The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP048108	Klebsiella michiganensis strain BD177 chromosome, complete genome	6150416	399717	408083	6150416	tRNA	Planktothrix_phage(33.33%)	8	NA	NA
WP_032751891.1|399717_400581_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.0	3.0e-11
WP_162122620.1|400591_401365_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.7	4.6e-27
WP_162121151.1|401780_402569_+	CadC family transcriptional regulator	NA	NA	NA	NA	NA
WP_162121152.1|402555_403026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160741203.1|403026_403923_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	28.9	8.8e-14
WP_160740929.1|404164_405526_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	92.0	1.6e-200
WP_160740930.1|405828_406551_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	32.7	2.4e-30
WP_162121153.1|406547_408083_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	27.6	3.7e-28
>prophage 2
NZ_CP048108	Klebsiella michiganensis strain BD177 chromosome, complete genome	6150416	464115	475613	6150416		Enterobacteria_phage(22.22%)	10	NA	NA
WP_102811887.1|464115_465522_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.9	5.6e-39
WP_064357888.1|465703_467119_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.1	1.4e-53
WP_102811886.1|467141_468512_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	26.4	1.1e-28
WP_004122483.1|468668_469733_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.7	4.9e-104
WP_102811885.1|469746_470616_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.7	8.3e-110
WP_102811884.1|470647_471538_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	32.1	1.8e-27
WP_014230057.1|471553_472108_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	56.7	7.3e-51
WP_025107748.1|472281_473448_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.2	5.3e-112
WP_142382949.1|474015_474138_-	small membrane protein	NA	NA	NA	NA	NA
WP_102811883.1|474608_475613_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.2	1.8e-31
>prophage 3
NZ_CP048108	Klebsiella michiganensis strain BD177 chromosome, complete genome	6150416	633358	737465	6150416	capsid,tRNA,integrase,tail,head,plate,portal,terminase,holin	Enterobacteria_phage(29.23%)	116	630010:630027	730817:730834
630010:630027	attL	GCGCCGCGCCGCAGGAGG	NA	NA	NA	NA
WP_162121204.1|633358_634375_-|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	64.2	4.8e-125
WP_015365914.1|634358_634604_-	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	41.4	2.8e-07
WP_015365915.1|634813_634999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064145722.1|635000_635567_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	63.0	3.6e-53
WP_162121205.1|635566_637720_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	34.0	6.9e-97
WP_029602739.1|637764_637998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041165547.1|638691_639078_-	helix-turn-helix domain-containing protein	NA	A5VW98	Enterobacteria_phage	59.4	1.5e-15
WP_041165548.1|639158_639353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015365920.1|639415_639862_+	hypothetical protein	NA	H9C162	Pectobacterium_phage	51.4	1.7e-26
WP_015365921.1|639945_640104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_126066585.1|640121_641090_+	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	73.3	1.6e-37
WP_162122625.1|641098_642493_+	replicative DNA helicase	NA	Q76H51	Enterobacteria_phage	46.4	9.2e-103
WP_162121206.1|642531_643200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015365925.1|643203_643437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162121207.1|643582_644173_+	adenine methylase	NA	A0A0F6TJC3	Escherichia_coli_O157_typing_phage	84.5	1.3e-95
WP_049099634.1|644173_644356_+	hypothetical protein	NA	A0A2H4FQT4	Salmonella_phage	91.5	4.2e-24
WP_162122626.1|644355_645186_+	DNA adenine methylase	NA	Q5QF26	Pseudomonas_virus	50.4	2.1e-70
WP_162121208.1|645398_645737_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	82.0	3.9e-47
WP_162121209.1|646179_646776_+	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	70.2	4.0e-79
WP_162121210.1|646787_647090_+	DUF968 domain-containing protein	NA	A0A1I9KFA7	Aeromonas_phage	55.8	3.4e-26
WP_015365933.1|647245_647542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162121211.1|647569_648010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032409891.1|648020_648242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049099626.1|648245_649871_+|head,tail	bacteriophage head to tail connecting protein	head,tail	A0A2H4J3N6	uncultured_Caudovirales_phage	59.7	5.2e-174
WP_032409894.1|649867_650101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064164983.1|650087_650936_+	hypothetical protein	NA	A0A2H4JEQ5	uncultured_Caudovirales_phage	42.5	7.0e-45
WP_162121212.1|650969_651134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162121213.1|651149_651620_+	DUF2829 domain-containing protein	NA	A0A1B0VMG3	Pseudomonas_phage	60.3	3.2e-47
WP_114692664.1|651655_652012_+	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	70.7	1.1e-41
WP_162121214.1|652227_653133_+	hypothetical protein	NA	A0A2H4JC66	uncultured_Caudovirales_phage	39.6	2.8e-44
WP_162121215.1|653192_653756_+	hypothetical protein	NA	A0A2H4JID6	uncultured_Caudovirales_phage	49.7	5.8e-48
WP_162121216.1|653755_655747_+	hypothetical protein	NA	A0A2H4J6H2	uncultured_Caudovirales_phage	48.4	1.2e-185
WP_077254071.1|655746_656199_+	GNAT family N-acetyltransferase	NA	A0A2H4J9Z5	uncultured_Caudovirales_phage	43.6	5.2e-23
WP_101863135.1|656201_656690_+	hypothetical protein	NA	A0A2H4J679	uncultured_Caudovirales_phage	49.0	7.9e-09
WP_162121217.1|656695_659410_+	transglycosylase SLT domain-containing protein	NA	G9L6D3	Escherichia_phage	60.1	6.3e-289
WP_162121218.1|659409_662289_+	hypothetical protein	NA	G9L6D4	Escherichia_phage	68.8	0.0e+00
WP_142759554.1|662359_662653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162121219.1|662714_663059_+	hypothetical protein	NA	A0A2H4J7H0	uncultured_Caudovirales_phage	48.2	2.4e-20
WP_162121220.1|663055_664666_+|terminase	phage terminase large subunit	terminase	A0A2H4JCA3	uncultured_Caudovirales_phage	69.3	3.5e-223
WP_162121221.1|664683_667821_+	hypothetical protein	NA	T1S9Y2	Salmonella_phage	33.8	1.1e-37
WP_162122627.1|668031_668256_+|holin	holin	holin	A0A0P0ZFW5	Escherichia_phage	68.7	2.7e-20
WP_076752318.1|668239_668776_+	lysozyme	NA	K7PM52	Enterobacteria_phage	70.5	1.9e-72
WP_087829013.1|668772_669132_+	hypothetical protein	NA	R9TPM9	Aeromonas_phage	45.0	3.4e-17
WP_162121222.1|669672_670410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162121223.1|670414_671422_-|integrase	tyrosine-type recombinase/integrase	integrase	P79671	Haemophilus_phage	57.9	8.7e-103
WP_162121224.1|671418_671745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162121225.1|671755_672403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162121226.1|672412_672799_-	XRE family transcriptional regulator	NA	A0A2H4JFL3	uncultured_Caudovirales_phage	56.9	1.4e-21
WP_162121227.1|672882_673095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162121228.1|673097_673340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162121229.1|673360_673564_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_162121230.1|673573_673777_+	DUF4761 family protein	NA	A0A0M5M1I3	Salmonella_phage	64.3	2.6e-14
