The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP048066	Piscirickettsia salmonis strain Ps-8079A chromosome, complete genome	3175218	3075	115257	3175218	tRNA,transposase	Staphylococcus_phage(21.43%)	109	NA	NA
WP_016209326.1|3075_4455_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_036776466.1|4569_6462_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_036776463.1|6509_7136_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_016209314.1|7155_8040_+	ParA family protein	NA	Q8JL10	Natrialba_phage	27.7	1.7e-17
WP_016209349.1|8072_8966_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	31.8	6.7e-14
WP_016209313.1|9080_9479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209354.1|9483_10299_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_016209328.1|10350_10755_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_017378485.1|10809_11280_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_016209332.1|11291_11819_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_016209323.1|11835_13377_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_016209322.1|13402_14263_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_016209339.1|14293_15685_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_016209335.1|15709_16138_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_016209325.1|16231_17596_+	UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	40.5	6.6e-37
WP_036776458.1|17651_19487_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	44.0	3.3e-124
WP_162034391.1|19660_20251_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_075273393.1|20315_21023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274976.1|21167_21419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274975.1|21827_22010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047256.1|22214_23438_+	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.8	7.3e-11
WP_075273397.1|23649_24045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211851.1|24733_25390_-	2OG-Fe dioxygenase family protein	NA	NA	NA	NA	NA
WP_075273625.1|25586_26339_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_016211852.1|26397_27111_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	36.0	1.7e-28
WP_129556614.1|27696_27849_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_122942409.1|27986_28418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211924.1|28776_28935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157883632.1|29975_30221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162034392.1|30738_30924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162034393.1|30947_31316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162034458.1|31284_31518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162034394.1|31564_32182_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_162034386.1|33643_33877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047148.1|35804_36842_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_162034395.1|37216_37771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162034396.1|38048_38819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162034459.1|38629_38989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162034397.1|39000_39345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162034398.1|39277_39853_+	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_081377865.1|40211_40496_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273551.1|42520_42823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162034391.1|52727_53318_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_075273393.1|53382_54090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274976.1|54234_54486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274975.1|54894_55077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047256.1|55281_56505_+	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.8	7.3e-11
WP_075273397.1|56716_57112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211851.1|57800_58457_-	2OG-Fe dioxygenase family protein	NA	NA	NA	NA	NA
WP_075273625.1|58653_59406_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_016211852.1|59464_60178_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	36.0	1.7e-28
WP_129556614.1|60763_60916_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_122942409.1|61053_61485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211924.1|61844_62003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047255.1|62158_63130_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_157883632.1|63048_63294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126480.1|63908_64592_+	methyltransferase	NA	NA	NA	NA	NA
WP_080743040.1|64638_65295_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|65353_66328_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_052104719.1|66840_68265_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211299.1|68492_69434_+	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_032126720.1|69453_71448_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_016211298.1|71444_72050_+	cytochrome c oxidase subunit III family protein	NA	NA	NA	NA	NA
WP_016211294.1|72051_72393_+	prokaryotic cytochrome C oxidase subunit IV family protein	NA	NA	NA	NA	NA
WP_016211297.1|72393_73230_+	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_016211291.1|73226_73571_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_155047005.1|73608_74458_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|74517_75492_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211791.1|75564_75828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211793.1|75853_77281_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016211790.1|77277_77973_-	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_054300550.1|79277_79643_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|79699_79864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|79853_80153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007065.1|80365_81205_+	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_016212335.1|81221_81560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|82654_83629_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047254.1|83672_83810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036777721.1|84746_85520_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_162034399.1|85617_86646_-	protein kinase family protein	NA	NA	NA	NA	NA
