The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP039819	Klebsiella pneumoniae strain C2414 chromosome, complete genome	5588118	12647	69269	5588118	integrase,transposase	Escherichia_phage(23.81%)	45	NA	NA
WP_000019473.1|12647_13628_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_073547085.1|13685_14288_+	galactonate dehydratase	NA	NA	NA	NA	NA
WP_021440944.1|14465_15803_+	MFS transporter	NA	NA	NA	NA	NA
WP_004151525.1|15854_17075_+	DUF3748 domain-containing protein	NA	NA	NA	NA	NA
WP_004151524.1|17076_17409_-	YceK/YidQ family lipoprotein	NA	NA	NA	NA	NA
WP_004151523.1|17723_18137_+	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
WP_004145074.1|18253_18682_+	heat shock chaperone IbpB	NA	A0A2H4N7P1	Lake_Baikal_phage	41.1	2.6e-16
WP_001067855.1|19346_20051_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001535719.1|20117_21515_+	HAMP domain-containing protein	NA	A0A1B0V854	Salmonella_phage	99.2	1.1e-58
WP_019725138.1|21662_22310_-	DNA polymerase V subunit UmuC	NA	A0A1W6JNT0	Morganella_phage	51.2	8.8e-48
WP_012477564.1|22373_22964_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_001493762.1|23100_23673_+	recombinase family protein	NA	A0JC18	Ralstonia_phage	38.5	9.9e-19
WP_014839878.1|23709_25101_+|transposase	ISKra4-like element ISKpn19 family transposase	transposase	NA	NA	NA	NA
WP_001516695.1|25880_26537_-	quinolone resistance pentapeptide repeat protein QnrS1	NA	NA	NA	NA	NA
WP_012477595.1|28133_28991_-	class A beta-lactamase LAP-2	NA	Q1MVP3	Enterobacteria_phage	61.1	2.0e-92
WP_107318696.1|29055_30357_-	cell division protein FtsI	NA	NA	NA	NA	NA
WP_001067855.1|30479_31184_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_014837927.1|31220_32348_-	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_000248278.1|32398_32626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000951934.1|32649_32841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000587837.1|33322_33865_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000557454.1|33877_34738_-	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_001067855.1|35809_36514_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004118473.1|36677_36995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152754.1|37029_37284_-	hypothetical protein	NA	G8C7V1	Escherichia_phage	51.2	1.6e-13
WP_004118478.1|37520_37946_-	antirestriction protein	NA	NA	NA	NA	NA
WP_004118481.1|38465_38696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162224963.1|38929_40441_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	32.2	1.4e-24
WP_004182047.1|40842_41268_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	50.4	2.9e-31
WP_023157784.1|41267_42539_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.0	1.5e-155
WP_004182043.1|42617_42869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000037308.1|43113_45066_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_004182042.1|45062_46343_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_004182039.1|50942_51914_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.3	9.2e-150
WP_004182032.1|51913_53080_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.4	4.0e-224
WP_004182030.1|53831_54842_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	54.3	3.0e-87
WP_020324066.1|55559_56300_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	7.0e-25
WP_004182028.1|57443_58391_+	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
WP_071527918.1|58417_58729_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_068814619.1|58748_59717_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.4	8.7e-185
WP_004197688.1|60389_60647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080895248.1|61265_62702_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004152070.1|63684_64962_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_004178088.1|65024_67022_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
WP_087530333.1|68061_69269_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	4.4e-101
>prophage 2
NZ_CP039819	Klebsiella pneumoniae strain C2414 chromosome, complete genome	5588118	104252	111636	5588118		Escherichia_phage(66.67%)	8	NA	NA
WP_003031541.1|104252_105455_-	hypothetical protein	NA	A0A222YXT1	Escherichia_phage	63.6	3.9e-126
WP_004118613.1|105447_105777_-	hypothetical protein	NA	A0A222YYR0	Escherichia_phage	65.1	6.7e-36
WP_000611681.1|105773_106295_-	hypothetical protein	NA	A0A222YZ79	Escherichia_phage	53.8	6.4e-49
WP_077253206.1|106856_107213_-	recombination enhancement function domain protein	NA	Q71TG3	Escherichia_phage	65.2	4.2e-36
WP_001114073.1|107765_108119_+	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.0	4.1e-23
WP_020324593.1|108166_108529_+	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_001556710.1|108546_110298_+	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_000922630.1|110346_111636_+	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	2.5e-171
>prophage 3
NZ_CP039819	Klebsiella pneumoniae strain C2414 chromosome, complete genome	5588118	121784	159572	5588118	integrase,transposase	Escherichia_phage(56.25%)	42	121721:121780	153325:154145
121721:121780	attL	GGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCT	NA	NA	NA	NA
WP_001067855.1|121784_122489_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000427619.1|122903_123908_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_087833528.1|126178_126400_-	antirestriction protein	NA	NA	NA	NA	NA
WP_032440563.1|126713_126944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004187354.1|127041_127380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032440562.1|127569_128430_-	DUF4942 domain-containing protein	NA	A0A1J0GUW2	Halomonas_phage	26.6	8.2e-17
WP_023285836.1|128502_128682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023285835.1|129324_129591_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_032440561.1|129635_130085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032440560.1|130202_130700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032440579.1|130692_130938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032440559.1|131379_131823_-	plasmid stability family protein	NA	NA	NA	NA	NA
WP_032440558.1|131825_132800_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	51.7	7.2e-86
WP_086556681.1|133040_133718_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	51.6	8.7e-22
WP_032440556.1|133847_134333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032440555.1|134417_134666_-	helix-turn-helix transcriptional regulator	NA	A0A248SLB9	Klebsiella_phage	51.5	1.6e-10
WP_032440554.1|135450_136509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032440553.1|136501_136711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015344981.1|136782_137067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032440552.1|137206_137848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000493286.1|138083_138413_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2I6TCA4	Escherichia_phage	43.1	3.1e-17
WP_000780222.1|138393_138675_+	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
WP_001351729.1|141142_141535_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000058717.1|141672_142557_+	EamA family transporter	NA	NA	NA	NA	NA
WP_000804064.1|142588_143788_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000164043.1|143893_144544_+	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000844627.1|144575_144818_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000777554.1|145020_145494_+	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	A0A140HLG8	Bacillus_phage	34.4	1.6e-19
WP_000679427.1|146197_146545_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|146538_147378_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000376623.1|147505_148006_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001389365.1|148512_149277_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001137892.1|149769_150354_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|150353_151592_-	MFS transporter	NA	NA	NA	NA	NA
WP_000219391.1|151588_152494_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067855.1|152615_153320_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|153470_154286_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
153325:154145	attR	AGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCCTCTGATGTTACATTGCACAAGATAAAAATATATCATCATGAACAATAAAACTGTCTGCTTACATAAACAGTAATACAAGGGGTGTTATGAGCCATATTCAACGGGAAACGTCTTGCTCGAGGCCGCGATTAAATTCCAACATGGATGCTGATTTATATGGGTATAAATGGGCTCGCGATAATGTCGGGCAATCAGGTGCGACAATCTATCGATTGTATGGGAAGCCCGATGCGCCAGAGTTGTTTCTGAAACATGGCAAAGGTAGCGTTGCCAATGATGTTACAGATGAGATGGTCAGACTAAACTGGCTGACGGAATTTATGCCTCTTCCGACCATCAAGCATTTTATCCGTACTCCTGATGATGCATGGTTACTCACCACTGCGATCCCCGGGAAAACAGCATTCCAGGTATTAGAAGAATATCCTGATTCAGGTGAAAATATTGTTGATGCGCTGGCAGTGTTCCTGCGCCGGTTGCATTCGATTCCTGTTTGTAATTGTCCTTTTAACAGCGATCGCGTATTTCGTCTCGCTCAGGCGCAATCACGAATGAATAACGGTTTGGTTGATGCGAGTGATTTTGATGACGAGCGTAATGGCTGGCCTGTTGAACAAGTCTGGAAAGAAATGCATAAGCTTTTGCCATTCTCACCGGATTCAGTCGTCACTCATGGTGATTTCTCACTTGATAACCTTATTTTTGACGAGGGGAAATTAATAGGTTGTATTGATGTTGGACGAGTCGGAATCGCAGACCGA	NA	NA	NA	NA
