The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP034931	Shigella flexneri strain 2013C-3749 chromosome, complete genome	4654019	413400	536046	4654019	protease,tRNA,plate,portal,coat,terminase,transposase	Escherichia_phage(20.0%)	103	NA	NA
WP_000742443.1|413400_414825_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.2	6.5e-27
WP_000272188.1|416224_416611_-	DUF3461 family protein	NA	NA	NA	NA	NA
WP_001186650.1|416924_417749_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_001094600.1|417779_420452_-	bifunctional uridylyltransferase/uridylyl-removing protein GlnD	NA	NA	NA	NA	NA
WP_001018194.1|420513_421308_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_000246888.1|421675_422401_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_000818114.1|422658_423510_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_000224573.1|423656_424382_+	UMP kinase	NA	NA	NA	NA	NA
WP_000622418.1|424673_425231_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_000811938.1|425322_426519_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_001295562.1|426707_427466_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
WP_000922446.1|427478_428336_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_005053372.1|428347_429700_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|429729_432162_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|432283_432769_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139282.1|432772_433798_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|433902_434358_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|434361_435150_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000132065.1|435149_436298_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569431.1|436294_436891_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.8e-26
WP_001294740.1|436927_440410_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000055741.1|440422_441382_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020991.1|441480_443622_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|443678_444068_+	VOC family protein	NA	NA	NA	NA	NA
WP_000176576.1|444132_445431_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|445479_445740_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|445726_445927_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185290.1|446092_446638_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635538.1|446634_447057_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239155.1|447070_447781_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_005053355.1|447935_448760_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260712.1|448812_450531_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094030.1|450641_451349_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202325.1|451345_451750_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874224.1|451867_452683_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294596.1|452722_453376_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593997.1|453368_454400_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140187.1|454587_455163_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997046.1|460921_461725_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	9.2e-39
WP_005086990.1|461763_463110_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_000648578.1|463159_464074_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|464314_465115_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211683.1|465192_465963_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644679.1|466010_467357_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	35.1	3.7e-08
WP_001052754.1|467428_468184_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_005060310.1|468217_468940_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|468936_469404_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001366128.1|469468_470200_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	7.6e-40
WP_000402248.1|470539_471586_-	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_000371478.1|472155_474039_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_001276640.1|474054_474549_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_094081497.1|476329_477602_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	1.5e-176
WP_000343116.1|477659_477947_-	hypothetical protein	NA	A0A1P8DTP0	Salmonella_phage	60.0	1.8e-29
WP_094081496.1|478024_479192_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	100.0	1.8e-184
WP_014532150.1|479186_480242_+|terminase	terminase	terminase	I1TEI5	Salmonella_phage	99.7	1.2e-211
WP_000752837.1|480242_482408_+|portal	portal protein	portal	A0A2D1GLJ6	Escherichia_phage	99.2	0.0e+00
WP_000373012.1|482421_483333_+	scaffold protein	NA	A0A2D1GLN7	Escherichia_phage	99.0	2.0e-159
WP_001196950.1|483332_484628_+|coat	coat protein	coat	A0A2D1GLV2	Escherichia_phage	98.4	1.5e-240
WP_005053303.1|484672_484903_+	hypothetical protein	NA	A0A2D1GLK1	Escherichia_phage	69.3	1.2e-23
WP_001054834.1|484880_485381_+	DNA recombination protein RmuC	NA	G8EYJ2	Enterobacteria_phage	99.4	6.5e-91
WP_001122382.1|485380_486799_+	packaged DNA stabilization protein gp10	NA	Q9AYZ4	Salmonella_phage	98.7	1.2e-272
WP_000785540.1|486798_487647_+	Packaged DNA stabilization protein gp26	NA	Q716G6	Shigella_phage	98.6	2.1e-102
WP_000627639.1|487646_488102_+	DUF2824 family protein	NA	A0A2D1GLX4	Escherichia_phage	99.3	8.8e-87
WP_000964877.1|488104_488797_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	99.6	2.1e-111
WP_000246949.1|488806_490138_+	phage DNA ejection protein	NA	A0A2D1GLX5	Escherichia_phage	99.8	3.1e-217
WP_005053293.1|490138_491869_+	lytic transglycosylase domain-containing protein	NA	A0A088CQ71	Enterobacteria_phage	97.9	6.8e-281
WP_005053289.1|493254_493575_-	phosphate starvation-inducible protein PsiF	NA	NA	NA	NA	NA
WP_005053287.1|493693_495109_-	alkaline phosphatase	NA	NA	NA	NA	NA
WP_000792969.1|495209_495470_-	anti-adapter protein IraP	NA	NA	NA	NA	NA
WP_023517632.1|495651_495855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413677.1|495932_497027_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_001599861.1|497050_497263_-	DUF2754 domain-containing protein	NA	NA	NA	NA	NA
WP_000763148.1|497522_497831_+	DUF2755 family protein	NA	NA	NA	NA	NA
WP_000092054.1|497889_498984_-	surface-exposed outer membrane lipoprotein YaiW	NA	NA	NA	NA	NA
WP_001342332.1|498996_500217_-	peptide antibiotic transporter SbmA	NA	NA	NA	NA	NA
WP_000830735.1|500568_501726_+	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	3.9e-06
WP_000953938.1|501726_502230_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_094081495.1|503950_505107_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	8.9e-67
WP_094081542.1|505883_507112_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	2.9e-177
WP_001295337.1|508872_509847_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_000004031.1|509952_510804_-	taurine dioxygenase	NA	NA	NA	NA	NA
WP_000114607.1|510800_511628_-	taurine ABC transporter permease TauC	NA	NA	NA	NA	NA
WP_000939367.1|511624_512392_-	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	39.8	4.3e-25
WP_045177322.1|512404_513331_-	taurine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_077696319.1|513597_513792_-	regulator	NA	NA	NA	NA	NA
WP_000003122.1|514700_515369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000370403.1|515611_516307_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023933.1|516299_517727_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102097.1|517737_518457_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000667623.1|520240_520627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000011500.1|520651_522865_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_005053237.1|523354_523762_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_000568701.1|523758_526047_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_005053234.1|526043_527033_+	RHS repeat-associated core domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	52.7	6.5e-26
WP_128567422.1|527132_527336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000343515.1|527353_527674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001139559.1|528081_528852_-	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000532697.1|529005_529479_+	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000973114.1|529521_531966_-	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000284050.1|532205_532784_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000333379.1|532989_533757_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225676.1|533727_534468_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000006251.1|535548_536046_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP034931	Shigella flexneri strain 2013C-3749 chromosome, complete genome	4654019	879075	964029	4654019	lysis,tRNA,portal,coat,terminase,transposase,integrase,capsid,holin	Enterobacteria_phage(34.55%)	90	895618:895633	964969:964984
WP_000162739.1|879075_880500_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_001018040.1|880652_881693_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.1e-47
WP_000084469.1|881689_882157_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_001278605.1|882246_883125_+	CNNM family magnesium/cobalt transport protein CorC	NA	NA	NA	NA	NA
WP_000344846.1|883149_884688_+	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_001177084.1|885084_885993_+	glutamate/aspartate ABC transporter substrate-binding protein GltI	NA	NA	NA	NA	NA
WP_000020953.1|886162_886903_+	glutamate/aspartate ABC transporter permease GltJ	NA	NA	NA	NA	NA
WP_000272830.1|886902_887577_+	glutamate/aspartate ABC transporter permease GltK	NA	NA	NA	NA	NA
WP_000631382.1|887576_888302_+	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	1.7e-31
WP_001207526.1|888419_889355_+	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_005049464.1|891168_892620_-	co-chaperone DjlC	NA	NA	NA	NA	NA
WP_001030938.1|892616_893324_-	DUF1266 domain-containing protein	NA	NA	NA	NA	NA
WP_001035656.1|893425_893980_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_000786582.1|893989_895417_-	J domain-containing protein	NA	NA	NA	NA	NA
WP_000367140.1|895413_896121_-	DUF1266 domain-containing protein	NA	NA	NA	NA	NA
895618:895633	attL	ACCAAAGGTATAACCG	NA	NA	NA	NA
WP_000578172.1|896284_897262_+	SEL1-like repeat protein	NA	NA	NA	NA	NA
WP_001044870.1|897331_897814_-	zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_001157892.1|898048_900631_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.3	1.4e-184
WP_001269672.1|900645_901227_+	LPS assembly lipoprotein LptE	NA	NA	NA	NA	NA
WP_000620544.1|901226_902258_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_000838889.1|902259_902901_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_001241888.1|902924_903536_+	adenosylcobalamin/alpha-ribazole phosphatase	NA	NA	NA	NA	NA