WP_162121231.1|673790_674030_+	DUF4754 domain-containing protein	NA	NA	NA	NA	NA
WP_162122628.1|674032_674305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213098.1|674372_674597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162121232.1|674593_675160_+	3'-5' exoribonuclease	NA	D4HTX2	Vibrio_phage	33.2	2.1e-13
WP_162121233.1|675392_676349_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	54.1	2.0e-85
WP_162121234.1|676365_678921_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	58.8	3.9e-248
WP_162121235.1|679063_681850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162121236.1|682572_683634_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	69.3	7.0e-143
WP_162121237.1|683627_685355_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	69.1	3.0e-236
WP_162121238.1|685511_686351_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	65.9	2.1e-94
WP_162121239.1|686360_687395_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	49.4	3.1e-95
WP_162121240.1|687444_688311_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	58.5	4.4e-71
WP_162121241.1|688415_688931_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	50.0	1.8e-40
WP_004131559.1|688930_689131_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	63.1	1.6e-16
WP_130958487.1|689121_689406_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_162121242.1|689402_689948_+	lysozyme	NA	Q1I0Z1	Pasteurella_virus	44.1	9.7e-32
WP_052698708.1|690194_690470_+	hypothetical protein	NA	B6SD31	Bacteriophage	35.3	2.3e-05
WP_162121243.1|690470_690938_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	59.5	2.4e-47
WP_162121244.1|690934_691570_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	51.0	1.7e-56
WP_032437020.1|691566_692154_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	60.0	9.1e-60
WP_024359484.1|692150_692501_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	55.7	2.7e-27
WP_162121245.1|692502_693426_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	43.2	4.9e-52
WP_162121246.1|693415_696445_+|tail	phage tail protein I	tail	V5YTN0	Pseudomonas_phage	38.5	4.9e-24
WP_032437013.1|696441_696657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162121247.1|698177_698867_+	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	30.2	3.7e-12
WP_142981843.1|698938_699685_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	30.7	5.1e-07
WP_162121248.1|699980_700472_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	62.7	1.9e-55
WP_162121249.1|700487_703505_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	45.4	1.1e-217
WP_032440702.1|703491_703650_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	63.3	3.5e-11
WP_162121250.1|703649_703961_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_047720980.1|704006_704522_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	61.2	2.2e-57
WP_162121251.1|704521_705691_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	70.5	3.5e-156
WP_162122629.1|705844_706978_+	phage late control D family protein	NA	B9A7A9	Serratia_phage	69.5	5.1e-144
WP_071845063.1|707021_707273_+	ogr/Delta-like zinc finger family protein	NA	Q858U4	Yersinia_virus	44.6	1.0e-07
WP_160741028.1|707627_708515_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_160741029.1|708581_709250_+	UPF0149 family protein	NA	NA	NA	NA	NA
WP_160741030.1|709279_710491_-	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_004852186.1|710685_710925_+	YecH family protein	NA	NA	NA	NA	NA
WP_004113821.1|710967_711465_-	non-heme ferritin	NA	NA	NA	NA	NA
WP_014229871.1|711886_712525_+	RpiB/LacA/LacB family sugar-phosphate isomerase	NA	NA	NA	NA	NA
WP_160741031.1|712577_713999_-	MFS transporter	NA	NA	NA	NA	NA
WP_014229869.1|714206_714290_+	stress response protein AzuC	NA	NA	NA	NA	NA
WP_014229868.1|714369_714621_+	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_160741214.1|714667_716179_-	MFS transporter	NA	NA	NA	NA	NA
WP_162121252.1|716503_717007_-	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_160741032.1|717507_718065_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_160741033.1|718353_719334_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_160741034.1|719395_720910_+	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2R8FG22	Brazilian_cedratvirus	27.6	1.5e-10
WP_004852169.1|720924_721905_+	L-arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_014229862.1|722063_722867_+	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_160741035.1|722841_724266_+	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_160741036.1|724292_724721_-	universal stress protein UspC	NA	NA	NA	NA	NA
WP_160741037.1|725017_725203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160741038.1|725278_726862_+	MFS transporter	NA	NA	NA	NA	NA
WP_160741039.1|726866_728006_+	glycoside hydrolase family 105 protein	NA	NA	NA	NA	NA
WP_160741040.1|728126_729860_-|tRNA	arginine--tRNA ligase	tRNA	A0A1V0SIS8	Klosneuvirus	34.5	6.3e-85
WP_032720340.1|730089_730659_+	VOC family protein	NA	NA	NA	NA	NA
WP_160741041.1|730734_731478_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
730817:730834	attR	GCGCCGCGCCGCAGGAGG	NA	NA	NA	NA
WP_160741042.1|731776_732799_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_160741043.1|732795_733539_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	29.1	1.1e-22
WP_004122068.1|733578_733974_-	membrane protein	NA	NA	NA	NA	NA
WP_160741044.1|734027_734846_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	81.9	9.1e-58
WP_160741045.1|734842_735409_-	hydrolase	NA	NA	NA	NA	NA
WP_004852140.1|735677_737465_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP048108	Klebsiella michiganensis strain BD177 chromosome, complete genome	6150416	1758629	1762656	6150416	tail,holin	Enterobacterial_phage(33.33%)	6	NA	NA
WP_162121550.1|1758629_1759784_-|tail	tail fiber domain-containing protein	tail	A0A0A0YQM3	Citrobacter_virus	36.4	8.1e-12
WP_162121551.1|1760013_1760556_-	glycoside hydrolase family 108 protein	NA	A0A0U2I1S0	Escherichia_phage	66.1	3.4e-69
WP_032749344.1|1760563_1760836_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	55.4	2.2e-16
WP_009653048.1|1760825_1761218_-	membrane protein	NA	K7PHB9	Enterobacterial_phage	66.2	1.3e-38
WP_014229124.1|1761294_1761657_-	hypothetical protein	NA	C6ZR44	Salmonella_phage	57.5	7.1e-31
WP_009653037.1|1762119_1762656_-	helix-turn-helix transcriptional regulator	NA	K7PKK1	Enterobacteria_phage	49.7	5.2e-30
>prophage 5
NZ_CP048108	Klebsiella michiganensis strain BD177 chromosome, complete genome	6150416	1864416	1904581	6150416	integrase,tail,head,portal,terminase,protease,holin,capsid	Klebsiella_phage(21.62%)	54	1897253:1897267	1911243:1911257
WP_162121574.1|1864416_1865721_-	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	52.9	9.8e-06
WP_162121575.1|1865795_1868873_-	kinase	NA	A0A286S259	Klebsiella_phage	61.9	0.0e+00
WP_049100207.1|1868869_1869250_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	79.4	7.2e-58
WP_049100206.1|1869262_1869739_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	65.8	1.1e-50
WP_004177132.1|1869725_1870199_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.1	1.4e-55
WP_162121576.1|1870219_1873582_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	56.9	5.6e-295