WP_016210702.1|87300_90363_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.9	1.2e-62
WP_016210701.1|90359_91424_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016210703.1|91779_92733_-	glutathione synthase	NA	NA	NA	NA	NA
WP_016210700.1|92764_93928_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_032126484.1|93933_94533_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_016210697.1|94720_95221_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.2	1.0e-19
WP_016210706.1|95238_96327_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_016211099.1|96465_97710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211097.1|97706_98549_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_036777711.1|98528_99338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126369.1|99505_99733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211100.1|99733_100684_+	TonB family protein	NA	NA	NA	NA	NA
WP_032126371.1|100739_101291_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_016211105.1|101417_101840_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_016211109.1|101832_102579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211103.1|102621_103320_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_032126370.1|103330_104155_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	35.5	5.4e-26
WP_016211108.1|104484_104853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|104847_105909_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126486.1|105958_106189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211248.1|106318_107533_-	aromatic amino acid transport family protein	NA	NA	NA	NA	NA
WP_017376242.1|107833_108895_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_036777695.1|108908_110636_+	oxaloacetate-decarboxylating malate dehydrogenase	NA	NA	NA	NA	NA
WP_016211245.1|110669_111401_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_016211247.1|111400_112189_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_016211251.1|112293_112917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211250.1|113236_113449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047032.1|113604_114666_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047033.1|114660_115257_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP048066	Piscirickettsia salmonis strain Ps-8079A chromosome, complete genome	3175218	144957	202948	3175218	transposase,protease	Staphylococcus_phage(37.5%)	59	NA	NA
WP_129556618.1|144957_146055_+|protease	trypsin-like serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.1	5.3e-21
WP_016209581.1|146120_146831_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_129556619.1|146913_148122_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_016209598.1|148188_148773_+	YggT family protein	NA	NA	NA	NA	NA
WP_032126223.1|148838_149498_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016209604.1|149501_150428_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_016209605.1|150424_151216_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_129556620.1|151296_152181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047034.1|152182_153370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|153346_154321_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016209611.1|154569_154761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047035.1|154840_155020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209580.1|155111_155636_+	ankyrin repeat family protein	NA	NA	NA	NA	NA
WP_016209612.1|156019_156388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209595.1|156425_156698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300576.1|156788_158084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211692.1|158719_159622_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	28.4	1.6e-18
WP_051307362.1|159678_160530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211694.1|161109_163119_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.8	3.0e-110
WP_054300271.1|163156_164131_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211637.1|164632_166045_-	amino acid permease	NA	NA	NA	NA	NA
WP_032126550.1|166537_167545_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_016211636.1|167564_169085_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	27.1	2.7e-31
WP_016211018.1|170035_171352_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_016211015.1|171455_171839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211019.1|171973_175039_-	MMPL family transporter	NA	S5VTK5	Leptospira_phage	20.6	5.1e-53
WP_016211017.1|175107_176211_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016211016.1|176234_176789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273381.1|176903_177473_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_155047036.1|178513_179413_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047037.1|179557_179863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212565.1|180293_180653_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_054300209.1|180674_181040_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046700.1|181096_181261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|181250_181550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126725.1|182582_183149_-	DUF1415 domain-containing protein	NA	NA	NA	NA	NA
WP_016210241.1|183160_183946_-	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_016210235.1|184577_185501_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_016210246.1|185552_186548_-	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_016210237.1|186579_187074_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_036778333.1|187165_187423_-	glutaredoxin 3	NA	NA	NA	NA	NA