WP_001067855.1|154475_155180_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_053897648.1|155204_156761_+	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	99.4	1.1e-83
WP_002210513.1|157088_157850_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002904004.1|157870_158731_-	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_001067855.1|158867_159572_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 4
NZ_CP039819	Klebsiella pneumoniae strain C2414 chromosome, complete genome	5588118	590224	623482	5588118	integrase,portal,terminase,protease,tRNA,tail,head,capsid	uncultured_Caudovirales_phage(75.0%)	34	607832:607849	623827:623844
WP_002919147.1|590224_591172_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
WP_002919144.1|591186_591696_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
WP_002919139.1|591824_592949_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002919137.1|592920_593394_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_004145330.1|593419_593962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002919132.1|593966_594539_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_002919126.1|594542_595361_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_002919125.1|595357_595615_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_002919123.1|595590_596145_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002919103.1|601940_602162_-	membrane protein	NA	NA	NA	NA	NA
WP_002919102.1|602455_605566_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_002919101.1|605578_606718_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004150972.1|607096_607747_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
607832:607849	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
WP_004150971.1|608022_609249_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
WP_004150970.1|609341_610283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001547839.1|610464_610749_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004150969.1|610759_611539_+	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
WP_157263200.1|612041_612260_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	1.4e-34
WP_001549752.1|612252_612441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004218267.1|612517_612646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|612744_613113_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_001549749.1|613109_613475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|613474_615610_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_004150964.1|615952_616288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150963.1|616336_616849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549743.1|617112_618279_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_001547826.1|618330_618891_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_004150962.1|618892_620134_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_004150961.1|620130_620466_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_001547824.1|620462_620762_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150959.1|620761_621205_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_004150957.1|621197_621350_+	hypothetical protein	NA	A0A2H4JCY9	uncultured_Caudovirales_phage	88.0	2.4e-17
WP_000113647.1|621480_621837_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150955.1|621820_623482_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
623827:623844	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
>prophage 5
NZ_CP039819	Klebsiella pneumoniae strain C2414 chromosome, complete genome	5588118	1380982	1430126	5588118	integrase,plate,portal,terminase,coat,transposase,tRNA,tail,lysis,head,capsid	Salmonella_phage(80.0%)	63	1368417:1368434	1409660:1409677
1368417:1368434	attL	CGGCAAAGAGGCGGGCGA	NA	NA	NA	NA
WP_000019445.1|1380982_1381963_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
WP_062955148.1|1382008_1383007_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	94.5	2.2e-183
WP_004151019.1|1383009_1383639_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
WP_001397669.1|1383761_1384004_+	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
WP_004151018.1|1384036_1384546_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
WP_004151017.1|1384553_1384754_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	4.5e-19
WP_004144796.1|1384717_1385056_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
WP_004151016.1|1385123_1385357_+	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
WP_004151014.1|1385356_1385584_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
WP_004151013.1|1385580_1386432_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
WP_004151012.1|1386428_1388813_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.9	0.0e+00
WP_004178082.1|1389290_1390778_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004151011.1|1390885_1391074_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
WP_004151010.1|1391085_1391319_+	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	2.0e-34
WP_004151009.1|1391414_1392098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151008.1|1392084_1393164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107332018.1|1393163_1394165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024940854.1|1394686_1394956_+	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.3	1.4e-15
WP_004151006.1|1395012_1396056_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
WP_019405037.1|1396055_1397819_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	91.8	0.0e+00
WP_004151004.1|1397959_1398793_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	77.6	4.4e-100
WP_004151003.1|1398809_1399862_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
WP_004134644.1|1399865_1400519_+|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
WP_004151002.1|1400614_1401079_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
WP_004151001.1|1401078_1401282_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	89.6	9.8e-30
WP_004134639.1|1401285_1401501_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
WP_004151000.1|1401481_1401991_+	lysozyme	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
WP_004150999.1|1401995_1402379_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
WP_004150998.1|1402375_1402804_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
WP_072093160.1|1402778_1402937_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	75.0	9.0e-15
WP_004150997.1|1402899_1403322_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
WP_004150996.1|1403314_1403761_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
WP_004150995.1|1403783_1404650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150994.1|1404744_1405317_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
WP_004150993.1|1405313_1405676_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
WP_004150992.1|1405662_1406571_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	68.9	1.9e-109
WP_004152935.1|1406563_1407235_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.9	3.2e-61
WP_004150990.1|1407236_1409186_+|coat	spore coat protein CotH	coat	Q6QI97	Burkholderia_phage	38.9	1.0e-06
WP_004200602.1|1409195_1410314_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	4.4e-55
1409660:1409677	attR	CGGCAAAGAGGCGGGCGA	NA	NA	NA	NA
WP_004150988.1|1410365_1411439_+|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
WP_004150987.1|1411587_1412760_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
WP_004150986.1|1412769_1413285_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
WP_004150985.1|1413337_1413637_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	78.0	8.2e-33
WP_002896220.1|1413651_1413771_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_072093161.1|1413997_1416394_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	44.5	8.1e-107
WP_004150983.1|1416390_1416876_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	5.2e-61
WP_004150982.1|1416872_1417967_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	83.6	2.4e-170
WP_004150981.1|1418033_1418252_+	positive regulator of late gene transcription	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
WP_004150980.1|1418279_1418657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914164.1|1419260_1419743_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
WP_004188817.1|1419853_1420330_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_002914161.1|1420319_1420610_+	RnfH family protein	NA	NA	NA	NA	NA