WP_049105829.1|1873634_1873919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162121577.1|1873974_1874280_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	65.0	4.7e-28
WP_162121578.1|1874282_1874687_-|tail	phage tail protein	tail	Q9MCS5	Enterobacteria_phage	55.7	5.5e-32
WP_017145575.1|1874717_1875428_-|tail	tail protein	tail	K7PHL2	Enterobacterial_phage	68.6	3.7e-84
WP_162121579.1|1875484_1875832_-	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	59.3	6.8e-31
WP_014838144.1|1875828_1876278_-	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	81.9	5.1e-63
WP_048258044.1|1876274_1876613_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	67.0	1.2e-37
WP_032734570.1|1876625_1876958_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6JIM5	Burkholderia_virus	31.6	8.8e-12
WP_162121580.1|1876963_1877218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162121581.1|1877263_1878484_-|capsid	phage major capsid protein	capsid	Q6JIM7	Burkholderia_virus	64.8	2.6e-141
WP_162121582.1|1878493_1879201_-|head,protease	HK97 family phage prohead protease	head,protease	Q6JIM8	Burkholderia_virus	63.0	1.9e-67
WP_162121583.1|1879176_1880496_-|portal	phage portal protein	portal	Q6JIM9	Burkholderia_virus	58.6	8.4e-138
WP_162121584.1|1880502_1882239_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	45.1	4.9e-138
WP_064398049.1|1882192_1882657_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.7	2.8e-48
WP_064353141.1|1882774_1883116_-	HNH endonuclease	NA	K7P7P4	Enterobacteria_phage	74.8	7.9e-48
WP_162121585.1|1883170_1883416_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	59.3	6.1e-18
WP_162121586.1|1883965_1884508_-	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	77.0	1.2e-77
WP_127074472.1|1884504_1884804_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	82.8	3.8e-38
WP_162121587.1|1885147_1885558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162121588.1|1886216_1886825_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	60.7	3.1e-71
WP_148676121.1|1886821_1886962_-	YlcG family protein	NA	NA	NA	NA	NA
WP_162121589.1|1886958_1889037_-	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	52.1	1.5e-194
WP_162121590.1|1889029_1889926_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	73.7	9.1e-128
WP_162121591.1|1889922_1890228_-	DUF968 domain-containing protein	NA	A0A2I7R8F9	Vibrio_phage	56.5	2.1e-23
WP_014837900.1|1890394_1890577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162121592.1|1890742_1890940_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	58.5	7.3e-14
WP_162121593.1|1891360_1891939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162121594.1|1891991_1892342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162121595.1|1892341_1893181_+	CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_162121596.1|1893101_1894007_+	hypothetical protein	NA	S5W9D9	Leptospira_phage	28.1	8.6e-17
WP_162122647.1|1894015_1894273_-	DNA polymerase III subunit theta	NA	Q71T70	Escherichia_phage	81.3	4.9e-26
WP_162121597.1|1894569_1895106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162121598.1|1895133_1896273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162122648.1|1896626_1896899_-	hypothetical protein	NA	K7PMC8	Enterobacterial_phage	84.4	3.8e-37
WP_162121599.1|1896901_1897468_-	hypothetical protein	NA	A0A2H4A316	Salmonella_phage	82.5	2.1e-21
1897253:1897267	attL	AAACAGCGCCGCCAG	NA	NA	NA	NA
WP_162121600.1|1897583_1898369_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	52.7	9.0e-63
WP_162121601.1|1898361_1898574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049130028.1|1898570_1898864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162121602.1|1898876_1899953_-	hypothetical protein	NA	K7PLZ7	Enterobacterial_phage	42.6	1.6e-30
WP_004111712.1|1899949_1900204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162121603.1|1900217_1900643_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_064377477.1|1900626_1900854_-	transcriptional regulator	NA	K7PHK4	Enterobacteria_phage	42.6	1.8e-08
WP_064377515.1|1900933_1901338_+	helix-turn-helix domain-containing protein	NA	B1B6L9	Salmonella_phage	54.9	1.2e-13
WP_162121604.1|1901928_1902222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162121605.1|1902286_1902520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162121606.1|1902743_1903250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074185878.1|1903299_1903533_+	excisionase	NA	C6ZCU6	Enterobacteria_phage	62.3	1.7e-17
WP_049130020.1|1903510_1904581_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	65.2	5.0e-133
1911243:1911257	attR	AAACAGCGCCGCCAG	NA	NA	NA	NA
>prophage 6
NZ_CP048108	Klebsiella michiganensis strain BD177 chromosome, complete genome	6150416	2451762	2547154	6150416	tRNA,transposase,tail,head,portal,terminase,protease,capsid	Klebsiella_phage(34.62%)	101	NA	NA
WP_160742136.1|2451762_2452467_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_002211347.1|2452746_2452965_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_004849425.1|2453102_2455385_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	2.8e-165
WP_004100628.1|2455415_2455733_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	3.4e-13
WP_004100627.1|2456057_2456288_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.4e-16
WP_025108294.1|2456356_2458303_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	39.2	9.4e-37
WP_162121733.1|2458299_2459415_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_162121734.1|2459591_2461250_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_004849414.1|2461632_2462328_+	aquaporin Z	NA	NA	NA	NA	NA
WP_004849412.1|2462451_2463351_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_025108293.1|2463496_2465149_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_162121735.1|2465160_2466129_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_025108291.1|2466168_2466603_-	DoxX family protein	NA	NA	NA	NA	NA
WP_162121736.1|2466755_2468474_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_032694256.1|2468628_2469630_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_162121737.1|2469640_2471074_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_009653274.1|2471170_2472184_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_160742130.1|2472180_2473011_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	28.9	8.2e-06
WP_004100606.1|2473007_2473331_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_162121738.1|2473448_2473964_+	lipoprotein	NA	NA	NA	NA	NA
WP_032721773.1|2474191_2474920_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	2.7e-29
WP_160742127.1|2474939_2475671_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004100599.1|2475677_2476394_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_014228606.1|2476393_2477062_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_014228605.1|2477235_2477967_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_160742125.1|2478184_2479657_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	32.4	4.3e-26
WP_162121739.1|2479653_2480370_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.9	2.9e-36
WP_162121740.1|2480448_2481579_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	25.8	2.5e-26
WP_004100588.1|2481621_2482110_-	YbjO family protein	NA	NA	NA	NA	NA
