The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP039808	Klebsiella pneumoniae strain C2660 chromosome, complete genome	5494793	448576	481834	5494793	portal,tail,terminase,tRNA,head,protease,integrase,capsid	uncultured_Caudovirales_phage(75.0%)	34	466184:466201	482179:482196
WP_002919147.1|448576_449524_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
WP_002919144.1|449538_450048_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
WP_002919139.1|450176_451301_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002919137.1|451272_451746_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_004145330.1|451771_452314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002919132.1|452318_452891_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_002919126.1|452894_453713_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_002919125.1|453709_453967_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_002919123.1|453942_454497_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002919103.1|460292_460514_-	membrane protein	NA	NA	NA	NA	NA
WP_002919102.1|460807_463918_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_002919101.1|463930_465070_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004150972.1|465448_466099_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
466184:466201	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
WP_004150971.1|466374_467601_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
WP_004150970.1|467693_468635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001547839.1|468816_469101_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004150969.1|469111_469891_+	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
WP_157263200.1|470393_470612_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	1.4e-34
WP_001549752.1|470604_470793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004218267.1|470869_470998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|471096_471465_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_001549749.1|471461_471827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|471826_473962_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_004150964.1|474304_474640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150963.1|474688_475201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549743.1|475464_476631_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_001547826.1|476682_477243_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_004150962.1|477244_478486_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_004150961.1|478482_478818_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_001547824.1|478814_479114_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150959.1|479113_479557_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_004150957.1|479549_479702_+	hypothetical protein	NA	A0A2H4JCY9	uncultured_Caudovirales_phage	88.0	2.4e-17
WP_000113647.1|479832_480189_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150955.1|480172_481834_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
482179:482196	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
>prophage 2
NZ_CP039808	Klebsiella pneumoniae strain C2660 chromosome, complete genome	5494793	1243493	1292637	5494793	portal,lysis,tail,plate,coat,transposase,terminase,tRNA,head,integrase,capsid	Salmonella_phage(80.0%)	63	1242908:1242954	1281263:1281309
1242908:1242954	attL	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_000019473.1|1243493_1244474_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_062955148.1|1244519_1245518_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	94.5	2.2e-183
WP_004151019.1|1245520_1246150_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
WP_001397669.1|1246272_1246515_+	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
WP_004151018.1|1246547_1247057_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
WP_004151017.1|1247064_1247265_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	4.5e-19
WP_004144796.1|1247228_1247567_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
WP_004151016.1|1247634_1247868_+	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
WP_004151014.1|1247867_1248095_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
WP_004151013.1|1248091_1248943_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
WP_004151012.1|1248939_1251324_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.9	0.0e+00
WP_004178082.1|1251801_1253289_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004151011.1|1253396_1253585_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
WP_004151010.1|1253596_1253830_+	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	2.0e-34
WP_004151009.1|1253925_1254609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151008.1|1254595_1255675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151007.1|1255674_1256676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024940854.1|1257197_1257467_+	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.3	1.4e-15
WP_004151006.1|1257523_1258567_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
WP_019405037.1|1258566_1260330_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	91.8	0.0e+00
WP_004151004.1|1260470_1261304_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	77.6	4.4e-100
WP_004151003.1|1261320_1262373_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
WP_004134644.1|1262376_1263030_+|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
WP_004151002.1|1263125_1263590_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
WP_004151001.1|1263589_1263793_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	89.6	9.8e-30
WP_004134639.1|1263796_1264012_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
WP_004151000.1|1263992_1264502_+	lysozyme	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
WP_004150999.1|1264506_1264890_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
WP_004150998.1|1264886_1265315_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
WP_072093160.1|1265289_1265448_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	75.0	9.0e-15
WP_004150997.1|1265410_1265833_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
WP_004150996.1|1265825_1266272_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
WP_004150995.1|1266294_1267161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150994.1|1267255_1267828_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
WP_004150993.1|1267824_1268187_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
WP_004150992.1|1268173_1269082_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	68.9	1.9e-109
WP_004152935.1|1269074_1269746_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.9	3.2e-61
WP_004150990.1|1269747_1271697_+|coat	spore coat protein CotH	coat	Q6QI97	Burkholderia_phage	38.9	1.0e-06
WP_004200602.1|1271706_1272825_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	4.4e-55
WP_004150988.1|1272876_1273950_+|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
WP_004150987.1|1274098_1275271_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
WP_004150986.1|1275280_1275796_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
WP_004150985.1|1275848_1276148_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	78.0	8.2e-33
WP_002896220.1|1276162_1276282_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_072093161.1|1276508_1278905_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	44.5	8.1e-107
WP_004150983.1|1278901_1279387_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	5.2e-61
WP_004150982.1|1279383_1280478_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	83.6	2.4e-170
WP_004150981.1|1280544_1280763_+	positive regulator of late gene transcription	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
WP_004150980.1|1280790_1281168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914164.1|1281771_1282254_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
1281263:1281309	attR	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_004188817.1|1282364_1282841_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_002914161.1|1282830_1283121_+	RnfH family protein	NA	NA	NA	NA	NA