WP_002914160.1|1420676_1421018_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_004145681.1|1420999_1421140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914159.1|1421165_1422827_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002914158.1|1422913_1423792_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_002914155.1|1423916_1424507_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_004149392.1|1424626_1425913_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914153.1|1425932_1426724_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_002914152.1|1426887_1428252_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914149.1|1428511_1428760_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_004150977.1|1428778_1429327_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914147.1|1429358_1430126_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP039819	Klebsiella pneumoniae strain C2414 chromosome, complete genome	5588118	1534842	1588651	5588118	integrase,terminase,transposase,holin,tail	Salmonella_phage(40.38%)	60	1528177:1528191	1558282:1558296
1528177:1528191	attL	TGAGCAGGTTCGCGA	NA	NA	NA	NA
WP_004151980.1|1534842_1536309_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
WP_004151979.1|1536376_1537954_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_062955102.1|1538145_1539396_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9TCT6	Enterobacter_phage	84.4	5.8e-205
WP_063002073.1|1539338_1539581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197356.1|1539577_1540171_-	MT-A70 family protein	NA	T1SA14	Salmonella_phage	91.9	6.3e-109
WP_062955103.1|1540167_1540830_-	hypothetical protein	NA	A0A059VF56	Pseudomonas_phage	46.6	1.2e-47
WP_048264082.1|1540826_1540985_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	78.8	1.1e-17
WP_009485475.1|1540977_1541271_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	4.0e-32
WP_062955104.1|1541380_1541629_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	76.8	4.9e-31
WP_062955105.1|1541677_1542559_-	recombinase RecT	NA	T1SBJ5	Salmonella_phage	84.3	8.9e-136
WP_062955106.1|1542555_1543377_-	exodeoxyribonuclease VIII	NA	A0A193GYK2	Enterobacter_phage	80.2	1.8e-130
WP_004164029.1|1543373_1543673_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	2.1e-20
WP_004144290.1|1544039_1544621_-	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.3	7.1e-65
WP_004152538.1|1544775_1545009_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
WP_004152537.1|1545155_1545365_+	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
WP_004207253.1|1545364_1546132_+	hypothetical protein	NA	A0A193GZ86	Enterobacter_phage	91.4	8.9e-140
WP_032418532.1|1546128_1546914_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.7	3.7e-133
WP_048328152.1|1547033_1547381_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	82.6	6.5e-50
WP_062955107.1|1547573_1547984_+	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	45.1	4.3e-16
WP_032441402.1|1547967_1548159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032441401.1|1548155_1548800_+	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	79.3	8.0e-110
WP_072200041.1|1549093_1549561_+	hypothetical protein	NA	A0A2R2Z312	Escherichia_phage	51.7	1.3e-37
WP_029602865.1|1549560_1549854_+	hypothetical protein	NA	Q6UAT9	Klebsiella_phage	86.6	2.7e-44
WP_050491799.1|1549850_1550471_+	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	40.7	1.0e-29
WP_032441458.1|1550470_1550674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023339258.1|1550666_1551005_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.0	1.8e-44
WP_004178082.1|1551101_1552589_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_032418540.1|1552989_1553247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032441400.1|1553324_1553909_+|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.6	2.2e-90
WP_062955142.1|1553905_1555381_+	hypothetical protein	NA	Q858H3	Salmonella_phage	93.1	6.4e-280
WP_004200550.1|1555424_1555796_-	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	91.9	3.7e-59
WP_004141368.1|1556549_1556756_+	hypothetical protein	NA	T1SA67	Salmonella_phage	88.2	4.8e-08
WP_032441398.1|1556770_1558453_+|tail	tail protein	tail	A0A0F6TJD8	Escherichia_coli_O157_typing_phage	84.4	1.5e-264
1558282:1558296	attR	TGAGCAGGTTCGCGA	NA	NA	NA	NA
WP_004152446.1|1558449_1558746_+	hypothetical protein	NA	T1SBI9	Salmonella_phage	70.4	1.2e-33
WP_032441397.1|1558748_1559429_+	peptidase	NA	G9L6C4	Escherichia_phage	84.0	6.1e-76
WP_004200546.1|1559443_1560430_+	hypothetical protein	NA	A0A193GZ49	Enterobacter_phage	94.2	2.5e-179
WP_020953461.1|1560483_1560921_+	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	91.7	1.3e-66
WP_062955141.1|1560931_1561273_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	70.8	2.4e-36
WP_004152441.1|1561323_1561647_+	hypothetical protein	NA	G9L6C8	Escherichia_phage	85.0	5.3e-46
WP_062955139.1|1561646_1562252_+	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	77.0	4.0e-87
WP_062955138.1|1562251_1564729_+	hypothetical protein	NA	Q858G3	Salmonella_phage	84.4	0.0e+00
WP_004152438.1|1564728_1565193_+	hypothetical protein	NA	Q858G2	Salmonella_phage	81.2	1.5e-70
WP_032447858.1|1565192_1565732_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	80.0	8.0e-71
WP_062955137.1|1565742_1568277_+	hypothetical protein	NA	Q858G0	Salmonella_phage	84.1	0.0e+00
WP_062955136.1|1568276_1570187_+	hypothetical protein	NA	Q858F9	Salmonella_phage	82.7	5.4e-287
WP_062955135.1|1570186_1572943_+	hypothetical protein	NA	Q858F8	Salmonella_phage	95.4	0.0e+00
WP_062955133.1|1573419_1573716_-	hypothetical protein	NA	T1SA06	Salmonella_phage	63.9	6.9e-24
WP_000019473.1|1575761_1576742_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_162224968.1|1576723_1577731_+	hypothetical protein	NA	A0A0A8J9B0	Klebsiella_phage	31.2	6.2e-16
WP_062955131.1|1577743_1578007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158208844.1|1578047_1578677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013362812.1|1578916_1579885_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	100.0	1.6e-186
WP_162224969.1|1579902_1580382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000608644.1|1581009_1582272_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_077265603.1|1583380_1584697_+	right-handed parallel beta-helix repeat-containing protein	NA	A0A0K2FI18	Enterobacter_phage	32.3	2.3e-34
WP_062955010.1|1584783_1585188_+	hypothetical protein	NA	T1SA79	Salmonella_phage	81.1	8.7e-54
WP_023339240.1|1585174_1585480_+|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	81.4	2.7e-39
WP_062955009.1|1585469_1586099_+	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	76.9	1.8e-90
WP_062955008.1|1586095_1586596_+	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	76.9	1.3e-59
WP_004152009.1|1586782_1588651_-	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
>prophage 7
NZ_CP039819	Klebsiella pneumoniae strain C2414 chromosome, complete genome	5588118	1918848	1925754	5588118	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004175147.1|1918848_1919712_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_004899467.1|1919722_1920496_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_004151134.1|1920737_1921634_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004144192.1|1921876_1923238_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004175198.1|1923556_1924279_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_062955084.1|1924275_1925754_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 8
NZ_CP039819	Klebsiella pneumoniae strain C2414 chromosome, complete genome	5588118	1967555	1983301	5588118		Enterobacteria_phage(33.33%)	16	NA	NA
WP_062955058.1|1967555_1968962_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	3.6e-38
WP_062955056.1|1969185_1970250_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.7	4.4e-105
WP_062956182.1|1970263_1971133_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.4	3.4e-111
WP_048996045.1|1971164_1972055_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	3.7e-28
WP_004175260.1|1972069_1972624_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.6	1.9e-51
WP_000704907.1|1972803_1973970_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	7.0e-112
WP_016947628.1|1974398_1974518_-	small membrane protein	NA	NA	NA	NA	NA
WP_001741931.1|1974708_1974849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062955151.1|1974918_1975923_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.2	4.0e-31
WP_073547076.1|1976762_1977827_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	2.6e-105
WP_063002077.1|1977840_1978710_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.0	5.7e-111
WP_048996045.1|1978741_1979632_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	3.7e-28
WP_015958693.1|1979646_1980201_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.6	1.9e-51
WP_015958692.1|1980287_1981118_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_062955124.1|1981146_1981980_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_062955125.1|1981969_1983301_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.1	6.9e-15