WP_162121741.1|2482292_2483138_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_014228601.1|2483134_2484088_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_004100581.1|2484098_2485277_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	6.1e-31
WP_004849369.1|2485334_2486447_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_004849367.1|2486795_2487275_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_009653278.1|2487364_2488267_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	34.5	2.0e-34
WP_160742121.1|2488370_2489093_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_160742120.1|2489076_2489367_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_004100567.1|2489571_2489835_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	71.8	1.6e-27
WP_004849358.1|2489841_2490225_-	membrane protein	NA	NA	NA	NA	NA
WP_004849356.1|2490492_2492178_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_009653296.1|2492336_2492879_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042927846.1|2493061_2494264_+	MFS transporter	NA	NA	NA	NA	NA
WP_160742119.1|2494263_2495079_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_160742118.1|2495126_2496362_-	MdfA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_162121742.1|2496680_2497274_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_004849345.1|2497399_2498158_+	DNA-binding transcriptional repressor DeoR	NA	A0A077SK06	Escherichia_phage	27.2	2.0e-11
WP_032721350.1|2498186_2499389_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	46.7	3.6e-95
WP_162122656.1|2499847_2499952_+	DinI family protein	NA	NA	NA	NA	NA
WP_162121743.1|2499985_2508928_-	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	59.7	0.0e+00
WP_162121744.1|2508992_2509574_-|tail	tail assembly protein	tail	Q6UAW2	Klebsiella_phage	73.9	2.4e-73
WP_162121745.1|2509586_2510297_-	peptidase P60	NA	Q6UAW4	Klebsiella_phage	96.2	2.3e-142
WP_162121746.1|2510298_2511054_-|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	92.4	1.9e-139
WP_162121747.1|2511050_2511389_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	92.0	1.7e-58
WP_162122657.1|2514576_2514789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162121748.1|2514806_2515151_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_162121749.1|2515209_2515668_-|tail	phage tail protein	tail	Q6UAX0	Klebsiella_phage	85.4	7.8e-67
WP_162121750.1|2515703_2516105_-	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	94.7	2.3e-62
WP_162121751.1|2516101_2516491_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	99.2	4.6e-68
WP_162121752.1|2516471_2516810_-|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	94.6	1.0e-55
WP_162122658.1|2516806_2517121_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	77.9	2.0e-37
WP_162121753.1|2517483_2518776_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	88.2	4.3e-211
WP_162122659.1|2518850_2519771_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	76.1	2.1e-127
WP_162121754.1|2519755_2520103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162121755.1|2520237_2520387_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_162122660.1|2520557_2521820_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	94.3	2.8e-231
WP_162121756.1|2521988_2523710_-|terminase	terminase large subunit	terminase	Q7Y413	Yersinia_phage	58.8	6.7e-196
WP_049095355.1|2523709_2524144_-|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	62.8	2.5e-30
WP_154905087.1|2524519_2524909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162121757.1|2524965_2525349_-	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	95.3	3.6e-65
WP_162121758.1|2525687_2526128_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	76.7	3.4e-59
WP_162121759.1|2526130_2526418_-	hypothetical protein	NA	Q6UAS1	Klebsiella_phage	70.5	5.1e-16
WP_162121760.1|2526414_2526777_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	94.2	8.3e-64
WP_162121761.1|2526760_2527771_-	hypothetical protein	NA	Q6UAS3	Klebsiella_phage	38.8	5.8e-14
WP_162121762.1|2527862_2528093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162121763.1|2529075_2529880_+|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	36.9	2.2e-32
WP_162121764.1|2530291_2530642_-	hypothetical protein	NA	A0A0K2FIW3	Enterobacter_phage	38.5	7.1e-12
WP_162121765.1|2530638_2531163_-	lysozyme	NA	I6PBN2	Cronobacter_phage	63.2	1.9e-48
WP_162121766.1|2531146_2531467_-	hypothetical protein	NA	O64361	Escherichia_phage	52.1	6.3e-23
WP_162121767.1|2533514_2533691_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_162121768.1|2534146_2534755_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	61.5	1.8e-71
WP_032694882.1|2534751_2534892_-	YlcG family protein	NA	NA	NA	NA	NA
WP_162121769.1|2534888_2535530_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	77.2	3.9e-88
WP_162121770.1|2535526_2536492_-	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	65.5	2.0e-141
WP_162121771.1|2536488_2537082_-	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	48.5	6.6e-42
WP_162121772.1|2537271_2537592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162121773.1|2538106_2538427_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_162121774.1|2538508_2538925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162121775.1|2539138_2539366_-	hypothetical protein	NA	G8C7S3	Escherichia_phage	51.7	4.8e-09
WP_162121039.1|2539647_2540346_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	69.6	5.6e-32
WP_162122661.1|2540351_2540777_-	hypothetical protein	NA	A0A2D2W6E9	Pectobacterium_phage	48.6	5.1e-36
WP_162121776.1|2540776_2541490_-	ead/Ea22-like family protein	NA	A0A2R2Z312	Escherichia_phage	46.9	5.9e-37
WP_162121777.1|2541486_2542272_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	54.1	1.1e-65
WP_162121778.1|2542264_2542477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162121779.1|2542473_2542767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162121780.1|2542782_2543523_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	72.0	3.3e-99
WP_162121781.1|2543525_2544422_-	hypothetical protein	NA	I6NW17	Burkholderia_virus	52.9	9.7e-29
WP_162121782.1|2544438_2544864_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_162121783.1|2544847_2545120_-	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	36.0	7.7e-06
WP_162121784.1|2545227_2545629_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	51.5	2.4e-11
WP_162121785.1|2545749_2546670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162121786.1|2546944_2547154_-	fumarate hydratase FumD	NA	I6R0R9	Salmonella_phage	92.8	7.2e-28
>prophage 7
NZ_CP048108	Klebsiella michiganensis strain BD177 chromosome, complete genome	6150416	3860551	3869905	6150416	integrase	Enterobacteria_phage(85.71%)	12	3852659:3852673	3876906:3876920
3852659:3852673	attL	AAGGTGCCGATGGGA	NA	NA	NA	NA
WP_162122058.1|3860551_3862885_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	81.0	0.0e+00
WP_004098169.1|3862898_3863219_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_004098168.1|3863215_3863443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162122676.1|3863439_3863985_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	74.1	2.2e-36
WP_004174792.1|3863987_3864254_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	70.5	7.5e-30