WP_001161664.1|903795_904113_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_000776104.1|904116_904584_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_000776197.1|904614_906516_+	peptidoglycan DD-transpeptidase MrdA	NA	NA	NA	NA	NA
WP_000131719.1|906518_907631_+	peptidoglycan glycosyltransferase MrdB	NA	NA	NA	NA	NA
WP_001231405.1|907641_908730_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
WP_001092085.1|908868_910080_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.2	7.5e-101
WP_000850550.1|910190_910454_+	YbeD family protein	NA	NA	NA	NA	NA
WP_000284045.1|910554_911196_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_000378035.1|911454_912408_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000042632.1|912616_913582_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_000503931.1|913682_913886_-	twin-arginine translocase subunit TatE	NA	NA	NA	NA	NA
WP_005049482.1|914014_914803_-	deaminated glutathione amidase	NA	NA	NA	NA	NA
WP_000939741.1|914895_915279_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
WP_000034825.1|915332_915542_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
WP_005049488.1|915716_916277_-	lipid IV(A) palmitoyltransferase PagP	NA	NA	NA	NA	NA
WP_000955063.1|916865_918251_+	anaerobic C4-dicarboxylate transporter DcuC	NA	NA	NA	NA	NA
WP_000833599.1|918970_919480_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_077696331.1|919642_919888_+	helix-turn-helix domain-containing protein	NA	A0A2I7S995	Vibrio_phage	63.2	6.1e-18
WP_094081558.1|921558_922714_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	8.9e-67
WP_011069283.1|922726_923002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000627468.1|922998_923940_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	85.6	2.3e-153
WP_005060669.1|924084_924441_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	87.4	4.7e-51
WP_000873153.1|924444_925665_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	85.6	2.5e-192
WP_000184977.1|925668_926412_-|capsid	minor capsid protein	capsid	A0A0M4REK0	Salmonella_phage	84.4	5.3e-89
WP_000113501.1|926302_927769_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	90.8	1.6e-259
WP_005020049.1|927768_928002_-	hypothetical protein	NA	A0A077KAW0	Edwardsiella_phage	65.8	6.2e-20
WP_005098291.1|927989_928529_-	hypothetical protein	NA	A0A077KAW0	Edwardsiella_phage	61.4	6.6e-49
WP_134796765.1|928513_929742_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	2.5e-176
WP_000204761.1|929817_930501_-|terminase	PBSX family phage terminase large subunit	terminase	K4NXU1	Acinetobacter_phage	73.4	7.0e-96
WP_001108106.1|930451_931216_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	55.4	7.0e-12
WP_011069285.1|931410_931923_+	VTT domain-containing protein	NA	NA	NA	NA	NA
WP_128567431.1|932055_932247_-	hypothetical protein	NA	Q76H62	Enterobacteria_phage	98.4	1.3e-28
WP_000747032.1|932329_933497_+|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	100.0	1.8e-184
WP_000482655.1|933526_933949_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	63.4	9.4e-43
WP_094085495.1|935260_936390_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	4.6e-60
WP_032322952.1|936665_938546_+	toprim domain-containing protein	NA	K7PK08	Enterobacteria_phage	99.0	0.0e+00
WP_000736913.1|938623_939064_+	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_016063117.1|939060_939243_+	NinE family protein	NA	K7PH28	Enterobacteria_phage	100.0	7.4e-29
WP_000566871.1|939239_939410_+	protein ninF	NA	K7PM86	Enterobacteria_phage	100.0	5.5e-26
WP_021530017.1|939402_940125_+	phage antirepressor KilAC domain-containing protein	NA	A5VW87	Enterobacteria_phage	99.6	1.6e-130
WP_000002245.1|940124_940415_+	DUF1364 domain-containing protein	NA	A5VW86	Enterobacteria_phage	100.0	1.0e-51
WP_001008199.1|940411_940774_+	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	100.0	9.2e-63
WP_000994516.1|940770_940959_+	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_025765980.1|940955_941579_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	99.5	2.6e-113
WP_000783734.1|942012_942336_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_000229389.1|942319_942796_+	glycoside hydrolase family protein	NA	A5VW81	Enterobacteria_phage	100.0	7.5e-89
WP_134315478.1|942792_943230_+|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	96.6	6.5e-71
WP_001139676.1|943217_943370_+	hypothetical protein	NA	A0A088CQ22	Enterobacteria_phage	100.0	1.2e-21
WP_000393198.1|943596_943785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000807788.1|943924_944167_+	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_025765985.1|944169_944607_+	hypothetical protein	NA	C7U0V7	Enterobacteria_phage	95.3	1.2e-64
WP_001543879.1|944606_946067_+	hypothetical protein	NA	W6MW26	Pseudomonas_phage	76.2	8.2e-219
WP_162284485.1|946066_948235_+|portal	portal protein	portal	A0A2D1GLJ6	Escherichia_phage	98.5	0.0e+00
WP_000373006.1|948248_949160_+	scaffold protein	NA	A0A2D1GLN7	Escherichia_phage	100.0	1.3e-161
WP_059216722.1|949159_950455_+|coat	coat protein	coat	A0A2D1GLV2	Escherichia_phage	98.8	6.1e-242
WP_000115359.1|950498_951098_+	hypothetical protein	NA	I6S1J7	Salmonella_phage	61.8	6.0e-59
WP_073461871.1|951075_951576_+	recombinase RmuC	NA	G8EYJ2	Enterobacteria_phage	98.8	1.9e-90
WP_113842076.1|951576_952995_+	packaged DNA stabilization protein gp10	NA	Q9AYZ4	Salmonella_phage	99.6	2.1e-275
WP_162284486.1|952994_953843_+	hypothetical protein	NA	Q716G6	Shigella_phage	87.6	7.6e-92
WP_016242489.1|953842_954298_+	DUF2824 family protein	NA	Q716G5	Shigella_phage	98.7	2.0e-86
WP_000964852.1|954300_954993_+	hypothetical protein	NA	G5DA80	Enterobacteria_phage	99.1	3.9e-110
WP_119177997.1|955002_956334_+	phage DNA ejection protein	NA	A0A2D1GLX5	Escherichia_phage	99.1	1.5e-214
WP_162284487.1|956334_958728_+	transglycosylase SLT domain-containing protein	NA	Q716G2	Shigella_phage	97.0	0.0e+00
WP_000287058.1|958817_959078_-	Arc family DNA-binding protein	NA	A0A088CPT2	Enterobacteria_phage	94.2	1.5e-35
WP_001104356.1|959209_959719_-	HNH endonuclease	NA	A0A291AXK3	Shigella_phage	44.9	2.6e-31
WP_162284494.1|959806_961681_+	endorhamnosidase	NA	Q716G1	Shigella_phage	99.0	0.0e+00
WP_000549610.1|961714_962716_-	acyltransferase	NA	Q716G0	Shigella_phage	100.0	6.3e-186
WP_000958651.1|962871_964029_-|integrase	prophage integrase IntS	integrase	Q716F9	Shigella_phage	100.0	1.9e-223
964969:964984	attR	ACCAAAGGTATAACCG	NA	NA	NA	NA
>prophage 3
NZ_CP034931	Shigella flexneri strain 2013C-3749 chromosome, complete genome	4654019	1304781	1311088	4654019		Enterobacteria_phage(50.0%)	6	NA	NA
WP_001116126.1|1304781_1306176_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	30.9	1.8e-18
WP_000183041.1|1306350_1307244_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.3e-46
WP_000699404.1|1307616_1308702_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.6	5.7e-100
WP_162284489.1|1308701_1309601_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.2	1.3e-28
WP_000857518.1|1309659_1310538_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	1.9e-106
WP_001100804.1|1310542_1311088_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.3	3.5e-50
>prophage 4
NZ_CP034931	Shigella flexneri strain 2013C-3749 chromosome, complete genome	4654019	1338112	1430471	4654019	transposase,integrase,tail,holin	Stx2-converting_phage(19.44%)	78	1333839:1333851	1380029:1380083
1333839:1333851	attL	AGCTGGTTCGCCG	NA	NA	NA	NA
WP_162284490.1|1338112_1338952_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A0P0ZDN8	Stx2-converting_phage	99.3	1.4e-159
1333839:1333851	attL	AGCTGGTTCGCCG	NA	NA	NA	NA
WP_004967157.1|1339030_1339705_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	2.0e-10
WP_004967157.1|1339030_1339705_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	2.0e-10
1339313:1339325	attR	CGGCGAACCAGCT	NA	NA	NA	NA
WP_005049241.1|1339701_1340052_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	67.5	1.8e-26
1339313:1339325	attR	CGGCGAACCAGCT	NA	NA	NA	NA
WP_094081542.1|1341043_1342271_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	2.9e-177
WP_094081531.1|1342636_1343792_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	1.5e-66
WP_045177795.1|1345107_1346709_-|transposase	IS66-like element ISSfl3 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	61.3	3.2e-147
WP_004967157.1|1348361_1349036_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	2.0e-10
WP_005088730.1|1349105_1349405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000450409.1|1349576_1349906_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_001016348.1|1350006_1350189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094081532.1|1352218_1353374_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	8.9e-67
WP_000261572.1|1353386_1353896_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_005049317.1|1353892_1354636_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001165576.1|1354647_1355727_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000986341.1|1355788_1356724_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011445.1|1357182_1358100_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_001010988.1|1358201_1359152_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_000532920.1|1361528_1362245_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060217.1|1362587_1364042_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_094081533.1|1364393_1365550_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	8.9e-67
WP_000747032.1|1365635_1366803_+|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	100.0	1.8e-184
WP_005063096.1|1366864_1367368_-	MFS transporter	NA	NA	NA	NA	NA
WP_094081534.1|1367429_1368597_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.7	8.9e-184
WP_001325918.1|1370304_1371102_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533619.1|1371337_1372363_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	2.0e-102
WP_005069274.1|1372529_1372946_+	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	72.0	1.5e-24
WP_000935258.1|1373540_1373753_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	6.6e-29
WP_011069426.1|1373920_1374199_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	45.0	4.5e-09
WP_001265248.1|1374200_1375259_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.0	2.6e-89
WP_000140020.1|1375259_1375625_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	68.1	7.1e-39
WP_005049343.1|1375621_1376305_+	antiterminator	NA	I6PDF8	Cronobacter_phage	49.8	2.0e-58
WP_000839572.1|1377105_1377321_+|holin	class II holin family protein	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_004967157.1|1377419_1378094_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	2.0e-10
WP_005049241.1|1378090_1378441_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	67.5	1.8e-26
WP_094081529.1|1380092_1381248_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	3.4e-66
WP_000497744.1|1381642_1381804_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	76.6	9.2e-15