>prophage 9
NZ_CP039819	Klebsiella pneumoniae strain C2414 chromosome, complete genome	5588118	2953609	2963023	5588118		Escherichia_phage(87.5%)	9	NA	NA
WP_160463746.1|2953609_2955244_+	DUF4981 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	55.8	3.1e-182
WP_004151612.1|2955298_2956564_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|2956594_2957683_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_002904006.1|2957769_2958030_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_002904004.1|2958327_2959188_+	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|2959208_2959970_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004151610.1|2960230_2961133_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
WP_004151609.1|2961144_2962410_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
WP_002210516.1|2962402_2963023_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 10
NZ_CP039819	Klebsiella pneumoniae strain C2414 chromosome, complete genome	5588118	3189930	3228218	5588118	terminase,integrase	Klebsiella_phage(35.56%)	59	3222785:3222799	3228794:3228808
WP_014343022.1|3189930_3192954_-	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	44.7	1.6e-22
WP_004152577.1|3193009_3193207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004231602.1|3193181_3193313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004231600.1|3193433_3193598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152575.1|3194072_3194846_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
WP_004152574.1|3194842_3196039_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
WP_004152573.1|3196038_3196392_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152572.1|3196393_3197047_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004225248.1|3197100_3197451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004173705.1|3197703_3197889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152570.1|3197941_3198283_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
WP_004152569.1|3198282_3199305_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004217362.1|3199307_3199535_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	56.0	4.6e-20
WP_004225238.1|3199610_3200024_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	55.9	8.1e-31
WP_004152566.1|3200209_3202213_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004152565.1|3202202_3202355_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152564.1|3202390_3202816_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_004199809.1|3202819_3203260_-	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	80.1	3.3e-62
WP_004152177.1|3203270_3204416_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004152176.1|3204419_3204860_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_001116156.1|3204954_3205341_-	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_000834982.1|3205340_3205847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|3205843_3206263_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000725700.1|3206231_3206513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001132269.1|3206552_3207494_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
WP_000528476.1|3207505_3208000_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_004199270.1|3208003_3209206_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_004152174.1|3209257_3209806_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004152173.1|3209861_3211313_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_004152172.1|3211550_3212951_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
WP_004218030.1|3212901_3213390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152170.1|3213755_3214076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153952.1|3214310_3214700_-	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152169.1|3214696_3215227_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004146526.1|3215229_3215478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218026.1|3215495_3215624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152168.1|3215661_3215817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152167.1|3215883_3216666_-	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004198239.1|3216662_3217139_-	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004218023.1|3217135_3218113_-	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198228.1|3218099_3219758_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004152162.1|3220334_3220556_-	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004152161.1|3220653_3221322_+	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152160.1|3221492_3221807_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152159.1|3221799_3221988_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004218017.1|3222361_3222523_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	96.2	1.5e-20
WP_004152157.1|3222515_3222770_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
3222785:3222799	attL	AGGCGCTGCAGGTCC	NA	NA	NA	NA
WP_004146412.1|3222837_3222960_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	100.0	1.3e-16
WP_004152156.1|3222956_3223382_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004152155.1|3223378_3223573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152154.1|3223569_3224397_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152153.1|3224501_3225020_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
WP_004154298.1|3225025_3225736_+	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152151.1|3225725_3225950_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004218013.1|3226045_3226159_+	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	100.0	4.6e-13
WP_014343018.1|3226401_3226635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004198245.1|3226707_3226854_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	70.8	2.9e-15
WP_004152148.1|3226813_3227056_+	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004152147.1|3227036_3228218_-|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
3228794:3228808	attR	GGACCTGCAGCGCCT	NA	NA	NA	NA
>prophage 11
NZ_CP039819	Klebsiella pneumoniae strain C2414 chromosome, complete genome	5588118	3265671	3296715	5588118	integrase,holin,transposase	Enterobacteria_phage(35.48%)	42	3265453:3265468	3294021:3294036
3265453:3265468	attL	TATGCCCTACGATAGC	NA	NA	NA	NA
WP_002901815.1|3265671_3266343_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.6	4.5e-79
WP_071531199.1|3266529_3267357_+	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	30.2	8.4e-19
WP_002901813.1|3267432_3268698_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.7	9.6e-208
WP_002901812.1|3268699_3269119_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
WP_004178082.1|3269198_3270686_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004152776.1|3271580_3272003_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	3.6e-26
WP_001067855.1|3272595_3273300_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000679427.1|3273915_3274263_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001261740.1|3274426_3275218_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_001067855.1|3276199_3276904_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_062955100.1|3276940_3277228_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	95.4	4.4e-36
WP_004218565.1|3277224_3277764_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	3.3e-101
WP_024940884.1|3277760_3278060_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	100.0	4.5e-47
WP_004232548.1|3278709_3279399_-	antiterminator-like protein	NA	I6PDF8	Cronobacter_phage	53.1	2.1e-55
WP_004218534.1|3279398_3279539_-	YlcG family protein	NA	NA	NA	NA	NA
WP_004218533.1|3279535_3280174_-	hypothetical protein	NA	H6WRY9	Salmonella_phage	69.8	3.2e-74
WP_004218532.1|3280166_3280835_-	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	78.7	1.4e-104
WP_004243010.1|3280831_3280999_-	NinE family protein	NA	K7P7K0	Enterobacteria_phage	62.5	4.6e-09
WP_004218531.1|3280979_3281447_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	45.8	3.4e-33
WP_004243011.1|3281579_3281858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218530.1|3281967_3282996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196831.1|3283203_3283449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218528.1|3283504_3283807_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004201118.1|3283803_3284652_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	60.1	5.1e-88
WP_004201117.1|3284648_3285509_-	replication protein	NA	K7PGT1	Enterobacteria_phage	53.3	1.0e-59
WP_001548453.1|3285594_3285816_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004201115.1|3285856_3286084_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	77.1	1.4e-24
