NA
WP_000933714.1|2744067_2745438_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.3	6.9e-34
WP_073816917.1|2745599_2747429_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.2	7.3e-132
WP_162281798.1|2747478_2748825_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_000827805.1|2749169_2749742_+	fimbrial protein	NA	NA	NA	NA	NA
WP_073817747.1|2749789_2749933_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_000099181.1|2750352_2751891_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.2	2.8e-294
WP_000612626.1|2751939_2752287_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_001333468.1|2752283_2752664_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000377786.1|2753898_2754624_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_000063125.1|2754638_2755412_-	phosphate ABC transporter ATP-binding protein PstB	NA	G9BWD6	Planktothrix_phage	31.6	1.3e-18
WP_001251975.1|2755502_2756393_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000741620.1|2756392_2757352_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_000867146.1|2757438_2758479_-	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
WP_001046014.1|2758726_2759800_-	fimbrial protein	NA	NA	NA	NA	NA
WP_088895425.1|2760839_2762067_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_000262788.1|2763683_2764280_-	fimbrial chaperone	NA	NA	NA	NA	NA
WP_000082690.1|2765065_2766403_+	adenine permease AdeP	NA	A0A0R6PHV4	Moraxella_phage	35.7	3.4e-62
>prophage 123
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	2777375	2784744	4652776		Staphylococcus_phage(33.33%)	8	NA	NA
WP_001307474.1|2777375_2777633_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
WP_000239730.1|2777596_2777956_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_000831330.1|2777972_2778113_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_120795392.1|2778342_2778423_-	protein YsdD	NA	NA	NA	NA	NA
WP_000059111.1|2778719_2780123_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_000673464.1|2780127_2781228_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000060105.1|2781227_2782301_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000072066.1|2782329_2784744_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	2.8e-115
>prophage 124
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	2789921	2790875	4652776		Cyanophage(50.0%)	2	NA	NA
WP_001243437.1|2789921_2790335_+	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
WP_001243431.1|2790446_2790875_+	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
>prophage 125
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	2797249	2803964	4652776	transposase	Escherichia_phage(50.0%)	9	NA	NA
WP_000826449.1|2797249_2797675_+	helix-turn-helix domain-containing protein	NA	A0A077SL42	Escherichia_phage	88.7	1.0e-68
WP_094190995.1|2797687_2798038_+|transposase	transposase	transposase	A0A077SL42	Escherichia_phage	96.7	4.3e-41
WP_000703959.1|2798613_2798961_+	YidH family protein	NA	NA	NA	NA	NA
WP_001113432.1|2798950_2799313_+	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_046891658.1|2799309_2799807_+	radical SAM protein	NA	NA	NA	NA	NA
WP_005136165.1|2799814_2800999_-	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	5.2e-14
WP_000060506.1|2801417_2801507_-	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_046891657.1|2802071_2802170_+	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_000168480.1|2802275_2803964_+	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.7	4.2e-57
>prophage 126
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	2821102	2822494	4652776		environmental_Halophage(100.0%)	1	NA	NA
WP_005024375.1|2821102_2822494_-	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	99.3	7.1e-71
>prophage 127
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	2826795	2833546	4652776		Bordetella_phage(33.33%)	5	NA	NA
WP_000280488.1|2826795_2828904_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
WP_000135058.1|2828922_2829198_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_005024369.1|2829252_2829876_-	guanylate kinase	NA	A0A212Q4J6	Cowpox_virus	34.4	3.3e-20
WP_000924289.1|2831812_2832430_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_004987253.1|2832721_2833546_-	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	77.0	4.8e-91
>prophage 128
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	2836723	2837983	4652776	integrase	Morganella_phage(100.0%)	1	2825608:2825621	2842098:2842111
2825608:2825621	attL	GCGTGGCCTGCTTT	NA	NA	NA	NA
WP_024259684.1|2836723_2837983_-|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	79.1	1.4e-195
WP_024259684.1|2836723_2837983_-|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	79.1	1.4e-195
2842098:2842111	attR	GCGTGGCCTGCTTT	NA	NA	NA	NA
>prophage 129
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	2841326	2845889	4652776		Xanthomonas_phage(25.0%)	7	NA	NA
WP_000976070.1|2841326_2841785_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	9.6e-49
WP_000050124.1|2841762_2842983_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	6.5e-44
WP_001298959.1|2843154_2843823_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_000091955.1|2844039_2844276_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001051798.1|2844296_2844464_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_001114533.1|2844561_2845371_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
WP_001171866.1|2845409_2845889_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.0	4.8e-27
>prophage 130
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	2853327	2855421	4652776		Archaeal_BJ1_virus(50.0%)	2	NA	NA
WP_000364785.1|2853327_2854353_+	UDP-galactose--(galactosyl) LPS alpha1,2-galactosyltransferase	NA	A0ZYL4	Archaeal_BJ1_virus	25.5	1.4e-10
WP_000064014.1|2854437_2855421_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	38.5	2.4e-12
>prophage 131
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	2858837	2868344	4652776		Synechococcus_phage(16.67%)	9	NA	NA
WP_000587750.1|2858837_2859770_-	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	8.5e-36
WP_001213834.1|2859983_2861180_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	4.9e-36
WP_000645972.1|2861189_2862215_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_073816655.1|2862453_2863488_+	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	5.8e-09
WP_000483840.1|2863474_2864434_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_001214157.1|2864437_2865721_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_000116565.1|2865730_2867275_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001156181.1|2867519_2867951_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000024392.1|2868092_2868344_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
>prophage 132
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	2877723	2882829	4652776	transposase	Shigella_phage(100.0%)	2	NA	NA
WP_088895425.1|2877723_2878952_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_094112578.1|2881660_2882829_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	98.7	9.3e-181
>prophage 133
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	2898774	2900619	4652776		Tupanvirus(100.0%)	1	NA	NA
WP_000582463.1|2898774_2900619_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.6	1.8e-16
>prophage 134
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	2930590	3007154	4652776	tRNA,transposase	Shigella_phage(20.0%)	58	NA	NA
WP_005045922.1|2930590_2931937_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_001295224.1|2933368_2933476_-	type I toxin-antitoxin system toxin Ldr family protein	NA	NA	NA	NA	NA
WP_005029350.1|2933951_2935223_+	transporter	NA	NA	NA	NA	NA
WP_000107017.1|2935252_2936257_-	dipeptide ABC transporter ATP binding subunit DppF	NA	G9BWD6	Planktothrix_phage	33.2	7.0e-20
WP_001196496.1|2936253_2937237_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	8.7e-15
WP_000084671.1|2937247_2938150_-	dipeptide ABC transporter permease DppC	NA	NA	NA	NA	NA
WP_001269221.1|2941932_2943624_-	kdo(2)-lipid A phosphoethanolamine 7''-transferase	NA	NA	NA	NA	NA
WP_000831419.1|2943876_2944401_-	long polar fimbrial protein LpfE	NA	NA	NA	NA	NA
WP_000189025.1|2945379_2946582_-	MFS transporter	NA	NA	NA	NA	NA
WP_005045936.1|2946809_2947508_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_000438961.1|2947665_2948229_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_000617481.1|2948225_2948666_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_000747616.1|2951120_2951708_+	OmpA family lipoprotein	NA	NA	NA	NA	NA
WP_000805034.1|2951811_2952786_+	glyoxylate/hydroxypyruvate reductase GhrB	NA	NA	NA	NA	NA
WP_004987320.1|2952835_2953546_-	DUF3053 domain-containing protein	NA	NA	NA	NA	NA
WP_005045913.1|2954754_2955045_+	HTH-type transcriptional regulator	NA	NA	NA	NA	NA
WP_000014594.1|2955325_2955538_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
WP_001135724.1|2955716_2955869_-	type I toxin-antitoxin system toxin HokA	NA	NA	NA	NA	NA
WP_088895425.1|2957133_2958361_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_000435415.1|2959605_2960025_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	77.3	2.9e-36
WP_000934216.1|2960538_2962188_-	alpha,alpha-trehalase TreF	NA	NA	NA	NA	NA
WP_000784841.1|2962591_2963989_+	cytochrome c peroxidase	NA	NA	NA	NA	NA
WP_000372240.1|2964199_2965600_+	glutamate decarboxylase	NA	NA	NA	NA	NA
WP_001191062.1|2965969_2966794_+	acid resistance transcriptional activator GadX	NA	NA	NA	NA	NA
WP_000149991.1|2967162_2967891_+	acid resistance transcriptional activator GadW	NA	NA	NA	NA	NA
WP_000024894.1|2968253_2971367_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_129592937.1|2971391_2972549_-	multidrug transporter subunit MdtE	NA	NA	NA	NA	NA
WP_001205329.1|2972608_2972887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005031732.1|2972887_2973415_-	acid resistance transcriptional activator GadE	NA	NA	NA	NA	NA
WP_000965672.1|2974213_2974786_-	acid-resistance protein HdeD	NA	NA	NA	NA	NA
WP_000756551.1|2975040_2975373_+	acid-activated periplasmic chaperone HdeA	NA	NA	NA	NA	NA
WP_001298717.1|2975488_2975815_+	acid-activated periplasmic chaperone HdeB	NA	NA	NA	NA	NA
WP_005039165.1|2975878_2976526_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	37.7	2.3e-16
WP_000478610.1|2976567_2977098_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001057453.1|2977253_2977820_-	outer membrane lipoprotein Slp	NA	NA	NA	NA	NA
WP_129592936.1|2978067_2978547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005031717.1|2978497_2979292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088895425.1|2979806_2981035_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_073817155.1|2982308_2982767_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	38.2	1.4e-07
WP_129592935.1|2982744_2983926_+	xylose ABC transporter permease XylH	NA	NA	NA	NA	NA
WP_000494484.1|2984003_2985182_+	DNA-binding transcriptional regulator XylR	NA	NA	NA	NA	NA
WP_001297957.1|2985289_2986114_-	protein bax	NA	NA	NA	NA	NA
WP_000761941.1|2986433_2988464_+	alpha-amylase	NA	NA	NA	NA	NA
WP_134800705.1|2988641_2989895_+	valine--pyruvate transaminase	NA	NA	NA	NA	NA
WP_001296790.1|2990045_2990519_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_000514248.1|2990620_2991469_-	IclR family transcriptional regulator YiaJ	NA	NA	NA	NA	NA