WP_000155743.1|1381800_1383297_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	Q8W623	Enterobacteria_phage	97.2	3.8e-272
WP_001062338.1|1383296_1383653_+|tail	phage tail tube protein	tail	Q8W622	Enterobacteria_phage	98.3	5.3e-63
WP_001251340.1|1383652_1383988_+|tail	phage tail assembly protein	tail	Q8W621	Enterobacteria_phage	97.2	9.8e-51
WP_000785377.1|1384072_1386022_+|tail	phage tail tape measure protein	tail	Q8W620	Enterobacteria_phage	98.2	0.0e+00
WP_032322769.1|1386089_1386572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014532281.1|1388976_1390620_-	T3SS effector E3 ubiquitin-protein ligase IpaH4/H7	NA	NA	NA	NA	NA
WP_000239881.1|1390935_1391604_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937511.1|1391660_1391930_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	81.7	1.2e-19
WP_001007781.1|1393007_1393658_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_001240061.1|1393915_1394551_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_000920127.1|1395664_1396078_-	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_001347103.1|1396210_1396882_+	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000826714.1|1396881_1398240_+	two-component system sensor histidine kinase HprS	NA	NA	NA	NA	NA
WP_000218218.1|1398347_1399199_-	protein deglycase HchA	NA	NA	NA	NA	NA
WP_111778310.1|1400842_1402070_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	9.8e-173
WP_094081536.1|1402909_1404056_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.2	1.5e-146
WP_032155863.1|1404057_1404315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001157215.1|1404961_1406380_+	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.1	1.0e-101
WP_000228688.1|1406360_1406831_+	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	7.6e-33
WP_001212270.1|1406819_1407740_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000922688.1|1407912_1408830_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_000009302.1|1408908_1409091_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_005048789.1|1412065_1412293_-	peroxide/acid resistance protein YodD	NA	NA	NA	NA	NA
WP_000867216.1|1412455_1412644_+	protein DsrB	NA	NA	NA	NA	NA
WP_000103994.1|1412687_1413311_-	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_000983188.1|1413595_1414381_-	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000187358.1|1414389_1414659_-	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_001253318.1|1414668_1415406_-	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_001298519.1|1415405_1415771_-	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001282086.1|1415773_1416187_-	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_005048779.1|1416183_1417188_-	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_000133106.1|1417192_1417657_-	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_000620124.1|1417761_1418889_-	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000213277.1|1419248_1420622_-	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_001282677.1|1420621_1421308_-	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000067956.1|1421300_1422296_-	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_001274301.1|1424161_1424476_+	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_001070440.1|1424820_1425153_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001313946.1|1425321_1425873_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000737286.1|1427169_1428252_-	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	79.8	7.8e-166
WP_005127797.1|1429262_1429436_+	helix-turn-helix domain-containing protein	NA	A0A1B0VCD8	Salmonella_phage	77.2	1.4e-16
WP_157849614.1|1429700_1430471_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1W6JP07	Morganella_phage	96.9	1.4e-129
>prophage 5
NZ_CP034931	Shigella flexneri strain 2013C-3749 chromosome, complete genome	4654019	1474371	1574994	4654019	transposase,integrase,tRNA,tail	Enterobacteria_phage(35.0%)	85	1491943:1492002	1557011:1557449
WP_000747032.1|1474371_1475539_+|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	100.0	1.8e-184
WP_000455174.1|1475474_1475933_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_001259572.1|1479385_1479724_+	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_005063152.1|1481190_1481679_-	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
WP_001025297.1|1481855_1483589_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	6.8e-87
WP_005048653.1|1483804_1484371_+	VOC family protein	NA	NA	NA	NA	NA
WP_001185741.1|1484384_1485131_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001214308.1|1485518_1486619_+	NapC/NirT family cytochrome c	NA	NA	NA	NA	NA
WP_001229400.1|1486643_1489073_+	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_000564755.1|1489237_1490209_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000019588.1|1490205_1490949_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_005048647.1|1490989_1491385_-	MAPEG family protein	NA	NA	NA	NA	NA
WP_000905997.1|1491437_1491788_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
1491943:1492002	attL	GGGTGAAGTGGCACACTGAATTTGGCCACCTGAACAGAGGTGATATGCTCACCTCAGAAC	NA	NA	NA	NA
WP_000747032.1|1492017_1493185_+|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	100.0	1.8e-184
WP_000528720.1|1493160_1493358_-	excisionase family protein	NA	Q8W657	Enterobacteria_phage	98.2	3.7e-26
WP_001030133.1|1493366_1493513_-	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	95.8	1.4e-22
WP_000457719.1|1493516_1493759_-	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	85.0	6.2e-31
WP_000586688.1|1493882_1494452_-	hypothetical protein	NA	A0A088C4R7	Shewanella_sp._phage	39.4	6.8e-28
WP_001099210.1|1494448_1495198_-	ORF6N domain-containing protein	NA	A0A1B5FPC0	Escherichia_phage	96.0	1.7e-135
WP_000755956.1|1495241_1496069_-	hypothetical protein	NA	Q8W654	Enterobacteria_phage	94.5	2.3e-125
WP_000248820.1|1497789_1497927_+	hypothetical protein	NA	Q8W639	Enterobacteria_phage	100.0	1.9e-16
WP_001215517.1|1497926_1498286_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.1	8.3e-40
WP_001064885.1|1498282_1498972_+	antiterminator	NA	I6PDF8	Cronobacter_phage	49.4	2.9e-57
WP_005049126.1|1500157_1501354_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001074423.1|1501617_1502019_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	66.2	3.3e-37
WP_000753026.1|1502030_1502402_+|tail	tail attachment protein	tail	NA	NA	NA	NA
WP_000677125.1|1502388_1502979_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	77.7	4.8e-77
WP_001079406.1|1502975_1503377_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	97.7	1.6e-71
WP_000211126.1|1503387_1504128_+	Ig-like domain-containing protein	NA	A5LH35	Enterobacteria_phage	96.7	1.5e-128
WP_000478927.1|1504186_1504573_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	92.2	1.4e-61
WP_001161004.1|1504581_1504911_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	99.1	1.3e-55
WP_000371983.1|1504882_1507924_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	86.5	0.0e+00
WP_000447264.1|1507923_1508253_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	97.2	2.4e-57
WP_001152490.1|1508252_1508951_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	89.7	8.4e-121
WP_000194740.1|1508955_1509699_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.7	6.8e-145
WP_000090877.1|1509635_1510238_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	8.1e-88
WP_000515521.1|1510298_1513778_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	87.3	0.0e+00
WP_001230481.1|1513845_1514445_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	93.0	1.8e-103
WP_000551132.1|1515870_1516494_+	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	75.9	5.1e-77
WP_000938097.1|1516673_1518425_-	T3SS effector E3 ubiquitin-protein ligase IpaH2	NA	NA	NA	NA	NA
WP_001210039.1|1519024_1519273_-	DinI-like family protein	NA	K7PLW4	Enterobacteria_phage	98.8	4.1e-38
WP_005049126.1|1520001_1521198_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000891627.1|1521389_1521644_-	isochorismatase family protein	NA	NA	NA	NA	NA
WP_001258670.1|1521953_1523726_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001300367.1|1523843_1524296_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000907248.1|1524324_1525065_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000974712.1|1525099_1525621_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_001024930.1|1525622_1526225_-	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001386853.1|1526294_1526360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580324.1|1526498_1527110_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_000568525.1|1527118_1528129_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.2	2.8e-08
WP_000571470.1|1528275_1529061_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000202992.1|1529057_1529813_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	3.8e-18
WP_001342995.1|1529891_1530824_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_001184045.1|1530839_1532162_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_000448385.1|1532281_1533253_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_000044417.1|1533383_1534826_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_001056694.1|1534953_1535823_-	DNA-binding transcriptional regulator HexR	NA	NA	NA	NA	NA
WP_000301736.1|1536159_1537635_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.3	9.9e-79
WP_001069479.1|1537869_1539681_+	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_000800512.1|1539717_1540359_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_000173487.1|1540414_1541593_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_005047608.1|1542083_1542440_+	protein YebF	NA	NA	NA	NA	NA
WP_000024751.1|1542766_1543426_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000936980.1|1543635_1545696_+	oligopeptidase B	NA	NA	NA	NA	NA
WP_000944268.1|1545692_1546355_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	3.5e-07
WP_000916763.1|1547136_1547367_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000168747.1|1547505_1547880_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000976476.1|1548768_1549110_+	YebY family protein	NA	NA	NA	NA	NA
WP_001189099.1|1550187_1550580_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	54.8	2.0e-31
WP_005127484.1|1550545_1550827_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	42.4	9.8e-12
WP_000683016.1|1554262_1555876_+	murein tripeptide ABC transporter substrate-binding protein MppA	NA	NA	NA	NA	NA
WP_000559908.1|1555926_1556958_-	low conductance mechanosensitive channel YnaI	NA	NA	NA	NA	NA
WP_000937573.1|1557633_1558821_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