WP_004201113.1|3286195_3286894_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	84.1	3.7e-108
WP_004201109.1|3287181_3288258_+	ParA family protein	NA	H2BD62	Pseudomonas_phage	37.9	9.1e-58
WP_004201108.1|3288339_3288543_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	3.9e-18
WP_004219883.1|3288853_3288979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004135674.1|3288971_3289166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201105.1|3289254_3289539_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	1.1e-39
WP_004201103.1|3289554_3290400_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	1.8e-69
WP_088224434.1|3290396_3290684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201102.1|3290685_3291366_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	91.2	8.2e-121
WP_004151898.1|3291362_3291791_+	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	80.3	7.5e-64
WP_004151899.1|3291787_3292450_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	84.6	2.7e-105
WP_004151900.1|3292657_3293875_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	51.9	8.6e-121
WP_004151901.1|3294021_3294912_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
3294021:3294036	attR	TATGCCCTACGATAGC	NA	NA	NA	NA
WP_004140266.1|3294911_3295904_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004140269.1|3295905_3296715_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
>prophage 12
NZ_CP039819	Klebsiella pneumoniae strain C2414 chromosome, complete genome	5588118	3425453	3513332	5588118	integrase,portal,terminase,tRNA,tail,lysis,head,capsid	Klebsiella_phage(44.19%)	96	3452256:3452270	3511143:3511157
WP_002901088.1|3425453_3425954_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_002901080.1|3426070_3426517_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_004140469.1|3426500_3427295_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014343001.1|3427402_3428578_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004140471.1|3428609_3429302_-	CTP synthase	NA	NA	NA	NA	NA
WP_004150778.1|3429447_3429957_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_014343000.1|3429961_3430300_+	DUF488 family protein	NA	NA	NA	NA	NA
WP_004150780.1|3430289_3430529_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_004150781.1|3430829_3431843_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.4e-12
WP_004150782.1|3431900_3432002_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_099119317.1|3432001_3432076_+	protein YoaJ	NA	NA	NA	NA	NA
WP_004140488.1|3432193_3432319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140489.1|3432378_3432642_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004150783.1|3432772_3433411_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004148038.1|3433500_3434415_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
WP_014342999.1|3434876_3434996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150784.1|3435076_3436120_-	type II asparaginase	NA	NA	NA	NA	NA
WP_004150785.1|3436422_3437631_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_004150787.1|3437704_3439489_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
WP_004150788.1|3439495_3440386_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004140497.1|3440506_3442015_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_004150789.1|3442048_3442213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150790.1|3442325_3443012_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004140501.1|3443409_3443589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150791.1|3443628_3444261_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_004140506.1|3444827_3445025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140509.1|3445140_3446151_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_004150793.1|3446147_3447554_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_004140512.1|3447609_3448497_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_004140514.1|3448513_3449020_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004150794.1|3449046_3449541_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004150795.1|3449631_3449817_-	general stress protein	NA	NA	NA	NA	NA
WP_004140529.1|3450438_3451632_+	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004140530.1|3451744_3451972_+	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
WP_004225560.1|3452113_3452290_+	hypothetical protein	NA	NA	NA	NA	NA
3452256:3452270	attL	TGGCTGGCGTTCTTT	NA	NA	NA	NA
WP_004150797.1|3452408_3452732_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_004150798.1|3452724_3453117_+	amino acid-binding protein	NA	NA	NA	NA	NA
WP_004150799.1|3453113_3453827_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004892953.1|3454099_3454252_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	3.8e-18
WP_023328083.1|3454406_3455903_-|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	63.7	1.4e-125
WP_073547060.1|3455971_3468676_-	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	47.1	0.0e+00
WP_023328085.1|3468738_3469332_-|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	76.6	8.0e-80
WP_047666390.1|3469358_3469781_-	hypothetical protein	NA	J9Q806	Salmonella_phage	50.0	5.9e-29
WP_047666389.1|3469822_3470533_-	peptidase P60	NA	Q6UAW4	Klebsiella_phage	90.3	1.9e-136
WP_023328087.1|3470534_3471290_-|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	80.5	4.6e-125
WP_023328088.1|3471286_3471625_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	88.4	1.4e-57
WP_162224979.1|3471624_3474960_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	88.3	0.0e+00
WP_014228914.1|3475192_3475558_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
WP_023328090.1|3475615_3476077_-	hypothetical protein	NA	Q6UAX0	Klebsiella_phage	83.7	7.8e-67
WP_023328091.1|3476108_3476510_-	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	94.0	2.3e-62
WP_017880258.1|3476506_3476896_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	86.0	9.6e-58
WP_023328092.1|3476876_3477215_-|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	90.2	2.8e-53
WP_020317538.1|3477211_3477529_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	89.8	1.5e-45
WP_049010370.1|3477509_3477770_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	60.5	7.4e-22
WP_023328094.1|3477828_3479115_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	89.0	9.8e-216
WP_014907815.1|3479192_3480113_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	88.2	9.6e-149
WP_023279520.1|3480149_3481409_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	89.8	1.8e-222
WP_017898992.1|3481408_3481588_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	57.6	3.1e-11
WP_021462603.1|3481581_3483303_-|terminase	terminase large subunit	terminase	Q7Y413	Yersinia_phage	57.4	1.5e-190
WP_012542168.1|3483302_3483737_-|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.9	9.4e-30
WP_014907818.1|3483985_3484417_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	61.6	1.8e-41
WP_023297386.1|3484413_3484737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032428746.1|3484688_3485051_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	83.3	1.2e-57
WP_032749552.1|3485377_3485602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049115059.1|3485640_3486078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016160650.1|3487027_3487378_-	hypothetical protein	NA	R9TPM9	Aeromonas_phage	38.1	7.9e-11
WP_032432826.1|3487374_3487872_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	84.6	1.1e-77
WP_016160648.1|3487871_3488087_-|lysis	phage S lysis protein	lysis	A5LH82	Enterobacteria_phage	88.7	2.7e-30
WP_004147999.1|3489004_3489154_+	small membrane protein	NA	NA	NA	NA	NA
WP_004147997.1|3489891_3490095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025861432.1|3490338_3490941_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	68.6	1.1e-76
WP_062955112.1|3490957_3491989_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	49.6	4.7e-96
WP_025861428.1|3492188_3492581_-	DNA-binding protein	NA	K7PHB4	Enterobacterial_phage	36.6	8.0e-12
WP_077255782.1|3492621_3492912_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	56.9	8.0e-17
WP_025368263.1|3492923_3493157_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	71.1	3.7e-25
WP_004178082.1|3493235_3494723_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_062954975.1|3495560_3496922_-	deoxyguanosinetriphosphate triphosphohydrolase family protein	NA	NA	NA	NA	NA
WP_062954976.1|3497095_3497809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062954989.1|3498160_3499030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062954977.1|3499118_3500510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032443841.1|3500858_3501299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047667474.1|3501312_3501777_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	72.2	4.1e-63
WP_077265602.1|3501769_3502774_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	40.0	1.0e-31