WP_000869023.1|2991669_2992662_+	3-dehydro-L-gulonate 2-dehydrogenase	NA	NA	NA	NA	NA
WP_000435415.1|2994203_2994623_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	77.3	2.9e-36
WP_001063816.1|2994971_2996099_-|transposase	IS110-like element ISSso6 family transposase	transposase	NA	NA	NA	NA
WP_001291811.1|2996461_2998531_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_001168544.1|2998540_2999452_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_000980111.1|2999546_2999846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171764138.1|3001737_3002966_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.3	2.7e-175
WP_001333468.1|3003079_3003460_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_129592866.1|3003456_3003804_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	98.3	8.2e-61
WP_046891815.1|3003852_3005277_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	92.0	2.3e-266
WP_000922639.1|3005456_3006746_-	arsenite/antimonite:H(+) antiporter ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	4.6e-173
WP_000008974.1|3006800_3007154_-	arsenical resistance operon transcriptional regulator ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.0	2.2e-24
>prophage 135
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	3010498	3012541	4652776		Indivirus(100.0%)	1	NA	NA
WP_005044568.1|3010498_3012541_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.1	6.8e-46
>prophage 136
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	3022445	3028342	4652776		Staphylococcus_phage(33.33%)	6	NA	NA
WP_000149136.1|3022445_3025181_+	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	4.1e-22
WP_001216257.1|3025180_3026305_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001259385.1|3026377_3026653_+	type II toxin-antitoxin system HicA family toxin	NA	R4JMD3	Burkholderia_phage	50.0	3.7e-16
WP_000593559.1|3026649_3027009_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_001190062.1|3027128_3027530_-	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_000173706.1|3027535_3028342_-	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	3.4e-17
>prophage 137
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	3036229	3040361	4652776		Dickeya_phage(50.0%)	4	NA	NA
WP_001100471.1|3036229_3036895_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	52.7	1.4e-56
WP_000130621.1|3037115_3037361_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_000106548.1|3037462_3039661_-	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.0	1.6e-117
WP_000964718.1|3039734_3040361_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
>prophage 138
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	3043373	3046192	4652776		Planktothrix_phage(50.0%)	3	NA	NA
WP_000617723.1|3043373_3044042_+	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	36.0	6.1e-28
WP_001042015.1|3044034_3045093_+	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000130217.1|3045337_3046192_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
>prophage 139
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	3051925	3053408	4652776		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
WP_000082101.1|3051925_3052693_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
WP_000416883.1|3052694_3053408_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	7.0e-14
>prophage 140
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	3056950	3058761	4652776		Planktothrix_phage(50.0%)	2	NA	NA
WP_000907794.1|3056950_3058021_+	sn-glycerol 3-phosphate ABC transporter ATP binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
WP_000073588.1|3058017_3058761_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.0	4.9e-10
>prophage 141
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	3080806	3086106	4652776	transposase	Stx2-converting_phage(50.0%)	4	NA	NA
WP_000993449.1|3080806_3083254_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
WP_000435415.1|3083716_3084136_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	77.3	2.9e-36
WP_000624671.1|3084132_3084483_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	4.7e-40
WP_046891721.1|3084513_3086106_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.0	1.4e-171
>prophage 142
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	3097954	3099181	4652776		Ralstonia_phage(100.0%)	1	NA	NA
WP_001105441.1|3097954_3099181_+	RNA-splicing ligase RtcB	NA	A0A1L7N133	Ralstonia_phage	59.5	4.4e-133
>prophage 143
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	3103560	3105954	4652776		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_000081875.1|3103560_3105954_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 144
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	3111923	3112802	4652776		Sodalis_phage(100.0%)	1	NA	NA
WP_000039053.1|3111923_3112802_-	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	53.3	1.7e-70
>prophage 145
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	3119365	3126584	4652776	transposase	Bacillus_phage(50.0%)	5	NA	NA
WP_001157751.1|3119365_3120085_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
WP_001253693.1|3120081_3121434_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	24.1	2.1e-11
WP_001265681.1|3121509_3123132_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	5.3e-142
WP_000370831.1|3123510_3125235_+	DUF4153 domain-containing protein	NA	NA	NA	NA	NA
WP_088895425.1|3125356_3126584_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
>prophage 146
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	3141451	3142288	4652776		Vibrio_phage(100.0%)	1	NA	NA
WP_000742140.1|3141451_3142288_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	8.4e-67
>prophage 147
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	3168642	3179519	4652776	transposase	Acinetobacter_phage(20.0%)	10	NA	NA
WP_000601849.1|3168642_3169206_+	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	55.2	3.5e-61
WP_000963811.1|3169291_3170512_+	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_001295162.1|3170578_3172669_-	FUSC family protein	NA	H9YQA8	environmental_Halophage	100.0	1.7e-76
WP_000242750.1|3172719_3173352_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_134805288.1|3173629_3174858_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_001148908.1|3174989_3175394_+	OsmC family protein	NA	NA	NA	NA	NA
WP_001274680.1|3175448_3176318_-	phosphoribulokinase	NA	NA	NA	NA	NA
WP_000907083.1|3176371_3176590_-	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	38.8	8.9e-05
WP_000057399.1|3176583_3177606_-	hydrolase	NA	NA	NA	NA	NA
WP_000634833.1|3177605_3179519_-	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.7	1.9e-74
>prophage 148
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	3185089	3190663	4652776		uncultured_Caudovirales_phage(33.33%)	7	NA	NA
WP_001209714.1|3185089_3185476_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	38.3	1.3e-17
WP_000820720.1|3185475_3185835_+	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_000903377.1|3185842_3186130_+	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000246815.1|3186255_3186630_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_001138043.1|3186726_3187197_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000124700.1|3187293_3189408_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_000031785.1|3189478_3190663_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 149
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	3211558	3213030	4652776	tRNA	Prochlorococcus_phage(50.0%)	2	NA	NA
WP_000004457.1|3211558_3212506_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
WP_000114984.1|3212520_3213030_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
>prophage 150
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	3223442	3227575	4652776		Planktothrix_phage(50.0%)	3	NA	NA
WP_000078313.1|3223442_3224201_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.1	1.3e-29
WP_005024740.1|3226005_3226482_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_129592927.1|3226549_3227575_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	1.2e-70
>prophage 151
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	3234079	3234964	4652776		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001258911.1|3234079_3234964_-	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.2	6.4e-25
>prophage 152
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	3240301	3241132	4652776		Escherichia_phage(100.0%)	1	NA	NA
WP_000843959.1|3240301_3241132_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	26.4	2.1e-09
>prophage 153
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	3246206	3256118	4652776	transposase	Shigella_phage(20.0%)	11	NA	NA
WP_129592926.1|3246206_3247326_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	98.6	4.9e-171
WP_000809264.1|3248325_3249186_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	44.0	2.5e-50
WP_000249088.1|3249249_3251286_+	penicillin-binding protein activator LpoA	NA	NA	NA	NA	NA
WP_000246860.1|3251243_3251639_+	YraN family protein	NA	NA	NA	NA	NA
WP_001158034.1|3251658_3252249_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000646041.1|3252258_3252834_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_000147586.1|3252947_3253988_-	permease	NA	NA	NA	NA	NA
WP_005027769.1|3254060_3254696_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_000037593.1|3254823_3255342_+	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	5.8e-10
WP_000449040.1|3255321_3255765_-	YhbP family protein	NA	NA	NA	NA	NA
WP_000189314.1|3255815_3256118_+	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	3.9e-14
>prophage 154
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	3261930	3263820	4652776		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001295553.1|3261930_3263820_-	ATP-dependent RNA helicase DeaD	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 155
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	3269301	3336428	4652776	protease,transposase	Stx2-converting_phage(14.29%)	63	NA	NA
WP_000133044.1|3269301_3271974_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	2.5e-24
WP_001031064.1|3271998_3273486_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_001300397.1|3273513_3273966_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_000207691.1|3274596_3275940_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
WP_005042757.1|3275994_3277191_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_024259669.1|3279419_3279692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295556.1|3280359_3280692_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_000071134.1|3280919_3282257_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_000764742.1|3282249_3283098_-	dihydropteroate synthase	NA	S4W084	Pandoravirus	30.1	1.5e-23
WP_001107476.1|3283187_3285122_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.5	4.1e-117
WP_000145975.1|3285221_3285851_-	23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE	NA	NA	NA	NA	NA
WP_001054420.1|3285976_3286270_+	ribosome assembly RNA-binding protein YhbY	NA	NA	NA	NA	NA
WP_001193478.1|3286426_3286903_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_001212655.1|3287150_3288584_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	NA	NA	NA	NA