WP_162122059.1|3864358_3864496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162122060.1|3864795_3865533_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	59.8	2.0e-72
WP_004185270.1|3865529_3865775_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
WP_162122061.1|3865792_3866359_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	1.3e-58
WP_162122677.1|3866430_3866580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087759021.1|3867206_3868148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087759020.1|3868636_3869905_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.7	1.4e-73
3876906:3876920	attR	TCCCATCGGCACCTT	NA	NA	NA	NA
>prophage 8
NZ_CP048108	Klebsiella michiganensis strain BD177 chromosome, complete genome	6150416	5297998	5351314	6150416	tRNA,integrase,tail,head,plate,lysis,portal,terminase,holin,capsid	Escherichia_phage(34.15%)	58	5311174:5311219	5344067:5344112
WP_014226909.1|5297998_5298331_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_162122383.1|5298368_5299748_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	27.9	2.2e-32
WP_160741387.1|5299988_5300543_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_160741386.1|5300781_5301555_+	SIP domain-containing protein	NA	NA	NA	NA	NA
WP_162122384.1|5302042_5303692_-	glycerone kinase	NA	NA	NA	NA	NA
WP_162122385.1|5303759_5305178_-	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
WP_160741383.1|5305188_5305821_-	dihydroxyacetone kinase ADP-binding subunit DhaL	NA	NA	NA	NA	NA
WP_160741382.1|5305832_5306903_-	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_160741381.1|5307499_5308597_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_162122386.1|5308702_5310616_+	PTS-dependent dihydroxyacetone kinase operon transcriptional regulator DhaR	NA	NA	NA	NA	NA
WP_071532228.1|5310755_5311079_+	DUF1889 family protein	NA	NA	NA	NA	NA
5311174:5311219	attL	TGGTGGCCCCTGCTGGACTTGAACCAGCGACCAAGCGATTATGAGT	NA	NA	NA	NA
WP_162122387.1|5311339_5312290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162122388.1|5312270_5313317_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	98.8	1.5e-193
WP_162122389.1|5313316_5313892_-	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	58.2	8.9e-60
WP_001630878.1|5314021_5314285_+	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	100.0	3.1e-44
WP_162122390.1|5314315_5314825_+	phage regulatory CII family protein	NA	A0A0M4QWN1	Salmonella_phage	98.8	2.1e-89
WP_000920169.1|5314832_5315033_+	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	100.0	1.2e-32
WP_162122391.1|5314996_5315335_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	92.0	8.9e-52
WP_162122392.1|5315402_5315630_+	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	97.3	2.2e-30
WP_162122393.1|5315629_5315851_+	TraR/DksA family transcriptional regulator	NA	A0A0M4S5Q7	Salmonella_phage	94.5	2.1e-33
WP_162122701.1|5315999_5318072_+	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	91.7	0.0e+00
WP_162122394.1|5318845_5319331_+	phosphohistidine phosphatase	NA	NA	NA	NA	NA
WP_162122395.1|5319344_5320436_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_162121044.1|5320801_5321251_+	hypothetical protein	NA	A0A0M4RE72	Salmonella_phage	84.8	2.1e-08
WP_115193882.1|5321299_5322292_-|portal	phage portal protein	portal	M1SV64	Escherichia_phage	83.6	6.7e-164
WP_162122396.1|5322339_5323017_-|terminase	terminase-like family protein	terminase	S4TT96	Salmonella_phage	31.3	1.3e-22
WP_162122397.1|5323016_5324786_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	87.9	2.8e-306
WP_072124542.1|5324951_5325806_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	81.3	2.1e-126
WP_162122398.1|5325879_5326938_+|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	83.5	3.5e-163
WP_074184779.1|5326965_5327685_+|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	79.4	1.6e-95
WP_162122399.1|5327781_5328288_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	83.6	1.2e-60
WP_162122400.1|5328287_5328491_+|tail	phage tail protein	tail	A0A0F7LCN2	Escherichia_phage	80.6	1.2e-24
WP_004195910.1|5328495_5328786_+|holin	holin	holin	O80308	Escherichia_phage	85.7	5.3e-37
WP_162122401.1|5328772_5329270_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	85.8	6.2e-78
WP_162122402.1|5329266_5329698_+|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	64.7	5.3e-41
WP_064172883.1|5329672_5329831_+	hypothetical protein	NA	A0A218M4L1	Erwinia_phage	70.0	2.5e-12
WP_101991545.1|5329793_5330261_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	74.8	1.8e-63
WP_162122403.1|5330253_5330703_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	67.3	2.1e-48
WP_162122404.1|5330771_5331407_+|plate	phage baseplate assembly protein V	plate	M1SV78	Escherichia_phage	83.4	2.2e-96
WP_162122405.1|5331403_5331751_+|plate	baseplate assembly protein	plate	Q7Y4D7	Escherichia_virus	77.4	2.2e-45
WP_162122406.1|5331755_5332664_+|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	71.9	5.8e-114
WP_162122702.1|5332671_5333259_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	55.5	1.8e-55
WP_162122407.1|5333260_5336152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162122408.1|5336163_5337222_+|tail	phage tail protein	tail	E5G6P0	Salmonella_phage	46.2	1.5e-33
WP_162122409.1|5337331_5338513_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	85.6	1.9e-194
WP_162122410.1|5338526_5339042_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	75.0	5.5e-69
WP_101342491.1|5339102_5339378_+|tail	phage tail assembly protein	tail	A0A0F7LBN9	Escherichia_phage	77.5	8.3e-32
WP_014343413.1|5339410_5339530_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	92.3	2.0e-14
WP_162122411.1|5339522_5341964_+|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	55.3	7.3e-212
WP_162122412.1|5341977_5342457_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	77.7	1.2e-65
WP_162122413.1|5342456_5343623_+	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	80.6	5.8e-175
WP_162122414.1|5343690_5343909_+	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	87.5	1.2e-33
WP_009651862.1|5344266_5344773_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
5344067:5344112	attR	TGGTGGCCCCTGCTGGACTTGAACCAGCGACCAAGCGATTATGAGT	NA	NA	NA	NA
WP_160741350.1|5344842_5345505_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004105908.1|5345749_5347594_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_160741349.1|5347867_5349613_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	39.2	1.4e-76
WP_001144069.1|5349847_5350063_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_160741348.1|5350300_5351314_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.6	1.2e-107
>prophage 1
NZ_CP048109	Klebsiella michiganensis strain BD177 plasmid unnamed1	281962	159265	166730	281962		Escherichia_phage(33.33%)	14	NA	NA
WP_004197207.1|159265_159538_-	hypothetical protein	NA	I7B2L9	Escherichia_phage	48.9	1.5e-12
WP_157769349.1|159621_159795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099745340.1|160096_160291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099745233.1|160290_161178_-	hypothetical protein	NA	A0A248SKW5	Klebsiella_phage	54.4	1.3e-20
WP_099745339.1|161174_161690_-	DUF262 domain-containing protein	NA	A0A2H4FWH2	Salmonella_phage	68.2	1.7e-65
WP_099745232.1|161720_162224_-	hypothetical protein	NA	A0A1V0E5L6	Salmonella_phage	67.5	1.6e-25