WP_002914160.1|1283187_1283529_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_004145681.1|1283510_1283651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914159.1|1283676_1285338_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002914158.1|1285424_1286303_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_002914155.1|1286427_1287018_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_004149392.1|1287137_1288424_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914153.1|1288443_1289235_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_002914152.1|1289398_1290763_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914149.1|1291022_1291271_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_004150977.1|1291289_1291838_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914147.1|1291869_1292637_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP039808	Klebsiella pneumoniae strain C2660 chromosome, complete genome	5494793	1397353	1450096	5494793	tail,transposase,terminase,holin,integrase	Salmonella_phage(40.0%)	57	1390688:1390702	1420793:1420807
1390688:1390702	attL	TGAGCAGGTTCGCGA	NA	NA	NA	NA
WP_004151980.1|1397353_1398820_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
WP_004151979.1|1398887_1400465_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_062955102.1|1400656_1401907_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9TCT6	Enterobacter_phage	84.4	5.8e-205
WP_063002073.1|1401849_1402092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197356.1|1402088_1402682_-	MT-A70 family protein	NA	T1SA14	Salmonella_phage	91.9	6.3e-109
WP_062955103.1|1402678_1403341_-	hypothetical protein	NA	A0A059VF56	Pseudomonas_phage	46.6	1.2e-47
WP_048264082.1|1403337_1403496_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	78.8	1.1e-17
WP_009485475.1|1403488_1403782_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	4.0e-32
WP_062955104.1|1403891_1404140_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	76.8	4.9e-31
WP_062955105.1|1404188_1405070_-	recombinase RecT	NA	T1SBJ5	Salmonella_phage	84.3	8.9e-136
WP_062955106.1|1405066_1405888_-	exodeoxyribonuclease VIII	NA	A0A193GYK2	Enterobacter_phage	80.2	1.8e-130
WP_004164029.1|1405884_1406184_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	2.1e-20
WP_004144290.1|1406550_1407132_-	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.3	7.1e-65
WP_004152538.1|1407286_1407520_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
WP_004152537.1|1407666_1407876_+	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
WP_004207253.1|1407875_1408643_+	hypothetical protein	NA	A0A193GZ86	Enterobacter_phage	91.4	8.9e-140
WP_032418532.1|1408639_1409425_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.7	3.7e-133
WP_048328152.1|1409544_1409892_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	82.6	6.5e-50
WP_062955107.1|1410084_1410495_+	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	45.1	4.3e-16
WP_032441402.1|1410478_1410670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032441401.1|1410666_1411311_+	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	79.3	8.0e-110
WP_072200041.1|1411604_1412072_+	hypothetical protein	NA	A0A2R2Z312	Escherichia_phage	51.7	1.3e-37
WP_029602865.1|1412071_1412365_+	hypothetical protein	NA	Q6UAT9	Klebsiella_phage	86.6	2.7e-44
WP_050491799.1|1412361_1412982_+	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	40.7	1.0e-29
WP_032441458.1|1412981_1413185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023339258.1|1413177_1413516_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.0	1.8e-44
WP_004178082.1|1413612_1415100_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_032418540.1|1415500_1415758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032441400.1|1415835_1416420_+|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.6	2.2e-90
WP_062955142.1|1416416_1417892_+	hypothetical protein	NA	Q858H3	Salmonella_phage	93.1	6.4e-280
WP_004200550.1|1417935_1418307_-	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	91.9	3.7e-59
WP_004141368.1|1419060_1419267_+	hypothetical protein	NA	T1SA67	Salmonella_phage	88.2	4.8e-08
WP_032441398.1|1419281_1420964_+|tail	tail protein	tail	A0A0F6TJD8	Escherichia_coli_O157_typing_phage	84.4	1.5e-264
1420793:1420807	attR	TGAGCAGGTTCGCGA	NA	NA	NA	NA
WP_004152446.1|1420960_1421257_+	hypothetical protein	NA	T1SBI9	Salmonella_phage	70.4	1.2e-33
WP_032441397.1|1421259_1421940_+	peptidase	NA	G9L6C4	Escherichia_phage	84.0	6.1e-76
WP_004200546.1|1421954_1422941_+	hypothetical protein	NA	A0A193GZ49	Enterobacter_phage	94.2	2.5e-179
WP_020953461.1|1422994_1423432_+	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	91.7	1.3e-66
WP_062955141.1|1423442_1423784_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	70.8	2.4e-36
WP_004152441.1|1423834_1424158_+	hypothetical protein	NA	G9L6C8	Escherichia_phage	85.0	5.3e-46
WP_062955139.1|1424157_1424763_+	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	77.0	4.0e-87
WP_062955138.1|1424762_1427240_+	hypothetical protein	NA	Q858G3	Salmonella_phage	84.4	0.0e+00
WP_004152438.1|1427239_1427704_+	hypothetical protein	NA	Q858G2	Salmonella_phage	81.2	1.5e-70
WP_032447858.1|1427703_1428243_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	80.0	8.0e-71
WP_062955137.1|1428253_1430788_+	hypothetical protein	NA	Q858G0	Salmonella_phage	84.1	0.0e+00
WP_062955136.1|1430787_1432698_+	hypothetical protein	NA	Q858F9	Salmonella_phage	82.7	5.4e-287
WP_062955135.1|1432697_1435454_+	hypothetical protein	NA	Q858F8	Salmonella_phage	95.4	0.0e+00
WP_062955133.1|1435930_1436227_-	hypothetical protein	NA	T1SA06	Salmonella_phage	63.9	6.9e-24
WP_062955131.1|1439054_1439318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153233543.1|1439358_1440624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019445.1|1440605_1441586_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
WP_000608644.1|1442454_1443717_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_077265603.1|1444825_1446142_+	right-handed parallel beta-helix repeat-containing protein	NA	A0A0K2FI18	Enterobacter_phage	32.3	2.3e-34
WP_062955010.1|1446228_1446633_+	hypothetical protein	NA	T1SA79	Salmonella_phage	81.1	8.7e-54
WP_162220112.1|1446619_1446925_+|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	82.4	1.6e-39
WP_062955009.1|1446914_1447544_+	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	76.9	1.8e-90
WP_062955008.1|1447540_1448041_+	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	76.9	1.3e-59
WP_004152009.1|1448227_1450096_-	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
>prophage 4
NZ_CP039808	Klebsiella pneumoniae strain C2660 chromosome, complete genome	5494793	1782325	1789230	5494793	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_072353998.1|1782325_1783189_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	7.4e-10
WP_004180550.1|1783199_1783973_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_004151134.1|1784213_1785110_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004144192.1|1785352_1786714_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004175198.1|1787032_1787755_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_072353997.1|1787751_1789230_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	1.9e-29
>prophage 5
NZ_CP039808	Klebsiella pneumoniae strain C2660 chromosome, complete genome	5494793	1832575	1844250	5494793	transposase	Escherichia_phage(33.33%)	10	NA	NA
WP_000043543.1|1832575_1833982_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
WP_004180506.1|1834208_1835624_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.0	1.4e-53
WP_039819506.1|1835645_1837016_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	25.9	6.4e-32
WP_039819536.1|1837170_1838235_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.7	9.8e-105
WP_023278825.1|1838248_1839118_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.7	1.7e-110
WP_004175259.1|1839149_1840040_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	2.8e-28
WP_039819508.1|1840054_1840609_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	2.9e-52
WP_072353991.1|1840788_1841955_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	9.1e-112
WP_158208765.1|1842347_1843229_+	acyltransferase family protein	NA	NA	NA	NA	NA
WP_000019473.1|1843269_1844250_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
>prophage 6
NZ_CP039808	Klebsiella pneumoniae strain C2660 chromosome, complete genome	5494793	2841246	2850660	5494793		Escherichia_phage(87.5%)	9	NA	NA
WP_160463746.1|2841246_2842881_+	DUF4981 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	55.8	3.1e-182
WP_004151612.1|2842935_2844201_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|2844231_2845320_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_002904006.1|2845406_2845667_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_004176269.1|2845964_2846825_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|2846845_2847607_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004151610.1|2847867_2848770_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