WP_000673544.1|3288623_3289796_-	Obg family GTPase CgtA	NA	NA	NA	NA	NA
WP_000813032.1|3289811_3290777_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000940595.1|3290903_3291161_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_000271401.1|3291181_3291493_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_001047336.1|3291751_3292723_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
WP_000445420.1|3292949_3293228_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	69.8	7.6e-17
WP_000357260.1|3293275_3294535_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000429656.1|3294589_3294844_-	BolA family iron metabolism protein IbaG	NA	NA	NA	NA	NA
WP_000004488.1|3295003_3295297_-	lipid asymmetry maintenance protein MlaB	NA	NA	NA	NA	NA
WP_000476487.1|3295296_3295932_-	phospholipid-binding protein MlaC	NA	NA	NA	NA	NA
WP_001296448.1|3295950_3296502_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_000925795.1|3296506_3297289_-	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_000438245.1|3297296_3298106_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
WP_000922863.1|3298315_3299293_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_005028950.1|3299306_3300293_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.2	5.6e-38
WP_000030005.1|3300313_3300880_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
WP_000030537.1|3300876_3301452_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000669785.1|3301420_3301978_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000224099.1|3301984_3302710_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000809051.1|3302757_3304191_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_001176597.1|3304213_3304501_+	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	4.2e-10
WP_000183676.1|3304618_3305110_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_000243741.1|3305155_3306010_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000216791.1|3306006_3306279_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_129592925.1|3306492_3307134_+	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000047091.1|3307130_3307859_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_005028964.1|3307855_3308509_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000809767.1|3308738_3311075_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_005044260.1|3311170_3312100_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
WP_005028970.1|3312773_3317234_+	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_000081674.1|3317246_3318665_+	glutamate synthase subunit GltD	NA	NA	NA	NA	NA
WP_001333468.1|3319142_3319523_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612610.1|3319519_3319867_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	2.8e-61
WP_000099181.1|3319915_3321454_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.2	2.8e-294
WP_000639208.1|3321793_3322099_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000979883.1|3322174_3322639_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000209048.1|3322635_3323511_-	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000054239.1|3323507_3324197_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_000108471.1|3324244_3325735_-	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.6	4.9e-09
WP_000224714.1|3325843_3326737_-	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_000523845.1|3326858_3327650_-	transcriptional regulator NanR	NA	NA	NA	NA	NA
WP_000366129.1|3329439_3329937_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	42.9	3.3e-26
WP_000257293.1|3329942_3330581_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_000829818.1|3330975_3331368_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_004986574.1|3331383_3331812_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_001192311.1|3332030_3333158_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_001295270.1|3333351_3333750_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_005028997.1|3333903_3335271_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	3.0e-21
WP_000497730.1|3335360_3336428_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
>prophage 156
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	3344173	3345401	4652776	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_088895425.1|3344173_3345401_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
>prophage 157
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	3355680	3356724	4652776		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|3355680_3356724_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 158
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	3367084	3370498	4652776	transposase	Shigella_phage(50.0%)	3	NA	NA
WP_088895425.1|3367084_3368313_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_001570270.1|3368886_3369093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001379149.1|3369742_3370498_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A7K9	Microcystis_virus	40.6	2.9e-10
>prophage 159
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	3384733	3386134	4652776		environmental_Halophage(100.0%)	1	NA	NA
WP_001280171.1|3384733_3386134_+	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	45.2	1.9e-18
>prophage 160
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	3391747	3400123	4652776	tRNA	Enterobacteria_phage(20.0%)	9	NA	NA
WP_024259665.1|3391747_3393196_+	urate/proton symporter UacT	NA	Q9KX94	Enterobacteria_phage	26.2	7.3e-26
WP_001050745.1|3393197_3393323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795390.1|3393319_3393391_-	protein YqfH	NA	NA	NA	NA	NA
WP_001192790.1|3393445_3393994_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_000003068.1|3394036_3395554_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_001701073.1|3395563_3396662_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_129592923.1|3396752_3398486_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.3	2.1e-59
WP_000715205.1|3398491_3399202_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000806638.1|3399226_3400123_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
>prophage 161
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	3403928	3409301	4652776		Pandoravirus(50.0%)	3	NA	NA
WP_141095349.1|3403928_3405362_+	6-phospho-beta-glucosidase BglA	NA	A0A0B5JD41	Pandoravirus	26.3	2.6e-31
WP_000951947.1|3405418_3406162_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_129592921.1|3406427_3409301_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.0	2.4e-262
>prophage 162
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	3417828	3419061	4652776		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|3417828_3419061_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 163
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	3439292	3439970	4652776		Bacillus_virus(100.0%)	1	NA	NA
WP_000956893.1|3439292_3439970_+	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.1	4.9e-09
>prophage 164
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	3453447	3454602	4652776		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001062133.1|3453447_3454602_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	62.9	2.6e-127
>prophage 165
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	3465765	3468077	4652776	transposase	Stx2-converting_phage(100.0%)	3	NA	NA
WP_001333468.1|3465765_3466146_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612610.1|3466142_3466490_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	2.8e-61
WP_000099181.1|3466538_3468077_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.2	2.8e-294
>prophage 166
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	3502011	3502896	4652776		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000018771.1|3502011_3502896_-	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	46.8	3.7e-65
>prophage 167
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	3522538	3526270	4652776		Bacillus_virus(50.0%)	3	NA	NA
WP_001281893.1|3522538_3524797_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	2.4e-84
WP_000183511.1|3525342_3525825_-	GyrI-like domain-containing protein	NA	NA	NA	NA	NA
WP_000712661.1|3525877_3526270_-	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	52.7	3.2e-21
>prophage 168
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	3529510	3540460	4652776		Bacillus_virus(20.0%)	11	NA	NA
WP_000195273.1|3529510_3531403_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.2	2.6e-92
WP_000105733.1|3531431_3532013_-	esterase YqiA	NA	NA	NA	NA	NA
WP_000444747.1|3532012_3532840_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000833393.1|3532864_3533287_-	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000917117.1|3533287_3533917_-	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
WP_000735275.1|3534121_3535603_+	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000831554.1|3535750_3536422_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	6.3e-33
WP_000442860.1|3536427_3537588_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
WP_001299419.1|3537625_3538414_-	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_005026485.1|3538556_3539318_+	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_001076982.1|3539806_3540460_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	1.4e-45
>prophage 169
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	3544914	3546348	4652776		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869225.1|3544914_3546348_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.6	4.6e-41
>prophage 170
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	3551486	3552725	4652776	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_000708501.1|3551486_3552725_+|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.6	5.9e-93
>prophage 171
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	3559671	3649141	4652776	tRNA,transposase	Shigella_phage(21.05%)	63	NA	NA
WP_001264365.1|3559671_3560685_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	4.8e-109
WP_001144069.1|3560921_3561137_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918827.1|3561247_3562993_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
WP_000437371.1|3563187_3565029_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_005043692.1|3565113_3566460_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_000228937.1|3566546_3567053_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001065914.1|3567306_3568071_-	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000018003.1|3568358_3568982_+	DNA-binding transcriptional regulator NfeR	NA	NA	NA	NA	NA
WP_000094706.1|3569135_3570656_-	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	51.5	9.0e-35
WP_001301395.1|3571072_3572452_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	2.0e-33
WP_000450589.1|3572493_3572826_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_000212469.1|3573044_3574028_+	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_001082886.1|3574211_3577304_+	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	33.9	1.6e-155
WP_073817613.1|3578870_3579521_-	type I-E CRISPR-associated protein Cas6/Cse3/CasE	NA	NA	NA	NA	NA
WP_000085068.1|3579502_3580249_-	type I-E CRISPR-associated protein Cas5/CasD	NA	NA	NA	NA	NA
