The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP048222	Rhodocytophaga sp. 172606-1 chromosome, complete genome	8983451	12051	141790	8983451	bacteriocin,transposase	Bacillus_phage(21.43%)	117	NA	NA
WP_162441266.1|12051_12696_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_162441267.1|12593_12734_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_162441268.1|13028_13604_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_162441269.1|13658_14060_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_162441270.1|14109_14625_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_162447745.1|14828_15926_-	NAD(P)-dependent alcohol dehydrogenase	NA	K7Z7U2	Megavirus	42.9	4.6e-81
WP_162441271.1|16147_16633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162441272.1|16923_17709_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_162441273.1|17723_18833_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_162441274.1|18907_19054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162441275.1|19114_19984_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_162447746.1|20226_20877_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_162441276.1|20840_21272_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_162441277.1|21527_21899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162441278.1|22529_22685_-	PQQ-binding-like beta-propeller repeat protein	NA	NA	NA	NA	NA
WP_162441279.1|22724_23150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162441280.1|23139_23283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162441281.1|23417_23684_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_162441282.1|23656_23905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162441283.1|23901_24465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162441284.1|24449_24875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162441285.1|25296_25929_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_162441286.1|26090_27140_+	FecR family protein	NA	NA	NA	NA	NA
WP_162441287.1|27164_29735_+	SusC/RagA family TonB-linked outer membrane protein	NA	NA	NA	NA	NA
WP_162441288.1|29746_30607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162441289.1|30637_32395_+	RagB/SusD family nutrient uptake outer membrane protein	NA	NA	NA	NA	NA
WP_162441290.1|32421_32820_+	DUF4945 domain-containing protein	NA	NA	NA	NA	NA
WP_162441291.1|33017_35894_+	dehydrogenase	NA	NA	NA	NA	NA
WP_162441292.1|36334_37240_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_162441293.1|37575_38343_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_162441294.1|38375_38786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162441295.1|38853_39432_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_162441296.1|39535_40105_+	YceI family protein	NA	NA	NA	NA	NA
WP_162441297.1|40116_40335_+	4-oxalocrotonate tautomerase family protein	NA	NA	NA	NA	NA
WP_162441298.1|40347_41082_+	SDR family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.8	1.2e-05
WP_162441299.1|41152_41533_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_162441300.1|41567_42656_+	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_162441301.1|42777_43365_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_162447747.1|43454_43667_+	DUF2798 domain-containing protein	NA	NA	NA	NA	NA
WP_162441302.1|43716_44190_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_162441303.1|45955_46936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162441304.1|47084_48404_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_162441305.1|48438_48897_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_162441306.1|48899_50195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162441307.1|50315_52205_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_162441308.1|52217_53012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162447748.1|53140_53542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162441309.1|53585_54644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162447749.1|54827_55049_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_162441310.1|55045_55282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162441311.1|55946_56186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162441312.1|56250_58428_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_162441313.1|58947_59550_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_162441314.1|59691_60828_+	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_162441315.1|61060_62002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162441316.1|62957_63548_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_162441317.1|63564_63840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162441318.1|63861_65151_+	MFS transporter	NA	NA	NA	NA	NA
WP_162441319.1|65261_65678_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_162441320.1|65635_66193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162441321.1|66350_66800_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_162441322.1|67378_67642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162447750.1|67953_68679_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.9	5.4e-46
WP_162441323.1|68692_69190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162441324.1|69330_69651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162441325.1|69776_70835_-	DUF1016 domain-containing protein	NA	Q9JMP5	Wolbachia_phage	52.0	7.8e-102
WP_162441326.1|71077_71653_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	50.8	3.7e-42
WP_162441327.1|72986_73478_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_162441328.1|73723_74371_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_162441329.1|74986_75580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162441330.1|76456_79519_+	tetratricopeptide repeat protein	NA	W8CYM9	Bacillus_phage	39.2	4.2e-15
WP_162441331.1|80026_82792_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	24.5	2.3e-12
WP_162441332.1|83212_83938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162441333.1|84070_86011_+	T9SS type A sorting domain-containing protein	NA	E5EQB4	Micromonas_sp._RCC1109_virus	34.1	5.6e-05
WP_162441334.1|86035_86815_+	DUF1624 domain-containing protein	NA	NA	NA	NA	NA
WP_162441335.1|86913_87321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162441336.1|87680_88157_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_162441337.1|88352_88574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162441338.1|88633_88897_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_162441339.1|89742_90546_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_162447751.1|90625_91003_+	DoxX family protein	NA	NA	NA	NA	NA
WP_162447752.1|91267_91780_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_162447753.1|91783_91954_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_162441340.1|92086_93178_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_162441341.1|93489_93831_+	YrdB family protein	NA	NA	NA	NA	NA
WP_162441342.1|94115_94877_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_162441343.1|95192_96692_-	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	26.8	1.2e-23
WP_162441344.1|97759_98059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162441345.1|98619_102639_+	T9SS type A sorting domain-containing protein	NA	S5WIY5	Leptospira_phage	26.3	3.0e-13
WP_162441346.1|102868_103021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162441347.1|103248_104388_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_162441348.1|104463_105708_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_162441349.1|106402_106540_+|bacteriocin	class IIb bacteriocin, lactobin A/cerein 7B family	bacteriocin	NA	NA	NA	NA
WP_162441350.1|106834_108004_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_162441351.1|108032_110219_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	31.8	2.3e-52
WP_162441352.1|110788_111796_+	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	50.5	6.5e-74
WP_162441353.1|111919_112624_-	endonuclease	NA	NA	NA	NA	NA
WP_162441354.1|113234_113762_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_162441355.1|113922_114981_+	hypothetical protein	NA	A0A1V0SJG8	Klosneuvirus	31.9	6.5e-08
WP_162441356.1|115379_117092_+	PQQ-binding-like beta-propeller repeat protein	NA	NA	NA	NA	NA
WP_162441357.1|117061_117952_-	glycoside hydrolase family 16 protein	NA	NA	NA	NA	NA
WP_162441358.1|118248_119016_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_162441359.1|119539_119743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162441360.1|120425_120680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162441361.1|121836_122415_+	peroxidase-related enzyme	NA	NA	NA	NA	NA
WP_162441362.1|125409_126711_+	RagB/SusD family nutrient uptake outer membrane protein	NA	NA	NA	NA	NA
WP_162441363.1|126744_127926_+	DUF3179 domain-containing protein	NA	NA	NA	NA	NA
WP_162441364.1|128149_129631_+	M28 family peptidase	NA	NA	NA	NA	NA
WP_162441365.1|130155_131317_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	40.1	2.4e-48
WP_162441366.1|131478_131706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162441367.1|132020_132431_+	TerB family tellurite resistance protein	NA	NA	NA	NA	NA
WP_162441368.1|132727_132883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162441369.1|135131_136604_+	glycosidase	NA	NA	NA	NA	NA
WP_162441370.1|136592_137600_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_162441371.1|137596_139876_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_162441372.1|139952_141023_-	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_162447746.1|141139_141790_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP048222	Rhodocytophaga sp. 172606-1 chromosome, complete genome	8983451	152394	221930	8983451	transposase	Bacillus_phage(57.14%)	57	NA	NA
WP_162441382.1|152394_153162_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_162441383.1|153256_153688_+	PRC-barrel domain containing protein	NA	NA	NA	NA	NA
WP_162441384.1|153761_154034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162441385.1|154045_154321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162441386.1|154406_154805_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_162441387.1|155336_155657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162441388.1|155767_156142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162441389.1|156719_157217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162441390.1|157433_157802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162441391.1|158928_159348_-	response regulator	NA	NA	NA	NA	NA
WP_162441392.1|159390_162582_-	PAS domain-containing protein	NA	W8CYF6	Bacillus_phage	24.2	4.2e-10
WP_162441393.1|163017_164259_+	PAS domain S-box protein	NA	W8CYF6	Bacillus_phage	27.1	7.1e-22
WP_162441394.1|164481_165177_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_162441395.1|166399_166933_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	28.7	3.0e-09
WP_162441396.1|167066_170306_-	chemotaxis protein CheR	NA	NA	NA	NA	NA
WP_162441397.1|171156_171438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162441398.1|171454_172576_+	acyl-CoA desaturase	NA	A6N231	Microbacterium_phage	25.2	2.6e-07
WP_162441399.1|173041_173944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162441400.1|174048_174261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162441401.1|174721_175189_+	NfeD family protein	NA	NA	NA	NA	NA
WP_162441402.1|175191_176157_+	paraslipin	NA	NA	NA	NA	NA