WP_004151609.1|2848781_2850047_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
WP_002210516.1|2850039_2850660_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 7
NZ_CP039808	Klebsiella pneumoniae strain C2660 chromosome, complete genome	5494793	3034062	3108083	5494793	transposase,plate,integrase,terminase	uncultured_Caudovirales_phage(31.37%)	88	3099196:3099210	3105205:3105219
WP_002902268.1|3034062_3035148_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004151598.1|3035111_3036866_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004151599.1|3038537_3041963_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_002902254.1|3041946_3043086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002902252.1|3043082_3043340_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_002902180.1|3045789_3046320_-	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902178.1|3046387_3046918_-	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902176.1|3046986_3047517_-	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902174.1|3047584_3048115_-	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902172.1|3048183_3048714_-	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902169.1|3048777_3049557_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_004228410.1|3049557_3051927_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.8	9.1e-18
WP_002902163.1|3051928_3054583_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.4	2.5e-96
WP_002902160.1|3054847_3055339_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_004151602.1|3055343_3057050_-	OmpA family protein	NA	NA	NA	NA	NA
WP_004151603.1|3057046_3057736_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004218490.1|3057732_3059076_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002902148.1|3059085_3060630_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002902144.1|3060672_3061164_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004230193.1|3061322_3061445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019473.1|3061633_3062614_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_002902136.1|3063209_3063458_+	DinI-like family protein	NA	S5MQI1	Escherichia_phage	70.4	1.4e-25
WP_002902133.1|3063680_3063965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000343760.1|3064064_3065285_+|transposase	ISL3-like element ISKox3 family transposase	transposase	NA	NA	NA	NA
WP_002902131.1|3065393_3065603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002902128.1|3065599_3066331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014343022.1|3066341_3069365_-	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	44.7	1.6e-22
WP_004152577.1|3069420_3069618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004231602.1|3069592_3069724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004231600.1|3069844_3070009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152575.1|3070483_3071257_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
WP_004152574.1|3071253_3072450_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
WP_004152573.1|3072449_3072803_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152572.1|3072804_3073458_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004225248.1|3073511_3073862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004173705.1|3074114_3074300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152570.1|3074352_3074694_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
WP_004152569.1|3074693_3075716_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004217362.1|3075718_3075946_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	56.0	4.6e-20
WP_004225238.1|3076021_3076435_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	55.9	8.1e-31
WP_004152566.1|3076620_3078624_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004152565.1|3078613_3078766_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152564.1|3078801_3079227_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_004199809.1|3079230_3079671_-	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	80.1	3.3e-62
WP_004152177.1|3079681_3080827_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004152176.1|3080830_3081271_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_001116156.1|3081365_3081752_-	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_000834982.1|3081751_3082258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|3082254_3082674_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000725700.1|3082642_3082924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001132269.1|3082963_3083905_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
WP_000528476.1|3083916_3084411_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_004199270.1|3084414_3085617_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_004152174.1|3085668_3086217_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004152173.1|3086272_3087724_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_004152172.1|3087961_3089362_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
WP_004218030.1|3089312_3089801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152170.1|3090166_3090487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153952.1|3090721_3091111_-	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152169.1|3091107_3091638_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004146526.1|3091640_3091889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218026.1|3091906_3092035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152168.1|3092072_3092228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152167.1|3092294_3093077_-	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004198239.1|3093073_3093550_-	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004218023.1|3093546_3094524_-	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198228.1|3094510_3096169_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004152162.1|3096745_3096967_-	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004152161.1|3097064_3097733_+	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152160.1|3097903_3098218_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152159.1|3098210_3098399_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004218017.1|3098772_3098934_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	96.2	1.5e-20
WP_004152157.1|3098926_3099181_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
3099196:3099210	attL	AGGCGCTGCAGGTCC	NA	NA	NA	NA
WP_004146412.1|3099248_3099371_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	100.0	1.3e-16
WP_004152156.1|3099367_3099793_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004152155.1|3099789_3099984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152154.1|3099980_3100808_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152153.1|3100912_3101431_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
WP_004154298.1|3101436_3102147_+	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152151.1|3102136_3102361_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004218013.1|3102456_3102570_+	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	100.0	4.6e-13
WP_014343018.1|3102812_3103046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004198245.1|3103118_3103265_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	70.8	2.9e-15
WP_004152148.1|3103224_3103467_+	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004152147.1|3103447_3104629_-|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
WP_016197745.1|3104825_3105374_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
3105205:3105219	attR	GGACCTGCAGCGCCT	NA	NA	NA	NA
WP_004152145.1|3105572_3107105_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_004152144.1|3107321_3108083_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
>prophage 8
NZ_CP039808	Klebsiella pneumoniae strain C2660 chromosome, complete genome	5494793	3141016	3171895	5494793	transposase,integrase,holin	Enterobacteria_phage(36.67%)	41	3140798:3140813	3169201:3169216
3140798:3140813	attL	TATGCCCTACGATAGC	NA	NA	NA	NA
WP_002901815.1|3141016_3141688_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.6	4.5e-79
WP_071531199.1|3141874_3142702_+	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	30.2	8.4e-19
WP_002901813.1|3142777_3144043_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.7	9.6e-208
WP_002901812.1|3144044_3144464_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
WP_004178082.1|3144543_3146031_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004152776.1|3146925_3147348_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	3.6e-26