WP_073817610.1|3581346_3581880_-	type I-E CRISPR-associated protein Cse2/CasB	NA	NA	NA	NA	NA
WP_162281799.1|3582412_3583610_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	98.7	9.5e-181
WP_073817591.1|3584787_3586353_-	CRISPR-associated helicase Cas3'	NA	NA	NA	NA	NA
WP_000956460.1|3588458_3588611_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_000039851.1|3588875_3589610_-	phosphoadenosine phosphosulfate reductase	NA	NA	NA	NA	NA
WP_001290706.1|3589684_3591397_-	assimilatory sulfite reductase (NADPH) hemoprotein subunit	NA	NA	NA	NA	NA
WP_000211889.1|3591396_3593196_-	NADPH-dependent assimilatory sulfite reductase flavoprotein subunit	NA	NA	NA	NA	NA
WP_129592915.1|3593317_3594438_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.0	1.3e-171
WP_000108294.1|3594766_3595129_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_005043878.1|3595206_3596475_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000109371.1|3596465_3596726_+	ferredoxin family protein	NA	NA	NA	NA	NA
WP_001130269.1|3596742_3597318_+	glycerol-3-phosphate responsive antiterminator	NA	NA	NA	NA	NA
WP_005043923.1|3597465_3598326_-	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_005028588.1|3598322_3599102_-	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_000147666.1|3599079_3600489_-	MFS transporter	NA	NA	NA	NA	NA
WP_088895425.1|3602317_3603546_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_000065943.1|3603813_3605043_-	HAAAP family serine/threonine permease	NA	NA	NA	NA	NA
WP_000656020.1|3605297_3606479_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_000383217.1|3606765_3607602_+	5-dehydro-4-deoxy-D-glucuronate isomerase	NA	NA	NA	NA	NA
WP_000603508.1|3607631_3608393_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	4.5e-19
WP_024259661.1|3608707_3610126_+	arabinose-proton symporter AraE	NA	O13311	Aichi_virus	27.1	6.0e-25
WP_000848664.1|3610254_3610947_+	amino acid racemase	NA	NA	NA	NA	NA
WP_000741823.1|3610933_3611869_-	DNA-binding transcriptional regulator LysR	NA	NA	NA	NA	NA
WP_001120700.1|3611990_3613253_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_000201048.1|3613259_3614291_-	HTH-type transcriptional regulator GalR	NA	NA	NA	NA	NA
WP_001063816.1|3614581_3615709_-|transposase	IS110-like element ISSso6 family transposase	transposase	NA	NA	NA	NA
WP_000899062.1|3616199_3618359_+	bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase	NA	NA	NA	NA	NA
WP_000004618.1|3618351_3619545_+	lysophospholipid transporter LplT	NA	NA	NA	NA	NA
WP_001199311.1|3619576_3620617_-	NADP(H)-dependent aldo-keto reductase	NA	NA	NA	NA	NA
WP_000758655.1|3620724_3620943_-	lipoprotein YgdR	NA	NA	NA	NA	NA
WP_000895624.1|3621080_3621794_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
WP_000082198.1|3621862_3622552_-	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000564491.1|3623236_3623767_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000957870.1|3623779_3626026_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000204658.1|3626176_3627052_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000816232.1|3627058_3627853_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
WP_000857051.1|3628037_3628508_+	prepilin peptidase-dependent protein	NA	NA	NA	NA	NA
WP_001144309.1|3628498_3629062_+	prepilin peptidase-dependent protein	NA	NA	NA	NA	NA
WP_001078377.1|3629058_3629466_+	DUF2509 family protein	NA	NA	NA	NA	NA
WP_001276457.1|3629450_3629774_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_000946884.1|3629786_3633155_+	exodeoxyribonuclease V subunit gamma	NA	NA	NA	NA	NA
WP_001138214.1|3633330_3636219_+	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.5	1.3e-66
WP_005043715.1|3636211_3639754_+	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	19.5	1.5e-08
WP_000775955.1|3639753_3641580_+	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.7	3.5e-25
WP_000237947.1|3641641_3642973_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000016907.1|3643204_3644458_+	N-acetylmuramoyl-L-alanine amidase AmiC	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_000582832.1|3644716_3645541_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_088895425.1|3647912_3649141_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
>prophage 172
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	3653071	3655104	4652776		Hokovirus(50.0%)	2	NA	NA
WP_001090374.1|3653071_3654499_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.1	1.4e-29
WP_001173679.1|3654498_3655104_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	4.2e-28
>prophage 173
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	3658216	3660829	4652776		uncultured_Mediterranean_phage(66.67%)	3	NA	NA
WP_001295182.1|3658216_3658978_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|3658971_3659598_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272581.1|3659737_3660829_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
>prophage 174
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	3664211	3671351	4652776		Escherichia_phage(80.0%)	5	NA	NA
WP_001278997.1|3664211_3664850_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.5	2.8e-83
WP_000590422.1|3664846_3666109_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.2	1.4e-134
WP_000848005.1|3666105_3667014_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.2	3.3e-117
WP_001297141.1|3667209_3667977_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001272926.1|3668789_3671351_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
>prophage 175
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	3689175	3690186	4652776		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001343660.1|3689175_3690186_+	DNA-binding transcriptional regulator AscG	NA	C6ZCU4	Enterobacteria_phage	28.3	2.3e-26
>prophage 176
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	3697661	3698627	4652776		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287421.1|3697661_3698627_-	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	34.3	1.0e-36
>prophage 177
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	3704093	3709653	4652776	tRNA	Pseudomonas_phage(25.0%)	5	NA	NA
WP_000132235.1|3704093_3704591_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	50.3	1.5e-31
WP_000963139.1|3704670_3705732_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	8.9e-114
WP_000140506.1|3705974_3706475_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000047152.1|3706602_3709233_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.7	7.1e-80
WP_000906486.1|3709467_3709653_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
>prophage 178
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	3722561	3727857	4652776		Bacillus_virus(20.0%)	5	NA	NA
WP_129592911.1|3722561_3723764_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
WP_000777966.1|3724118_3725078_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	2.6e-133
WP_000246541.1|3725087_3727232_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.1	2.4e-195
WP_000080953.1|3727204_3727615_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	43.5	1.7e-17
WP_001223227.1|3727611_3727857_-	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
>prophage 179
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	3731661	3732807	4652776		Streptococcus_phage(100.0%)	1	NA	NA
WP_005027325.1|3731661_3732807_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.3	2.2e-49
>prophage 180
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	3742320	3744615	4652776		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861745.1|3742320_3744615_+	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	40.8	1.7e-157
>prophage 181
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	3768146	3769112	4652776		Escherichia_phage(100.0%)	1	NA	NA
WP_001098818.1|3768146_3769112_-	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	6.7e-36
>prophage 182
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	3780275	3786890	4652776	tRNA	Tetraselmis_virus(25.0%)	7	NA	NA
WP_073817979.1|3780275_3780713_+	SIS domain-containing protein	NA	A0A2P0VNK5	Tetraselmis_virus	39.4	1.3e-15
WP_004985985.1|3781445_3781610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073817725.1|3781681_3782629_+	phosphoglycerate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	25.8	9.0e-17
WP_000678655.1|3783210_3784308_+	murein transglycosylase A	NA	NA	NA	NA	NA
WP_000117723.1|3784384_3785191_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.7	2.2e-16
WP_000184264.1|3785241_3785685_-	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_005031696.1|3785684_3786890_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.8	2.3e-73
>prophage 183
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	3798055	3798811	4652776		Bacillus_phage(100.0%)	1	NA	NA
WP_000268232.1|3798055_3798811_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	5.0e-10
>prophage 184
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	3803669	3804518	4652776		Vibrio_phage(100.0%)	1	NA	NA
WP_000100420.1|3803669_3804518_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.1	8.0e-41
>prophage 185
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	3809119	3816167	4652776		Oenococcus_phage(33.33%)	4	NA	NA
WP_000211792.1|3809119_3810460_+	glucarate dehydratase	NA	Q6A202	Oenococcus_phage	23.9	2.7e-06
WP_000098225.1|3810480_3811821_+	glucarate dehydratase	NA	NA	NA	NA	NA
WP_000186450.1|3812052_3814809_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
WP_000046825.1|3814865_3816167_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.7	3.3e-38
>prophage 186
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	3820199	3825284	4652776		Only_Syngen_Nebraska_virus(33.33%)	4	NA	NA
WP_000210878.1|3820199_3821837_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
WP_000036723.1|3821924_3823223_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_001288225.1|3824351_3824474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001199969.1|3824612_3825284_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.7e-14
>prophage 187
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	3828976	3829459	4652776		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000162574.1|3828976_3829459_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
>prophage 188
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	3838903	3886340	4652776	tRNA,transposase	Stx2-converting_phage(35.29%)	35	NA	NA
WP_000264777.1|3838903_3839671_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065255.1|3839712_3840060_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000589818.1|3840136_3840619_-	OmpA family protein	NA	NA	NA	NA	NA
WP_004985941.1|3843283_3843649_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001168066.1|3843856_3844927_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_000225221.1|3844937_3846059_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000200116.1|3846101_3847262_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_001386991.1|3847361_3847409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178456.1|3847512_3847854_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_094096479.1|3848317_3849474_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	1.2e-66