WP_162441403.1|176305_176632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162441404.1|176731_177817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162441405.1|178287_179121_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_162441406.1|179401_179962_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_162441407.1|180094_180484_+	cupin	NA	NA	NA	NA	NA
WP_162441408.1|180605_181220_+	YceI family protein	NA	NA	NA	NA	NA
WP_162441409.1|183350_186377_-	PAS domain S-box protein	NA	W8CYF6	Bacillus_phage	27.2	7.8e-14
WP_162441410.1|186910_187087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162441411.1|188226_188655_-	ASCH domain-containing protein	NA	I6RTQ6	Croceibacter_phage	28.3	9.4e-06
WP_162441412.1|188663_189977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162441413.1|189992_190760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162441414.1|190802_192788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162441415.1|192769_194065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162441416.1|194052_194403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162441417.1|194477_194780_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_162441418.1|195047_196442_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_162441419.1|196453_198037_-	peptidase M36	NA	NA	NA	NA	NA
WP_162441420.1|198288_199770_-	hypothetical protein	NA	A0A2K9L5Z9	Tupanvirus	22.2	1.9e-13
WP_162441421.1|199775_200024_-	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_162441422.1|200036_201263_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_162441423.1|201750_202008_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_162441424.1|202359_203346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162441425.1|203529_204516_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_162441426.1|204800_205067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162441427.1|205982_207551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162441428.1|207553_208975_+	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_162441429.1|208976_209741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162441430.1|210470_213191_+	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_162441431.1|213781_214015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162441432.1|214380_216207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162441433.1|216203_217310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162441434.1|217648_218698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162441435.1|219629_220313_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_162441436.1|220314_221358_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_162441437.1|221555_221720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162441438.1|221747_221930_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP048222	Rhodocytophaga sp. 172606-1 chromosome, complete genome	8983451	447889	497766	8983451	transposase,integrase,protease	Lactobacillus_phage(50.0%)	39	459443:459457	498773:498787
WP_162441441.1|447889_448711_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	28.6	3.3e-15
WP_162441440.1|448710_449001_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_162441340.1|449446_450538_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_162447770.1|450862_451222_+	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_162441607.1|451341_451848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162447771.1|451945_452704_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_162441608.1|452965_453940_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_162441609.1|457668_459066_+	RagB/SusD family nutrient uptake outer membrane protein	NA	NA	NA	NA	NA
459443:459457	attL	TATTTGCTATATTGG	NA	NA	NA	NA
WP_162441610.1|459508_462562_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_162441611.1|462598_463948_+	RagB/SusD family nutrient uptake outer membrane protein	NA	NA	NA	NA	NA
WP_162441612.1|464044_465013_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_162441613.1|465066_465789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162441614.1|465808_466123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162441615.1|466227_466806_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_162441616.1|467223_470253_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_162441617.1|470274_471642_+	RagB/SusD family nutrient uptake outer membrane protein	NA	NA	NA	NA	NA
WP_162441618.1|471766_472543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162441619.1|472553_473042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162441620.1|473137_475519_+	PKD domain-containing protein	NA	NA	NA	NA	NA
WP_162441621.1|476683_477028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162441622.1|477083_477950_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_162441623.1|477973_479275_-	dienelactone hydrolase	NA	NA	NA	NA	NA
WP_162441624.1|479392_480121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162441625.1|480359_483128_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_162441626.1|483134_484286_+	DUF4249 domain-containing protein	NA	NA	NA	NA	NA
WP_162441627.1|484340_486767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162441628.1|486770_487406_-	DUF4291 domain-containing protein	NA	NA	NA	NA	NA
WP_162441629.1|487437_488376_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_162441630.1|488419_488875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162447772.1|488906_490223_-	sialate O-acetylesterase	NA	NA	NA	NA	NA
WP_162441631.1|490367_490787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162441632.1|491020_491407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162447773.1|491549_491975_-	DoxX family protein	NA	NA	NA	NA	NA
WP_162441633.1|492088_492607_-	DinB family protein	NA	NA	NA	NA	NA
WP_162441634.1|492869_493514_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_162447774.1|493631_494264_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_162441635.1|494412_494970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162441534.1|495682_496597_+|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	32.7	5.8e-29
WP_162441535.1|496593_497766_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
498773:498787	attR	CCAATATAGCAAATA	NA	NA	NA	NA
>prophage 4
NZ_CP048222	Rhodocytophaga sp. 172606-1 chromosome, complete genome	8983451	609394	655195	8983451	transposase,integrase,tRNA	Leptospira_phage(50.0%)	41	616380:616395	630509:630524
WP_162441731.1|609394_609820_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_162441732.1|609959_610397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162441733.1|610550_611948_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_162447781.1|612079_612685_+	C40 family peptidase	NA	A0A1J0GW44	Streptomyces_phage	48.6	5.2e-10
WP_162441734.1|612914_614093_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_162441735.1|614404_614929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162441736.1|615553_616087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162441737.1|616181_616898_-	hypothetical protein	NA	NA	NA	NA	NA
616380:616395	attL	AACTTGGTGGTTTTTA	NA	NA	NA	NA
WP_162441738.1|617072_617987_+|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	32.7	6.2e-31
WP_162441739.1|619449_620082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162441740.1|620194_620761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162441741.1|620907_621306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162441742.1|621434_621911_-	hypothetical protein	NA	R9TGI0	Vibrio_phage	35.2	2.8e-11
WP_162441743.1|622531_622909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162441744.1|623077_623794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162441741.1|624936_625335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162441745.1|625454_625898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162441746.1|626011_626434_-	DUF3997 domain-containing protein	NA	NA	NA	NA	NA
WP_162441747.1|626559_626952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162441748.1|627130_628921_-|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	34.1	2.8e-35
WP_162441749.1|629270_629840_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	42.2	3.0e-36
WP_162441750.1|630080_630275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162441751.1|630677_631904_-	AAA family ATPase	NA	NA	NA	NA	NA
630509:630524	attR	TAAAAACCACCAAGTT	NA	NA	NA	NA
WP_162441752.1|632811_633303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162441753.1|633372_634134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162441754.1|634435_636334_-	DUF927 domain-containing protein	NA	NA	NA	NA	NA
WP_162441755.1|636613_636820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162441756.1|636825_637089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162441757.1|637105_637327_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_162441758.1|637447_638143_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_162441759.1|638344_641107_+	class I SAM-dependent DNA methyltransferase	NA	Q6NE04	Leptospira_phage	50.0	4.8e-260
WP_162441760.1|641161_642667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162441761.1|642797_647372_-	T9SS type A sorting domain-containing protein	NA	NA	NA	NA	NA
WP_162441762.1|647971_649630_+	M1 family metallopeptidase	NA	NA	NA	NA	NA
WP_162441763.1|649846_650434_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_162441764.1|650499_650868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162441765.1|651164_651758_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_162441766.1|651763_652258_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_162441767.1|653019_653451_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_162447782.1|653414_654053_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_162441340.1|654103_655195_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP048222	Rhodocytophaga sp. 172606-1 chromosome, complete genome	8983451	1269861	1345164	8983451	transposase,integrase,protease	Leptospira_phage(33.33%)	66	1269659:1269698	1303532:1303571
1269659:1269698	attL	CTCATTCGTAATGAGCAGGTCGCCGGTTCGAGTCCGGCAG	NA	NA	NA	NA
WP_162442223.1|1269861_1271214_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_162442224.1|1271299_1271458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162442225.1|1272092_1272563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162442226.1|1272688_1273138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162442227.1|1273248_1274163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162442228.1|1274121_1274589_+|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	41.4	2.0e-09
WP_162442229.1|1274585_1275758_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_162442230.1|1275786_1275957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162442231.1|1276037_1276547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162442232.1|1276664_1278020_-|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	40.4	3.6e-75
WP_162442233.1|1278277_1278901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162442234.1|1279089_1279719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162442235.1|1279909_1280098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162442236.1|1280080_1280800_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	30.7	2.4e-22
WP_162442237.1|1280823_1282389_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	33.2	1.4e-67
WP_162447809.1|1282649_1283465_+|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	32.8	1.1e-28