1557011:1557449	attR	GGGTGAAGTGGCACACTGAATTTGGCCACCTGAACAGAGGTGATATGCTCACCTCAGAACAACACAGGTGCTCCAATGAAAAAAAGAAATTTTAGCGCAGAGTTTAAACGCGAATCCGCTCAACTGGTTGTTGACCAGAAATACACGGTGGCAGATGCCGCCAAAGCTATGGATGTTGGCCTTTCCACAATGACAAGATGGGTCAAACAACTGCGTGATGAGCGTCAGGGCAAAACACCAAAAGCCTCCCCCATTACCCCGGAACAAATTGAAATCCGTGAGCTCAGGAAAAAGCTACAACGCATTGAAATGGAGAATGAAATATTAAAAAAGGCTACCGCGCTCTTGATGTCAGACTCCCTGAACAGTTCTCGATAATCGGGAAACTCAGAGCGCATTATCCTGTGGTCACACTCTGCCATGTGTTCGGGGTTCATCG	NA	NA	NA	NA
WP_000124119.1|1558820_1559186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001262123.1|1560578_1561529_-	universal stress protein UspE	NA	NA	NA	NA	NA
WP_000611911.1|1561680_1562433_-	fumarate/nitrate reduction transcriptional regulator Fnr	NA	NA	NA	NA	NA
WP_000945011.1|1562627_1563143_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
WP_000156575.1|1563686_1564502_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000587200.1|1564598_1565246_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_000957853.1|1566617_1566806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014532270.1|1567310_1568777_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_000387377.1|1571101_1572085_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123730.1|1572562_1573930_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.2e-51
WP_000081423.1|1574058_1574994_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.3	3.2e-144
>prophage 6
NZ_CP034931	Shigella flexneri strain 2013C-3749 chromosome, complete genome	4654019	1852375	1862892	4654019	holin	Escherichia_phage(27.27%)	13	NA	NA
WP_000527804.1|1852375_1853836_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.1e-42
WP_071818640.1|1856158_1856464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000534858.1|1856488_1856728_+	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_000323025.1|1856727_1857015_+	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000813254.1|1857086_1857242_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000980987.1|1857459_1857711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001265249.1|1858057_1859107_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	3.2e-108
WP_000904111.1|1859119_1859476_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	6.1e-35
WP_000762882.1|1859490_1860312_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	6.1e-78
WP_000871291.1|1861621_1861957_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_000874243.1|1862216_1862405_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.2	7.2e-27
WP_001323614.1|1862401_1862563_+	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	91.3	5.4e-15
WP_000372594.1|1862712_1862892_+|holin	class II holin family protein	holin	A0A2R2Z340	Escherichia_phage	91.5	4.1e-24
>prophage 7
NZ_CP034931	Shigella flexneri strain 2013C-3749 chromosome, complete genome	4654019	1973511	2034229	4654019	protease,tRNA,tail,transposase,integrase	Escherichia_phage(35.0%)	51	2012555:2012614	2034241:2034302
WP_001220997.1|1973511_1974207_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000128851.1|1974264_1976175_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.7	3.8e-91
WP_001295493.1|1976306_1976651_+	RidA family protein	NA	NA	NA	NA	NA
WP_001307845.1|1977012_1977372_+	DUF1889 family protein	NA	NA	NA	NA	NA
WP_000457325.1|1977491_1977671_-	YoaH family protein	NA	NA	NA	NA	NA
WP_000855039.1|1977744_1979106_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	41.7	6.4e-40
WP_000456710.1|1979109_1979688_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_000624314.1|1979871_1981236_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_005049862.1|1981366_1982965_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_000394974.1|1982968_1984519_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
WP_000150543.1|1984981_1985953_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_000406926.1|1986015_1986816_+	PTS mannose transporter subunit IIC	NA	NA	NA	NA	NA
WP_001331209.1|1986828_1987680_+	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
WP_000156246.1|1987734_1988211_+	DUF986 domain-containing protein	NA	NA	NA	NA	NA
WP_001668667.1|1989399_1989966_+	manganese efflux pump MntP	NA	NA	NA	NA	NA
WP_000010128.1|1989962_1990772_-	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_001062678.1|1990937_1991147_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
WP_001295496.1|1991159_1991303_-	YobF family protein	NA	NA	NA	NA	NA
WP_001006860.1|1991973_1992261_-	YebO family protein	NA	NA	NA	NA	NA
WP_000714550.1|1992335_1992479_-	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
WP_001211010.1|1992637_1992877_+	membrane protein	NA	NA	NA	NA	NA
WP_001262181.1|1993019_1993811_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_001127218.1|1993987_1995361_+	MFS transporter	NA	NA	NA	NA	NA
WP_000984517.1|1995406_1996288_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001055799.1|1996479_1998528_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	1.2e-85
WP_000431370.1|1998547_1999246_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001043881.1|1999342_1999840_-	L-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
WP_001207280.1|1999969_2001253_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001295499.1|2005478_2005715_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_005049838.1|2005819_2006011_+	YebW family protein	NA	NA	NA	NA	NA
WP_094081545.1|2006267_2007424_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.4	4.4e-66
WP_128568580.1|2009453_2011169_+	T3SS effector E3 ubiquitin-protein ligase IpaH3	NA	NA	NA	NA	NA
WP_001039888.1|2011169_2011349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000930142.1|2011348_2011972_-	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	75.9	2.7e-78
2012555:2012614	attL	TGTTGTTCTGAGGTGAGCATATCACCTCTGTTCAGGTGGCCAAATTCAGTGTGCCACTTC	NA	NA	NA	NA
WP_094081546.1|2014580_2015853_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	3.4e-176
WP_000560210.1|2015930_2016152_+	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	95.9	9.0e-37
WP_000245528.1|2016145_2016322_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	93.1	9.7e-26
WP_005049830.1|2016396_2016672_+	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	93.4	4.4e-41
WP_005135630.1|2019498_2019759_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	88.1	2.8e-37
WP_001173294.1|2019764_2020862_+	AAA family ATPase	NA	I6PCV5	Cronobacter_phage	83.8	1.3e-181
WP_005049823.1|2022193_2022361_+	excisionase family protein	NA	A0A0U2RY08	Escherichia_phage	100.0	1.3e-27
WP_000443254.1|2023336_2023942_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.0	7.3e-113
WP_000555620.1|2024373_2025288_+	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_000983722.1|2025287_2026115_+	iron/manganese ABC transporter ATP-binding protein SitB	NA	G9BWD6	Planktothrix_phage	28.5	3.8e-11
WP_001101728.1|2026111_2026969_+	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000968134.1|2026965_2027823_+	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_000930141.1|2028023_2028647_-	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	78.6	5.8e-81
WP_005098694.1|2028597_2029866_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q8W611	Enterobacteria_phage	43.0	2.2e-74
WP_011069357.1|2030457_2030826_-	hypothetical protein	NA	A0A0C4UQV0	Shigella_phage	55.4	2.6e-20
WP_000082749.1|2032500_2032683_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747032.1|2033060_2034229_-|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	100.0	1.8e-184
2034241:2034302	attR	TGTTGTTCTGAGGTGAGCATATCACCTCTGTTCAGGTGGCCAAATTCAGTGTGCCACTTCAA	NA	NA	NA	NA
>prophage 8
NZ_CP034931	Shigella flexneri strain 2013C-3749 chromosome, complete genome	4654019	2037288	2049808	4654019	transposase	Escherichia_phage(62.5%)	16	NA	NA
WP_045178261.1|2037288_2037795_-	ORF6N domain-containing protein	NA	A0A0N7C203	Escherichia_phage	73.2	1.9e-42
WP_000088353.1|2037841_2038981_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	2.5e-66
WP_005049799.1|2039042_2039228_-	hypothetical protein	NA	A0A291AWU3	Escherichia_phage	63.4	1.5e-05
WP_000640143.1|2039368_2039923_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	70.5	3.7e-71
WP_000228038.1|2039919_2040210_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	89.6	3.3e-47
WP_000940329.1|2040209_2040809_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	94.5	1.4e-108
WP_000018421.1|2042145_2042358_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	8.1e-27
WP_000610655.1|2042755_2043121_-	DUF551 domain-containing protein	NA	Q08J61	Stx2-converting_phage	53.7	6.1e-30
WP_000208062.1|2043120_2043786_-	hypothetical protein	NA	A0A076G611	Escherichia_phage	44.9	6.1e-36
WP_001229297.1|2043782_2044148_-	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	98.3	2.1e-67
WP_000256998.1|2044149_2044368_-	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	90.3	1.2e-28
WP_005048249.1|2044460_2044817_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	97.5	5.1e-58
WP_001118168.1|2044874_2045297_-	DUF977 family protein	NA	A0A2I6TCA7	Escherichia_phage	75.9	1.1e-51
WP_000788996.1|2045311_2046058_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	89.2	2.1e-122
WP_167547301.1|2046896_2048124_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	3.2e-176
WP_094081493.1|2048652_2049808_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	8.9e-67
>prophage 9
NZ_CP034931	Shigella flexneri strain 2013C-3749 chromosome, complete genome	4654019	2225919	2257896	4654019	protease,tRNA,portal,terminase,head,tail,transposase	uncultured_Caudovirales_phage(53.85%)	35	NA	NA
WP_085947598.1|2225919_2227082_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_148936977.1|2227808_2229036_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	1.5e-176
WP_005047937.1|2229759_2230455_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101055.1|2230478_2231291_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185665.1|2231294_2231561_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_001131446.1|2232311_2232431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014532223.1|2232391_2232577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000122462.1|2232677_2232851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005047943.1|2232912_2233197_+	glycine zipper family protein	NA	NA	NA	NA	NA
WP_000979977.1|2233200_2233536_+	YmgD family protein	NA	NA	NA	NA	NA
WP_011110579.1|2233592_2235914_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	43.5	3.2e-92
WP_005047951.1|2236030_2236240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001246473.1|2236990_2238514_-	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_000444487.1|2239411_2240662_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248670.1|2240833_2241487_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|2241496_2241958_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_005047976.1|2242011_2243118_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_005047980.1|2243153_2243795_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423725.1|2243798_2245169_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	7.2e-108