WP_099745231.1|162270_162486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099745230.1|163783_164011_-	hypothetical protein	NA	A9YWV3	Burkholderia_phage	48.1	1.5e-10
WP_099745227.1|164481_164670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142984094.1|164666_165164_-	hypothetical protein	NA	A0A076G835	Escherichia_phage	55.2	1.9e-26
WP_099745225.1|165257_165476_-	hypothetical protein	NA	R9TRD3	Aeromonas_phage	65.2	3.7e-19
WP_099745224.1|165656_165893_-	hypothetical protein	NA	S5MQM0	Escherichia_phage	76.7	1.0e-22
WP_162122731.1|166015_166330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101415780.1|166409_166730_-	hypothetical protein	NA	J9Q750	Salmonella_phage	50.0	1.1e-27
>prophage 2
NZ_CP048109	Klebsiella michiganensis strain BD177 plasmid unnamed1	281962	188835	197200	281962		Burkholderia_phage(28.57%)	12	NA	NA
WP_099745328.1|188835_189153_-	DUF3846 domain-containing protein	NA	A0A2H4P7A4	Pseudomonas_phage	46.5	3.0e-09
WP_004181828.1|189180_189429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099745326.1|190007_191210_+	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	38.6	1.2e-34
WP_099745325.1|191301_192717_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	51.1	1.5e-105
WP_162122735.1|192843_193587_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	49.2	1.1e-59
WP_004026465.1|193583_194018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004026466.1|194050_194311_-	hypothetical protein	NA	A0A0M3LSW2	Mannheimia_phage	41.0	5.9e-11
WP_004026468.1|194564_195008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181826.1|195238_195598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099745320.1|195613_196192_-	DNA-binding protein	NA	Q1MVE8	Enterobacteria_phage	55.3	3.2e-57
WP_032719502.1|196316_196631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099745319.1|196621_197200_-	HNH endonuclease	NA	W0LI46	Edwardsiella_phage	56.2	1.2e-40
>prophage 1
NZ_CP048110	Klebsiella michiganensis strain BD177 plasmid unnamed2	191962	3169	54381	191962	integrase,protease,transposase	Escherichia_phage(28.57%)	40	1027:1042	24331:24346
1027:1042	attL	CTAATGCGACAGAGCC	NA	NA	NA	NA
WP_162122744.1|3169_4177_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_162122745.1|4259_5384_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	58.1	6.9e-125
WP_045332765.1|5792_6668_+	protein RepA	NA	Q71TL8	Escherichia_phage	57.6	1.9e-82
WP_162122746.1|7174_7828_+	AAA family ATPase	NA	E5FFJ3	Burkholderia_phage	45.4	2.0e-44
WP_162122747.1|7875_8160_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_162122280.1|8357_9054_+|transposase	IS1 family transposase	transposase	A0A077SLN4	Escherichia_phage	55.8	1.5e-77
WP_162122885.1|9086_9755_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	86.9	2.8e-113
WP_162122748.1|10094_11072_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	55.5	1.3e-71
WP_162122749.1|11495_12191_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	43.9	2.0e-45
WP_162122750.1|12219_13317_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	43.5	1.4e-74
WP_162122751.1|13657_14287_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_162122752.1|15977_16577_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_162122753.1|16856_18110_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_162122754.1|18109_20323_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	24.7	5.3e-20
WP_162121763.1|20400_21205_+|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	36.9	2.2e-32
WP_162122755.1|21486_22587_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	43.2	1.1e-74
WP_162122756.1|22725_23079_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_162122757.1|24460_25840_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
24331:24346	attR	CTAATGCGACAGAGCC	NA	NA	NA	NA
WP_162122758.1|26245_27949_-	acyl--CoA ligase	NA	NA	NA	NA	NA
WP_162122759.1|27986_29135_-	MFS transporter	NA	NA	NA	NA	NA
WP_162122760.1|29173_30016_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_162122761.1|30015_30831_-	fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_162122762.1|30838_32179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162122763.1|32873_34535_-	oligopeptide ABC transporter substrate-binding protein OppA	NA	NA	NA	NA	NA
WP_162122764.1|35350_35629_-	cytoplasmic protein	NA	NA	NA	NA	NA
WP_162122765.1|35592_36243_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_162122766.1|36232_36787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162122886.1|38107_38515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162122767.1|40419_40599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162122768.1|40670_41609_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.3	5.5e-75
WP_142984176.1|41752_42034_-	cytoplasmic protein	NA	NA	NA	NA	NA
WP_162122769.1|42081_42813_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_131930946.1|43121_43481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131930945.1|43943_44243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162121763.1|44518_45323_+|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	36.9	2.2e-32
WP_162122770.1|45312_47247_-	colicin-D	NA	NA	NA	NA	NA
WP_162122771.1|48857_49871_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	32.4	2.5e-17
WP_162122772.1|50876_51734_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_162122773.1|52033_52294_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_162122774.1|53358_54381_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP048110	Klebsiella michiganensis strain BD177 plasmid unnamed2	191962	96698	138319	191962	protease,transposase	Escherichia_phage(22.22%)	45	NA	NA
WP_162122890.1|96698_97523_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_162122815.1|97786_98986_-	nucleoside permease	NA	NA	NA	NA	NA
WP_162122816.1|99070_100090_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_162122817.1|100079_101192_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	32.5	1.8e-48
WP_162122818.1|101188_101872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162122276.1|102007_103048_+|transposase	IS481 family transposase	transposase	A0A077SLK2	Escherichia_phage	94.5	7.7e-195
WP_162122819.1|103150_104104_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	48.8	2.7e-61
WP_162122891.1|104174_104504_-	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	63.4	3.9e-28
WP_162122892.1|105369_106044_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_162122820.1|106294_106525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162122821.1|106616_106844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162122822.1|107121_107559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162122893.1|107684_107870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162122823.1|107914_108421_-	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	28.6	1.7e-06
WP_162122824.1|108802_109063_-	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	45.0	1.6e-13
WP_162122825.1|109069_109219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162122826.1|109345_109864_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_162122827.1|109857_110292_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_162122828.1|110349_112431_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	25.4	4.3e-19