WP_162442238.1|1283461_1284634_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_162442239.1|1284941_1285298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162442240.1|1285476_1285932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162441746.1|1286048_1286471_-	DUF3997 domain-containing protein	NA	NA	NA	NA	NA
WP_162442241.1|1286972_1288019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162442242.1|1288590_1289085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162442243.1|1289199_1289493_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_162442244.1|1289480_1289660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162442245.1|1289822_1290218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162442246.1|1290353_1290764_-	DUF2569 domain-containing protein	NA	NA	NA	NA	NA
WP_162442247.1|1291197_1292466_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_162441534.1|1292671_1293586_+|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	32.7	5.8e-29
WP_162442238.1|1293582_1294755_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_162442248.1|1295050_1295440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162442249.1|1295616_1296687_-|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	30.6	4.0e-29
WP_162442250.1|1296708_1297497_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_162442251.1|1297521_1298166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162442252.1|1298374_1298707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162442253.1|1298666_1303187_-	RecQ family ATP-dependent DNA helicase	NA	F2NZ48	Diadromus_pulchellus_ascovirus	32.8	9.5e-40
WP_162442254.1|1303917_1304817_-	TraB/GumN family protein	NA	NA	NA	NA	NA
1303532:1303571	attR	CTCATTCGTAATGAGCAGGTCGCCGGTTCGAGTCCGGCAG	NA	NA	NA	NA
WP_162442255.1|1305210_1309965_-	T9SS type A sorting domain-containing protein	NA	NA	NA	NA	NA
WP_162442256.1|1310295_1314462_-	response regulator	NA	A0A1V0SGX0	Hokovirus	25.9	9.7e-23
WP_162442257.1|1314717_1315266_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_162447810.1|1315293_1315479_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_162442258.1|1315703_1316093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162442259.1|1316469_1317237_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_162442260.1|1319799_1320258_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_162442261.1|1320296_1321151_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_162447811.1|1321584_1322208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162442262.1|1322706_1323114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162442263.1|1323543_1323915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162442264.1|1324160_1324781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162447812.1|1324830_1325025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162442265.1|1325165_1327853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162442266.1|1328301_1331430_+	hypothetical protein	NA	Q9EYF3	Enterobacteria_phage	33.9	2.3e-16
WP_162442267.1|1331486_1332230_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_162442268.1|1332780_1333848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162442269.1|1333825_1334647_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_162442270.1|1334968_1336285_+	vanadium-dependent haloperoxidase	NA	NA	NA	NA	NA
WP_162442271.1|1336542_1336797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162442272.1|1337283_1337613_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_162442273.1|1337911_1338553_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	53.5	4.8e-46
WP_162442274.1|1338734_1339715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162442275.1|1339751_1340453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162442276.1|1340430_1340961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162447813.1|1340976_1341354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162442277.1|1341557_1342277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162442278.1|1342560_1343499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162441440.1|1344052_1344343_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_162441441.1|1344342_1345164_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	28.6	3.3e-15
>prophage 7
NZ_CP048222	Rhodocytophaga sp. 172606-1 chromosome, complete genome	8983451	1497977	1569524	8983451	transposase,integrase,tRNA	Bacillus_phage(20.0%)	58	1543685:1543701	1577794:1577810
WP_162441765.1|1497977_1498571_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_162441766.1|1498576_1499071_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_162447822.1|1499463_1501887_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_162442368.1|1502212_1502560_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_162442369.1|1502698_1503628_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_162442370.1|1503705_1504068_-	DUF4406 domain-containing protein	NA	NA	NA	NA	NA
WP_162442371.1|1504116_1504689_-	GDP-mannose pyrophosphatase NudK	NA	NA	NA	NA	NA
WP_162442372.1|1504753_1505506_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_162447823.1|1505563_1512538_-	cell surface protein SprA	NA	NA	NA	NA	NA
WP_162442373.1|1512893_1513487_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_162447824.1|1513596_1515927_-	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
WP_162442374.1|1516221_1517340_-	DUF4837 family protein	NA	NA	NA	NA	NA
WP_162442375.1|1517551_1519036_-	transglycosylase SLT domain-containing protein	NA	A0A0S2SXN2	Bacillus_phage	38.7	3.0e-11
WP_162442376.1|1519164_1520586_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_162442377.1|1520588_1520804_-	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
WP_162442378.1|1521001_1521439_-	DUF1232 domain-containing protein	NA	NA	NA	NA	NA
WP_162442379.1|1521894_1523424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162442380.1|1523475_1524771_-	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_162442381.1|1524905_1527209_+	T9SS type A sorting domain-containing protein	NA	NA	NA	NA	NA
WP_162442382.1|1527214_1527610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162447825.1|1527779_1529201_+	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_162442383.1|1529287_1529449_-	lmo0937 family membrane protein	NA	NA	NA	NA	NA
WP_162442384.1|1529582_1529744_-	lmo0937 family membrane protein	NA	NA	NA	NA	NA
WP_162442385.1|1530200_1530770_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_162442386.1|1530741_1532520_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_162442387.1|1532755_1533178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162442388.1|1533342_1533720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162442389.1|1533735_1534296_+	YceI family protein	NA	NA	NA	NA	NA
WP_162442390.1|1534325_1535219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162442391.1|1535482_1535674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162442392.1|1535732_1537235_-	peptidase M14	NA	NA	NA	NA	NA
WP_162447826.1|1537479_1538697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162442393.1|1538874_1539558_+	hydrolase	NA	NA	NA	NA	NA
WP_162442394.1|1539598_1540132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162442395.1|1540139_1541381_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_162442396.1|1541653_1544620_+	TonB-dependent receptor	NA	NA	NA	NA	NA
1543685:1543701	attL	CTTACCGCTGAAGTAGA	NA	NA	NA	NA
WP_162442397.1|1544632_1546135_+	RagB/SusD family nutrient uptake outer membrane protein	NA	NA	NA	NA	NA
WP_162442398.1|1546198_1547455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162442399.1|1547526_1549509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162442400.1|1549545_1549890_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_162442401.1|1550002_1550890_+	NmrA family NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_162442402.1|1550941_1551640_-	adenylate/guanylate cyclase domain-containing protein	NA	A0A218MLZ2	uncultured_virus	27.7	5.6e-08
WP_162442403.1|1552279_1553473_+|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	24.7	8.4e-12
WP_162442250.1|1553553_1554342_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_162442404.1|1554573_1554987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162442405.1|1555806_1556298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162442406.1|1556433_1556880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162442407.1|1557000_1558356_-|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	39.5	5.1e-74
WP_162442408.1|1558763_1559207_+	helix-turn-helix domain containing protein	NA	NA	NA	NA	NA
WP_162442409.1|1559212_1559890_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_162442410.1|1560112_1561186_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_162442411.1|1561854_1562340_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_162442412.1|1562332_1563352_+	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
WP_162442413.1|1563377_1565615_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	23.1	6.0e-27
WP_162442414.1|1566150_1566303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162442415.1|1567138_1567876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162442416.1|1568296_1568830_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_162447746.1|1568873_1569524_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
1577794:1577810	attR	TCTACTTCAGCGGTAAG	NA	NA	NA	NA
>prophage 8
NZ_CP048222	Rhodocytophaga sp. 172606-1 chromosome, complete genome	8983451	1589967	1645760	8983451	transposase	Acinetobacter_phage(16.67%)	44	NA	NA
WP_162442430.1|1589967_1590204_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_162442431.1|1590244_1591039_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.8	5.4e-39
WP_162442432.1|1591386_1591626_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_162447827.1|1591629_1592109_-	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_162442433.1|1592356_1592503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162442434.1|1592842_1593469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162442435.1|1594547_1603157_+	T9SS type A sorting domain-containing protein	NA	NA	NA	NA	NA
WP_162441323.1|1603336_1603834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162447750.1|1603847_1604573_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.9	5.4e-46
WP_162442436.1|1604769_1605705_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_162442437.1|1605923_1607051_-	PAS domain S-box protein	NA	W8CYF6	Bacillus_phage	25.5	8.8e-11
WP_162442438.1|1607659_1607854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162442439.1|1607943_1608195_+	T9SS type A sorting domain-containing protein	NA	NA	NA	NA	NA
WP_162442440.1|1608454_1609069_-	lactate utilization protein B/C	NA	NA	NA	NA	NA
WP_162442441.1|1609260_1610646_-	lactate utilization protein	NA	NA	NA	NA	NA
WP_162442442.1|1610642_1611380_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_162442443.1|1611599_1612772_-	amidohydrolase	NA	NA	NA	NA	NA
WP_162442444.1|1612977_1613448_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_162442445.1|1613419_1613932_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_162442446.1|1614002_1614329_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_162442447.1|1614477_1616919_-	T9SS type A sorting domain-containing protein	NA	NA	NA	NA	NA
WP_162442448.1|1617005_1618892_-	PKD domain-containing protein	NA	NA	NA	NA	NA