WP_001067855.1|3147940_3148645_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000679427.1|3149260_3149608_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001261740.1|3149771_3150563_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_001067855.1|3151544_3152249_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004218565.1|3152404_3152944_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	3.3e-101
WP_024940884.1|3152940_3153240_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	100.0	4.5e-47
WP_004232548.1|3153889_3154579_-	antiterminator-like protein	NA	I6PDF8	Cronobacter_phage	53.1	2.1e-55
WP_004218534.1|3154578_3154719_-	YlcG family protein	NA	NA	NA	NA	NA
WP_004218533.1|3154715_3155354_-	hypothetical protein	NA	H6WRY9	Salmonella_phage	69.8	3.2e-74
WP_004218532.1|3155346_3156015_-	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	78.7	1.4e-104
WP_004243010.1|3156011_3156179_-	NinE family protein	NA	K7P7K0	Enterobacteria_phage	62.5	4.6e-09
WP_004218531.1|3156159_3156627_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	45.8	3.4e-33
WP_004243011.1|3156759_3157038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218530.1|3157147_3158176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196831.1|3158383_3158629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218528.1|3158684_3158987_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004201118.1|3158983_3159832_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	60.1	5.1e-88
WP_004201117.1|3159828_3160689_-	replication protein	NA	K7PGT1	Enterobacteria_phage	53.3	1.0e-59
WP_001548453.1|3160774_3160996_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004201115.1|3161036_3161264_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	77.1	1.4e-24
WP_004201113.1|3161375_3162074_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	84.1	3.7e-108
WP_004201109.1|3162361_3163438_+	ParA family protein	NA	H2BD62	Pseudomonas_phage	37.9	9.1e-58
WP_004201108.1|3163519_3163723_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	3.9e-18
WP_004219883.1|3164033_3164159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004135674.1|3164151_3164346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201105.1|3164434_3164719_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	1.1e-39
WP_004201103.1|3164734_3165580_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	1.8e-69
WP_088224434.1|3165576_3165864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201102.1|3165865_3166546_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	91.2	8.2e-121
WP_004151898.1|3166542_3166971_+	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	80.3	7.5e-64
WP_004151899.1|3166967_3167630_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	84.6	2.7e-105
WP_004151900.1|3167837_3169055_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	51.9	8.6e-121
WP_004151901.1|3169201_3170092_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
3169201:3169216	attR	TATGCCCTACGATAGC	NA	NA	NA	NA
WP_004140266.1|3170091_3171084_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004140269.1|3171085_3171895_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
>prophage 9
NZ_CP039808	Klebsiella pneumoniae strain C2660 chromosome, complete genome	5494793	3299567	3387446	5494793	portal,lysis,tail,terminase,tRNA,head,integrase,capsid	Klebsiella_phage(44.19%)	96	3326370:3326384	3385257:3385271
WP_002901088.1|3299567_3300068_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_002901080.1|3300184_3300631_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_004140469.1|3300614_3301409_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014343001.1|3301516_3302692_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004140471.1|3302723_3303416_-	CTP synthase	NA	NA	NA	NA	NA
WP_004150778.1|3303561_3304071_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_014343000.1|3304075_3304414_+	DUF488 family protein	NA	NA	NA	NA	NA
WP_004150780.1|3304403_3304643_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_004150781.1|3304943_3305957_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.4e-12
WP_004150782.1|3306014_3306116_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_099119317.1|3306115_3306190_+	protein YoaJ	NA	NA	NA	NA	NA
WP_004140488.1|3306307_3306433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140489.1|3306492_3306756_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004150783.1|3306886_3307525_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004148038.1|3307614_3308529_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
WP_014342999.1|3308990_3309110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150784.1|3309190_3310234_-	type II asparaginase	NA	NA	NA	NA	NA
WP_004150785.1|3310536_3311745_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_004150787.1|3311818_3313603_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
WP_004150788.1|3313609_3314500_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004140497.1|3314620_3316129_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_004150789.1|3316162_3316327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150790.1|3316439_3317126_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004140501.1|3317523_3317703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150791.1|3317742_3318375_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_004140506.1|3318941_3319139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140509.1|3319254_3320265_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_004150793.1|3320261_3321668_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_004140512.1|3321723_3322611_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_004140514.1|3322627_3323134_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004150794.1|3323160_3323655_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004150795.1|3323745_3323931_-	general stress protein	NA	NA	NA	NA	NA
WP_004140529.1|3324552_3325746_+	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004140530.1|3325858_3326086_+	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
WP_004225560.1|3326227_3326404_+	hypothetical protein	NA	NA	NA	NA	NA
3326370:3326384	attL	TGGCTGGCGTTCTTT	NA	NA	NA	NA
WP_004150797.1|3326522_3326846_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_004150798.1|3326838_3327231_+	amino acid-binding protein	NA	NA	NA	NA	NA
WP_004150799.1|3327227_3327941_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004892953.1|3328213_3328366_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	3.8e-18
WP_023328083.1|3328520_3330017_-|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	63.7	1.4e-125
WP_062955111.1|3330085_3342790_-	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	47.1	0.0e+00
WP_023328085.1|3342852_3343446_-|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	76.6	8.0e-80
WP_047666390.1|3343472_3343895_-	hypothetical protein	NA	J9Q806	Salmonella_phage	50.0	5.9e-29
WP_047666389.1|3343936_3344647_-	peptidase P60	NA	Q6UAW4	Klebsiella_phage	90.3	1.9e-136
WP_023328087.1|3344648_3345404_-|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	80.5	4.6e-125
WP_023328088.1|3345400_3345739_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	88.4	1.4e-57
WP_023328089.1|3345738_3349074_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	88.3	0.0e+00
WP_014228914.1|3349306_3349672_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
WP_023328090.1|3349729_3350191_-	hypothetical protein	NA	Q6UAX0	Klebsiella_phage	83.7	7.8e-67
WP_023328091.1|3350222_3350624_-	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	94.0	2.3e-62
WP_017880258.1|3350620_3351010_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	86.0	9.6e-58
WP_023328092.1|3350990_3351329_-|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	90.2	2.8e-53
WP_020317538.1|3351325_3351643_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	89.8	1.5e-45
WP_049010370.1|3351623_3351884_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	60.5	7.4e-22
WP_023328094.1|3351942_3353229_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	89.0	9.8e-216
WP_014907815.1|3353306_3354227_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	88.2	9.6e-149
WP_023279520.1|3354263_3355523_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	89.8	1.8e-222
WP_017898992.1|3355522_3355702_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	57.6	3.1e-11
WP_021462603.1|3355695_3357417_-|terminase	terminase large subunit	terminase	Q7Y413	Yersinia_phage	57.4	1.5e-190
WP_012542168.1|3357416_3357851_-|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.9	9.4e-30
WP_014907818.1|3358099_3358531_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	61.6	1.8e-41
