The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP047591	Aminipila sp. CBA3637 chromosome, complete genome	3512404	625412	633595	3512404	plate,tail,holin	Clostridium_phage(33.33%)	12	NA	NA
WP_162363646.1|625412_626027_-|plate	baseplate J/gp47 family protein	plate	A0A0A7S0L4	Clostridium_phage	52.5	2.4e-47
WP_162361233.1|625936_626452_-	hypothetical protein	NA	E5DV64	Deep-sea_thermophilic_phage	35.3	6.8e-11
WP_162361234.1|626448_626871_-	DUF2634 domain-containing protein	NA	NA	NA	NA	NA
WP_162361235.1|626870_627188_-	DUF2577 domain-containing protein	NA	NA	NA	NA	NA
WP_162361236.1|627189_628179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162361237.1|628153_628588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162361238.1|628596_630519_-	hypothetical protein	NA	A0A0E3Y5G6	Fusobacterium_phage	35.7	2.9e-30
WP_162361239.1|630706_631087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162361240.1|631161_631584_-|tail	phage tail tube protein	tail	A0A2H4J032	uncultured_Caudovirales_phage	27.3	1.2e-08
WP_162361241.1|631595_632684_-|tail	phage tail protein	tail	A0A0A8WJR2	Clostridium_phage	33.0	1.3e-43
WP_162361242.1|632676_633189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162361243.1|633346_633595_-|holin	phage holin	holin	A0A1Q1PW49	Staphylococcus_phage	42.0	1.1e-09
>prophage 2
NZ_CP047591	Aminipila sp. CBA3637 chromosome, complete genome	3512404	1841972	1847916	3512404		Synechococcus_phage(33.33%)	6	NA	NA
WP_162362243.1|1841972_1842452_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	45.9	7.5e-28
WP_162362244.1|1842510_1843215_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3HWF9	Synechococcus_phage	38.8	9.6e-40
WP_162362245.1|1843277_1844705_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.6	1.5e-55
WP_162362246.1|1844716_1845748_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.5	2.5e-68
WP_162362247.1|1845741_1846329_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.1	1.0e-23
WP_162362248.1|1846383_1847916_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	45.8	3.4e-66
>prophage 3
NZ_CP047591	Aminipila sp. CBA3637 chromosome, complete genome	3512404	2341908	2377973	3512404	tail,integrase,terminase,plate,portal,head	Clostridium_phage(47.37%)	39	2341816:2341846	2383869:2383899
2341816:2341846	attL	GAGTTCGACTCTCCTCATCTCCACCACAAAA	NA	NA	NA	NA
WP_162362634.1|2341908_2343063_-|integrase	site-specific integrase	integrase	S5MNZ2	Brevibacillus_phage	34.6	3.9e-54
WP_162362635.1|2343222_2343660_-	YHYH domain-containing protein	NA	NA	NA	NA	NA
WP_162362636.1|2343965_2344295_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_162362637.1|2344534_2344717_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_162362638.1|2344727_2344934_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_162362639.1|2345041_2345314_+	stage V sporulation protein S	NA	A0A1J0GVV0	Streptomyces_phage	53.2	4.2e-12
WP_162362640.1|2345319_2345610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162362641.1|2345620_2346124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162362642.1|2346113_2346293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162362643.1|2346241_2346784_+	hypothetical protein	NA	A0A217ER34	Bacillus_phage	43.8	1.0e-09
WP_162362644.1|2346780_2346948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162362645.1|2346962_2347484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162362646.1|2347483_2348668_+	DUF2800 domain-containing protein	NA	H7BVP9	unidentified_phage	48.8	4.9e-97
WP_162362647.1|2348670_2349378_+	DUF2815 family protein	NA	A0A0A7RVM4	Clostridium_phage	47.2	6.4e-36
WP_162362648.1|2349374_2351348_+	DNA polymerase	NA	H7BVQ1	unidentified_phage	59.6	1.4e-229
WP_162362649.1|2351354_2353745_+	virulence-associated protein E	NA	A0A0A7RTG3	Clostridium_phage	46.9	7.4e-217
WP_162362650.1|2354306_2355707_+	DEAD/DEAH box helicase	NA	S5MA26	Brevibacillus_phage	55.6	1.4e-146
WP_162362651.1|2355755_2355968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162362652.1|2355987_2357157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162362653.1|2357131_2357332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162362654.1|2357853_2358546_+	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_162362655.1|2358765_2359719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162362656.1|2359724_2360279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162362657.1|2360700_2361459_+|terminase	terminase	terminase	A0A2H4J4R0	uncultured_Caudovirales_phage	45.7	4.2e-49