WP_162447828.1|1619783_1620176_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_162442449.1|1621376_1621994_+	collagen-like protein	NA	NA	NA	NA	NA
WP_162442450.1|1622097_1622970_-	phosphoenolpyruvate hydrolase family protein	NA	NA	NA	NA	NA
WP_162442451.1|1622979_1624236_-	UPF0261 family protein	NA	NA	NA	NA	NA
WP_162442452.1|1624471_1628560_+	response regulator	NA	A0A1V0SGX0	Hokovirus	33.6	9.5e-23
WP_162442453.1|1628687_1629128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162442454.1|1629408_1630785_+	B12-binding domain-containing radical SAM protein	NA	NA	NA	NA	NA
WP_162442455.1|1630898_1631540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162442456.1|1631687_1631900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162442457.1|1631883_1634157_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	35.0	8.7e-143
WP_162447746.1|1634381_1635032_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_162441276.1|1634995_1635427_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_162442458.1|1635562_1636504_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_162442459.1|1636726_1637104_+	BlaI/MecI/CopY family transcriptional regulator	NA	NA	NA	NA	NA
WP_162442460.1|1637100_1638501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162442461.1|1638568_1639714_-	DUF5009 domain-containing protein	NA	NA	NA	NA	NA
WP_162442462.1|1639951_1640779_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_162442463.1|1641108_1641384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162442464.1|1641921_1643649_+	DUF885 domain-containing protein	NA	NA	NA	NA	NA
WP_162442465.1|1643759_1644464_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_162441440.1|1644648_1644939_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_162441441.1|1644938_1645760_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	28.6	3.3e-15
>prophage 9
NZ_CP048222	Rhodocytophaga sp. 172606-1 chromosome, complete genome	8983451	2310005	2355383	8983451	transposase	Streptococcus_phage(25.0%)	34	NA	NA
WP_162442953.1|2310005_2310794_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_162442954.1|2310790_2310964_-	DUF1801 domain-containing protein	NA	NA	NA	NA	NA
WP_162442955.1|2310986_2312087_-	DNA alkylation repair protein	NA	NA	NA	NA	NA
WP_162442956.1|2312167_2313121_-	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	37.8	1.2e-29
WP_162442957.1|2313284_2314307_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_162442958.1|2314873_2318410_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_162447746.1|2318414_2319065_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_162441276.1|2319028_2319460_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_162442959.1|2319689_2320040_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_162442960.1|2320269_2320731_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	45.0	3.4e-30
WP_162442961.1|2320931_2321444_+	HNH endonuclease	NA	H6WG01	Cyanophage	36.2	2.0e-23
WP_162442962.1|2321649_2323431_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_162447862.1|2324790_2325054_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_162442963.1|2325893_2325989_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_162442964.1|2326155_2326647_-	SgcJ/EcaC family oxidoreductase	NA	NA	NA	NA	NA
WP_162442965.1|2326929_2331096_-	response regulator	NA	A0A1V0SGX0	Hokovirus	27.4	3.9e-24
WP_162442966.1|2331219_2331378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162442967.1|2332046_2333051_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_162442968.1|2333123_2334020_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_162442250.1|2335274_2336063_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_162442969.1|2336196_2336874_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_162442970.1|2337872_2338139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162442971.1|2338199_2338694_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_162442972.1|2338677_2339817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162442973.1|2340211_2340661_+	SRPBCC family protein	NA	NA	NA	NA	NA
WP_162442974.1|2340955_2341432_-	RDD family protein	NA	NA	NA	NA	NA
WP_162442975.1|2341721_2342618_+	chromosome condensation regulator	NA	NA	NA	NA	NA
WP_162447863.1|2342846_2343761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162442976.1|2343951_2346807_+	DUF1080 domain-containing protein	NA	NA	NA	NA	NA
WP_162442977.1|2347192_2347498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162442978.1|2347541_2347793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162447864.1|2347944_2348694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162442979.1|2349101_2351939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162442259.1|2354615_2355383_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP048222	Rhodocytophaga sp. 172606-1 chromosome, complete genome	8983451	2374033	2427497	8983451	transposase,protease	Acinetobacter_phage(20.0%)	47	NA	NA
WP_162442990.1|2374033_2375189_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.4	1.3e-54
WP_162442991.1|2375233_2376478_-	membrane dipeptidase	NA	NA	NA	NA	NA
WP_162442992.1|2376579_2377947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162442993.1|2377994_2378279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162441319.1|2379031_2379448_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_162442994.1|2379405_2379741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162442237.1|2379949_2381515_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	33.2	1.4e-67
WP_162442236.1|2381538_2382258_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	30.7	2.4e-22
WP_162442995.1|2382388_2382604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162442996.1|2382761_2383271_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_162442997.1|2383396_2385340_-	response regulator	NA	NA	NA	NA	NA
WP_162442998.1|2385336_2387601_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_162442999.1|2388073_2388862_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_162443000.1|2389001_2389793_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_162443001.1|2389851_2390877_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_162443002.1|2392688_2393687_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_162443003.1|2393795_2395172_+	alginate export family protein	NA	NA	NA	NA	NA
WP_162447867.1|2395291_2396074_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_162443004.1|2396108_2396303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162443005.1|2396296_2396707_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_162442409.1|2396709_2397387_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_162442408.1|2397392_2397836_-	helix-turn-helix domain containing protein	NA	NA	NA	NA	NA
WP_162443006.1|2397971_2398910_+	adenylate/guanylate cyclase domain-containing protein	NA	A0A2H4N7Z5	Lake_Baikal_phage	24.7	8.1e-10
WP_162443007.1|2400246_2400501_+	TraB/GumN family protein	NA	NA	NA	NA	NA
WP_162443008.1|2401005_2401449_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_162443009.1|2401487_2401976_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_162443010.1|2402055_2402451_-	group III truncated hemoglobin	NA	NA	NA	NA	NA
WP_162443011.1|2402451_2402859_-	cytochrome C	NA	NA	NA	NA	NA
WP_162443012.1|2402870_2403128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162443013.1|2403180_2404197_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_162443014.1|2406082_2406394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162443015.1|2406437_2406668_-	DUF2249 domain-containing protein	NA	NA	NA	NA	NA
WP_162443016.1|2409425_2410169_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_162447868.1|2410578_2411634_-	histidine kinase	NA	NA	NA	NA	NA
WP_162443017.1|2411984_2412554_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_162443018.1|2412642_2414847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162443019.1|2414973_2415963_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_162443020.1|2416079_2417057_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_162443021.1|2417123_2417753_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_162443022.1|2417752_2418884_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	25.1	1.6e-12
WP_162443023.1|2418867_2419143_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_162443024.1|2419844_2420213_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_162443025.1|2420469_2420682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162443026.1|2421001_2421604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162443027.1|2422148_2422352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162443028.1|2422504_2422945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162443029.1|2423183_2427497_+|protease	M6 family metalloprotease domain-containing protein	protease	NA	NA	NA	NA
>prophage 11
NZ_CP048222	Rhodocytophaga sp. 172606-1 chromosome, complete genome	8983451	2830029	2954746	8983451	transposase	Mollivirus(20.0%)	114	NA	NA
WP_162441765.1|2830029_2830623_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_162443310.1|2830584_2831028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162443311.1|2831154_2831976_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_162443312.1|2832103_2832973_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_162443313.1|2833091_2836226_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_162443314.1|2836644_2838306_-	carboxylesterase/lipase family protein	NA	A0A0M4JT58	Mollivirus	31.9	4.0e-28
WP_162443315.1|2838415_2840860_-	alpha-rhamnosidase	NA	NA	NA	NA	NA
WP_162443316.1|2841050_2842034_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_162443317.1|2842413_2842602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162443318.1|2842875_2845134_-	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	NA	NA	NA	NA
WP_162443319.1|2845154_2845625_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_162447891.1|2846755_2847088_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_162443320.1|2847229_2847847_-	flavodoxin	NA	NA	NA	NA	NA
WP_162443321.1|2848316_2849216_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_162443322.1|2849696_2850128_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_162443037.1|2850086_2850854_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_162443323.1|2851133_2854391_-	azurin	NA	NA	NA	NA	NA
WP_162443324.1|2856487_2856802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162443325.1|2857122_2858100_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_162443326.1|2858146_2858335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162443327.1|2858616_2859507_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_162447892.1|2859564_2860485_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_162443328.1|2860795_2861584_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_162443329.1|2861652_2862954_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_162443330.1|2863277_2863892_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_162443331.1|2863915_2866075_-	PAS domain-containing protein	NA	W8CYF6	Bacillus_phage	23.7	5.2e-12
WP_162443332.1|2866315_2867764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162447893.1|2867901_2871426_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_162443333.1|2871466_2872702_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_162443334.1|2872891_2873833_-	DUF1080 domain-containing protein	NA	NA	NA	NA	NA