WP_001265481.1|2245337_2246009_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735425.1|2246008_2247469_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_128568578.1|2247915_2248104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000133415.1|2248265_2248547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000127901.1|2248560_2250222_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.4	4.4e-277
WP_029716858.1|2250205_2250532_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	79.6	9.2e-46
WP_000174068.1|2250587_2250770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145905.1|2250753_2251194_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	72.6	2.5e-62
WP_000134107.1|2251193_2251490_-|head,tail	phage head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	62.2	2.2e-30
WP_001020662.1|2251486_2251825_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	1.7e-31
WP_000267599.1|2251821_2253033_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	78.5	3.1e-187
WP_000504054.1|2253034_2253607_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.5	1.6e-61
WP_000126624.1|2255107_2255269_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001294167.1|2255278_2255584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000557473.1|2255580_2255859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000761802.1|2256147_2257896_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	39.5	7.3e-89
>prophage 10
NZ_CP034931	Shigella flexneri strain 2013C-3749 chromosome, complete genome	4654019	2334461	2363383	4654019	transposase	Shigella_phage(60.0%)	22	NA	NA
WP_094081550.1|2334461_2335618_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	8.9e-67
WP_088895425.1|2337510_2338739_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_000747032.1|2339311_2340480_-|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	100.0	1.8e-184
WP_000124119.1|2341517_2341883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000937574.1|2341882_2343070_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001295445.1|2343485_2346029_-	glucans biosynthesis glucosyltransferase MdoH	NA	NA	NA	NA	NA
WP_011069327.1|2346021_2347557_-	glucans biosynthesis protein MdoG	NA	NA	NA	NA	NA
WP_001070350.1|2347950_2349108_+	glucans biosynthesis protein MdoC	NA	NA	NA	NA	NA
WP_011069326.1|2349115_2350597_-	cardiolipin synthase ClsC	NA	NA	NA	NA	NA
WP_000857408.1|2350538_2351072_-	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	7.8e-26
WP_000489563.1|2351166_2351478_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000747032.1|2351861_2353029_+|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	100.0	1.8e-184
WP_024259219.1|2352964_2353183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001144017.1|2353241_2353607_-	curlin major subunit CsgA	NA	NA	NA	NA	NA
WP_005047380.1|2354882_2355338_-	curlin minor subunit CsgB	NA	NA	NA	NA	NA
WP_000481500.1|2356091_2356742_+	transcriptional regulator CsgD	NA	NA	NA	NA	NA
WP_000833291.1|2356746_2357136_+	curli production assembly/transport protein CsgE	NA	NA	NA	NA	NA
WP_001264088.1|2357160_2357577_+	curli production assembly/transport protein CsgF	NA	NA	NA	NA	NA
WP_001297187.1|2358442_2358934_-	DUF1097 domain-containing protein	NA	NA	NA	NA	NA
WP_001001915.1|2359035_2359590_-	molecular chaperone YcdY	NA	NA	NA	NA	NA
WP_000283673.1|2359613_2360351_-	zinc-binding phosphatase	NA	NA	NA	NA	NA
WP_001179707.1|2362378_2363383_-|transposase	IS110-like element ISSfl8 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP034931	Shigella flexneri strain 2013C-3749 chromosome, complete genome	4654019	2375278	2414206	4654019	transposase,integrase,holin	Acinetobacter_phage(27.27%)	28	2396345:2396359	2409147:2409161
WP_001138064.1|2375278_2378245_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_000147567.1|2378247_2378808_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_000454193.1|2378933_2379284_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|2379486_2380500_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001334766.1|2380709_2381540_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_001209508.1|2381652_2382444_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_005086346.1|2383786_2384737_+	virulence factor VirK	NA	NA	NA	NA	NA
WP_001411475.1|2384801_2385746_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_000088357.1|2385926_2387066_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.5e-68
WP_001293435.1|2387219_2389217_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
WP_000625669.1|2389279_2390557_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_085949416.1|2390836_2391999_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.2	2.0e-50
WP_000145481.1|2392065_2392284_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_049828170.1|2392334_2392724_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	99.2	1.9e-61
WP_001189111.1|2394214_2395723_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
2396345:2396359	attL	TTATTAAGTAGCAGC	NA	NA	NA	NA
WP_042196155.1|2397460_2397667_-	helicase	NA	NA	NA	NA	NA
WP_000282110.1|2397773_2398337_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_001258873.1|2399711_2401547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000070931.1|2401647_2401935_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_005067490.1|2401906_2403436_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000279879.1|2403605_2404823_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	1.7e-44
WP_000611853.1|2405189_2406176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085947598.1|2406767_2407929_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_005047400.1|2408039_2408828_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	75.7	8.6e-90
WP_001199452.1|2409434_2410700_-	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
2409147:2409161	attR	GCTGCTACTTAATAA	NA	NA	NA	NA
WP_000154398.1|2410705_2411833_-	iron uptake system protein EfeO	NA	NA	NA	NA	NA
WP_000124119.1|2412653_2413019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000937574.1|2413018_2414206_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP034931	Shigella flexneri strain 2013C-3749 chromosome, complete genome	4654019	2472340	2547424	4654019	transposase,integrase,protease,tRNA	Acinetobacter_phage(14.29%)	54	2467609:2467627	2555882:2555900
2467609:2467627	attL	CTGGCGTATCGTATTGCCC	NA	NA	NA	NA
WP_000156489.1|2472340_2474101_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_005047466.1|2474169_2474688_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_011110566.1|2474757_2474925_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759120.1|2475180_2475744_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000445541.1|2475740_2477381_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333176.1|2477385_2478639_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053116.1|2478768_2480676_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.5	8.3e-54
WP_001086554.1|2480687_2482796_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224274.1|2483039_2484149_+	6-N-hydroxylaminopurine resistance protein YcbX	NA	NA	NA	NA	NA
WP_004991542.1|2484145_2484688_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_001370288.1|2484861_2485872_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001111452.1|2485982_2486720_-	fimbrial chaperone	NA	NA	NA	NA	NA
WP_000919489.1|2486685_2487201_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_005083752.1|2487846_2488830_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000286331.1|2488820_2491421_-	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001263929.1|2493395_2493971_+	NADPH-dependent FMN reductase	NA	NA	NA	NA	NA
WP_001244319.1|2493963_2494923_+	aliphatic sulfonate ABC transporter substrate-binding protein SsuA	NA	NA	NA	NA	NA
WP_000055999.1|2494919_2496065_+	FMNH2-dependent alkanesulfonate monooxygenase	NA	NA	NA	NA	NA
WP_000235193.1|2496076_2496259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088895425.1|2496347_2497575_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_001090476.1|2498200_2498968_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.6	4.1e-28
WP_000193826.1|2499174_2501790_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	4.1e-19
WP_001297200.1|2502055_2503258_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000117881.1|2503426_2504827_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_000977934.1|2505427_2506516_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
WP_000462669.1|2506700_2507891_+	aspartate transaminase	NA	NA	NA	NA	NA
WP_001109487.1|2508113_2508761_-	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_001295932.1|2508787_2509336_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_000925982.1|2509516_2511364_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_005083739.1|2511571_2512918_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_000572706.1|2513062_2517523_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_001295931.1|2517522_2518227_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_001288850.1|2518207_2519530_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_005047510.1|2519526_2520312_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_000899599.1|2520447_2521227_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_000436922.1|2521203_2522097_-	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000011599.1|2522250_2522997_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000350058.1|2522993_2523176_-	protein YcaR	NA	NA	NA	NA	NA
WP_000056529.1|2523227_2524460_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000570543.1|2524496_2525483_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000551266.1|2525479_2527228_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	3.3e-57
WP_000167336.1|2529730_2530015_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000140327.1|2530174_2531848_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000125013.1|2531958_2532642_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_001295345.1|2532814_2533579_-	metallopeptidase YcaL	NA	NA	NA	NA	NA
WP_000483773.1|2533714_2535061_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_000445222.1|2535186_2536470_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000057149.1|2536540_2537629_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
WP_005051051.1|2538583_2540344_+	YcaO-like family protein	NA	NA	NA	NA	NA
WP_000642544.1|2540750_2541608_+	formate transporter FocA	NA	NA	NA	NA	NA
WP_001292813.1|2541662_2543945_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.2	4.9e-162
WP_000111043.1|2544136_2544877_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_094081518.1|2545285_2546441_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.4	2.0e-66
WP_024219169.1|2546542_2547424_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.7	7.2e-162
2555882:2555900	attR	GGGCAATACGATACGCCAG	NA	NA	NA	NA