WP_162362658.1|2362740_2364159_+|portal	phage portal protein	portal	A0A0A7S0I9	Clostridium_phage	63.8	3.6e-171
WP_162362659.1|2364139_2365690_+|head	phage head morphogenesis protein	head	H7BWE7	unidentified_phage	31.6	4.4e-61
WP_162362660.1|2365893_2366205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162362661.1|2366652_2367303_+	hypothetical protein	NA	A0A0A7S0J5	Clostridium_phage	73.5	3.8e-43
WP_162362662.1|2368377_2368785_+	DNA-packaging protein	NA	NA	NA	NA	NA
WP_162362663.1|2368781_2369117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162362664.1|2369113_2369527_+	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_162362665.1|2369516_2369924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162362666.1|2369939_2370977_+|tail	phage tail sheath protein	tail	A0A0A7RTT5	Clostridium_phage	32.2	9.1e-47
WP_162362667.1|2370993_2371470_+|tail	phage tail tube protein	tail	A0A0A7RVP1	Clostridium_phage	36.7	1.7e-19
WP_162362668.1|2372105_2374076_+	tape measure protein	NA	S6AVU8	Thermus_phage	31.6	1.1e-64
WP_162362669.1|2374078_2374750_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A7RVP5	Clostridium_phage	36.9	2.7e-31
WP_162362670.1|2376023_2376416_+	DUF2634 domain-containing protein	NA	A0A0A7RTH1	Clostridium_phage	53.2	4.0e-27
WP_162363743.1|2376427_2377432_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	48.8	4.6e-80
WP_162362671.1|2377433_2377973_+	YmfQ family protein	NA	A0A0A7RUW8	Clostridium_phage	38.5	6.9e-30
2383869:2383899	attR	GAGTTCGACTCTCCTCATCTCCACCACAAAA	NA	NA	NA	NA
>prophage 4
NZ_CP047591	Aminipila sp. CBA3637 chromosome, complete genome	3512404	3381942	3446314	3512404	holin,tRNA,tail,capsid,integrase,terminase,plate,portal,head	Bacillus_phage(18.52%)	79	3375088:3375105	3440637:3440651
3375088:3375105	attL	GCCACAACTTTTTGATTC	NA	NA	NA	NA
WP_162363495.1|3381942_3383073_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2R2ZHE2	Clostridioides_phage	25.2	1.3e-09
3375088:3375105	attL	GCCACAACTTTTTGATTC	NA	NA	NA	NA
WP_162363496.1|3383051_3383984_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_162363497.1|3384014_3385976_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	31.0	4.0e-67
WP_162363498.1|3385968_3388629_-	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	25.2	3.5e-50
WP_162363499.1|3388679_3389879_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_162363500.1|3392657_3393554_-	polyprenyl synthetase family protein	NA	A0A1V0SE37	Indivirus	23.4	4.4e-05
3391602:3391619	attR	GCCACAACTTTTTGATTC	NA	NA	NA	NA
WP_162363501.1|3393568_3393763_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
3391602:3391619	attR	GCCACAACTTTTTGATTC	NA	NA	NA	NA
WP_162363502.1|3393765_3394977_-	exodeoxyribonuclease VII large subunit	NA	A0A1V0SC03	Catovirus	30.0	2.5e-40
WP_162363503.1|3394967_3395936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162363504.1|3395941_3396349_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_162363505.1|3396352_3396736_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_162363506.1|3396866_3397514_-	SpoIIIAH-like family protein	NA	NA	NA	NA	NA
WP_162363507.1|3397506_3397722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162363508.1|3397764_3397932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162363509.1|3397945_3399040_-	stage III sporulation protein AE	NA	NA	NA	NA	NA
WP_162363510.1|3399226_3399667_-	Fe-S cluster assembly scaffold protein NifU	NA	A0A2H4N7M4	Lake_Baikal_phage	54.5	1.2e-29
WP_162363511.1|3399673_3400843_-	cysteine desulfurase NifS	NA	H7BUW1	unidentified_phage	39.6	4.9e-41
WP_162363512.1|3401082_3401529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162363513.1|3401607_3401817_-	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_162363514.1|3401861_3402419_-	recombinase family protein	NA	A0A1J1J8Z4	Escherichia_phage	45.4	1.6e-37
WP_162363515.1|3402804_3404178_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.1	3.9e-05
WP_162363803.1|3404381_3405194_-	sporulation transcription factor Spo0A	NA	W8CYM9	Bacillus_phage	30.7	4.0e-05
WP_162363516.1|3405320_3406412_-	SpoIVB peptidase	NA	NA	NA	NA	NA
WP_162363517.1|3406427_3406877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162363518.1|3406920_3407646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162363519.1|3407733_3408420_-	DUF2344 domain-containing protein	NA	NA	NA	NA	NA
WP_162363520.1|3408412_3410254_-	TIGR03960 family B12-binding radical SAM protein	NA	NA	NA	NA	NA