WP_162443335.1|2875034_2876003_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_162443336.1|2876013_2876766_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_162443337.1|2876909_2877131_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_162443338.1|2877173_2878595_-	glucose sorbosone dehydrogenase	NA	NA	NA	NA	NA
WP_162443339.1|2878941_2879340_+	DUF1232 domain-containing protein	NA	NA	NA	NA	NA
WP_162443340.1|2879906_2880344_+	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
WP_162443341.1|2880560_2880917_+	dihydrofolate reductase family protein	NA	NA	NA	NA	NA
WP_162447894.1|2880910_2881153_+	dihydrofolate reductase family protein	NA	NA	NA	NA	NA
WP_162443342.1|2881252_2881699_+	VOC family protein	NA	NA	NA	NA	NA
WP_162443343.1|2881998_2882661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162443344.1|2882917_2883658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162443345.1|2883715_2885098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162443346.1|2885448_2885655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162443347.1|2885729_2887883_-	PAS domain S-box protein	NA	W8CYF6	Bacillus_phage	25.3	1.6e-13
WP_162443348.1|2890217_2890502_+	response regulator	NA	NA	NA	NA	NA
WP_162443349.1|2890498_2890915_+	response regulator	NA	NA	NA	NA	NA
WP_162443350.1|2891110_2891797_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_162443351.1|2892004_2892901_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_162443352.1|2893056_2893818_+	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	32.0	2.2e-05
WP_162443353.1|2894272_2894704_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_162447746.1|2894667_2895318_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_162443354.1|2895516_2896389_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_162443355.1|2896494_2897484_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_162443356.1|2897530_2898199_+	carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
WP_162443357.1|2899051_2899264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162441440.1|2899326_2899617_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_162441441.1|2899616_2900438_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	28.6	3.3e-15
WP_162443358.1|2900827_2901160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162443359.1|2901195_2901639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162442048.1|2901687_2902344_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_162447796.1|2902349_2902796_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_162443360.1|2902840_2903380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162443361.1|2903929_2905729_+	ATPase	NA	NA	NA	NA	NA
WP_162441854.1|2906221_2906989_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_162443362.1|2907084_2907447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162443363.1|2907788_2908139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162443364.1|2908501_2909056_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_162443365.1|2909317_2909533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162443366.1|2909573_2911049_-	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_162443367.1|2911226_2911520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162443368.1|2911533_2912550_-	sodium-dependent bicarbonate transport family permease	NA	NA	NA	NA	NA
WP_162441854.1|2912780_2913548_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_162443369.1|2913669_2914605_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_162443370.1|2915012_2915747_-	serine/threonine protein phosphatase	NA	A0A0F6SJ14	Sinorhizobium_phage	25.6	1.6e-08
WP_162443371.1|2916438_2916936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162447895.1|2917263_2917899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162443372.1|2918331_2918520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162443373.1|2918774_2920394_-	serine hydrolase	NA	NA	NA	NA	NA
WP_162443374.1|2920549_2920711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162442237.1|2920897_2922463_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	33.2	1.4e-67
WP_162443375.1|2922486_2923206_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	30.7	1.9e-22
WP_162443376.1|2923443_2923704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162443377.1|2923746_2924004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162443378.1|2924080_2924362_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_162443379.1|2924734_2925679_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_162443380.1|2926267_2926933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162447896.1|2926926_2927154_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_162443381.1|2927280_2928114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162443382.1|2928230_2928932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162443383.1|2929532_2930078_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_162443384.1|2930472_2931216_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_162443385.1|2931454_2932270_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_162443386.1|2932316_2932847_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_162447897.1|2933407_2933719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162443387.1|2934194_2934545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162443388.1|2934904_2936221_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_162443389.1|2936745_2937837_+	acyltransferase	NA	NA	NA	NA	NA
WP_162443390.1|2938232_2938664_-	EamA family transporter	NA	NA	NA	NA	NA
WP_162443391.1|2938950_2939649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162443392.1|2939898_2940357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162443393.1|2940411_2940681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162443394.1|2940831_2943303_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_162443395.1|2943897_2945472_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_162443396.1|2945735_2946905_+	esterase	NA	NA	NA	NA	NA
WP_162443397.1|2947282_2947942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162443398.1|2948090_2948393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162443399.1|2948626_2949040_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_162443400.1|2949651_2950026_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_162443401.1|2950298_2950775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162443402.1|2950901_2951441_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_162443403.1|2951437_2951956_+	VOC family protein	NA	NA	NA	NA	NA
WP_162443404.1|2952553_2952871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162443405.1|2952858_2953197_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5WJH4	Leptospira_phage	38.7	1.3e-07
WP_162443406.1|2953267_2954746_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	33.5	5.6e-66
>prophage 12
NZ_CP048222	Rhodocytophaga sp. 172606-1 chromosome, complete genome	8983451	2990686	3034507	8983451	transposase,integrase	Acinetobacter_phage(16.67%)	43	2997682:2997702	3006434:3006454
WP_162447900.1|2990686_2990788_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_162442990.1|2992195_2993351_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.4	1.3e-54
WP_162443424.1|2993654_2994221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162443425.1|2994376_2997325_-	hypothetical protein	NA	NA	NA	NA	NA
2997682:2997702	attL	AATACCTAATTTTAGGTATTT	NA	NA	NA	NA
WP_162443426.1|2997804_2999193_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_162443427.1|2999302_3000274_-	LexA family transcriptional regulator	NA	A0A0A7RUJ5	Clostridium_phage	35.8	1.2e-05
WP_162443428.1|3000551_3001295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162443429.1|3001394_3001808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162443430.1|3002063_3002369_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_162443431.1|3002449_3003082_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_162443432.1|3003568_3004426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162443433.1|3004601_3004838_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_162443434.1|3004923_3005481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162443435.1|3005789_3006158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162443436.1|3006626_3008027_+	DUF4041 domain-containing protein	NA	Q5G8X0	Enterobacteria_phage	43.1	4.2e-55
3006434:3006454	attR	AAATACCTAAAATTAGGTATT	NA	NA	NA	NA
WP_162443437.1|3008237_3009278_+	WG repeat-containing protein	NA	NA	NA	NA	NA
WP_162443438.1|3009286_3009544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162443439.1|3009652_3009919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162443440.1|3009968_3010754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162443441.1|3011086_3012358_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_162447746.1|3012321_3012972_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_162443442.1|3012943_3013705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162443443.1|3013838_3014843_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_162443444.1|3015113_3016331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162443445.1|3016720_3017875_+	glutathione-dependent formaldehyde dehydrogenase	NA	E3SJ82	Synechococcus_phage	27.7	1.2e-10
WP_162443446.1|3018027_3019266_+	insulinase family protein	NA	NA	NA	NA	NA
WP_162443447.1|3019361_3020411_-	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_162447901.1|3020562_3020682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162447902.1|3020644_3020932_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_162447903.1|3021558_3021714_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_162443448.1|3021648_3022095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162443449.1|3022146_3022407_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	47.3	1.3e-07
WP_162443450.1|3022726_3024571_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.8	4.6e-17
WP_162441340.1|3024940_3026032_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_162443451.1|3026230_3026503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162443452.1|3026631_3028104_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_162443453.1|3028353_3028917_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_162443454.1|3028922_3029450_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_162443455.1|3029615_3030560_+	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_162447904.1|3030688_3031546_+	nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_162443456.1|3031666_3032569_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_162443457.1|3032609_3033725_+	aminoglycoside phosphotransferase family protein	NA	NA	NA	NA	NA
WP_162447746.1|3033856_3034507_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP048222	Rhodocytophaga sp. 172606-1 chromosome, complete genome	8983451	4248531	4260687	8983451		Tupanvirus(37.5%)	11	NA	NA
WP_162444332.1|4248531_4249911_+	ATP-binding protein	NA	A0A1V0SGX0	Hokovirus	33.6	4.2e-07
WP_162444333.1|4250003_4250612_-	Ezrin/radixin/moesin family protein	NA	NA	NA	NA	NA
WP_162444334.1|4251136_4252135_+	NTP transferase domain-containing protein	NA	I7I009	Enterobacteria_phage	26.7	5.2e-15
WP_162444335.1|4252200_4252674_+	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_162444336.1|4252680_4253544_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	H9NC64	Sphingomonas_phage	62.0	8.5e-99
WP_162444337.1|4253617_4254601_-	SDR family oxidoreductase	NA	A0A2K9L4U8	Tupanvirus	50.2	5.2e-84