WP_023297386.1|3358527_3358851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032428746.1|3358802_3359165_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	83.3	1.2e-57
WP_032749552.1|3359491_3359716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049115059.1|3359754_3360192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016160650.1|3361141_3361492_-	hypothetical protein	NA	R9TPM9	Aeromonas_phage	38.1	7.9e-11
WP_032432826.1|3361488_3361986_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	84.6	1.1e-77
WP_016160648.1|3361985_3362201_-|lysis	phage S lysis protein	lysis	A5LH82	Enterobacteria_phage	88.7	2.7e-30
WP_004147999.1|3363118_3363268_+	small membrane protein	NA	NA	NA	NA	NA
WP_004147997.1|3364005_3364209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025861432.1|3364452_3365055_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	68.6	1.1e-76
WP_062955112.1|3365071_3366103_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	49.6	4.7e-96
WP_025861428.1|3366302_3366695_-	DNA-binding protein	NA	K7PHB4	Enterobacterial_phage	36.6	8.0e-12
WP_077255782.1|3366735_3367026_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	56.9	8.0e-17
WP_025368263.1|3367037_3367271_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	71.1	3.7e-25
WP_004178082.1|3367349_3368837_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_062954975.1|3369674_3371036_-	deoxyguanosinetriphosphate triphosphohydrolase family protein	NA	NA	NA	NA	NA
WP_062954976.1|3371209_3371923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062954989.1|3372274_3373144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062954977.1|3373232_3374624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032443841.1|3374972_3375413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047667474.1|3375426_3375891_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	72.2	4.1e-63
WP_077265602.1|3375883_3376888_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	40.0	1.0e-31
WP_046622349.1|3376947_3377502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071561166.1|3377504_3377729_-	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	62.5	1.3e-19
WP_077257742.1|3377817_3378255_+	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	62.2	1.3e-39
WP_040234937.1|3378576_3378891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023279538.1|3379281_3379476_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_014228879.1|3379518_3379863_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_062954978.1|3380004_3382143_+	exodeoxyribonuclease VIII	NA	S4TNL0	Salmonella_phage	42.7	5.6e-99
WP_012542206.1|3382195_3382441_+	excisionase	NA	NA	NA	NA	NA
WP_032418030.1|3382421_3383549_+|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	58.4	4.4e-119
WP_004150800.1|3383666_3384917_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
WP_004150801.1|3385157_3385808_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
3385257:3385271	attR	AAAGAACGCCAGCCA	NA	NA	NA	NA
WP_004150802.1|3385824_3386283_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004150803.1|3386339_3387446_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 10
NZ_CP039808	Klebsiella pneumoniae strain C2660 chromosome, complete genome	5494793	3497203	3553362	5494793	portal,tail,plate,terminase,head,integrase,protease,capsid	Enterobacteria_phage(40.0%)	63	3495363:3495383	3529887:3529907
3495363:3495383	attL	AACCCGGAGTGCTCCGGGTTT	NA	NA	NA	NA
WP_077273873.1|3497203_3498358_-	phage late control D family protein	NA	B9A7A9	Serratia_phage	77.2	6.6e-171
WP_072353964.1|3498509_3499691_+|tail	phage tail protein	tail	A0A0A7NV69	Enterobacteria_phage	69.4	8.0e-156
WP_004187274.1|3499691_3500207_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	70.0	2.6e-63
WP_072353963.1|3500258_3500558_+|tail	phage tail protein	tail	B9A7B2	Serratia_phage	72.7	2.9e-30
WP_050554917.1|3500578_3500731_+|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	71.4	1.5e-11
WP_072353962.1|3500720_3503456_+|tail	phage tail tape measure protein	tail	B9A7B3	Serratia_phage	80.6	2.0e-242
WP_072353961.1|3503467_3503956_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	59.9	2.9e-51
WP_072353960.1|3504053_3505130_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	48.3	2.3e-32
WP_064144972.1|3505141_3505885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072353959.1|3505890_3508155_-	hypothetical protein	NA	B5TAB2	Burkholderia_phage	39.7	5.7e-102
WP_072353958.1|3508156_3508759_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	44.8	1.8e-42
WP_040209819.1|3508751_3509651_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	62.2	6.2e-92
WP_004187254.1|3509637_3510006_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	57.4	2.3e-29
WP_072353957.1|3510002_3510587_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	61.4	8.7e-63
WP_072353956.1|3510586_3511228_-	phage virion morphogenesis protein	NA	A0A0M4RCU1	Salmonella_phage	49.8	1.4e-45
WP_004187249.1|3511224_3511683_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	46.8	3.1e-31
WP_072353969.1|3511679_3511943_-	peptidase	NA	NA	NA	NA	NA
WP_117328715.1|3511827_3512223_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_072353955.1|3512219_3512771_-	lysozyme	NA	Q1I0Z1	Pasteurella_virus	42.5	6.8e-33
WP_004187237.1|3512767_3513049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004187236.1|3513039_3513240_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	64.6	3.0e-15
WP_032705909.1|3513239_3513737_-|head	head completion/stabilization protein	head	B9A7B7	Serratia_phage	69.7	2.2e-59
WP_072353954.1|3513839_3514700_-|terminase	terminase	terminase	B9A7B6	Serratia_phage	68.4	1.0e-83
WP_060528036.1|3514746_3515796_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	53.9	2.3e-106
WP_072353953.1|3515819_3516653_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	65.3	6.5e-96
WP_060528038.1|3516813_3518535_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	66.5	4.3e-227
WP_077273872.1|3518555_3519590_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.6	2.0e-139
WP_072353968.1|3519997_3520312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072353951.1|3520584_3520992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072353950.1|3521163_3523758_-	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	51.7	1.1e-192
WP_072353949.1|3523750_3524767_-	DNA cytosine methyltransferase	NA	Q6J1P4	Burkholderia_virus	54.8	2.4e-92
WP_158413321.1|3524742_3524898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072353948.1|3525068_3526037_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	49.1	3.1e-73
WP_046624144.1|3526045_3526624_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	39.5	2.7e-32
WP_046624145.1|3526620_3526845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004187204.1|3526912_3527185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004187203.1|3527200_3527587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071561575.1|3527603_3527801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023328159.1|3527992_3528325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004201485.1|3528419_3528722_+	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	61.0	2.6e-26
WP_072353947.1|3528809_3529817_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	52.1	7.6e-99
WP_004221448.1|3529913_3531179_-	bifunctional glucose-1-phosphatase/inositol phosphatase	NA	NA	NA	NA	NA
3529887:3529907	attR	AACCCGGAGTGCTCCGGGTTT	NA	NA	NA	NA
WP_002898606.1|3531313_3531763_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004150831.1|3531878_3532667_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002898602.1|3532687_3532909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002898600.1|3533165_3533288_+	small membrane protein	NA	NA	NA	NA	NA
WP_002898598.1|3533406_3534798_-	APC family permease	NA	NA	NA	NA	NA
WP_002898595.1|3535151_3536573_-	glutamine synthetase	NA	NA	NA	NA	NA
WP_004221445.1|3536798_3537551_+	gamma-glutamyl-gamma-aminobutyrate hydrolase	NA	NA	NA	NA	NA
WP_002898590.1|3537576_3538134_+	HTH-type transcriptional regulator PuuR	NA	NA	NA	NA	NA
WP_004150832.1|3538454_3539942_+	aldehyde dehydrogenase PuuC	NA	NA	NA	NA	NA
WP_062954981.1|3539944_3541225_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_004221441.1|3541221_3542184_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002898577.1|3542266_3543352_+	tartrate dehydrogenase	NA	NA	NA	NA	NA
WP_002898574.1|3543856_3545464_+	BCCT family transporter	NA	NA	NA	NA	NA
WP_002898571.1|3545500_3546625_+	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_004150833.1|3546643_3548092_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_002898475.1|3548149_3549115_+	oxidoreductase	NA	NA	NA	NA	NA