WP_000197686.1|3850831_3851569_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079103.1|3851703_3852684_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	A0A2H4UV25	Bodo_saltans_virus	25.1	2.8e-05
WP_000040159.1|3852680_3853412_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_129593012.1|3853541_3856115_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	5.3e-128
WP_001333468.1|3862845_3863226_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_134800697.1|3863222_3863570_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	2.2e-61
WP_129592863.1|3863618_3865157_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.0	1.8e-293
WP_094096479.1|3865479_3866636_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	1.2e-66
WP_073817198.1|3866988_3867312_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949272.1|3867357_3868713_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_073817200.1|3868826_3871487_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000138184.1|3871518_3872217_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_001098726.1|3872285_3872705_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997403.1|3872911_3873949_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001262727.1|3873996_3874686_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.4	4.6e-55
WP_000627807.1|3874990_3875374_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_000189207.1|3875429_3876017_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_134805288.1|3876140_3877368_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_005027037.1|3877454_3878336_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219197.1|3878544_3879879_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_005007860.1|3880010_3880748_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_001333468.1|3882039_3882420_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612610.1|3882416_3882764_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	2.8e-61
WP_000099181.1|3882812_3884351_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.2	2.8e-294
WP_088895425.1|3885112_3886340_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
>prophage 189
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	3890702	3894445	4652776		Tupanvirus(50.0%)	3	NA	NA
WP_000790168.1|3890702_3892502_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
WP_000002542.1|3892517_3893492_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068343.1|3893764_3894445_+	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
>prophage 190
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	3897903	3898164	4652776		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196283.1|3897903_3898164_-	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.1e-17
>prophage 191
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	3902283	3913572	4652776		Bacillus_phage(50.0%)	7	NA	NA
WP_000970129.1|3902283_3906171_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.9	1.3e-130
WP_001298980.1|3906728_3908156_+	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	2.3e-16
WP_001215852.1|3908319_3909033_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001295369.1|3909022_3910357_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_000717694.1|3910417_3910756_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000883127.1|3910800_3911991_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000919159.1|3912318_3913572_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
>prophage 192
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	3919346	3920503	4652776	transposase	Acinetobacter_phage(100.0%)	1	NA	NA
WP_094096667.1|3919346_3920503_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	1.2e-66
>prophage 193
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	3931923	3938380	4652776		Faustovirus(20.0%)	8	NA	NA
WP_001295373.1|3931923_3933138_+	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
WP_000331709.1|3933165_3933552_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.1	2.0e-52
WP_000028953.1|3933568_3933892_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000384422.1|3933987_3934503_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_001196598.1|3934519_3936370_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	7.2e-103
WP_001124469.1|3936371_3936707_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_000523616.1|3936718_3936919_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_000133575.1|3937096_3938380_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.5	1.1e-33
>prophage 194
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	3948264	3948696	4652776		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963837.1|3948264_3948696_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
>prophage 195
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	3957525	3962804	4652776		Bodo_saltans_virus(33.33%)	4	NA	NA
WP_000937933.1|3957525_3958896_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	4.0e-42
WP_005028285.1|3959057_3960524_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	1.8e-88
WP_000138275.1|3960592_3962170_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_000755183.1|3962264_3962804_-	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	98.3	5.8e-45
>prophage 196
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	3969980	3973980	4652776		Prochlorococcus_phage(33.33%)	4	NA	NA
WP_001028618.1|3969980_3970619_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	4.0e-29
WP_005043501.1|3970618_3971656_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.1e-71
WP_001295473.1|3971979_3972606_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_005026368.1|3972690_3973980_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
>prophage 197
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	3996508	3997222	4652776		Synechococcus_phage(100.0%)	1	NA	NA
WP_005026404.1|3996508_3997222_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FHU1	Synechococcus_phage	36.1	1.2e-37
>prophage 198
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	4016043	4016994	4652776		Cyanophage(100.0%)	1	NA	NA
WP_001003718.1|4016043_4016994_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	1.3e-10
>prophage 199
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	4036425	4040147	4652776		Deep-sea_thermophilic_phage(50.0%)	5	NA	NA
WP_000102891.1|4036425_4037295_-	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	4.2e-13
WP_000405998.1|4037508_4037934_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_005043427.1|4037920_4038370_+	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_129592902.1|4038576_4039152_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_005030479.1|4039247_4040147_+	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	1.3e-25
>prophage 200
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	4045763	4046555	4652776		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_000517427.1|4045763_4046555_+	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.2	1.2e-17
>prophage 201
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	4049572	4061266	4652776		Streptococcus_phage(40.0%)	11	NA	NA
WP_000021036.1|4049572_4050670_+	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
WP_001295461.1|4050803_4051715_+	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.9	7.7e-58
WP_000719952.1|4051717_4052086_-	YfeK family protein	NA	NA	NA	NA	NA
WP_000096660.1|4052190_4053042_+	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000522245.1|4053083_4053593_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000623136.1|4053633_4055361_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
WP_000487600.1|4055405_4055663_-	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000034402.1|4056046_4057018_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000254839.1|4057202_4057964_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_005030504.1|4058193_4059180_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000443668.1|4059250_4061266_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.4	1.1e-149
>prophage 202
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	4064483	4130887	4652776	tRNA,transposase	Stx2-converting_phage(33.33%)	48	NA	NA
WP_000695657.1|4064483_4065899_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001341599.1|4065949_4066321_-	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001296278.1|4066343_4066688_-	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_129592901.1|4067322_4069512_+	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
WP_162281802.1|4069607_4070954_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_005031738.1|4071000_4072203_-	nucleoside permease NupC	NA	NA	NA	NA	NA
WP_000186369.1|4072538_4073777_+	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_000490072.1|4073917_4074244_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_000903157.1|4074358_4075615_-	ion channel protein	NA	NA	NA	NA	NA
WP_000598932.1|4075818_4076784_+	glucokinase	NA	NA	NA	NA	NA
WP_005043385.1|4077002_4077329_+	PTS fructose transporter subunit IIB	NA	NA	NA	NA	NA
WP_000985336.1|4077350_4078598_+	PTS fructose transporter subunit IIC	NA	NA	NA	NA	NA
WP_000173245.1|4078612_4079698_+	aminopeptidase	NA	NA	NA	NA	NA
WP_000366045.1|4079697_4080486_+	aminopeptidase	NA	NA	NA	NA	NA
WP_000492409.1|4080525_4080735_+	aminopeptidase Y	NA	NA	NA	NA	NA
WP_000955852.1|4080759_4083255_+	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_005031743.1|4083257_4083995_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_134800738.1|4084123_4084858_-	two-component system response regulator YpdB	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
WP_000544359.1|4084872_4086570_-	two-component system sensor histidine kinase YpdA	NA	NA	NA	NA	NA
WP_000785925.1|4086946_4088185_+	alanine transaminase	NA	NA	NA	NA	NA
WP_010723117.1|4088249_4088321_-	membrane protein YpdK	NA	NA	NA	NA	NA
WP_000484400.1|4088676_4089597_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.1	5.4e-75
WP_000639883.1|4089949_4090192_+	YfdY family protein	NA	NA	NA	NA	NA
WP_000867639.1|4090268_4090544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000825604.1|4090839_4091472_+	YfdX family protein	NA	NA	NA	NA	NA
WP_129592899.1|4091637_4092793_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	1.2e-66
WP_000106759.1|4093251_4094502_+	formyl-CoA transferase	NA	NA	NA	NA	NA
WP_001283487.1|4094555_4096250_+	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.8e-23
WP_000955028.1|4096319_4097264_+	transporter YfdV	NA	NA	NA	NA	NA
WP_094096479.1|4097541_4098697_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	1.2e-66
WP_000991370.1|4104178_4104793_-	acid-sensing system DNA-binding response regulator EvgA	NA	NA	NA	NA	NA
WP_073817264.1|4105208_4106372_+	multidrug efflux MFS transporter periplasmic adaptor subunit EmrK	NA	NA	NA	NA	NA
WP_001018714.1|4106371_4107910_+	multidrug efflux MFS transporter permease subunit EmrY	NA	NA	NA	NA	NA
WP_001333468.1|4110533_4110914_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_134800697.1|4110910_4111258_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	2.2e-61
WP_129592863.1|4111306_4112845_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.0	1.8e-293