WP_162444338.1|4254657_4255707_-	dTDP-glucose 4,6-dehydratase	NA	A0A291LAD7	Escherichia_phage	51.8	2.8e-88
WP_162444339.1|4255719_4256766_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	42.4	1.4e-71
WP_162444340.1|4257026_4258316_-	nucleotide sugar dehydrogenase	NA	NA	NA	NA	NA
WP_162444341.1|4258380_4259319_-	SDR family oxidoreductase	NA	A0A2K9KZK0	Tupanvirus	44.6	1.8e-70
WP_162444342.1|4259355_4260687_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	41.2	1.0e-87
>prophage 14
NZ_CP048222	Rhodocytophaga sp. 172606-1 chromosome, complete genome	8983451	4701469	4763132	8983451	transposase	Stx2-converting_phage(25.0%)	48	NA	NA
WP_162441340.1|4701469_4702561_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_162444679.1|4703202_4706259_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_162444680.1|4706283_4707867_+	RagB/SusD family nutrient uptake outer membrane protein	NA	NA	NA	NA	NA
WP_162444681.1|4707926_4709012_+	SusF/SusE family outer membrane protein	NA	NA	NA	NA	NA
WP_162444682.1|4709100_4711977_+	T9SS type A sorting domain-containing protein	NA	NA	NA	NA	NA
WP_162444683.1|4712036_4712771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162441440.1|4713849_4714140_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_162441441.1|4714139_4714961_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	28.6	3.3e-15
WP_162444684.1|4716585_4717479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162444685.1|4717750_4719175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162444686.1|4719441_4720239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162444687.1|4720240_4721329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162444688.1|4721726_4723595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162444689.1|4723683_4724415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162444690.1|4724827_4726117_+	DUF4238 domain-containing protein	NA	NA	NA	NA	NA
WP_162447988.1|4726431_4726713_+	DUF3592 domain-containing protein	NA	NA	NA	NA	NA
WP_162444691.1|4726989_4727733_-	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	42.6	2.8e-05
WP_162444692.1|4727901_4729470_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_162444693.1|4730292_4733055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162444694.1|4733949_4734714_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	39.5	6.6e-10
WP_162444695.1|4734724_4734916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162444696.1|4735049_4735373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162444697.1|4735466_4735844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162444698.1|4735852_4738573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162444699.1|4738663_4739305_-	recombinase family protein	NA	A0A1B0RXN5	Streptococcus_phage	31.7	1.8e-08
WP_162444700.1|4740323_4740683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162444701.1|4740879_4741134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162444702.1|4741462_4741801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162444703.1|4742554_4743250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162447989.1|4743682_4744978_+	DNA phosphorothioation system sulfurtransferase DndC	NA	NA	NA	NA	NA
WP_162444704.1|4744989_4747170_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_162447990.1|4747159_4747555_+	DndE family protein	NA	NA	NA	NA	NA
WP_162444705.1|4747554_4748367_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_162444706.1|4748353_4750606_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_162444707.1|4750609_4750822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162444708.1|4750827_4753014_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_162444709.1|4753022_4753535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162444710.1|4753574_4755332_+	DGQHR domain-containing protein	NA	NA	NA	NA	NA
WP_162444711.1|4755568_4756390_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_162444712.1|4756382_4757039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162444713.1|4757022_4757364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162444714.1|4757373_4758852_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	34.0	2.5e-66
WP_162444715.1|4758883_4759246_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	42.5	1.8e-10
WP_162444716.1|4759233_4759551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162444717.1|4759622_4759925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162444718.1|4759932_4761084_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	28.0	3.3e-29
WP_162444719.1|4761270_4761573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162443406.1|4761653_4763132_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	33.5	5.6e-66
>prophage 15
NZ_CP048222	Rhodocytophaga sp. 172606-1 chromosome, complete genome	8983451	4965697	5063095	8983451	transposase,tRNA	Bacillus_phage(42.86%)	58	NA	NA
WP_162441765.1|4965697_4966291_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_162441766.1|4966296_4966791_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_162444878.1|4966944_4968906_-	1,4-alpha-glucan branching protein GlgB	NA	NA	NA	NA	NA
WP_162444879.1|4968907_4972255_-	maltose alpha-D-glucosyltransferase	NA	NA	NA	NA	NA
WP_162444880.1|4972430_4974386_-	alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase	NA	NA	NA	NA	NA
WP_162444881.1|4974538_4974829_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_162444882.1|4975183_4975513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162444883.1|4975614_4977177_-	RagB/SusD family nutrient uptake outer membrane protein	NA	NA	NA	NA	NA
WP_162447997.1|4977331_4980502_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_162444884.1|4981151_4984181_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_162444885.1|4984250_4985534_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_162444886.1|4985703_4986135_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_162447998.1|4986098_4986749_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_162444887.1|4987073_4988705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162444888.1|4989021_4989573_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_162444889.1|4989622_4990201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162444890.1|4990235_4991336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162444891.1|4991610_4994802_+	cyclic nucleotide-binding domain-containing protein	NA	NA	NA	NA	NA
WP_162444892.1|4994835_4996329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162444893.1|4996321_4999444_+	High-affnity carbon uptake protein Hat/HatR	NA	NA	NA	NA	NA
WP_162444894.1|4999459_5000548_+	PorT family protein	NA	NA	NA	NA	NA
WP_162444895.1|5000556_5001801_+	PQQ-like beta-propeller repeat protein	NA	NA	NA	NA	NA
WP_162444896.1|5001802_5012887_+	PKD domain-containing protein	NA	NA	NA	NA	NA
WP_162444897.1|5013143_5013401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162444898.1|5013410_5013797_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_162444899.1|5014577_5017718_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_162444900.1|5017758_5019285_+	RagB/SusD family nutrient uptake outer membrane protein	NA	NA	NA	NA	NA
WP_162444901.1|5019655_5021971_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_162444902.1|5021981_5023010_+	DUF4249 domain-containing protein	NA	NA	NA	NA	NA
WP_162444903.1|5023530_5026881_+	VCBS repeat-containing protein	NA	NA	NA	NA	NA
WP_162444904.1|5026834_5030230_+	VCBS repeat-containing protein	NA	NA	NA	NA	NA
WP_162447999.1|5030398_5031727_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_162444905.1|5032092_5032725_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_162444906.1|5032911_5033907_+	DUF697 domain-containing protein	NA	NA	NA	NA	NA
WP_162444907.1|5034085_5037937_-	PAS domain-containing protein	NA	W8CYF6	Bacillus_phage	24.5	4.3e-09
WP_162444908.1|5038358_5039582_+	sorbosone dehydrogenase family protein	NA	NA	NA	NA	NA
WP_162444909.1|5039731_5040883_-	AhpC/TSA family protein	NA	NA	NA	NA	NA
WP_162444910.1|5041126_5042590_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_162444911.1|5042778_5043561_+	DUF2490 domain-containing protein	NA	NA	NA	NA	NA
WP_162444912.1|5043592_5044702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162444913.1|5044921_5046709_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	44.8	1.3e-24
WP_162444914.1|5046796_5047189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162444915.1|5047306_5048191_+	bifunctional 5,10-methylene-tetrahydrofolate dehydrogenase/5,10-methylene-tetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	35.6	1.6e-28
WP_162444916.1|5048295_5048871_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_162444917.1|5049045_5049855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162441765.1|5049844_5050438_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_162441766.1|5050443_5050938_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_162444918.1|5051221_5052529_-	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	42.1	1.2e-43
WP_162444919.1|5053162_5053648_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_162444920.1|5055372_5056527_+	family 20 glycosylhydrolase	NA	NA	NA	NA	NA
WP_162444921.1|5056546_5056741_-	YwbE family protein	NA	NA	NA	NA	NA
WP_162442250.1|5056800_5057589_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_162444922.1|5057681_5058500_-	ATP-grasp domain-containing protein	NA	A0A0F6YPJ3	Sinorhizobium_phage	26.0	1.2e-17
WP_162444923.1|5058510_5058858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162444924.1|5058922_5059507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162448000.1|5059547_5060072_-	5'-3'-deoxyribonucleotidase	NA	A0A0A0PKY7	Bacillus_phage	37.5	2.5e-24
WP_162444925.1|5060282_5061899_-	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	32.9	6.1e-66
WP_162447746.1|5062444_5063095_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP048222	Rhodocytophaga sp. 172606-1 chromosome, complete genome	8983451	7573192	7703968	8983451	tail,transposase,integrase	Mycobacterium_phage(10.53%)	118	7589882:7589913	7593965:7593996
WP_162441950.1|7573192_7573945_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	49.6	8.1e-29
WP_162446734.1|7574295_7574853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162446735.1|7574940_7575588_+	vanadium-dependent haloperoxidase	NA	NA	NA	NA	NA
WP_162446736.1|7575702_7576860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162446737.1|7577012_7578131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162443361.1|7578492_7580292_-	ATPase	NA	NA	NA	NA	NA
WP_162446738.1|7580692_7581172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162448116.1|7581351_7582395_-	beta-lactamase family protein	NA	Q19XB5	Mycobacterium_phage	27.7	1.1e-15
WP_162446739.1|7582586_7582991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162446740.1|7583581_7584001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162446741.1|7584478_7585039_+	HAD hydrolase-like protein	NA	NA	NA	NA	NA
WP_162446742.1|7585174_7585387_+	ester cyclase	NA	NA	NA	NA	NA
WP_162446743.1|7585689_7586628_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_162448117.1|7586851_7587079_-	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_162446744.1|7587094_7587550_-	response regulator	NA	NA	NA	NA	NA
WP_162446745.1|7587896_7589045_+	amino acid permease	NA	NA	NA	NA	NA
WP_162446746.1|7589237_7589873_+	DUF2306 domain-containing protein	NA	NA	NA	NA	NA