WP_016210233.1|187512_187935_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_016210236.1|188253_188970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210247.1|189013_189265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778330.1|189269_190706_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_016210231.1|190733_192176_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_016210242.1|192263_192602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210243.1|192686_193217_+	outer membrane family protein	NA	NA	NA	NA	NA
WP_016210228.1|193277_195470_+	DNA helicase II	NA	A7KV33	Bacillus_phage	36.0	1.3e-106
WP_016210238.1|195512_195998_-	ProQ/FinO family protein	NA	NA	NA	NA	NA
WP_016210226.1|196267_196699_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_036778324.1|196716_197547_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_080664837.1|197561_197705_-	lipoprotein	NA	NA	NA	NA	NA
WP_052104672.1|197735_198620_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_016210244.1|198591_198813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210225.1|198986_199265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|200235_201141_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_036780891.1|201197_202376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|202372_202948_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP048066	Piscirickettsia salmonis strain Ps-8079A chromosome, complete genome	3175218	226634	297631	3175218	tail,tRNA,transposase,protease	Acinetobacter_phage(25.0%)	60	NA	NA
WP_016209871.1|226634_228617_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G9E4U6	Ostreococcus_lucimarinus_virus	40.9	3.9e-115
WP_016209869.1|228826_230170_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_016209874.1|230436_233106_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_016209857.1|233129_235049_+	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_016209860.1|235218_236640_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	3.1e-45
WP_016209866.1|236785_237760_+	phospholipase A	NA	NA	NA	NA	NA
WP_054300537.1|237791_238199_+	glyoxalase	NA	NA	NA	NA	NA
WP_016209859.1|238477_238699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209875.1|238862_240524_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	64.9	5.3e-182
WP_016209850.1|240596_240887_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	42.6	3.3e-15
WP_036776911.1|241112_241568_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_016209852.1|241632_242097_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_016209862.1|242189_243536_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_016209870.1|243535_244441_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_016209854.1|244502_245489_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_016209851.1|245481_245724_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_016209858.1|245845_247390_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.8	6.5e-65
WP_036776914.1|247436_248723_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_016209864.1|248765_250160_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_016209867.1|250183_250363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307322.1|250359_250539_-	DDE endonuclease	NA	NA	NA	NA	NA
WP_054300181.1|250542_250824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|250880_251246_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210079.1|254251_254749_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_016210095.1|254919_255615_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_080664831.1|255717_257280_-	APC family permease	NA	NA	NA	NA	NA
WP_016210093.1|257595_259389_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	41.3	2.6e-118
WP_016210081.1|259474_259747_+	DUF615 domain-containing protein	NA	NA	NA	NA	NA
WP_016210094.1|259752_260379_+	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_016210077.1|260365_261796_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_016210086.1|262128_263184_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.2	4.3e-28
WP_032126605.1|263152_263830_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_016210084.1|263819_264656_+	D-methionine-binding lipoprotein metQ	NA	NA	NA	NA	NA
WP_016210080.1|264815_265109_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_122940784.1|265215_266022_-	trfA family protein	NA	NA	NA	NA	NA
WP_016210083.1|266326_267181_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_036776920.1|267335_268385_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_036776924.1|268435_269092_-	DedA family protein	NA	NA	NA	NA	NA
WP_016210097.1|269109_270390_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_016210096.1|270663_272025_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_032126863.1|272424_272976_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_162034387.1|277288_277447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211802.1|278407_279679_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_036778206.1|279735_280719_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_016211800.1|280715_281501_+	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_032126362.1|282197_282563_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|282508_283084_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300535.1|283087_283807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300534.1|283951_284152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211358.1|284199_284661_-	DUF1499 domain-containing protein	NA	NA	NA	NA	NA
WP_016211357.1|285084_286566_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.3	6.3e-49
WP_016211355.1|286628_287738_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	2.9e-35
WP_016211354.1|287835_289797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211359.1|290326_290731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047045.1|290783_291479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047246.1|291455_292430_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	1.8e-28