WP_088895425.1|4113755_4114983_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_000844746.1|4115119_4115659_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000714140.1|4115655_4116144_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000018471.1|4116140_4116650_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000482745.1|4116665_4117418_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000445012.1|4120937_4121192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001195819.1|4122908_4123394_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000424994.1|4123596_4125741_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531964.1|4125740_4127051_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_000030901.1|4127229_4127514_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_005025042.1|4127885_4129226_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_129592898.1|4129690_4130887_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 203
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	4134102	4144603	4652776	transposase	Stx2-converting_phage(40.0%)	9	NA	NA
WP_046891760.1|4134102_4135035_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	1.5e-165
WP_000624671.1|4135848_4136199_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	4.7e-40
WP_001072394.1|4136229_4137822_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.2	3.7e-172
WP_001063816.1|4138114_4139242_-|transposase	IS110-like element ISSso6 family transposase	transposase	NA	NA	NA	NA
WP_088895425.1|4139704_4140933_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_004985136.1|4140996_4141761_+	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000730804.1|4141833_4142385_-	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001339812.1|4142550_4143483_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000918449.1|4143517_4144603_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.1	1.0e-88
>prophage 204
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	4153158	4154295	4652776		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000699121.1|4153158_4154295_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	5.9e-23
>prophage 205
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	4160772	4162290	4652776		Mollivirus(100.0%)	1	NA	NA
WP_000334220.1|4160772_4162290_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.9e-87
>prophage 206
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	4166501	4167275	4652776		Planktothrix_phage(100.0%)	1	NA	NA
WP_001293612.1|4166501_4167275_+	histidine ABC transporter ATP-binding protein HisP	NA	G9BWD6	Planktothrix_phage	38.1	2.4e-23
>prophage 207
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	4183105	4183705	4652776		Salmonella_phage(100.0%)	1	NA	NA
WP_000813847.1|4183105_4183705_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	37.3	5.9e-06
>prophage 208
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	4220494	4223515	4652776		Cronobacter_phage(33.33%)	3	NA	NA
WP_000461666.1|4220494_4221463_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.2	5.7e-35
WP_005043265.1|4221466_4222606_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	29.5	9.4e-29
WP_001297077.1|4222912_4223515_+	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	3.4e-09
>prophage 209
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	4230530	4284144	4652776	tail,protease,transposase	Shigella_phage(23.53%)	34	NA	NA
WP_000140570.1|4230530_4231433_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.8	2.5e-69
WP_001000359.1|4231625_4232816_-	anaerobic glycerol-3-phosphate dehydrogenase subunit C	NA	NA	NA	NA	NA
WP_001209906.1|4232812_4234072_-	glycerol-3-phosphate dehydrogenase subunit GlpB	NA	NA	NA	NA	NA
WP_000857231.1|4234061_4235690_-	anaerobic glycerol-3-phosphate dehydrogenase subunit A	NA	NA	NA	NA	NA
WP_000948732.1|4235962_4237321_+	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_000779090.1|4237325_4238402_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
WP_167544916.1|4238657_4239886_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_000202532.1|4239896_4240121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000135040.1|4240904_4241159_-	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_005028363.1|4241158_4242289_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	79.1	4.3e-175
WP_001075159.1|4242435_4244721_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.5e-283
WP_073817308.1|4246282_4247419_+	autotransporter-associated beta strand repeat-containing protein	NA	NA	NA	NA	NA
WP_000990754.1|4249336_4250059_-	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_073817315.1|4250205_4252833_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.3	1.4e-91
WP_129592896.1|4253786_4254954_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	98.4	8.4e-182
WP_077897128.1|4255008_4255188_+	IS1 encoded protein	NA	A0A0C4UQV0	Shigella_phage	66.7	2.4e-16
WP_129592895.1|4255190_4255736_+|tail	tail fiber assembly protein	tail	Q8W612	Enterobacteria_phage	68.7	1.7e-68
WP_000551126.1|4257080_4257704_+	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	76.5	5.4e-79
WP_001039895.1|4257703_4257883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000801158.1|4257883_4259647_-	E3 ubiquitin--protein ligase	NA	NA	NA	NA	NA
WP_001104570.1|4264753_4266403_+	DUF2300 domain-containing protein	NA	NA	NA	NA	NA
WP_001225840.1|4266407_4267103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094112586.1|4267037_4268206_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	98.7	6.4e-182
WP_094139026.1|4268244_4268436_+	DUF2135 domain-containing protein	NA	NA	NA	NA	NA
WP_073816723.1|4268710_4271560_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	26.9	6.4e-42
WP_001061917.1|4271759_4272410_-	transcriptional regulator RcsB	NA	NA	NA	NA	NA
WP_001249158.1|4272426_4275099_-	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_000865598.1|4275837_4276968_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	59.2	6.3e-118
WP_000406105.1|4277079_4278135_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000786355.1|4278208_4279273_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	49.5	3.1e-18
WP_134800696.1|4279272_4279923_+	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	30.7	3.2e-05
WP_000422160.1|4279998_4281642_+	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	2.8e-13
WP_000758039.1|4281859_4283506_+	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_005024548.1|4283655_4284144_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
>prophage 210
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	4290410	4291028	4652776		Bacillus_virus(100.0%)	1	NA	NA
WP_000888560.1|4290410_4291028_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
>prophage 211
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	4303122	4310770	4652776		Vibrio_phage(50.0%)	7	NA	NA
WP_000050791.1|4303122_4304130_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	1.2e-83
WP_000494178.1|4304268_4304553_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000578074.1|4304677_4306438_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	3.2e-100
WP_001234850.1|4306586_4307282_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_073816715.1|4307309_4308500_+	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	22.4	3.2e-19
WP_000202790.1|4308832_4309177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194882.1|4309180_4310770_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.9	2.7e-18
>prophage 212
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	4316524	4320825	4652776		Clostridioides_phage(50.0%)	4	NA	NA
WP_000241011.1|4316524_4317091_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
WP_005028654.1|4317502_4318216_-	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000198795.1|4318254_4319241_-	zinc-binding GTPase YeiR	NA	NA	NA	NA	NA
WP_000848216.1|4319358_4320825_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.3	3.9e-43
>prophage 213
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	4334573	4335431	4652776		Catovirus(100.0%)	1	NA	NA
WP_000873890.1|4334573_4335431_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	34.0	1.4e-24
>prophage 214
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	4342608	4343277	4652776		Cellulophaga_phage(100.0%)	1	NA	NA
WP_001139613.1|4342608_4343277_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
>prophage 215
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	4346971	4440659	4652776	head,tRNA,lysis,tail,portal,holin,plate,terminase,integrase,transposase,capsid	Escherichia_phage(40.0%)	86	4389486:4389512	4425246:4425272
WP_000255031.1|4346971_4348492_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
WP_001275118.1|4348507_4349518_+	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_024259585.1|4349760_4350054_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_000099181.1|4350130_4351669_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.2	2.8e-294
WP_134800697.1|4351717_4352065_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	2.2e-61
WP_000477609.1|4352061_4352298_-|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	98.7	1.3e-36
WP_000937505.1|4353809_4354067_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	70.2	5.1e-15
WP_001026780.1|4354077_4354623_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_001261938.1|4354939_4355188_-	DinI-like family protein	NA	B6DZC1	Enterobacteria_phage	98.8	7.0e-38
WP_005031165.1|4355702_4357388_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.5	4.3e-304
WP_000598642.1|4357384_4358104_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|4358150_4358621_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_073817411.1|4360476_4361799_-	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_005030819.1|4361939_4363973_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	4.0e-54
WP_001005448.1|4364104_4365214_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_072059034.1|4366259_4366535_+	DUF2574 family protein	NA	NA	NA	NA	NA
WP_000677411.1|4367463_4368138_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000153067.1|4370956_4371295_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000019944.1|4372115_4372388_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_001195636.1|4372610_4373399_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822274.1|4373395_4374196_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_005031483.1|4374260_4375079_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	5.0e-24
WP_000434038.1|4375130_4375877_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000846236.1|4376715_4377720_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	1.7e-13
WP_000858484.1|4377716_4378994_-	nucleoside permease	NA	NA	NA	NA	NA
WP_000129571.1|4379250_4380303_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000289785.1|4380610_4381465_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000182920.1|4382765_4383218_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000490651.1|4384299_4385655_+	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000844202.1|4385702_4386743_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178555.1|4386842_4387622_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807369.1|4387703_4388603_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.5	8.8e-14
WP_001318299.1|4389008_4389326_+	hypothetical protein	NA	NA	NA	NA	NA