7589882:7589913	attL	AACATATAAGGGTTCATGGGGTGGTCTTAACC	NA	NA	NA	NA
WP_162442230.1|7589963_7590134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162442229.1|7590162_7591335_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_162446747.1|7591331_7592246_-|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	32.3	2.6e-29
WP_162446748.1|7592590_7592887_+	TfoX/Sxy family protein	NA	NA	NA	NA	NA
WP_162446749.1|7593047_7593953_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_162446750.1|7594966_7595638_-	hypothetical protein	NA	NA	NA	NA	NA
7593965:7593996	attR	AACATATAAGGGTTCATGGGGTGGTCTTAACC	NA	NA	NA	NA
WP_162446751.1|7595976_7596210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162446752.1|7596249_7596468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162446753.1|7596538_7596700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162446754.1|7596865_7598614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162446755.1|7599033_7599978_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_162446756.1|7600200_7600806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162446757.1|7601341_7601599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162446758.1|7602361_7603120_+	beta-lactamase family protein	NA	NA	NA	NA	NA
WP_162446759.1|7603119_7604703_+	carboxylesterase family protein	NA	L7Y5U6	Megavirus	37.5	3.3e-32
WP_162446760.1|7605089_7605539_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_162446761.1|7606067_7607174_-	TIGR03118 family protein	NA	A0A2K9KZ30	Tupanvirus	29.9	5.2e-32
WP_162446762.1|7607918_7608347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162446763.1|7608652_7609234_+	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_162446764.1|7609564_7614241_+	T9SS type A sorting domain-containing protein	NA	NA	NA	NA	NA
WP_162446765.1|7614585_7614828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162446766.1|7615191_7615719_+	MepB family protein	NA	NA	NA	NA	NA
WP_162446767.1|7616152_7617751_+	PAS domain-containing protein	NA	W8CYF6	Bacillus_phage	24.7	1.5e-16
WP_162443365.1|7617943_7618159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162443366.1|7618199_7619675_-	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_162443367.1|7619852_7620146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162443368.1|7620159_7621176_-	sodium-dependent bicarbonate transport family permease	NA	NA	NA	NA	NA
WP_162443369.1|7621434_7622370_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_162446768.1|7622970_7624749_+	T9SS type A sorting domain-containing protein	NA	NA	NA	NA	NA
WP_162446769.1|7625074_7625410_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_162446770.1|7626258_7627938_+	beta-lactamase family protein	NA	X2KYU1	Mycobacterium_phage	24.7	4.5e-11
WP_162446771.1|7628263_7629031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162446772.1|7629352_7629745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162446773.1|7630860_7632609_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	53.6	3.4e-09
WP_162446774.1|7632788_7634000_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	46.0	6.9e-46
WP_162446775.1|7634209_7634620_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_162446776.1|7634893_7635178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162446777.1|7635627_7636962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162446778.1|7637683_7638064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162448118.1|7638492_7638933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162441441.1|7638960_7639782_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	28.6	3.3e-15
WP_162441440.1|7639781_7640072_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_162446779.1|7640149_7640734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162441766.1|7641040_7641535_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_162446780.1|7641540_7642134_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_162446781.1|7642276_7645936_+	T9SS type A sorting domain-containing protein	NA	NA	NA	NA	NA
WP_162443399.1|7646183_7646597_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_162446782.1|7646681_7648058_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_162446783.1|7648411_7649788_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_162448119.1|7649964_7650540_+	deaminase	NA	NA	NA	NA	NA
WP_162442237.1|7651472_7653038_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	33.2	1.4e-67
WP_162442236.1|7653061_7653781_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	30.7	2.4e-22
WP_162446784.1|7653763_7654648_-	esterase	NA	NA	NA	NA	NA
WP_162446785.1|7654749_7655908_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	40.1	9.2e-48
WP_162446786.1|7656945_7657341_+	response regulator	NA	NA	NA	NA	NA
WP_162448120.1|7657722_7658625_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_162448121.1|7658935_7659502_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_162446787.1|7659576_7660494_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_162446788.1|7660590_7660824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162446789.1|7660912_7661839_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_162446790.1|7661936_7662899_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_162446791.1|7662981_7663323_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_162446792.1|7663379_7663793_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.7	7.4e-16
WP_162446793.1|7663874_7664252_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	48.0	2.1e-25
WP_162446794.1|7664269_7665184_-|tail	tail fiber domain-containing protein	tail	NA	NA	NA	NA
WP_162446795.1|7665292_7665850_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_162446796.1|7665910_7666465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162446797.1|7666538_7668176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162446798.1|7668452_7668950_-	SgcJ/EcaC family oxidoreductase	NA	NA	NA	NA	NA
WP_162446799.1|7668946_7669789_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_162446800.1|7669937_7670699_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_162446801.1|7671205_7671970_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_162446802.1|7672098_7673028_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_162446803.1|7673547_7673874_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_162446804.1|7673870_7676480_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_162446805.1|7676679_7679127_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_162446806.1|7679350_7679569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162448122.1|7680057_7683048_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_162448123.1|7683385_7685197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162446807.1|7685464_7685941_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_162443404.1|7685958_7686276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162443405.1|7686263_7686602_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5WJH4	Leptospira_phage	38.7	1.3e-07
WP_162443406.1|7686672_7688151_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	33.5	5.6e-66
WP_162446808.1|7688211_7688622_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_162446809.1|7689176_7689377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162446810.1|7689793_7690726_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_162446811.1|7690770_7691511_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_162443383.1|7691938_7692484_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_162446812.1|7692961_7693096_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_162446813.1|7693327_7693516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162446814.1|7693708_7693963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162446815.1|7694253_7694610_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_162446816.1|7695040_7695451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162446817.1|7696211_7696562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162446818.1|7697266_7697986_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	30.7	8.3e-23
WP_162442237.1|7698009_7699575_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	33.2	1.4e-67
WP_162446819.1|7699761_7700115_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_162446820.1|7700616_7702311_+|tail	tail fiber domain-containing protein	tail	NA	NA	NA	NA
WP_162446821.1|7702417_7702879_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_162441320.1|7703036_7703594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162441319.1|7703551_7703968_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP048222	Rhodocytophaga sp. 172606-1 chromosome, complete genome	8983451	7715972	7757535	8983451	bacteriocin,transposase	Hokovirus(50.0%)	24	NA	NA
WP_162446828.1|7715972_7716401_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_162446829.1|7716397_7716610_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_162446830.1|7716839_7720985_+	response regulator	NA	A0A1V0SGX0	Hokovirus	26.7	4.1e-21
WP_162446831.1|7721593_7724218_+	T9SS type A sorting domain-containing protein	NA	NA	NA	NA	NA
WP_162446832.1|7726095_7727328_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	58.8	2.3e-57
WP_162441351.1|7727547_7729734_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	31.8	2.3e-52
WP_162446833.1|7729762_7730932_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_162441349.1|7731226_7731364_-|bacteriocin	class IIb bacteriocin, lactobin A/cerein 7B family	bacteriocin	NA	NA	NA	NA
WP_162446834.1|7731669_7731942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162446835.1|7732048_7734499_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_162446836.1|7734876_7735128_-	erythromycin esterase family protein	NA	NA	NA	NA	NA
WP_162446837.1|7735100_7735505_-	erythromycin esterase family protein	NA	NA	NA	NA	NA
WP_162446838.1|7735677_7739970_-	response regulator	NA	A0A1V0SGX0	Hokovirus	30.2	3.8e-22
WP_162441767.1|7740133_7740565_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_162447970.1|7740528_7741179_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_162446839.1|7741278_7743645_+	T9SS type A sorting domain-containing protein	NA	NA	NA	NA	NA
WP_162446840.1|7744000_7747852_+	T9SS type A sorting domain-containing protein	NA	NA	NA	NA	NA
WP_162446841.1|7747871_7748027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162446842.1|7748360_7751135_+	T9SS type A sorting domain-containing protein	NA	NA	NA	NA	NA
WP_162446843.1|7751317_7752352_-	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_162446844.1|7752826_7753150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162446845.1|7754411_7754999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162446846.1|7755211_7756492_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_162441854.1|7756767_7757535_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP048222	Rhodocytophaga sp. 172606-1 chromosome, complete genome	8983451	8452961	8575419	8983451	transposase,protease	Bacillus_phage(33.33%)	82	NA	NA
WP_162447394.1|8452961_8455487_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	39.6	2.9e-123
WP_162447395.1|8455629_8456265_-	WbqC family protein	NA	NA	NA	NA	NA
WP_162447396.1|8456434_8457292_+	lysophospholipid acyltransferase family protein	NA	NA	NA	NA	NA