WP_046622349.1|3502833_3503388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071561166.1|3503390_3503615_-	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	62.5	1.3e-19
WP_077257742.1|3503703_3504141_+	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	62.2	1.3e-39
WP_040234937.1|3504462_3504777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023279538.1|3505167_3505362_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_014228879.1|3505404_3505749_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_062954978.1|3505890_3508029_+	exodeoxyribonuclease VIII	NA	S4TNL0	Salmonella_phage	42.7	5.6e-99
WP_012542206.1|3508081_3508327_+	excisionase	NA	NA	NA	NA	NA
WP_032418030.1|3508307_3509435_+|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	58.4	4.4e-119
WP_004150800.1|3509552_3510803_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
WP_004150801.1|3511043_3511694_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
3511143:3511157	attR	AAAGAACGCCAGCCA	NA	NA	NA	NA
WP_004150802.1|3511710_3512169_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004150803.1|3512225_3513332_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 13
NZ_CP039819	Klebsiella pneumoniae strain C2414 chromosome, complete genome	5588118	3731585	3816991	5588118	capsid,plate,portal,integrase,terminase,protease,transposase,tRNA,lysis,head,tail	Salmonella_phage(48.98%)	84	3787111:3787129	3817066:3817084
WP_002898139.1|3731585_3732878_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
WP_002898137.1|3732968_3734312_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
WP_002898132.1|3734320_3734932_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_004150846.1|3735054_3739308_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
WP_000228469.1|3739443_3739938_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_004147787.1|3740221_3740353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002898019.1|3740470_3741439_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.2e-62
WP_002898017.1|3741553_3743320_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
WP_004150847.1|3743320_3745042_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	22.4	3.4e-14
WP_004141853.1|3745068_3745788_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3746141_3746360_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3746480_3748760_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3748790_3749108_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3749433_3749655_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|3749731_3751672_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|3751668_3752784_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_002896437.1|3752930_3754589_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_002896434.1|3755008_3755704_+	aquaporin Z	NA	NA	NA	NA	NA
WP_004147773.1|3755819_3756719_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_002896412.1|3756862_3758515_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_002896410.1|3758525_3759494_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_002896408.1|3759705_3760140_-	DoxX family protein	NA	NA	NA	NA	NA
WP_002896406.1|3760291_3762010_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_002896404.1|3762048_3763050_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_002896401.1|3763060_3764503_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002896399.1|3764590_3765604_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002896397.1|3765600_3766431_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
WP_004150851.1|3766462_3767602_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_002896394.1|3768479_3768995_+	lipoprotein	NA	NA	NA	NA	NA
WP_032419144.1|3769221_3769950_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
WP_002896390.1|3769970_3770702_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896386.1|3770708_3771425_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_004150852.1|3771424_3772093_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_002896384.1|3772276_3773008_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896382.1|3773050_3774523_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
WP_002896380.1|3774519_3775236_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
WP_002896378.1|3775314_3776442_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
WP_002896376.1|3776483_3776972_-	DUF2593 family protein	NA	NA	NA	NA	NA
WP_002896372.1|3777029_3777875_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_002896371.1|3777871_3778825_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_004176719.1|3778835_3780002_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.3e-30
WP_002896368.1|3780132_3781245_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896365.1|3781593_3782073_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_002896363.1|3782161_3783064_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
WP_002896354.1|3783885_3784173_-	YbjC family protein	NA	NA	NA	NA	NA
WP_002896352.1|3784375_3784639_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
WP_002896351.1|3784645_3785029_-	membrane protein	NA	NA	NA	NA	NA
WP_004179131.1|3785295_3786981_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_004226292.1|3786972_3787095_-	hypothetical protein	NA	NA	NA	NA	NA
3787111:3787129	attL	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
WP_000972391.1|3787200_3787419_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_002896225.1|3787510_3788611_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_002896224.1|3788607_3789093_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_014342962.1|3789089_3791483_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	44.0	1.1e-106
WP_002896220.1|3791709_3791829_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_002896204.1|3791843_3792143_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896201.1|3792195_3792711_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896193.1|3792720_3793893_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896191.1|3794031_3795108_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_004232615.1|3795137_3795299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002896186.1|3795337_3796069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152882.1|3796072_3799024_-	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
WP_004150856.1|3799025_3799625_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_002896182.1|3799617_3800526_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_032441567.1|3800512_3800875_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	83.9	4.9e-48
WP_002896177.1|3800871_3801444_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_004226282.1|3801558_3801723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199112.1|3801721_3802231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896175.1|3802227_3802674_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_002896172.1|3802666_3803098_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896170.1|3803060_3803207_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	76.1	6.0e-13
WP_002896168.1|3803193_3803622_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896163.1|3803618_3804002_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896161.1|3804006_3804516_-	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896158.1|3804496_3804712_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896155.1|3804715_3804919_-|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896151.1|3804918_3805383_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_000059191.1|3805478_3806129_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002895972.1|3806132_3807191_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_002895967.1|3807207_3808041_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_004150858.1|3808183_3809950_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895959.1|3809949_3810975_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_004199124.1|3811036_3812779_-	AIPR family protein	NA	NA	NA	NA	NA
WP_000019473.1|3813126_3814107_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_014342959.1|3816010_3816991_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.2	1.4e-97
3817066:3817084	attR	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
>prophage 14
NZ_CP039819	Klebsiella pneumoniae strain C2414 chromosome, complete genome	5588118	4474390	4486043	5588118	integrase	Enterobacteria_phage(70.0%)	15	4474242:4474255	4478455:4478468
4474242:4474255	attL	TCTGACATATTTTT	NA	NA	NA	NA
WP_004144574.1|4474390_4475494_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
WP_002889940.1|4475504_4476758_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_002889938.1|4477110_4478301_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_004152029.1|4478288_4479239_+	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