WP_162122894.1|113288_113684_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_162122829.1|113752_114184_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	33.3	4.2e-14
WP_162122830.1|114602_115370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162122831.1|115418_115829_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_162122832.1|115875_116097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162122833.1|116096_116798_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	33.3	6.6e-25
WP_162122834.1|117188_117524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162122835.1|117520_117754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162122836.1|118211_118442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162122837.1|118647_118893_+	DinI family protein	NA	Q7Y3V9	Yersinia_phage	41.0	6.7e-09
WP_162122895.1|118934_119339_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.2	1.2e-31
WP_162122838.1|120102_121074_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_162122839.1|121063_122719_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_162122840.1|122699_123275_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	51.1	5.8e-43
WP_162122841.1|123813_124431_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_162122842.1|124818_125427_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_162122843.1|125423_127064_-	MCE family protein	NA	NA	NA	NA	NA
WP_162122844.1|127060_127684_-	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_162122845.1|127673_128300_-	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_162122276.1|128478_129519_+|transposase	IS481 family transposase	transposase	A0A077SLK2	Escherichia_phage	94.5	7.7e-195
WP_162122846.1|129587_130256_-	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
WP_162122847.1|131063_132779_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	53.5	7.7e-168
WP_162122848.1|133967_134930_-	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	68.2	3.1e-113
WP_162122849.1|134926_136132_-	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	90.2	3.8e-206
WP_032635043.1|136576_137173_+	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	37.2	1.8e-23
WP_162122276.1|137278_138319_-|transposase	IS481 family transposase	transposase	A0A077SLK2	Escherichia_phage	94.5	7.7e-195
>prophage 3
NZ_CP048110	Klebsiella michiganensis strain BD177 plasmid unnamed2	191962	141547	148871	191962	integrase,transposase	Burkholderia_phage(33.33%)	7	130051:130064	152466:152479
130051:130064	attL	ATGATGTTGTTATA	NA	NA	NA	NA
WP_162122896.1|141547_142762_+	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	41.9	4.7e-34
WP_045265538.1|142796_144230_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	51.6	6.4e-107
WP_162122897.1|144609_145230_+	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	29.6	9.4e-07
WP_040118531.1|145249_145513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040118542.1|145613_146543_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	55.0	4.2e-75
WP_040118530.1|147336_148032_+	replication initiation protein	NA	I3WF20	Macacine_betaherpesvirus	31.6	8.6e-25
WP_162122850.1|148076_148871_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.1	7.7e-54
152466:152479	attR	ATGATGTTGTTATA	NA	NA	NA	NA
>prophage 4
NZ_CP048110	Klebsiella michiganensis strain BD177 plasmid unnamed2	191962	162584	175773	191962	transposase	Pseudomonas_phage(22.22%)	10	NA	NA
WP_162122863.1|162584_164267_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	52.0	3.0e-164
WP_162122864.1|164270_164453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162122865.1|164850_165177_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	74.5	1.2e-42
WP_162122866.1|165173_165797_-|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	42.7	1.5e-15
WP_162122898.1|165983_169991_-	DEAD/DEAH box helicase	NA	Q1HGZ3	Antheraea_pernyi_nuclear_polyhedrosis_virus	30.1	7.1e-47
WP_162122867.1|170119_171091_-	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	27.8	2.4e-09
WP_162122868.1|171090_172758_-|transposase	transposase family protein	transposase	Q5ZR04	Pseudomonas_phage	24.2	6.4e-10
WP_162122899.1|172757_173411_-	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	46.0	4.3e-34
WP_162122869.1|173801_174497_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.9	1.2e-42
WP_162122280.1|175076_175773_+|transposase	IS1 family transposase	transposase	A0A077SLN4	Escherichia_phage	55.8	1.5e-77
>prophage 1
NZ_CP048111	Klebsiella michiganensis strain BD177 plasmid unnamed3	164510	4526	59205	164510	transposase	Escherichia_phage(38.89%)	52	NA	NA
WP_162123002.1|4526_5210_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	40.5	9.3e-40
WP_079959158.1|5606_5798_-	ribbon-helix-helix domain-containing protein	NA	NA	NA	NA	NA
WP_162122904.1|5959_6283_-	plasmid maintenance protein CcdB	NA	NA	NA	NA	NA
WP_079959175.1|6282_6531_-	post-segregation antitoxin CcdA	NA	NA	NA	NA	NA
WP_162122905.1|6799_7495_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.5	1.7e-41
WP_000124732.1|8256_8499_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_050880437.1|8491_8776_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_162122906.1|8898_9591_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.4	4.0e-46
WP_162122905.1|9655_10351_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.5	1.7e-41
WP_162122907.1|10958_11570_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_162122908.1|11843_12518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162122909.1|12594_12954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162122910.1|13016_13415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162122911.1|13411_13720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162122779.1|13945_14386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162122778.1|14385_14667_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_162122912.1|14879_15374_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_162122913.1|15441_15666_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_162122914.1|15677_16241_-	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_162122915.1|16531_17164_+	recombinase family protein	NA	NA	NA	NA	NA
WP_162122916.1|17603_17963_+	DUF596 domain-containing protein	NA	NA	NA	NA	NA
WP_162122917.1|17959_18133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162123003.1|19454_20661_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	62.5	1.5e-101
WP_162122918.1|20808_21909_+	DUF4037 domain-containing protein	NA	NA	NA	NA	NA
WP_162122865.1|22615_22942_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	74.5	1.2e-42
WP_162122864.1|23339_23522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162122863.1|23525_25208_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	52.0	3.0e-164
WP_162122919.1|25342_26914_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	60.2	7.3e-173
WP_162122920.1|27138_27693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162122765.1|27682_28333_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_162122921.1|28296_28575_+	cytoplasmic protein	NA	NA	NA	NA	NA
WP_162122763.1|29390_31052_+	oligopeptide ABC transporter substrate-binding protein OppA	NA	NA	NA	NA	NA
WP_162122922.1|32023_33124_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	42.7	5.4e-74