WP_162447397.1|8457329_8457956_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_162447398.1|8458214_8459252_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_162447399.1|8459316_8459724_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_162447400.1|8459730_8460693_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_162447401.1|8461225_8461333_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_162447402.1|8461405_8461606_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_162447403.1|8461645_8461960_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_162447404.1|8462584_8463649_-	6-bladed beta-propeller	NA	NA	NA	NA	NA
WP_162447405.1|8463846_8465583_-	RagB/SusD family nutrient uptake outer membrane protein	NA	NA	NA	NA	NA
WP_162447406.1|8465601_8469264_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_162447407.1|8469537_8470545_-	DUF4974 domain-containing protein	NA	NA	NA	NA	NA
WP_162447408.1|8470641_8471334_-	RNA polymerase sigma-70 factor	NA	NA	NA	NA	NA
WP_162448152.1|8471807_8474498_-	glycoside hydrolase family 92 protein	NA	NA	NA	NA	NA
WP_162447409.1|8474621_8477189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162447410.1|8477592_8479047_-	RagB/SusD family nutrient uptake outer membrane protein	NA	NA	NA	NA	NA
WP_162447411.1|8479072_8482144_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_162447412.1|8482557_8483139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162447413.1|8483474_8483723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162447414.1|8484149_8487737_-	VCBS repeat-containing protein	NA	NA	NA	NA	NA
WP_162447415.1|8487811_8489029_-	DUF4185 domain-containing protein	NA	NA	NA	NA	NA
WP_162447416.1|8489338_8490619_-	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_162447417.1|8490660_8491677_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_162447418.1|8491932_8492457_-	VanZ family protein	NA	NA	NA	NA	NA
WP_162447419.1|8492978_8493881_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_162447420.1|8494957_8495212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162447421.1|8495321_8496386_+	cobalamin-independent methionine synthase II family protein	NA	NA	NA	NA	NA
WP_162447422.1|8496456_8499690_+	SusC/RagA family TonB-linked outer membrane protein	NA	NA	NA	NA	NA
WP_162447423.1|8499716_8501189_+	RagB/SusD family nutrient uptake outer membrane protein	NA	NA	NA	NA	NA
WP_162447424.1|8501332_8502430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162441276.1|8502855_8503287_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_162447746.1|8503250_8503901_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_162441319.1|8504099_8504516_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_162441320.1|8504473_8505031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162447425.1|8505188_8505674_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_162447426.1|8505574_8505826_-	T9SS type A sorting domain-containing protein	NA	NA	NA	NA	NA
WP_162447427.1|8506797_8507820_+	UDP-glucuronosyltransferase	NA	NA	NA	NA	NA
WP_162447428.1|8508558_8508705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162447429.1|8509140_8510523_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_162447430.1|8510738_8511635_-	alpha/beta hydrolase	NA	A0A2L2DMU8	Acanthamoeba_polyphaga_mimivirus	30.3	5.0e-25
WP_162447431.1|8511810_8512377_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_162447432.1|8512479_8513022_-	ester cyclase	NA	NA	NA	NA	NA
WP_162447433.1|8513260_8516215_-	response regulator	NA	W8CYM9	Bacillus_phage	36.5	1.4e-15
WP_162447434.1|8516904_8517879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162447435.1|8517919_8518594_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.7	8.6e-22
WP_162447436.1|8518905_8519364_+	DoxX family protein	NA	NA	NA	NA	NA
WP_162447437.1|8519462_8520803_+	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_162448153.1|8521826_8523014_-	DEAD/DEAH box helicase	NA	A0A1B1IS59	uncultured_Mediterranean_phage	31.5	5.7e-45
WP_162447438.1|8523839_8525831_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_162447439.1|8526841_8527318_-	DinB family protein	NA	NA	NA	NA	NA
WP_162447440.1|8527456_8527642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162447441.1|8527814_8528795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162447442.1|8528831_8530445_-	PAS domain S-box protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	27.4	9.6e-11
WP_162447443.1|8531101_8532178_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_162447444.1|8532235_8535778_-	VCBS repeat-containing protein	NA	NA	NA	NA	NA
WP_162447445.1|8535761_8539382_-	VCBS repeat-containing protein	NA	NA	NA	NA	NA
WP_162447446.1|8539526_8541062_-	RagB/SusD family nutrient uptake outer membrane protein	NA	NA	NA	NA	NA
WP_162447447.1|8541126_8544219_-	TonB-dependent receptor	NA	Q2PGD7	Norovirus	26.1	1.7e-11
WP_162447448.1|8544841_8546311_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_162447449.1|8546536_8547229_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_162447450.1|8547808_8550049_-	accessory Sec system translocase SecA2	NA	NA	NA	NA	NA
WP_162447451.1|8550163_8550571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162447452.1|8551349_8552321_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_162447453.1|8552363_8553176_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_162447454.1|8553658_8555374_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_162447455.1|8555416_8555959_-	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_162447456.1|8556831_8558613_+	arylsulfatase	NA	NA	NA	NA	NA
WP_162447457.1|8558789_8559188_-	YciI family protein	NA	NA	NA	NA	NA
WP_162447458.1|8559334_8559907_-	dihydrofolate reductase family protein	NA	NA	NA	NA	NA
WP_162447459.1|8560200_8561451_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_162447460.1|8561861_8565455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162447461.1|8565451_8566351_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.6	1.5e-21
WP_162447462.1|8566800_8568543_-	sulfatase	NA	NA	NA	NA	NA
WP_162447463.1|8569529_8571419_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_162447464.1|8571454_8572087_-	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_162447465.1|8572605_8572743_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_162447466.1|8572937_8573423_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_162447467.1|8573381_8574011_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_162443022.1|8574010_8575142_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	25.1	1.6e-12
WP_162447468.1|8575182_8575419_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP048222	Rhodocytophaga sp. 172606-1 chromosome, complete genome	8983451	8858038	8924589	8983451	transposase,integrase	Shigella_phage(33.33%)	55	8857985:8858037	8885546:8885598
8857985:8858037	attL	AGTTTAGTGCTTTTAAGGCTGATGAAAAGTGGGTTACGGATATGGACCTGCTA	NA	NA	NA	NA
WP_162447651.1|8858038_8858590_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	U5P429	Shigella_phage	55.2	1.1e-19
WP_162447652.1|8858924_8860361_-	sulfatase	NA	NA	NA	NA	NA
WP_162442409.1|8860765_8861443_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_162443629.1|8861448_8861892_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_162447653.1|8862266_8864285_-	M13 family metallopeptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	30.5	1.1e-69
WP_162447654.1|8864631_8865036_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_162448163.1|8864999_8865650_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_162447655.1|8865922_8866369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162447656.1|8867583_8868321_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_162447657.1|8868677_8869607_-	cysteine synthase family protein	NA	C3U2M1	Lactococcus_phage	34.8	2.0e-29
WP_162447658.1|8869893_8882169_-	PKD domain-containing protein	NA	NA	NA	NA	NA
WP_162447659.1|8883237_8883669_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.8	3.0e-12
WP_162447660.1|8883859_8884084_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_162447661.1|8884226_8884352_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_162441358.1|8884385_8885153_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_162447662.1|8885602_8885920_+|transposase	transposase	transposase	NA	NA	NA	NA
8885546:8885598	attR	TAGCAGGTCCATATCCGTAACCCACTTTTCATCAGCCTTAAAAGCACTAAACT	NA	NA	NA	NA
WP_162447663.1|8885906_8886233_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_162447664.1|8886198_8886546_+|transposase	transposase family protein	transposase	Q716C2	Shigella_phage	35.6	3.2e-12
WP_162447665.1|8886542_8886761_+|transposase	transposase	transposase	U5P429	Shigella_phage	40.0	4.6e-09
WP_162447666.1|8886793_8887210_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_162441276.1|8887315_8887747_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_162448048.1|8887710_8888361_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_162447667.1|8888445_8889324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162442237.1|8889567_8891133_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	33.2	1.4e-67
WP_162442236.1|8891156_8891876_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	30.7	2.4e-22
WP_162447668.1|8893053_8893737_-	response regulator	NA	NA	NA	NA	NA
WP_162447669.1|8893729_8894077_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_162447670.1|8894045_8894786_-	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_162447671.1|8895265_8895517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162447672.1|8895636_8896455_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_162447673.1|8896529_8897012_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_162447674.1|8899585_8900044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162443328.1|8900819_8901608_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_162447675.1|8901853_8902672_+	hypothetical protein	NA	A0A1B0V398	Roseobacter_phage	35.5	7.0e-10
WP_162447676.1|8903264_8904377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162447677.1|8905212_8905611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162447678.1|8905780_8906029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162447679.1|8906177_8906390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162447680.1|8906461_8906668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162447796.1|8906705_8907152_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_162442048.1|8907157_8907814_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_162447681.1|8907859_8908285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162447682.1|8908557_8909199_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_162448164.1|8909565_8910147_+	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_162447683.1|8910290_8911112_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_162441358.1|8911342_8912110_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_162447684.1|8912610_8912916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162447685.1|8912953_8914078_-	adenylate/guanylate cyclase domain-containing protein	NA	NA	NA	NA	NA
WP_162447686.1|8914118_8915033_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_162447687.1|8915042_8915972_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_162447688.1|8916133_8916346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162447689.1|8916653_8916791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162447690.1|8917677_8920251_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_162447691.1|8921128_8923462_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_162441340.1|8923497_8924589_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