4478455:4478468	attR	AAAAATATGTCAGA	NA	NA	NA	NA
WP_004152979.1|4479238_4479664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020802988.1|4480010_4480160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152202.1|4480231_4480798_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
WP_004152203.1|4480815_4481061_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_062956184.1|4481057_4481795_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.9e-70
WP_004903606.1|4482094_4482232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002889915.1|4482336_4482603_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_072028197.1|4482605_4483157_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_004219964.1|4483201_4483381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889897.1|4483377_4483698_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_002889890.1|4483709_4486043_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
>prophage 15
NZ_CP039819	Klebsiella pneumoniae strain C2414 chromosome, complete genome	5588118	4954294	4966085	5588118	transposase	Enterobacteria_phage(66.67%)	13	NA	NA
WP_004152207.1|4954294_4956628_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	83.9	0.0e+00
WP_004152206.1|4956642_4956963_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_004152205.1|4956959_4957187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072093163.1|4957183_4957726_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	69.4	1.1e-30
WP_000556592.1|4957728_4957995_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.0e-30
WP_004152204.1|4958555_4959293_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.1e-70
WP_004152203.1|4959289_4959535_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_004152202.1|4959552_4960119_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
WP_014342868.1|4960190_4960340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013362812.1|4961730_4962699_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	100.0	1.6e-186
WP_004152200.1|4963005_4963542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019473.1|4963904_4964885_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_000019445.1|4965104_4966085_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
>prophage 1
NZ_CP039820	Klebsiella pneumoniae strain C2414 plasmid pC2414-2-KPC, complete sequence	172001	1796	39785	172001	transposase,protease	Escherichia_phage(43.75%)	40	NA	NA
WP_000616807.1|1796_2450_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000557619.1|2542_2800_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_001398199.1|2732_3134_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_001067855.1|4444_5149_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_014342101.1|5557_5680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013188475.1|5659_6535_+	class A extended-spectrum beta-lactamase CTX-M-65	NA	A0A1B0VBP7	Salmonella_phage	98.9	6.8e-152
WP_013362812.1|6569_7538_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	100.0	1.6e-186
WP_001067855.1|9288_9993_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|11103_11808_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_014839979.1|11873_12392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014839980.1|12396_12813_-	fosfomycin resistance glutathione transferase FosA3	NA	Q2LI91	Bacillus_phage	35.6	2.0e-08
WP_001067855.1|13198_13903_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000957857.1|14580_14769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064441864.1|14860_15397_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	2.8e-84
WP_000027057.1|15579_16440_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_012372818.1|16609_17365_+	16S rRNA (guanine(1405)-N(7))-methyltransferase RmtB1	NA	NA	NA	NA	NA
WP_001067858.1|17814_18519_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_071557810.1|18509_18650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001333089.1|20460_20742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000361389.1|20864_21215_-	protein stbB	NA	NA	NA	NA	NA
WP_000959884.1|21217_22180_-	plasmid segregation protein ParM	NA	A0A222YXF2	Escherichia_phage	53.9	4.1e-94
WP_032146011.1|22326_22620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000085883.1|22696_23380_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	5.6e-29
WP_001104881.1|23380_23602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000274503.1|23615_24050_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_011161242.1|24749_25322_+	YubH family protein	NA	NA	NA	NA	NA
WP_001198928.1|25294_25720_+	antirestriction protein	NA	NA	NA	NA	NA
WP_000271762.1|25766_26189_+	DUF1380 family protein	NA	NA	NA	NA	NA
WP_001027493.1|26185_26377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012372796.1|26690_28358_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	53.3	1.7e-164
WP_000218642.1|29757_29988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000170695.1|30039_31401_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_015059007.1|31447_32011_+	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	37.3	6.1e-21
WP_000290834.1|32853_33381_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	74.4	6.0e-47
WP_000006003.1|33438_33672_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_000845953.1|35824_36259_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001276217.1|36255_36975_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_001312861.1|37254_37413_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001272251.1|38327_38624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019473.1|38804_39785_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
>prophage 2
NZ_CP039820	Klebsiella pneumoniae strain C2414 plasmid pC2414-2-KPC, complete sequence	172001	65094	112280	172001	transposase,integrase	Escherichia_phage(35.29%)	54	81121:81135	101666:101680
WP_013362812.1|65094_66063_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	100.0	1.6e-186
WP_021559024.1|66359_67091_+	complement resistance protein TraT	NA	NA	NA	NA	NA
WP_015059020.1|67293_68031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021573169.1|68081_70289_+	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_071177725.1|70288_75424_+	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_001067855.1|75457_76162_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_094833374.1|76220_76778_+	replication protein	NA	NA	NA	NA	NA
WP_013213990.1|77231_77510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013213989.1|77620_78046_+	antirestriction protein	NA	A0A2D0W8Z5	Bordetella_virus	37.3	5.3e-17
WP_013213988.1|78173_78329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013213987.1|78374_78671_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_004199234.1|79905_80787_-	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_014343469.1|80803_80950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013213985.1|81062_82043_-|transposase	IS481-like element ISKpn27 family transposase	transposase	A8RHK4	Spiroplasma_virus	27.4	2.9e-10
81121:81135	attL	TCATGCCATTCCTTG	NA	NA	NA	NA
WP_014343468.1|82165_82639_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	99.3	3.3e-76
WP_001067855.1|82678_83383_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001300294.1|84694_85363_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000993386.1|85398_85635_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277456.1|85631_85994_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000105636.1|86011_87706_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001340589.1|87757_88180_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732292.1|88215_88491_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294663.1|88504_88855_-	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000429836.1|88926_89361_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000427619.1|89439_90444_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_014343466.1|91783_91906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000361404.1|91977_93000_-	helicase UvrD	NA	NA	NA	NA	NA
WP_004206609.1|92984_94547_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001044770.1|94620_95037_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001261282.1|95033_95264_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_014343465.1|95220_95682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014343464.1|95697_95817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011977810.1|95842_96787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011977811.1|96823_97216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094960442.1|97273_97795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011977813.1|97840_98044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011977814.1|98073_99078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014343463.1|99121_99253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013214009.1|99261_100041_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.0	5.4e-52