>prophage 13
NZ_CP034931	Shigella flexneri strain 2013C-3749 chromosome, complete genome	4654019	2559650	2611692	4654019	transposase,protease,tRNA	Stx2-converting_phage(18.52%)	40	NA	NA
WP_094081550.1|2559650_2560806_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	8.9e-67
WP_094081550.1|2561696_2562853_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	8.9e-67
WP_000935590.1|2564447_2565296_-	Rha family phage regulatory protein	NA	A0A0P0ZE80	Stx2-converting_phage	57.0	9.7e-55
WP_094081542.1|2565843_2567071_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	2.9e-177
WP_001005968.1|2567313_2567517_-	hypothetical protein	NA	I6PDF6	Cronobacter_phage	82.5	1.0e-10
WP_001091985.1|2567518_2567674_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.2e-07
WP_000787424.1|2567876_2568284_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	1.7e-28
WP_000912291.1|2568360_2568588_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000702036.1|2568571_2568994_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	93.6	3.8e-68
WP_001118167.1|2570616_2571039_+	DUF977 family protein	NA	A0A2I6TCA7	Escherichia_phage	76.6	5.9e-53
WP_005048249.1|2571096_2571453_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	97.5	5.1e-58
WP_029716636.1|2571621_2572287_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_000882657.1|2572457_2572670_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	90.0	4.0e-26
WP_000747032.1|2572952_2574120_+|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	100.0	1.8e-184
WP_005083422.1|2574660_2576262_-|transposase	IS66-like element ISSfl3 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	61.3	5.0e-145
WP_005048975.1|2576258_2576609_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	68.7	3.5e-27
WP_005051091.1|2576605_2577280_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.1	3.4e-10
WP_000109301.1|2577592_2578741_-	MFS transporter	NA	NA	NA	NA	NA
WP_000165870.1|2579055_2579682_+	hydrolase	NA	NA	NA	NA	NA
WP_000534651.1|2579717_2580509_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213098.1|2580510_2581128_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000886683.1|2583821_2585114_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067746.1|2585204_2586548_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	41.0	4.3e-81
WP_001295343.1|2586558_2587170_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077083.1|2587324_2591353_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|2591487_2591982_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537402.1|2592525_2593491_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.3	3.2e-62
WP_001043574.1|2593613_2595380_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.0	4.6e-22
WP_001202220.1|2595380_2597102_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.4	9.9e-22
WP_001241678.1|2597143_2597848_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|2598132_2598351_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934033.1|2599094_2601371_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	4.3e-166
WP_000520781.1|2601401_2601722_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|2602044_2602269_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188161.1|2602341_2604288_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	39.6	5.5e-37
WP_000746446.1|2604284_2605400_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_005067329.1|2605550_2606507_+	VirK/YbjX family protein	NA	NA	NA	NA	NA
WP_000599806.1|2606503_2608162_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001298299.1|2609328_2610024_+	aquaporin Z	NA	NA	NA	NA	NA
WP_088895425.1|2610464_2611692_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
>prophage 14
NZ_CP034931	Shigella flexneri strain 2013C-3749 chromosome, complete genome	4654019	2689293	2800608	4654019	tRNA,terminase,head,tail,transposase,capsid,holin	Enterobacteria_phage(40.48%)	94	NA	NA
WP_014532194.1|2689293_2690640_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_000990151.1|2692737_2693415_+	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	29.7	3.4e-18
WP_000135439.1|2693488_2693755_+	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	4.0e-07
WP_000849301.1|2694019_2694280_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000443521.1|2694508_2695594_-	hydroxycarboxylate dehydrogenase HcXB	NA	NA	NA	NA	NA
WP_000386531.1|2695734_2696697_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_005048497.1|2696724_2698875_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	25.6	3.1e-41
WP_001145124.1|2698994_2699477_+	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.0	1.3e-35
WP_001296991.1|2701099_2701771_+	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000743444.1|2701773_2702769_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_000996107.1|2702761_2704498_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
WP_000070107.1|2704490_2705624_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000469031.1|2705634_2706741_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000871982.1|2706702_2707113_-	YbhQ family protein	NA	NA	NA	NA	NA
WP_001113348.1|2707245_2708007_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000650362.1|2708003_2709245_+	cardiolipin synthase ClsB	NA	NA	NA	NA	NA
WP_000045466.1|2709244_2710201_+	UPF0104 family protein	NA	NA	NA	NA	NA
WP_000446914.1|2710236_2710950_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000373626.1|2711154_2711859_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000852286.1|2711995_2712448_-	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
WP_000598624.1|2712449_2712695_-	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
WP_000080885.1|2712687_2713173_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_000084630.1|2713175_2713688_-	molybdenum cofactor biosynthesis protein B	NA	NA	NA	NA	NA
WP_005048531.1|2713709_2714699_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_005048534.1|2715095_2716004_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
WP_000042516.1|2716195_2718217_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_000044878.1|2718795_2719473_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000246759.1|2719465_2720221_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_000118810.1|2720207_2721362_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_000951226.1|2721358_2722399_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_005048541.1|2722485_2723775_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.6	6.5e-18
WP_000767391.1|2723833_2724310_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_000801162.1|2724892_2726656_+	invasion plasmid antigen	NA	NA	NA	NA	NA
WP_000551132.1|2726835_2727459_-	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	75.9	5.1e-77
WP_001230481.1|2728884_2729484_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	93.0	1.8e-103
WP_000515521.1|2729551_2733031_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	87.3	0.0e+00
WP_000090877.1|2733091_2733694_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	8.1e-88
WP_000194740.1|2733630_2734374_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.7	6.8e-145
WP_001152490.1|2734378_2735077_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	89.7	8.4e-121
WP_000447264.1|2735076_2735406_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	97.2	2.4e-57
WP_000371983.1|2735405_2738447_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	86.5	0.0e+00
WP_001161004.1|2738418_2738748_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	99.1	1.3e-55
WP_000478927.1|2738756_2739143_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	92.2	1.4e-61
WP_000211126.1|2739201_2739942_-	Ig-like domain-containing protein	NA	A5LH35	Enterobacteria_phage	96.7	1.5e-128
WP_001079407.1|2739952_2740354_-|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	94.0	1.1e-69
WP_000677140.1|2740350_2740935_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	87.6	6.0e-88
WP_000348593.1|2740921_2741299_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	57.3	2.5e-31
WP_000201488.1|2741310_2741697_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000522647.1|2741748_2742777_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	62.8	1.8e-116
WP_000256794.1|2742834_2743182_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	55.9	8.3e-21
WP_001254019.1|2743218_2744724_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.0	4.3e-98
WP_000259004.1|2746303_2746507_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	57.4	8.6e-10
WP_005049594.1|2746507_2748418_-|terminase	phage terminase large subunit family protein	terminase	K7P6G6	Enterobacteria_phage	63.9	4.9e-248
WP_094081532.1|2748740_2749897_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	8.9e-67
WP_128567432.1|2749948_2750143_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	100.0	2.5e-27
WP_001274722.1|2750359_2750893_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	98.3	1.6e-100
WP_005083349.1|2750958_2751588_-	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	57.6	4.7e-30
WP_000839566.1|2751591_2751807_-|holin	class II holin family protein	holin	M1FN85	Enterobacteria_phage	94.4	2.2e-32
WP_001204832.1|2752609_2752990_-	antitermination protein	NA	A0A088CD47	Shigella_phage	87.9	8.2e-62
WP_000111769.1|2752982_2753183_-	protein ninH	NA	A0A088CC23	Shigella_phage	74.2	1.1e-20
WP_001064799.1|2753277_2753535_-	hypothetical protein	NA	Q8W639	Enterobacteria_phage	93.8	1.1e-33
WP_000211324.1|2753531_2754923_-	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	95.7	3.6e-256
WP_000988183.1|2754919_2755798_-	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	95.6	3.0e-139
WP_000747032.1|2755815_2756984_-|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	100.0	1.8e-184
WP_000194508.1|2757885_2759319_+	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.0	5.9e-28
WP_000362338.1|2759326_2760385_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000426457.1|2760788_2762117_+	D-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_001018726.1|2762224_2763763_-	multidrug efflux MFS transporter permease subunit EmrY	NA	NA	NA	NA	NA
WP_000435187.1|2763762_2764926_-	multidrug efflux MFS transporter periplasmic adaptor subunit EmrK	NA	NA	NA	NA	NA
WP_000991370.1|2765341_2765956_+	acid-sensing system DNA-binding response regulator EvgA	NA	NA	NA	NA	NA
WP_011069458.1|2765960_2769554_+	acid-sensing system histidine kinase EvgS	NA	W8CYM9	Bacillus_phage	40.0	1.1e-09
WP_005047065.1|2769609_2770755_-	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_000955028.1|2770828_2771773_-	transporter YfdV	NA	NA	NA	NA	NA
WP_001283471.1|2771842_2773537_-	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	8.0e-24
WP_000106759.1|2773590_2774841_-	formyl-CoA transferase	NA	NA	NA	NA	NA
WP_000825597.1|2775353_2775977_-	YfdX family protein	NA	NA	NA	NA	NA