WP_002898472.1|3549284_3549473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004176625.1|3549537_3549825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002898466.1|3549803_3550424_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004150834.1|3550780_3552433_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002898458.1|3552702_3553362_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	46.6	3.2e-37
>prophage 11
NZ_CP039808	Klebsiella pneumoniae strain C2660 chromosome, complete genome	5494793	3638130	3734191	5494793	portal,lysis,tail,plate,transposase,terminase,tRNA,head,protease,integrase,capsid	Salmonella_phage(55.74%)	98	3693656:3693674	3734266:3734284
WP_002898139.1|3638130_3639423_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
WP_002898137.1|3639513_3640857_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
WP_002898132.1|3640865_3641477_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_004150846.1|3641599_3645853_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
WP_000228469.1|3645988_3646483_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_004147787.1|3646766_3646898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002898019.1|3647015_3647984_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.2e-62
WP_002898017.1|3648098_3649865_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
WP_004150847.1|3649865_3651587_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_004141853.1|3651613_3652333_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3652686_3652905_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3653025_3655305_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3655335_3655653_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3655978_3656200_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|3656276_3658217_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|3658213_3659329_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_002896437.1|3659475_3661134_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_002896434.1|3661553_3662249_+	aquaporin Z	NA	NA	NA	NA	NA
WP_004147773.1|3662364_3663264_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_002896412.1|3663407_3665060_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_002896410.1|3665070_3666039_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_002896408.1|3666250_3666685_-	DoxX family protein	NA	NA	NA	NA	NA
WP_002896406.1|3666836_3668555_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_002896404.1|3668593_3669595_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_002896401.1|3669605_3671048_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002896399.1|3671135_3672149_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002896397.1|3672145_3672976_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
WP_004150851.1|3673007_3674147_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_002896394.1|3675024_3675540_+	lipoprotein	NA	NA	NA	NA	NA
WP_032419144.1|3675766_3676495_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
WP_002896390.1|3676515_3677247_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896386.1|3677253_3677970_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_004150852.1|3677969_3678638_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_002896384.1|3678821_3679553_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896382.1|3679595_3681068_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
WP_002896380.1|3681064_3681781_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
WP_002896378.1|3681859_3682987_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
WP_002896376.1|3683028_3683517_-	DUF2593 family protein	NA	NA	NA	NA	NA
WP_002896372.1|3683574_3684420_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_002896371.1|3684416_3685370_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_004176719.1|3685380_3686547_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.3e-30
WP_002896368.1|3686677_3687790_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896365.1|3688138_3688618_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_002896363.1|3688706_3689609_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
WP_002896354.1|3690430_3690718_-	YbjC family protein	NA	NA	NA	NA	NA
WP_002896352.1|3690920_3691184_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
WP_002896351.1|3691190_3691574_-	membrane protein	NA	NA	NA	NA	NA
WP_004179131.1|3691840_3693526_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_004226292.1|3693517_3693640_-	hypothetical protein	NA	NA	NA	NA	NA
3693656:3693674	attL	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
WP_000972391.1|3693745_3693964_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_002896225.1|3694055_3695156_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_002896224.1|3695152_3695638_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_014342962.1|3695634_3698028_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	44.0	1.1e-106
WP_002896220.1|3698254_3698374_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_002896204.1|3698388_3698688_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896201.1|3698740_3699256_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896193.1|3699265_3700438_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896191.1|3700576_3701653_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_004232615.1|3701682_3701844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002896186.1|3701882_3702614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152882.1|3702617_3705569_-	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
WP_004150856.1|3705570_3706170_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_002896182.1|3706162_3707071_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_032441567.1|3707057_3707420_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	83.9	4.9e-48
WP_002896177.1|3707416_3707989_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_000019445.1|3708348_3709329_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
WP_004199112.1|3709466_3709976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896175.1|3709972_3710419_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_002896172.1|3710411_3710843_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896170.1|3710805_3710952_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	76.1	6.0e-13
WP_002896168.1|3710938_3711367_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896163.1|3711363_3711747_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896161.1|3711751_3712261_-	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896158.1|3712241_3712457_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896155.1|3712460_3712664_-|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_162220120.1|3712663_3713128_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	88.3	7.9e-75
WP_000059191.1|3713223_3713874_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002895972.1|3713877_3714936_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_002895967.1|3714952_3715786_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_004150858.1|3715928_3717695_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895959.1|3717694_3718720_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_004199124.1|3718781_3720524_-	AIPR family protein	NA	NA	NA	NA	NA
WP_000700647.1|3720799_3721477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|3721591_3721825_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|3721835_3722024_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_004178082.1|3722124_3723612_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004150862.1|3724087_3726502_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_004150863.1|3726498_3727356_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
WP_000752622.1|3727352_3727580_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_004150864.1|3727579_3727813_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
WP_000963473.1|3727880_3728222_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_000956179.1|3728185_3728386_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
WP_000460893.1|3728393_3728903_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000188448.1|3728935_3729157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152885.1|3729302_3730181_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
WP_004150866.1|3730192_3731137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004178082.1|3731235_3732723_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_014342959.1|3733210_3734191_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.2	1.4e-97