WP_013214010.1|100086_100344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014343462.1|100472_100586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118283.1|101121_101988_+	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
101666:101680	attR	TCATGCCATTCCTTG	NA	NA	NA	NA
WP_011977818.1|103097_104303_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	5.3e-163
WP_011977819.1|104302_105277_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	53.8	1.4e-86
WP_013214011.1|105358_106630_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	7.5e-152
WP_001568036.1|106629_107061_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
WP_014343520.1|107038_107155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004178082.1|107467_108955_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_014343519.1|108947_109073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152353.1|109203_110175_+	mediator of plasmid stability	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_013214012.1|110177_110849_+	mediator of plasmid stability	NA	NA	NA	NA	NA
WP_001568040.1|110911_111142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014343518.1|111260_111377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001568041.1|111578_112280_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.2	1.6e-26
>prophage 3
NZ_CP039820	Klebsiella pneumoniae strain C2414 plasmid pC2414-2-KPC, complete sequence	172001	134989	163517	172001	transposase	Escherichia_phage(29.41%)	34	NA	NA
WP_001067855.1|134989_135694_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001239317.1|135773_136274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001011939.1|136423_137065_+	type A-2 chloramphenicol O-acetyltransferase CatII	NA	G3CFL0	Escherichia_phage	45.9	7.3e-55
WP_001067855.1|137197_137902_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_042934582.1|138370_138928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019445.1|139579_140560_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
WP_015493087.1|141073_141469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015493086.1|141465_142077_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_015493085.1|142073_143024_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	55.6	6.6e-76
WP_040219232.1|143170_143371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022652286.1|143424_144057_-	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	31.9	2.5e-07
WP_015493083.1|144419_145625_+	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	89.2	1.1e-205
WP_016479949.1|145621_146593_+	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	68.9	1.4e-113
WP_015493081.1|146728_148000_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.0	6.1e-154
WP_015493080.1|147999_148422_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.5	3.1e-30
WP_015493079.1|148601_149273_-	Gifsy-2 prophage protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.7	5.1e-83
WP_002211749.1|149631_150309_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	1.6e-28
WP_015493077.1|150308_150530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015493076.1|150540_150960_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_015493075.1|151013_151793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015493074.1|152197_152704_+	antirestriction protein ArdA	NA	A0A1I9S7Y0	Rhodococcus_phage	31.8	4.8e-09
WP_015493073.1|152746_152938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015493072.1|153130_153385_+	hypothetical protein	NA	H9C187	Pectobacterium_phage	46.2	5.2e-12
WP_015493071.1|154362_154593_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_008324186.1|156715_157147_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_008324185.1|157143_157872_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_015493069.1|158253_158613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008324180.1|159238_159613_+	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	62.7	2.2e-27
WP_001067855.1|159738_160443_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001044210.1|160448_160589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001446887.1|161074_161812_+	recombinase family protein	NA	NA	NA	NA	NA
WP_000743213.1|161808_162033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000954592.1|162154_162331_+	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_000427619.1|162512_163517_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP039821	Klebsiella pneumoniae strain C2414 plasmid pC2414-3-NDM, complete sequence	63046	0	43607	63046	transposase,integrase	Burkholderia_phage(18.75%)	47	2553:2570	9737:9754
WP_001749982.1|0_720_+	replication initiation protein	NA	I3WF20	Macacine_betaherpesvirus	28.9	8.6e-20
WP_001749988.1|2079_2649_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	43.2	5.2e-36
2553:2570	attL	CCTGATAGATTTGCTCAC	NA	NA	NA	NA
WP_000845048.1|3041_4055_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_004201280.1|4210_4684_+	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_001144737.1|4904_5171_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_001389365.1|5313_6078_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_004098817.1|6338_7553_+	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_001288432.1|7586_9020_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
WP_001749967.1|9401_9608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001749966.1|9612_10254_-	restriction endonuclease	NA	NA	NA	NA	NA
9737:9754	attR	GTGAGCAAATCTATCAGG	NA	NA	NA	NA
WP_001452736.1|10309_10621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001749965.1|10656_10971_-	KikA protein	NA	NA	NA	NA	NA
WP_001749964.1|10967_11312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024129965.1|11327_11678_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_001749963.1|11741_12476_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_000440698.1|12484_12766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001749962.1|12775_13069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000496058.1|13118_13436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001749961.1|13435_16036_+	VirB4 family type IV secretion/conjugal transfer ATPase	NA	NA	NA	NA	NA
WP_001749960.1|16053_16767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001749959.1|16774_17002_+	IncN-type entry exclusion lipoprotein EexN	NA	NA	NA	NA	NA
WP_001749958.1|17017_18058_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_000646594.1|18276_18975_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_000735066.1|18985_19870_+	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_000101710.1|19869_21030_+	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_000128596.1|21071_22067_+	Flp pilus assembly complex ATPase component	NA	NA	NA	NA	NA
WP_000792636.1|22066_22600_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.9	5.8e-21
WP_162224988.1|22773_22893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004178082.1|22953_24441_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_001067855.1|25481_26186_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001516695.1|27265_27922_+	quinolone resistance pentapeptide repeat protein QnrS1	NA	NA	NA	NA	NA
WP_014839983.1|28240_28855_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	47.4	8.1e-35
WP_012477564.1|29108_29699_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_001493762.1|29835_30408_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	39.4	3.4e-19
WP_014839878.1|30444_31836_+|transposase	ISKra4-like element ISKpn19 family transposase	transposase	NA	NA	NA	NA
WP_004201164.1|32220_33033_+	subclass B1 metallo-beta-lactamase NDM-1	NA	NA	NA	NA	NA
WP_004201167.1|33036_33402_+	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_004201168.1|33406_34045_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_004201169.1|34055_35087_-	twin-arginine translocation (TAT) pathway signal sequence domain protein	NA	NA	NA	NA	NA
WP_004201171.1|35091_35421_-	divalent-cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_004201172.1|35614_35905_+	co-chaperone GroES	NA	A0A221S322	uncultured_virus	47.8	2.1e-17
WP_014839878.1|37252_38644_-|transposase	ISKra4-like element ISKpn19 family transposase	transposase	NA	NA	NA	NA
WP_001493762.1|38680_39253_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	39.4	3.4e-19
WP_012477564.1|39389_39980_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_014839983.1|40233_40848_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	47.4	8.1e-35
WP_001516695.1|41166_41823_-	quinolone resistance pentapeptide repeat protein QnrS1	NA	NA	NA	NA	NA
WP_001067855.1|42902_43607_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