WP_098082809.1|292600_292951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162034402.1|293668_293806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|293893_294976_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_129556499.1|296478_297631_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
>prophage 4
NZ_CP048066	Piscirickettsia salmonis strain Ps-8079A chromosome, complete genome	3175218	326572	386432	3175218	transposase	Bodo_saltans_virus(20.0%)	57	NA	NA
WP_054300526.1|326572_326869_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_105962174.1|327017_327182_-	phosphatase	NA	NA	NA	NA	NA
WP_016211026.1|327280_327685_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_075273367.1|327977_328754_+	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_155047049.1|328762_330844_+	protein kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	28.0	4.0e-17
WP_016211031.1|331008_331488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211032.1|331797_332595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211033.1|332706_333999_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_032126377.1|334164_335166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211034.1|335282_335462_+	rubredoxin	NA	NA	NA	NA	NA
WP_016211023.1|335472_335907_-	protoporphyrinogen oxidase HemJ	NA	NA	NA	NA	NA
WP_016211029.1|336120_336483_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.5	7.6e-25
WP_016212102.1|336656_338297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|339807_340960_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_129556441.1|344388_345615_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126490.1|345963_346929_+	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_016210868.1|346925_347225_+	pilZ domain protein	NA	NA	NA	NA	NA
WP_036778898.1|347256_348036_+	YchF/TatD family DNA exonuclease	NA	NA	NA	NA	NA
WP_016210861.1|348061_348292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210862.1|348443_348689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210870.1|348840_349632_+	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_016212128.1|350545_351292_+	solute symporter family protein	NA	NA	NA	NA	NA
WP_032126495.1|351382_352267_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_054300397.1|352672_352918_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046705.1|353158_353326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273298.1|353271_353847_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047050.1|353899_354637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777815.1|354640_354925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210128.1|355018_355282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210132.1|355648_356467_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_129556442.1|356539_358912_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	35.3	2.8e-160
WP_036777812.1|359624_361052_+	amino acid permease	NA	NA	NA	NA	NA
WP_016210131.1|361086_362109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210140.1|362125_362503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|363465_363831_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|363776_364352_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210122.1|364591_365284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126492.1|365910_366885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210121.1|366874_368647_+	single-stranded-DNA-specific exonuclease RecJ	NA	NA	NA	NA	NA
WP_016210136.1|368647_368995_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_036777821.1|369244_370471_+	cysteine desulfurase-like protein	NA	NA	NA	NA	NA
WP_016210141.1|370560_371859_-	MFS transporter	NA	NA	NA	NA	NA
WP_162034403.1|371892_372600_-	queuosine precursor transporter	NA	A0A1W7AG82	Streptococcus_virus	30.4	3.7e-15
WP_016210137.1|372622_373174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777805.1|373400_374639_-	MFS transporter	NA	NA	NA	NA	NA
WP_016210130.1|374815_375106_+	PAAR motif family protein	NA	NA	NA	NA	NA
WP_155047051.1|375417_376287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047052.1|376431_377160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777801.1|378022_378241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212044.1|379014_379269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036794771.1|379991_380978_+	APC family permease	NA	NA	NA	NA	NA
WP_016211795.1|381115_381310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300521.1|381995_383054_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_016211797.1|383215_384619_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_075273359.1|384669_385245_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300520.1|385190_385505_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047053.1|385545_386432_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP048066	Piscirickettsia salmonis strain Ps-8079A chromosome, complete genome	3175218	470664	626724	3175218	tRNA,integrase,transposase,protease	Escherichia_phage(36.84%)	167	537451:537510	551661:551834
WP_054300513.1|470664_471528_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129556623.1|471744_473304_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.9	3.0e-09
WP_051307335.1|473325_474360_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_016210643.1|474408_474978_+	elongation factor P	NA	NA	NA	NA	NA
WP_122940481.1|475113_476085_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A1V0SAC0	Catovirus	25.3	2.8e-21
WP_016210645.1|476096_477674_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_129556624.1|477739_478726_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_054300512.1|479057_480167_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_016210650.1|480272_481457_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_016210649.1|481534_483523_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_016210644.1|483731_483887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300510.1|484157_484340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|484482_484848_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|484793_485369_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047056.1|485358_485721_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126128.1|486637_488044_+	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_016210501.1|488061_489048_+	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	K7Y9E1	Megavirus	34.2	4.9e-42