3734266:3734284	attR	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
>prophage 12
NZ_CP039808	Klebsiella pneumoniae strain C2660 chromosome, complete genome	5494793	4385824	4397477	5494793	integrase	Enterobacteria_phage(70.0%)	15	4385676:4385689	4389889:4389902
4385676:4385689	attL	TCTGACATATTTTT	NA	NA	NA	NA
WP_004144574.1|4385824_4386928_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
WP_002889940.1|4386938_4388192_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_002889938.1|4388544_4389735_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_004152029.1|4389722_4390673_+	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
4389889:4389902	attR	AAAAATATGTCAGA	NA	NA	NA	NA
WP_004152979.1|4390672_4391098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020802988.1|4391444_4391594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152202.1|4391665_4392232_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
WP_004152203.1|4392249_4392495_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_062956184.1|4392491_4393229_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.9e-70
WP_004903606.1|4393528_4393666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002889915.1|4393770_4394037_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_072028197.1|4394039_4394591_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_004219964.1|4394635_4394815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889897.1|4394811_4395132_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_002889890.1|4395143_4397477_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
>prophage 13
NZ_CP039808	Klebsiella pneumoniae strain C2660 chromosome, complete genome	5494793	4865481	4875006	5494793	transposase	Enterobacteria_phage(85.71%)	12	NA	NA
WP_004152207.1|4865481_4867815_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	83.9	0.0e+00
WP_004152206.1|4867829_4868150_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_004152205.1|4868146_4868374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072093163.1|4868370_4868913_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	69.4	1.1e-30
WP_000556592.1|4868915_4869182_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.0e-30
WP_004152204.1|4869742_4870480_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.1e-70
WP_004152203.1|4870476_4870722_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_004152202.1|4870739_4871306_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
WP_014342868.1|4871377_4871527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152201.1|4872046_4873126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152200.1|4873126_4873663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019445.1|4874025_4875006_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
>prophage 1
NZ_CP039809	Klebsiella pneumoniae strain C2660 plasmid pC2660-2, complete sequence	205652	1727	96732	205652	protease,integrase,transposase	Escherichia_phage(19.35%)	89	75140:75199	85317:86654
WP_001515717.1|1727_2468_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
WP_004152065.1|3611_4559_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.6	1.8e-12
WP_071527918.1|4585_4897_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011977741.1|4916_5885_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.1	2.5e-184
WP_004197688.1|6557_6815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080895248.1|7434_8871_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004152070.1|9853_11131_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_004178088.1|11193_13191_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
WP_085955172.1|14230_15438_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
WP_004178091.1|16866_17298_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_003032875.1|17548_19024_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_001572351.1|19016_19697_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
WP_000475512.1|19886_21272_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_001246153.1|21300_21654_+	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_004152079.1|21767_23060_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_004098958.1|23070_26217_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
WP_000758228.1|26303_26744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162220125.1|26870_29318_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.9	2.0e-84
WP_000843497.1|29358_29556_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004118669.1|29589_30327_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
WP_001023257.1|30615_31065_-	copper resistance protein	NA	NA	NA	NA	NA
WP_000925242.1|31298_33116_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_001242438.1|33115_34012_+	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_000025662.1|34051_34432_+	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_004118344.1|34436_35366_+	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_001188930.1|35420_36101_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_004152084.1|36097_37498_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
WP_004152085.1|37714_38149_+	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_004152086.1|38380_38560_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_031944101.1|40302_40812_+	major intrinsic protein MIP	NA	NA	NA	NA	NA
WP_004152091.1|40861_41359_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152092.1|41690_42017_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004152093.1|42013_42727_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	77.0	2.9e-92
WP_004182005.1|42735_43281_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_004152095.1|43356_43719_+	arsenic metallochaperone ArsD family protein	NA	NA	NA	NA	NA
WP_004152096.1|45615_46152_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152097.1|46184_46610_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	2.3e-52
WP_004152098.1|46622_47912_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	1.9e-171
WP_004152099.1|47959_49711_-	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_004152100.1|49728_50091_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_004152101.1|50140_50491_-	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.4e-23
WP_004152102.1|50848_51118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152103.1|51105_51681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152104.1|51711_52206_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_004152105.1|52249_52618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152106.1|52651_52855_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_004152107.1|52903_53161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152108.1|53236_53491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003026799.1|53666_53933_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_003026803.1|53920_54403_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_020314316.1|54614_55961_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_004152113.1|57803_58766_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_009483782.1|58752_59502_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_004152115.1|59739_59937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152116.1|59936_62732_-	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.0	5.2e-129
WP_004152117.1|62846_63416_-	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_004152118.1|63450_63732_-	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
WP_004118208.1|63975_64239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118209.1|64253_64517_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000019473.1|65718_66699_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004152692.1|67907_68777_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152693.1|68770_69781_-	phosphonate dehydrogenase PtxD	NA	A0A1V0SBV6	Catovirus	25.1	1.4e-15
WP_004152694.1|69789_70617_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_004152695.1|70625_71489_-	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014386147.1|71485_72313_-	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	9.0e-21
WP_004217321.1|73168_73873_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
75140:75199	attL	TTAATGAGATGGTCACTCCCTCCTTCCCAGTACTATGCTGAGGACAGGCTTTCATTCGGA	NA	NA	NA	NA
WP_000427619.1|75207_76212_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_044117068.1|76503_77172_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.5	1.9e-130