4389486:4389512	attL	AAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_000985261.1|4389591_4390605_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.1	4.1e-193
WP_001306384.1|4390720_4391020_-	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	100.0	2.5e-50
WP_000043869.1|4391134_4391410_+	hypothetical protein	NA	Q1JS62	Enterobacteria_phage	100.0	1.3e-48
WP_000217677.1|4391587_4392088_+	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	100.0	4.5e-92
WP_000557703.1|4392151_4392376_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001277959.1|4392375_4392678_+	DUF5405 family protein	NA	U5N0U2	Enterobacteria_phage	98.0	2.9e-46
WP_001113278.1|4392677_4392902_+	TraR/DksA family transcriptional regulator	NA	A0A0F7LDG9	Escherichia_phage	95.9	1.9e-34
WP_000027667.1|4392898_4393174_+	DUF5405 family protein	NA	Q858T5	Yersinia_virus	100.0	3.8e-45
WP_000268616.1|4393163_4395335_+	replication endonuclease	NA	A0A0F7LA09	Escherichia_phage	99.3	0.0e+00
WP_001515549.1|4395438_4396368_+	DUF4238 domain-containing protein	NA	A0A0F7LBR6	Escherichia_phage	100.0	1.3e-177
WP_000038167.1|4396771_4397806_-|portal	phage portal protein	portal	U5N087	Enterobacteria_phage	99.1	7.9e-200
WP_000156858.1|4397805_4399578_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.7	0.0e+00
WP_001085978.1|4399751_4400606_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MH0	Enterobacteria_phage	98.6	6.2e-134
WP_001248589.1|4400664_4401738_+|capsid	phage major capsid protein, P2 family	capsid	Q83VT1	Escherichia_phage	99.4	7.4e-201
WP_000203457.1|4401741_4402491_+|terminase	terminase endonuclease subunit	terminase	Q94MK1	Enterobacteria_phage	98.0	4.9e-119
WP_000988639.1|4402590_4403100_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	99.4	2.5e-90
WP_000846409.1|4403099_4403303_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000123123.1|4403306_4403588_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144101.1|4403587_4404085_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000736628.1|4404099_4404525_+	hypothetical protein	NA	Q858W1	Yersinia_virus	91.5	1.5e-59
WP_000040671.1|4404512_4404938_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7L9Y0	Escherichia_phage	98.6	6.5e-68
WP_000917155.1|4405045_4405513_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	99.4	3.0e-82
WP_001001790.1|4405505_4405958_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	98.7	9.1e-76
WP_024259820.1|4407216_4407846_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	96.1	2.5e-108
WP_000127163.1|4407842_4408190_+	GPW/gp25 family protein	NA	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001121467.1|4408194_4409103_+|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	99.0	3.7e-161
WP_001285316.1|4409095_4409626_+|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	98.9	2.5e-101
WP_000104687.1|4409636_4411727_+|tail	tail fiber protein	tail	U5N099	Enterobacteria_phage	65.6	3.4e-186
WP_001164147.1|4411730_4412258_+|tail	tail fiber assembly protein	tail	Q858V3	Yersinia_virus	95.4	6.8e-91
WP_005032116.1|4412579_4414577_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	2.2e-20
WP_000625667.1|4414640_4415918_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_000161640.1|4416058_4416868_-	hypothetical protein	NA	A0A0F7L9X0	Escherichia_phage	94.8	2.1e-155
WP_088895425.1|4417190_4418418_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_001286716.1|4418540_4419731_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	100.0	1.6e-225
WP_001251408.1|4419743_4420262_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031307.1|4420319_4420595_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_000785970.1|4420627_4420747_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_134800692.1|4420739_4423187_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	96.3	0.0e+00
WP_000978874.1|4423201_4423681_+|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	99.4	1.5e-84
WP_000882978.1|4423680_4424844_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	8.3e-206
WP_000468308.1|4424924_4425143_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000476014.1|4425416_4426778_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
4425246:4425272	attR	AAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_000929408.1|4426924_4427257_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137877.1|4427447_4428170_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000675183.1|4428166_4429570_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	1.2e-33
WP_000130835.1|4429566_4430982_-	MFS transporter	NA	NA	NA	NA	NA
WP_000667604.1|4430982_4434060_-	multidrug efflux RND transporter permease subunit MdtC	NA	NA	NA	NA	NA
WP_001197908.1|4434060_4437183_-	multidrug efflux RND transporter permease subunit MdtB	NA	NA	NA	NA	NA
WP_000679005.1|4437182_4438430_-	multidrug efflux RND transporter subunit MdtA	NA	NA	NA	NA	NA
WP_100792650.1|4438708_4438765_+	type I toxin-antitoxin system Ibs family toxin	NA	NA	NA	NA	NA
WP_100249772.1|4439036_4439093_+	type I toxin-antitoxin system Ibs family toxin	NA	NA	NA	NA	NA
WP_071528451.1|4439364_4439424_+	type I toxin-antitoxin system Ibs family toxin	NA	NA	NA	NA	NA
WP_005042757.1|4439462_4440659_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 216
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	4444460	4445813	4652776		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_000469690.1|4444460_4445813_-	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	20.6	1.3e-05
>prophage 217
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	4450531	4461182	4652776		Catovirus(20.0%)	9	NA	NA
WP_001295424.1|4450531_4451173_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
WP_001234767.1|4451264_4451846_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.3e-31
WP_001252331.1|4451867_4453721_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001339006.1|4454169_4455753_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_162829205.1|4455953_4456103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000978094.1|4456411_4457551_+	polysaccharide export protein Wza	NA	NA	NA	NA	NA
WP_000482901.1|4457556_4458000_+	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_057109785.1|4458002_4460165_+	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	1.9e-17
WP_000654503.1|4460342_4461182_+	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	9.7e-07
>prophage 218
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	4465426	4472220	4652776		Synechococcus_phage(25.0%)	6	NA	NA
WP_134800691.1|4465426_4466548_+	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	2.0e-132
WP_000089922.1|4466550_4467516_+	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.8	1.3e-87
WP_000479838.1|4467518_4467998_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_134800690.1|4467994_4469218_+	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_000079266.1|4469220_4470657_+	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.6	3.9e-48
WP_001296216.1|4470849_4472220_+	colanic acid biosynthesis phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.7	1.7e-32
>prophage 219
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	4477836	4484147	4652776		Enterobacteria_phage(50.0%)	6	NA	NA
WP_040092579.1|4477836_4479231_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.6	1.1e-18
WP_000183032.1|4479405_4480299_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.9e-46
WP_040079223.1|4480670_4481756_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.5	4.2e-103
WP_001023631.1|4481755_4482655_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.5	8.2e-28
WP_060773441.1|4482712_4483591_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	3.9e-107
WP_060773442.1|4483595_4484147_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	7.7e-53
>prophage 220
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	4491745	4548591	4652776	transposase	Acinetobacter_phage(22.22%)	39	NA	NA
WP_060773447.1|4491745_4493152_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.4e-37
WP_134800686.1|4493916_4494660_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_085947598.1|4495483_4496646_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_000704889.1|4498425_4499592_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	52.2	5.0e-110
WP_134800737.1|4499738_4500716_+	LPS O-antigen chain length determinant protein WzzB	NA	NA	NA	NA	NA
WP_000954833.1|4500812_4501424_-	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	NA	NA	NA	NA
WP_000880182.1|4501417_4502194_-	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_000586452.1|4502175_4502913_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_001103560.1|4502912_4503503_-	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_000080109.1|4503502_4504570_-	bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_000108941.1|4504569_4505640_-	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
WP_001345878.1|4505636_4506941_-	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_000131769.1|4506946_4507846_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	92.1	7.0e-11
WP_010989201.1|4507991_4508033_-	his operon leader peptide	NA	NA	NA	NA	NA
WP_001259255.1|4508315_4508567_+	YoeB-YefM toxin-antitoxin system antitoxin YefM	NA	NA	NA	NA	NA
WP_000767829.1|4508563_4508818_+	type II toxin-antitoxin system mRNA interferase toxin YoeB	NA	NA	NA	NA	NA
WP_000754737.1|4508900_4509725_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_167544908.1|4511408_4512636_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	3.8e-177
WP_010723108.1|4513028_4513091_+	membrane protein YoeI	NA	NA	NA	NA	NA
WP_134805639.1|4514605_4515958_+	putrescine/proton symporter PlaP	NA	NA	NA	NA	NA
WP_000492322.1|4516136_4517195_+	transport protein YeeE	NA	NA	NA	NA	NA
WP_000985273.1|4517208_4517436_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_000980542.1|4517478_4518906_-	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_001302630.1|4519029_4519188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001105385.1|4520398_4520872_+	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001200876.1|4521069_4522128_+	FUSC family protein	NA	NA	NA	NA	NA
WP_000450409.1|4522299_4522629_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_024259628.1|4522729_4522912_-	ethanolamine utilization protein	NA	NA	NA	NA	NA
WP_167544914.1|4523536_4524750_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.0	7.1e-168
WP_000255950.1|4525277_4526300_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.8	8.6e-199
WP_088895425.1|4526381_4527610_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_000973150.1|4529478_4530024_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_005042779.1|4530020_4530764_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001166156.1|4530775_4531855_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_134800685.1|4531916_4532852_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011482.1|4533310_4534228_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_001010986.1|4534329_4535280_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_001060236.1|4540289_4541744_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_094112617.1|4547434_4548591_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.4	5.7e-66