WP_162363521.1|3410263_3410518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162363522.1|3410619_3410796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162363523.1|3410854_3411112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162363524.1|3411214_3412510_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_128745471.1|3412599_3412860_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_162363525.1|3412942_3413305_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_162363526.1|3413459_3414548_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	65.7	1.2e-118
WP_162363527.1|3415316_3415856_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_162363528.1|3415858_3417208_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_162363529.1|3417360_3417537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162363530.1|3417739_3417952_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_162363531.1|3418057_3418306_-|holin	phage holin	holin	H9A138	Staphylococcus_phage	39.5	2.6e-08
WP_162363532.1|3418302_3418572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162363533.1|3418583_3419324_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_162363534.1|3419366_3419600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162363535.1|3420216_3420618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162363536.1|3420631_3421186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162363537.1|3421200_3422106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162363538.1|3422117_3422648_-	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_162363539.1|3422647_3423730_-|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	34.5	7.1e-42
WP_162363540.1|3423872_3424202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162363541.1|3424216_3424582_-	DUF2577 domain-containing protein	NA	NA	NA	NA	NA
WP_162363542.1|3424582_3425593_-|terminase	terminase	terminase	NA	NA	NA	NA
WP_162363543.1|3425595_3426018_-|portal	phage portal protein	portal	NA	NA	NA	NA
WP_162363544.1|3426034_3427696_-	hypothetical protein	NA	A0A218KCH0	Bacillus_phage	30.8	2.2e-26
WP_162363545.1|3427927_3428365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162363546.1|3428382_3428799_-	hypothetical protein	NA	A0A090DCP2	Clostridium_phage	32.6	2.1e-10
WP_162363547.1|3428821_3429913_-|tail	phage tail sheath protein	tail	A0A0A8WJL8	Clostridium_phage	32.8	1.1e-45
WP_162363548.1|3429927_3430371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162363549.1|3430383_3430788_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_162363550.1|3430797_3431130_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_162363551.1|3431141_3431432_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A075KJE2	Lactobacillus_phage	56.8	3.7e-22
WP_162363552.1|3431587_3432766_-|capsid	phage major capsid protein	capsid	A0A2P1CCA5	Lactobacillus_phage	50.8	4.9e-97
WP_162363804.1|3433347_3434535_-|portal	phage portal protein	portal	A0A075KQ80	Lactobacillus_phage	47.7	3.4e-98
WP_162363553.1|3437161_3437533_-	HNH endonuclease	NA	A0A0D4DD69	Staphylococcus_phage	39.5	1.9e-07
WP_162363554.1|3437817_3438375_-|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	46.7	9.2e-38
WP_162363555.1|3438553_3439540_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4J4W0	uncultured_Caudovirales_phage	40.3	2.5e-22
WP_162363805.1|3439574_3439778_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_162363556.1|3439860_3440130_+	CRISPR-associated protein Cas2	NA	A0A0N9STP5	Staphylococcus_phage	44.2	3.4e-14
WP_162363557.1|3440092_3440284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162363558.1|3440317_3440590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162363559.1|3440608_3441139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162360752.1|3441171_3441357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162363560.1|3441376_3441769_-	hypothetical protein	NA	Q24LD2	Clostridium_phage	40.7	1.1e-16
WP_162363561.1|3441831_3442341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162363562.1|3442337_3443171_-	DUF4373 domain-containing protein	NA	A0A0H4TKJ7	Bacillus_phage	35.5	2.9e-11
WP_162363563.1|3443260_3443635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162363564.1|3443665_3443884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162363565.1|3443914_3444106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162363566.1|3444118_3444511_-	single-stranded DNA-binding protein	NA	S5MNH0	Brevibacillus_phage	45.3	9.7e-26
WP_162363567.1|3444503_3445487_-	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_162363568.1|3445510_3446314_-	ParA family protein	NA	H7BUL8	unidentified_phage	39.2	5.2e-42