WP_000018329.1|77361_78177_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|78327_79032_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000845039.1|79523_80537_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001083725.1|80681_81179_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_001336345.1|81290_81581_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001206356.1|81586_82378_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000679427.1|82541_82889_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|82882_83722_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_004883563.1|83849_84122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000427619.1|84303_85308_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_000184001.1|85535_86741_+	chromate efflux transporter	NA	NA	NA	NA	NA
85317:86654	attR	TCCGAATGAAAGCCTGTCCTCAGCATAGTACTGGGAAGGAGGGAGTGACCATCTCATTAAATAAAGCACGCTAAGCCGTAAGTAAGCGTGCTCCTGTGAAAGCCACAGCTAAAACTGCGTAGTACACATAGAGGTATTTTTTTCTAGATTTATATCGAATTTCGTTATCGAATTTCGCTTATTATTGATCAACTCGTTGCAGATCATGAAGGCGAAAGTATGACGAATAACCCTACCGATGACAGCAGACCATGGTCGGTCTTTCTTATTTTTCTGCGGCTTGGATTGACATCTTTTGGCGGCCCCATTGCGCACTTGGGCTACTTCCGCGCCGAATTTGTCACACGGCGGCGCTGGCTCTCCGAACGGAGCTATGCTGACTTGGTCGCGCTTTGTCAGTTCTTGCCAGGGCCTGCAAGCAGCCAGGTCGGCATAGCGGTAGGACTGTCTCGGGCTGGATACAGCGGGGCGCTGGCTGCTTGGGCTGGCTTCACGCTGCCGTCTGCCATAGCCTTGATCCTTTTTGCGCTCGGCATCTCCAGCTATGGCGATTACGTCTCGCAGGGCGCGTTGCATGGCTTAAAAGTGGTGGCTGTGGCCGTGGTCGCTCAAGCAGTATGGGGCATGGCGCGTAACCTATGCACGGATGGGCTGCGAGTCACCATCATGGCAATTGCTACCTGCGTCGTTTTACTTGTGCCGTCCGCGTGGGGACAGGTTGGCGTGATTGCTATCGCAGGCATCGCAGGCCGGTTATTGTTCAAGCCAGCGAAAGTTGTTGAGCATGACCCCCTACCTATCACGGTCAGTCACCGGGCCGGCGTGCTTTGGCTCTCGCTGTTCTTTGTCTTGCTGATTGGCCTGCCGGTGTTGGCCGAACTGATGCCAAGTCAAACCATGGCAATGGTGGATTCCTTCTATCGTGTCGGATCACTGGTGTTCGGCGGTGGTCACGTTGTGCTGCCATTACTGCAAGCCGAAGTGGTGCCCTCCGGCTGGGTCAACAATGAATCCTTTCTCGCGGGGTACGGGGCAGCTCAAGCGGTGCCCGGCCCTTTGTTCACGTTCGCCGCGTTTCTTGGTGCCTCGATGAACACCGCCCCGTCGGGCTGGATCGGCGGCATTGTGTGTCTGCTGGCTATCTTCGCGCCCTCGTTCTTGCTGGTCGTCGGATCAATGCCATTTTGGGAGCGTTTGCGCCGCAATACAGGCATCCAAGCTGCGCTGGCCGGGATCAATGCCGCTGTAGTCGGCTTGCTGCTGGCCGCGCTGTATCAGCCTGTATGGACTAGCGCCATCTTTCAGCCGCAAGACTTCGGCTTGGCATTAGTTGCCCTT	NA	NA	NA	NA
WP_000130000.1|86751_87057_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|87283_88048_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001137892.1|88540_89125_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|89124_90363_-	MFS transporter	NA	NA	NA	NA	NA
WP_000219391.1|90359_91265_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_004217321.1|91386_92091_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001553819.1|92360_95258_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
WP_001398199.1|95394_95796_-	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_000557619.1|95728_95986_-	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_000616807.1|96078_96732_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 1
NZ_CP039810	Klebsiella pneumoniae strain C2660 plasmid pC2660-3-KPC, complete sequence	153556	1796	20837	153556	protease,transposase	Escherichia_phage(41.67%)	19	NA	NA
WP_000616807.1|1796_2450_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000557619.1|2542_2800_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_001398199.1|2732_3134_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_001067855.1|4444_5149_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004199234.1|6417_7299_-	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_014343469.1|7315_7462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013213985.1|7574_8555_-|transposase	IS481-like element ISKpn27 family transposase	transposase	A8RHK4	Spiroplasma_virus	27.4	2.9e-10
WP_014343468.1|8677_9151_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	99.3	3.3e-76
WP_001067855.1|9190_9895_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_014342101.1|10303_10426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013188475.1|10405_11281_+	class A extended-spectrum beta-lactamase CTX-M-65	NA	A0A1B0VBP7	Salmonella_phage	98.9	6.8e-152
WP_013362812.1|11315_12284_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	100.0	1.6e-186
WP_001067855.1|13701_14406_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|15516_16221_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000957857.1|16898_17087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064441864.1|17178_17715_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	2.8e-84
WP_000027057.1|17897_18758_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_012372818.1|18927_19683_+	16S rRNA (guanine(1405)-N(7))-methyltransferase RmtB1	NA	NA	NA	NA	NA
WP_001067858.1|20132_20837_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
>prophage 2
NZ_CP039810	Klebsiella pneumoniae strain C2660 plasmid pC2660-3-KPC, complete sequence	153556	77915	91721	153556	transposase	Enterobacteria_phage(18.18%)	18	NA	NA
WP_000019445.1|77915_78896_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
WP_015493087.1|79409_79805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015493086.1|79801_80413_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_015493085.1|80409_81360_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	55.6	6.6e-76
WP_040219232.1|81506_81707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022652286.1|81760_82393_-	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	31.9	2.5e-07
WP_015493083.1|82755_83961_+	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	89.2	1.1e-205
WP_016479949.1|83957_84929_+	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	68.9	1.4e-113
WP_015493081.1|85064_86336_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.0	6.1e-154
WP_015493080.1|86335_86758_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.5	3.1e-30
WP_015493079.1|86937_87609_-	Gifsy-2 prophage protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.7	5.1e-83
WP_002211749.1|87967_88645_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	1.6e-28
WP_015493077.1|88644_88866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015493076.1|88876_89296_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_015493075.1|89349_90129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015493074.1|90533_91040_+	antirestriction protein ArdA	NA	A0A1I9S7Y0	Rhodococcus_phage	31.8	4.8e-09
WP_015493073.1|91082_91274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015493072.1|91466_91721_+	hypothetical protein	NA	H9C187	Pectobacterium_phage	46.2	5.2e-12
>prophage 3
NZ_CP039810	Klebsiella pneumoniae strain C2660 plasmid pC2660-3-KPC, complete sequence	153556	122233	133390	153556		Escherichia_phage(50.0%)	13	NA	NA
WP_001568041.1|122233_122935_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.2	1.6e-26
WP_014343518.1|123136_123253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568040.1|123371_123602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013214012.1|123664_124336_-	mediator of plasmid stability	NA	NA	NA	NA	NA
WP_004152353.1|124338_125310_-	mediator of plasmid stability	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_014343519.1|125440_125566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004178082.1|125558_127046_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_014343520.1|127358_127475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568036.1|127452_127884_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
WP_013214011.1|127883_129155_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	7.5e-152
WP_011977819.1|129236_130211_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	53.8	1.4e-86
WP_011977818.1|130210_131416_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	5.3e-163
WP_004118283.1|132523_133390_-	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
>prophage 1
NZ_CP039811	Klebsiella pneumoniae strain C2660 plasmid pC2660-4-NDM, complete sequence	53097	27761	35538	53097	transposase	Escherichia_phage(57.14%)	8	NA	NA
WP_001067855.1|27761_28466_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_002904004.1|28602_29463_+	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|29483_30245_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_001067855.1|31085_31790_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001549892.1|32182_32422_-	hypothetical protein	NA	I6PD82	Cronobacter_phage	55.1	4.4e-21
WP_000343760.1|32523_33744_+|transposase	ISL3-like element ISKox3 family transposase	transposase	NA	NA	NA	NA
WP_001549893.1|33832_34495_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	29.1	9.7e-10
WP_000516402.1|34875_35538_+	peptidyl-arginine deiminase	NA	E5FFJ3	Burkholderia_phage	25.2	2.6e-07