WP_162123004.1|34213_34360_+|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	62.9	5.8e-08
WP_162122280.1|34670_35368_-|transposase	IS1 family transposase	transposase	A0A077SLN4	Escherichia_phage	55.8	1.5e-77
WP_162122923.1|35787_36348_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_162122924.1|36412_36961_+	fimbrial protein	NA	NA	NA	NA	NA
WP_162122925.1|36966_37734_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_162122926.1|37833_40461_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_162123005.1|40552_41554_+	fimbrial protein	NA	NA	NA	NA	NA
WP_162122927.1|41571_42144_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_162122928.1|42279_43059_+	porin family protein	NA	NA	NA	NA	NA
WP_162122929.1|44822_46364_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_162122930.1|46591_47820_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	81.3	5.0e-145
WP_162122931.1|50902_51502_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_162122040.1|51680_52377_+|transposase	IS1 family transposase	transposase	A0A077SLN4	Escherichia_phage	55.8	4.4e-77
WP_162122932.1|53079_54180_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	43.2	8.4e-75
WP_162122933.1|54697_55672_-	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	53.5	5.7e-83
WP_047596155.1|55671_56877_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	6.9e-163
WP_162122934.1|57224_57845_+	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	31.0	3.5e-09
WP_022644719.1|57864_58131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162122935.1|58251_59205_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	57.1	1.5e-75
>prophage 2
NZ_CP048111	Klebsiella michiganensis strain BD177 plasmid unnamed3	164510	65019	133245	164510	transposase	Stx2-converting_phage(23.81%)	51	NA	NA
WP_162121763.1|65019_65825_-|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	36.9	2.2e-32
WP_162122941.1|65918_66239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162122942.1|66955_68161_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	47.0	2.1e-87
WP_162122943.1|68358_69621_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_162122921.1|70893_71172_-	cytoplasmic protein	NA	NA	NA	NA	NA
WP_162122765.1|71135_71786_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_162122944.1|71775_72321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162122945.1|72422_72749_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_162122772.1|73724_74582_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_162122946.1|74879_75137_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_162122947.1|75501_75921_+	VOC family protein	NA	NA	NA	NA	NA
WP_162122919.1|76093_77665_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	60.2	7.3e-173
WP_162122948.1|77684_78032_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	1.8e-44
WP_162122866.1|78028_78652_-|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	42.7	1.5e-15
WP_162122949.1|79973_80669_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.1	8.5e-41
WP_162121763.1|80905_81710_+|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	36.9	2.2e-32
WP_162122950.1|81779_82829_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	40.4	1.4e-66
WP_125366744.1|86076_87147_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.0	1.4e-26
WP_162122951.1|87139_88909_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_162122952.1|88989_90078_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_162122953.1|90246_90942_-	response regulator	NA	NA	NA	NA	NA
WP_162122954.1|90925_92566_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_162121763.1|93075_93881_-|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	36.9	2.2e-32
WP_162122955.1|95157_95925_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_162122956.1|95890_97279_-	fimbrial usher protein StbD	NA	NA	NA	NA	NA
WP_162122957.1|97281_99879_-	fimbrial outer membrane usher protein	NA	NA	NA	NA	NA
WP_162123006.1|99859_100579_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_162122958.1|100667_101201_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_162122959.1|101281_101611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162122960.1|102696_103797_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	42.7	5.4e-74
WP_162122961.1|104407_105101_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	81.0	1.3e-110
WP_162123007.1|105299_106586_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	28.9	2.8e-37
WP_162121763.1|106665_107470_+|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	36.9	2.2e-32
WP_162122962.1|107636_108053_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_061549448.1|108049_108280_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_162122963.1|108832_109162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162122964.1|110894_111242_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	67.9	2.8e-40
WP_162122965.1|111241_111655_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	35.0	1.9e-11
WP_162123008.1|112226_112625_+	Exc2 family lipoprotein	NA	NA	NA	NA	NA
WP_162123009.1|112788_114057_+	S-layer protein	NA	NA	NA	NA	NA
WP_162122966.1|115568_117689_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	27.7	2.3e-36
WP_162122967.1|117681_118959_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_162122968.1|120564_120957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162122969.1|121338_121557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162122040.1|121907_122605_-|transposase	IS1 family transposase	transposase	A0A077SLN4	Escherichia_phage	55.8	4.4e-77
WP_162123010.1|122668_123334_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.4	4.8e-41
WP_162122970.1|125198_126203_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_162122971.1|127202_129683_+	glycosyl hydrolase	NA	NA	NA	NA	NA
WP_162122972.1|129966_131067_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	45.5	4.6e-81
WP_162122973.1|131299_132178_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_162122905.1|132549_133245_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.5	1.7e-41
>prophage 3
NZ_CP048111	Klebsiella michiganensis strain BD177 plasmid unnamed3	164510	154436	162444	164510	integrase,transposase	Escherichia_phage(42.86%)	9	152325:152340	160008:160023
152325:152340	attL	CGGTTCTGTCGCATTA	NA	NA	NA	NA
WP_000143805.1|154436_154727_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	61.1	3.0e-24
WP_162122997.1|154716_154971_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	47.6	2.6e-11
WP_162122998.1|155127_155838_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	42.5	2.2e-15
WP_032672763.1|155924_156320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162122999.1|157089_157569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162122276.1|157663_158704_+|transposase	IS481 family transposase	transposase	A0A077SLK2	Escherichia_phage	94.5	7.7e-195
WP_162123012.1|160061_160760_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.5	1.7e-41
160008:160023	attR	CGGTTCTGTCGCATTA	NA	NA	NA	NA
WP_162122040.1|160798_161495_+|transposase	IS1 family transposase	transposase	A0A077SLN4	Escherichia_phage	55.8	4.4e-77
WP_162121763.1|161639_162444_+|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	36.9	2.2e-32