WP_000867638.1|2776273_2776549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000639883.1|2776625_2776868_-	YfdY family protein	NA	NA	NA	NA	NA
WP_000484404.1|2777220_2778141_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	4.9e-76
WP_010723117.1|2778495_2778567_+	membrane protein YpdK	NA	NA	NA	NA	NA
WP_000785918.1|2778631_2779870_-	alanine transaminase	NA	NA	NA	NA	NA
WP_001295458.1|2781747_2782482_+	two-component system response regulator YpdB	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
WP_000955858.1|2783354_2785850_-	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_000366006.1|2785874_2786912_-	aminopeptidase	NA	NA	NA	NA	NA
WP_000985333.1|2788009_2789257_-	PTS fructose transporter subunit IIC	NA	NA	NA	NA	NA
WP_005047083.1|2789278_2789605_-	fructose-like phosphotransferase enzyme IIB component 1	NA	NA	NA	NA	NA
WP_000170347.1|2789823_2790789_-	glucokinase	NA	NA	NA	NA	NA
WP_000903159.1|2790992_2792249_+	ion channel protein	NA	NA	NA	NA	NA
WP_000490072.1|2792363_2792690_+	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_000186375.1|2792830_2794069_-	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_005085424.1|2794404_2795607_+	nucleoside permease NupC	NA	NA	NA	NA	NA
WP_001296278.1|2798402_2798747_+	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_005088980.1|2798769_2799141_+	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000695655.1|2799192_2800608_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 15
NZ_CP034931	Shigella flexneri strain 2013C-3749 chromosome, complete genome	4654019	2894572	2902041	4654019	transposase	Escherichia_phage(66.67%)	7	NA	NA
WP_094081509.1|2894572_2895728_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	5.2e-67
WP_000017552.1|2897088_2897241_-	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
WP_000076001.1|2897258_2897450_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_000975306.1|2897760_2898279_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	6.5e-62
WP_000755178.1|2898294_2898834_+	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	98.9	1.4e-43
WP_000138258.1|2898928_2900506_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_001299507.1|2900574_2902041_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
>prophage 16
NZ_CP034931	Shigella flexneri strain 2013C-3749 chromosome, complete genome	4654019	2966952	2974193	4654019	tail,transposase	Enterobacteria_phage(33.33%)	6	NA	NA
WP_061440221.1|2966952_2968389_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q8W611	Enterobacteria_phage	53.8	1.3e-75
WP_000902877.1|2968412_2968958_-|tail	tail fiber assembly protein	tail	Q8W612	Enterobacteria_phage	73.1	2.5e-72
WP_011069472.1|2968960_2969479_-	hypothetical protein	NA	Q7Y4D4	Escherichia_virus	53.0	3.5e-39
WP_167389526.1|2969542_2970770_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	6.5e-177
WP_001181756.1|2971668_2972274_-	DUF2612 domain-containing protein	NA	H9C0Y0	Aeromonas_phage	43.8	1.2e-30
WP_094085562.1|2973037_2974193_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	5.2e-67
>prophage 17
NZ_CP034931	Shigella flexneri strain 2013C-3749 chromosome, complete genome	4654019	3109465	3117259	4654019	transposase	Pseudomonas_phage(50.0%)	6	NA	NA
WP_005051483.1|3109465_3110233_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	4.8e-69
WP_094085512.1|3111618_3112729_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.9	8.0e-65
WP_094081518.1|3112791_3113947_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.4	2.0e-66
WP_001192434.1|3114181_3116278_-|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A2D1GNK9	Pseudomonas_phage	48.7	1.2e-173
WP_001249841.1|3116279_3116531_-	helix-turn-helix domain-containing protein	NA	A0A2D1GNH1	Pseudomonas_phage	53.0	1.1e-17
WP_001224024.1|3116695_3117259_+	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	55.8	1.1e-35
>prophage 18
NZ_CP034931	Shigella flexneri strain 2013C-3749 chromosome, complete genome	4654019	3300024	3358922	4654019	transposase,integrase,protease,tRNA	Enterobacteria_phage(33.33%)	41	3306690:3306705	3351822:3351837
WP_005051759.1|3300024_3300783_+|protease	metalloprotease LoiP	protease	NA	NA	NA	NA
WP_000105566.1|3300988_3301909_-	agmatinase	NA	NA	NA	NA	NA
WP_005096955.1|3303288_3305265_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_005051767.1|3305273_3305405_-	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_011110620.1|3305540_3305756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001062128.1|3306059_3307214_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
3306690:3306705	attL	ATTCTGCCCGCTGAAT	NA	NA	NA	NA
WP_001112298.1|3307650_3309045_+	galactose/proton symporter	NA	NA	NA	NA	NA
WP_005051770.1|3309121_3309619_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_000286517.1|3309713_3310421_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001222509.1|3310500_3311232_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593267.1|3311244_3312195_+	glutathione synthase	NA	NA	NA	NA	NA
WP_001053178.1|3312303_3312867_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017111.1|3312866_3313283_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001055626.1|3313458_3314439_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997800.1|3314456_3315161_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094817.1|3315178_3315745_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_001277222.1|3315741_3316032_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174735.1|3316039_3316633_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_000239924.1|3316625_3317762_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000577041.1|3319083_3319587_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_000378934.1|3320350_3321652_+	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_000745204.1|3321752_3322715_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000394115.1|3322831_3323878_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984792.1|3324053_3324773_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001107556.1|3324956_3325283_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786911.1|3325282_3326002_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_004972828.1|3326162_3327215_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091700.1|3327242_3327518_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_005064048.1|3327582_3328662_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001049791.1|3328863_3330120_+	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_005085661.1|3330168_3332304_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234511.1|3332701_3333409_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001218804.1|3333787_3335050_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.3	9.3e-78
WP_000344102.1|3335502_3339018_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_001034110.1|3341488_3345346_+|protease	serine protease autotransporter toxin SigA	protease	Q9LA58	Enterobacterial_phage	38.3	2.4e-225
WP_000291751.1|3345392_3345974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001045650.1|3348788_3352907_-|protease	serine protease autotransporter toxin Pic	protease	Q9LA54	Enterobacteria_phage	45.8	0.0e+00
3351822:3351837	attR	ATTCTGCCCGCTGAAT	NA	NA	NA	NA
WP_001189111.1|3353634_3355143_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_001013320.1|3356837_3357263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000271035.1|3357259_3357643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000747032.1|3357754_3358922_+|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	100.0	1.8e-184
>prophage 19
NZ_CP034931	Shigella flexneri strain 2013C-3749 chromosome, complete genome	4654019	4181461	4223927	4654019	transposase,integrase,tRNA	Acinetobacter_phage(14.29%)	36	4189077:4189091	4203133:4203147
WP_094081529.1|4181461_4182617_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	3.4e-66
WP_000665246.1|4182658_4183615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094081542.1|4184793_4186021_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	2.9e-177
WP_000827814.1|4186787_4187360_-	long polar fimbria major subunit LpfA-O113	NA	NA	NA	NA	NA
WP_005086215.1|4187651_4188998_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
4189077:4189091	attL	GCTGTGGGCGGACAA	NA	NA	NA	NA
WP_001353740.1|4189587_4189827_+	DUF1819 family protein	NA	NA	NA	NA	NA
WP_000777554.1|4191323_4191797_+	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	A0A140HLG8	Bacillus_phage	34.4	1.6e-19
WP_000704156.1|4191891_4192416_+	streptothricin N-acetyltransferase Sat2	NA	E4ZFP7	Streptococcus_phage	38.9	4.2e-16
WP_001206315.1|4192473_4193262_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_001444089.1|4193337_4193835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000119696.1|4193895_4194267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001271300.1|4194676_4195054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000251878.1|4195284_4196901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001243518.1|4196901_4198428_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001276994.1|4198430_4200098_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000267723.1|4200094_4202203_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001029679.1|4202189_4203011_-	TnsA endonuclease N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_000334086.1|4203172_4205002_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.2	5.6e-132
4203133:4203147	attR	TTGTCCGCCCACAGC	NA	NA	NA	NA
WP_000933743.1|4205163_4206534_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	3.1e-34
WP_001251965.1|4206884_4207304_-	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_000190506.1|4207324_4208707_-	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_000896498.1|4208733_4209597_-	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_001176745.1|4209647_4211189_-	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_001288593.1|4211201_4211735_-	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_001052219.1|4211749_4212220_-	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_000429386.1|4212281_4212521_-	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_000135623.1|4212567_4213383_-	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_000116695.1|4213391_4213772_-	F0F1 ATP synthase subunit I	NA	NA	NA	NA	NA
WP_000932839.1|4214388_4215012_-	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_000499813.1|4215075_4216965_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_000763760.1|4217343_4217787_-	FMN-binding protein MioC	NA	NA	NA	NA	NA
WP_000432970.1|4217876_4218335_-	transcriptional regulator AsnC	NA	NA	NA	NA	NA
WP_000845131.1|4218486_4219479_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	38.0	3.4e-51
WP_000956622.1|4219483_4220935_-	ATPase RavA stimulator ViaA	NA	NA	NA	NA	NA
WP_005051985.1|4220928_4222425_-	ATPase RavA	NA	NA	NA	NA	NA