>prophage 221
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	4558996	4622913	4652776	tail,transposase	Escherichia_phage(22.22%)	55	NA	NA
WP_001117462.1|4558996_4559266_+	DNA-binding protein	NA	A0A2I6PIE5	Escherichia_phage	61.3	4.1e-15
WP_000693856.1|4559262_4559688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024259707.1|4559759_4560830_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.7	3.8e-64
WP_001151146.1|4560870_4561293_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.7	3.9e-65
WP_001266147.1|4561289_4561595_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.1	1.1e-48
WP_000335375.1|4561581_4562037_+	ead/Ea22-like family protein	NA	Q5G8U8	Enterobacteria_phage	69.6	1.4e-28
WP_000099181.1|4562086_4563625_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.2	2.8e-294
WP_000612610.1|4563673_4564021_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	2.8e-61
WP_001333468.1|4564017_4564398_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_005069274.1|4564509_4564926_+	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	72.0	1.5e-24
WP_000935258.1|4565520_4565733_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	6.6e-29
WP_000929754.1|4565900_4566179_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	43.8	2.4e-10
WP_000902849.1|4568747_4569293_+|tail	tail fiber assembly protein	tail	Q8W612	Enterobacteria_phage	74.7	1.6e-74
WP_000551126.1|4570535_4571159_+	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	76.5	5.4e-79
WP_001039895.1|4571158_4571338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046891740.1|4571338_4572982_-	E3 ubiquitin--protein ligase	NA	NA	NA	NA	NA
WP_134800684.1|4576003_4577172_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	98.7	4.2e-181
WP_171764165.1|4578607_4579835_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	5.0e-177
WP_094096479.1|4580175_4581332_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	1.2e-66
WP_162281804.1|4581549_4582200_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_001241113.1|4582456_4583092_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_000740102.1|4583092_4584097_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_000920127.1|4584205_4584619_-	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_001339045.1|4584751_4585423_+	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000826750.1|4585422_4586781_+	two-component system sensor histidine kinase HprS	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.3	6.6e-05
WP_114142771.1|4589885_4590413_-	porin	NA	Q1MVN1	Enterobacteria_phage	47.0	1.7e-36
WP_134805288.1|4590476_4591704_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_072135367.1|4592861_4593227_+	permease	NA	NA	NA	NA	NA
WP_000365569.1|4593266_4593962_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.8	5.6e-08
WP_001157235.1|4594028_4595447_+	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.1	3.0e-101
WP_000786008.1|4595427_4595898_+	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	4.4e-33
WP_001212273.1|4595886_4596807_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_129592878.1|4596979_4597897_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_000009307.1|4597975_4598158_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_077897541.1|4598328_4600023_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.1	8.5e-18
WP_000491513.1|4600019_4600835_-	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_000844800.1|4601132_4601360_-	peroxide/acid resistance protein YodD	NA	NA	NA	NA	NA
WP_000867217.1|4601522_4601711_+	protein DsrB	NA	NA	NA	NA	NA
WP_024259586.1|4601754_4602363_-	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_000187358.1|4604228_4604498_-	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_001253451.1|4604507_4605170_-	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_004982751.1|4605169_4605535_-	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001282098.1|4605537_4605951_-	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_005040713.1|4605947_4606952_-	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_000133228.1|4606956_4607421_-	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_073817118.1|4607525_4608680_-	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_001282673.1|4609902_4610589_-	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000067936.1|4610581_4611577_-	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_000994403.1|4611569_4612739_-	flagellar M-ring protein FliF	NA	NA	NA	NA	NA
WP_001274295.1|4612953_4613268_+	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_001070456.1|4613601_4613934_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_088895425.1|4615284_4616512_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_000734031.1|4616553_4617105_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_129592877.1|4618522_4619679_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	3.4e-66
WP_000334573.1|4622241_4622913_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.9	1.1e-80
>prophage 222
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	4635127	4635880	4652776		Planktothrix_phage(100.0%)	1	NA	NA
WP_001272989.1|4635127_4635880_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G9BWD6	Planktothrix_phage	41.4	1.7e-31
>prophage 223
NZ_CP034935	Shigella dysenteriae strain 79-8006 chromosome, complete genome	4652776	4650435	4651592	4652776	transposase	Acinetobacter_phage(100.0%)	1	NA	NA
WP_094096479.1|4650435_4651592_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	1.2e-66
>prophage 1
NZ_CP034934	Shigella dysenteriae strain 79-8006 plasmid p79-8006, complete sequence	100586	4	92909	100586	transposase,tRNA,protease	Stx2-converting_phage(42.11%)	64	NA	NA
WP_001063816.1|4_1132_+|transposase	IS110-like element ISSso6 family transposase	transposase	NA	NA	NA	NA
WP_001072392.1|1424_3017_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.2	4.8e-172
WP_129593018.1|3047_3398_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	1.8e-39
WP_000435415.1|3394_3814_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	77.3	2.9e-36
WP_001178088.1|5047_5332_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_000421262.1|5331_5607_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000766699.1|5738_5876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050546159.1|8197_9328_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_167544920.1|9391_10605_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	96.6	8.2e-164
WP_000019158.1|10699_10972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813626.1|12900_13119_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159860.1|13120_13426_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_129593020.1|13818_15456_+	T3SS effector E3 ubiquitin-protein ligase IpaH9.8	NA	NA	NA	NA	NA
WP_000079956.1|15663_15933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000705599.1|16184_16670_+	protein kinase	NA	NA	NA	NA	NA
WP_004996477.1|17588_17705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000931198.1|18068_18911_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_005027207.1|18913_20002_+	putative hexosyltransferase CapU	NA	NA	NA	NA	NA
WP_005045525.1|20006_20957_+	virulence factor VirK	NA	NA	NA	NA	NA
WP_005027201.1|21021_21966_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_069661558.1|23751_25932_+	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_000911318.1|25940_26339_-|tRNA	tRNA(fMet)-specific endonuclease VapC	tRNA	NA	NA	NA	NA
WP_000450530.1|26338_26566_-	toxin-antitoxin system antitoxin VapB	NA	NA	NA	NA	NA
WP_171770082.1|27052_32689_+	conjugative transfer relaxase/helicase TraI	NA	A0A077JBM8	Xanthomonas_phage	32.0	4.1e-08
WP_005056178.1|32743_33304_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_011379083.1|33434_33647_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001233866.1|33890_34352_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.7	3.2e-20
WP_001299729.1|34397_34607_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_000766818.1|34645_35236_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_000083819.1|35475_35736_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001365705.1|35959_36034_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000130973.1|36026_36884_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_000957863.1|41008_41197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094096542.1|42139_42984_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	50.0	4.4e-23
WP_000701106.1|43408_44863_+	type 3 secretion system effector OspC2	NA	NA	NA	NA	NA
WP_046891828.1|45311_46520_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000019158.1|46500_46773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010921625.1|47044_47347_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_000405248.1|47337_47820_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000625268.1|50056_50749_-	type III secretion system effector cysteine methyltransferase OspZ	NA	NA	NA	NA	NA
WP_005026553.1|51238_51376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005041436.1|52337_53285_+|protease	omptin family outer membrane protease IcsP	protease	NA	NA	NA	NA
WP_134805288.1|55339_56567_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_001046941.1|57503_58370_+	type 3 secretion system effector OspB	NA	A0A0P0ZCT1	Stx2-converting_phage	35.3	7.2e-29
WP_000850660.1|58697_59438_+	PAP2 family phosphatase PhoN2	NA	A0A1B1IUP6	uncultured_Mediterranean_phage	28.9	2.6e-11
WP_114142765.1|59797_59884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005008498.1|63777_63975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005041841.1|64056_65766_-	ShET2/EspL2 family type III secretion system effector toxin	NA	NA	NA	NA	NA
WP_001121865.1|66197_66917_-	type III secretion system effector phosphothreonine lyase	NA	NA	NA	NA	NA
WP_000868561.1|67955_68534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001077959.1|69885_70173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000622995.1|72286_72634_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	75.7	3.4e-46
WP_000026472.1|75447_76125_+	type 3 secretion system effector OspD1	NA	NA	NA	NA	NA
WP_011114726.1|76636_76951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024259653.1|77232_77799_+	type III secretion effector IpgB2	NA	NA	NA	NA	NA
WP_004979576.1|81884_82046_+	hypothetical protein	NA	A0A0P0ZEB3	Stx2-converting_phage	55.0	3.9e-05
WP_000200287.1|82183_83383_+	AAA family ATPase	NA	Q71TL9	Escherichia_phage	75.1	2.0e-175
WP_000431557.1|83382_84363_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	58.2	8.5e-95
WP_073691216.1|85392_86571_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	32.1	1.7e-28
WP_171764169.1|87300_88526_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	97.3	1.5e-165
WP_005031011.1|88827_89502_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.1	7.6e-10
WP_129592979.1|89811_90831_+|transposase	IS110-like element ISEc11 family transposase	transposase	NA	NA	NA	NA
WP_089519923.1|91105_91288_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	71.2	2.5e-16
WP_004967149.1|91307_92909_+|transposase	IS66-like element ISSfl3 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.5	4.9e-148