WP_000483773.1|4222580_4223927_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP034932	Shigella flexneri strain 2013C-3749 plasmid p2013C-3749-1, complete sequence	71053	0	14960	71053	transposase	Escherichia_phage(75.0%)	15	NA	NA
WP_000170695.1|524_1886_-	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_000218642.1|1937_2168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001027493.1|3205_3397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000271762.1|3393_3816_-	DUF1380 family protein	NA	NA	NA	NA	NA
WP_001198928.1|3862_4288_-	antirestriction protein	NA	NA	NA	NA	NA
WP_011161242.1|4260_4833_-	YubH family protein	NA	NA	NA	NA	NA
WP_000274503.1|5532_5967_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001104881.1|5980_6202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000085883.1|6202_6886_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	5.6e-29
WP_032146011.1|6962_7256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000959884.1|7402_8365_+	plasmid segregation protein ParM	NA	A0A222YXF2	Escherichia_phage	53.9	4.1e-94
WP_000361389.1|8367_8718_+	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_001333089.1|8840_9122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|11063_11768_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001067855.1|14255_14960_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 2
NZ_CP034932	Shigella flexneri strain 2013C-3749 plasmid p2013C-3749-1, complete sequence	71053	18307	20220	71053	transposase	Streptococcus_phage(66.67%)	4	NA	NA
WP_170852050.1|18307_18478_-	rRNA adenine methyltransferase	NA	E4ZFP9	Streptococcus_phage	92.7	3.4e-20
WP_013362818.1|18422_19160_-	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(B)	NA	E4ZFQ0	Streptococcus_phage	99.6	6.3e-135
WP_013362819.1|19285_19381_-	23S rRNA methyltransferase attenuation leader peptide	NA	NA	NA	NA	NA
WP_001067855.1|19515_20220_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 3
NZ_CP034932	Shigella flexneri strain 2013C-3749 plasmid p2013C-3749-1, complete sequence	71053	26345	29721	71053		Moraxella_phage(33.33%)	5	NA	NA
WP_001233838.1|26345_26807_-	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.1	4.2e-20
WP_001309245.1|27051_27264_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000139323.1|27392_27953_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_000704523.1|28055_28916_-	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.5	1.9e-10
WP_000205725.1|28974_29721_-	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.8	2.4e-09
>prophage 4
NZ_CP034932	Shigella flexneri strain 2013C-3749 plasmid p2013C-3749-1, complete sequence	71053	55385	55607	71053		Vibrio_virus(100.0%)	1	NA	NA
WP_001278683.1|55385_55607_-	conjugal transfer protein TraR	NA	A2I309	Vibrio_virus	40.8	5.7e-07
>prophage 5
NZ_CP034932	Shigella flexneri strain 2013C-3749 plasmid p2013C-3749-1, complete sequence	71053	63422	64244	71053		Yersinia_phage(100.0%)	1	NA	NA
WP_001234445.1|63422_64244_-	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.2	3.4e-44
>prophage 6
NZ_CP034932	Shigella flexneri strain 2013C-3749 plasmid p2013C-3749-1, complete sequence	71053	69597	70125	71053		Xanthomonas_phage(100.0%)	1	NA	NA
WP_000290834.1|69597_70125_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	74.4	6.0e-47
>prophage 1
NZ_CP034933	Shigella flexneri strain 2013C-3749 plasmid p2013C-3749-2, complete sequence	223405	20953	84800	223405	transposase,protease	Stx2-converting_phage(30.0%)	33	NA	NA
WP_005059304.1|20953_21733_-|protease	type III secretion system effector cysteine protease IpaJ	protease	NA	NA	NA	NA
WP_000255980.1|23085_24090_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	97.8	2.0e-184
WP_005119583.1|24281_25478_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_015683184.1|29049_30504_-	T3SS effector OspC family protein	NA	NA	NA	NA	NA
WP_004967157.1|31075_31750_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	2.0e-10
WP_005048975.1|31746_32097_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	68.7	3.5e-27
WP_005063916.1|32093_33695_+|transposase	IS66-like element ISSfl3 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	61.6	1.2e-146
WP_001346193.1|33948_34113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011114751.1|35014_35299_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_000501974.1|35286_35772_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_094085527.1|36292_37448_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	5.2e-67
WP_094081497.1|37518_38791_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	1.5e-176
WP_000502854.1|38957_39596_+	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	50.0	1.2e-52
WP_005085088.1|40242_41439_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_167389526.1|41692_42921_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	6.5e-177
WP_005038443.1|43025_43499_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_094085526.1|43587_44452_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	47.7	6.7e-19
WP_001026857.1|45792_47205_+	type 3 secretion system effector OspC1	NA	NA	NA	NA	NA
WP_024259347.1|47533_49231_+	type III secretion system effector OspD3	NA	NA	NA	NA	NA
WP_000019158.1|49633_49906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072056208.1|51469_52168_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.1	7.3e-125
WP_000051931.1|54776_56141_-	MFS transporter	NA	NA	NA	NA	NA
WP_010921638.1|58404_60129_-	T3SS effector E3 ubiquitin-protein ligase IpaH4.5	NA	NA	NA	NA	NA
WP_064203851.1|60556_62254_-	T3SS effector E3 ubiquitin-protein ligase IpaH7.8	NA	NA	NA	NA	NA
WP_004998488.1|63662_64694_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_000957853.1|67037_67226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000701108.1|75271_76726_+	type 3 secretion system effector OspC2	NA	NA	NA	NA	NA
WP_000198552.1|77174_78383_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000019158.1|78363_78636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010921625.1|78907_79210_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_000405245.1|79200_79683_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000597733.1|81576_83268_-	E3 ubiquitin-protein ligase ipaH3	NA	NA	NA	NA	NA
WP_005085088.1|83603_84800_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP034933	Shigella flexneri strain 2013C-3749 plasmid p2013C-3749-2, complete sequence	223405	99447	173461	223405	tRNA,transposase,protease	Acinetobacter_phage(36.36%)	51	NA	NA
WP_005064872.1|99447_100641_+|transposase	IS4-like element ISSfl1 family transposase	transposase	S5FM71	Shigella_phage	62.5	2.0e-138
WP_000901798.1|103211_103778_-	type III secretion effector IpgB2	NA	NA	NA	NA	NA
WP_011114726.1|104059_104374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000026470.1|104885_105563_-	type 3 secretion system effector OspD1	NA	NA	NA	NA	NA
WP_000622998.1|108452_108800_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	74.8	9.8e-46
WP_011587243.1|109243_110590_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_000338649.1|111047_111233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000868563.1|112554_113133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001121867.1|114164_114884_+	type III secretion system effector phosphothreonine lyase	NA	NA	NA	NA	NA
WP_005061014.1|115315_117025_+	ShET2/EspL2 family type III secretion system effector toxin	NA	NA	NA	NA	NA
WP_094085530.1|117196_118352_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	3.4e-66
WP_000261567.1|118364_118715_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	37.0	2.8e-08
WP_000850662.1|121348_122089_-	PAP2 family phosphatase PhoN2	NA	A0A1B1IUP6	uncultured_Mediterranean_phage	28.4	7.5e-11
WP_001046939.1|122417_123284_-	type 3 secretion system effector OspB	NA	A0A0P0ZCT1	Stx2-converting_phage	32.7	9.4e-29
WP_005061047.1|124830_125778_-|protease	omptin family outer membrane protease IcsP	protease	NA	NA	NA	NA
WP_011378983.1|126739_126877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148936977.1|128286_129515_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	1.5e-176
WP_011114782.1|131604_131757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000957716.1|132404_132671_+	type 3 secretion system effector OspE1	NA	NA	NA	NA	NA
WP_000597731.1|133060_134788_+	T3SS effector E3 ubiquitin-protein ligase IpaH1.4	NA	NA	NA	NA	NA
WP_000957853.1|135118_135307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094092433.1|135316_136511_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000829592.1|136741_136933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000130973.1|137633_138491_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001365705.1|138483_138558_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000083819.1|138781_139042_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_000766818.1|139281_139872_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_001299729.1|139910_140120_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_094081574.1|140454_141610_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	3.4e-66
WP_004971339.1|142137_142350_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000139368.1|142480_143041_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_000205722.1|143095_143842_-	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	32.0	5.4e-09
WP_005087747.1|148743_149115_-	conjugative relaxase	NA	NA	NA	NA	NA
WP_000450531.1|149196_149424_+	toxin-antitoxin system antitoxin VapB	NA	NA	NA	NA	NA
WP_000911311.1|149423_149822_+|tRNA	tRNA(fMet)-specific endonuclease VapC	tRNA	NA	NA	NA	NA
WP_094081572.1|150054_151210_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	5.2e-67
WP_004996485.1|152332_153277_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_015683210.1|153341_154292_-	virulence factor VirK	NA	NA	NA	NA	NA
WP_010921719.1|154296_155385_-	putative hexosyltransferase CapU	NA	NA	NA	NA	NA
WP_000931197.1|155387_156230_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_004996477.1|156593_156710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162284499.1|156712_159625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064753708.1|161517_162837_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_000705601.1|163522_164113_-	type III secretion system effector protein kinase OspG	NA	NA	NA	NA	NA
WP_000936806.1|164841_166479_-	T3SS effector E3 ubiquitin-protein ligase IpaH9.8	NA	NA	NA	NA	NA
WP_023592908.1|166740_166848_-|transposase	transposase domain-containing protein	transposase	NA	NA	NA	NA
WP_001159860.1|166871_167177_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000813626.1|167178_167397_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_000421262.1|169864_170140_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011114774.1|170139_170424_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_011110603.1|171859_173461_-|transposase	IS66-like element ISSfl3 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	61.6	1.1e-147