WP_016210490.1|489050_490205_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2D2W2B8	Stenotrophomonas_phage	28.6	1.3e-14
WP_016210502.1|490201_490897_+	pseudaminic acid cytidylyltransferase	NA	A0A1B1IVD3	uncultured_Mediterranean_phage	35.5	1.5e-08
WP_016210500.1|491031_492522_+	UDP-2,4-diacetamido-2,4, 6-trideoxy-beta-L-altropyranose hydrolase	NA	NA	NA	NA	NA
WP_036777447.1|492542_493592_+	pseudaminic acid synthase	NA	NA	NA	NA	NA
WP_016210496.1|493658_495053_-	capsule polysaccharide biosynthesis family protein	NA	NA	NA	NA	NA
WP_036777444.1|495931_497863_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.6	1.0e-120
WP_075273353.1|497867_498398_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	4.7e-15
WP_016210493.1|498432_498627_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_016210495.1|498669_499029_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_016211706.1|499448_500444_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.4	2.5e-33
WP_036777440.1|500456_502838_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211707.1|502843_503131_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	33.7	3.0e-08
WP_052133265.1|503402_503879_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_054300509.1|504023_504221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|504345_505320_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273615.1|506220_506319_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036780545.1|506803_507514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047057.1|507677_508094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300575.1|508330_509023_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_016210472.1|509064_509838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210485.1|509839_510781_-	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	26.5	2.3e-20
WP_016210482.1|510913_512491_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_016210484.1|512700_514458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210486.1|515006_515765_-	oxidoreductase NAD-binding domain protein	NA	NA	NA	NA	NA
WP_032126625.1|515972_516545_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_016210475.1|516648_517197_+	DUF2058 family protein	NA	NA	NA	NA	NA
WP_016210487.1|517498_517744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210488.1|517772_518069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036779353.1|518336_519248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300506.1|519738_520146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300481.1|520217_520946_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_032126799.1|521026_521839_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_155047058.1|522900_523263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212146.1|523265_525005_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_155046941.1|525406_525670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300500.1|526341_527070_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	2.7e-45
WP_016212070.1|527479_528079_-	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_016212069.1|528053_528221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212066.1|528432_529209_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_054300501.1|529569_530298_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_032126794.1|530309_530702_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_016212477.1|530698_530944_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_017375910.1|531104_531833_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_162034404.1|531907_535189_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|536500_537076_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|537021_537387_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
537451:537510	attL	ATAAGGCATAGCGGCCATACCAACGCACCAGCCAAAGAATAATCTCACCGGAATAATGCT	NA	NA	NA	NA
WP_155047059.1|537665_538580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212159.1|538847_539045_+	antirestriction family protein	NA	A0A222Z017	Rhodococcus_phage	55.7	4.1e-09
WP_054300201.1|539404_540133_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_155047060.1|540162_540837_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	45.9	5.2e-27
WP_016212024.1|540981_541230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036780881.1|541226_541826_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_016212022.1|541825_542044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212023.1|542818_543811_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.7	1.1e-17
WP_075273432.1|543807_544542_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	5.7e-43
WP_155047061.1|544802_545069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047062.1|545213_545372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047063.1|545394_545646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300477.1|546095_546824_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	5.6e-43
WP_051307368.1|547530_548811_+	AAA family ATPase	NA	Q7Y3Y6	Yersinia_phage	33.5	7.3e-38
WP_162034405.1|548810_549431_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_162034406.1|549400_549778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211646.1|550149_550389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211642.1|550381_550735_+	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_017375910.1|551037_551766_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_162034407.1|552235_552475_-	hypothetical protein	NA	NA	NA	NA	NA
551661:551834	attR	ATAAGGCATAGCGGCCATACCAACGCACCAGCCAAAGAATAATCTCACCGGAATAATGCTTCCATTTAAAGGGTTGATTCTTCTTAAATCGTTTACGTTTTACCACAGCAATTCACTCTTAACTTCCGTTGATTGCTACACCCTACTCAAATCTAAATTTTTTGCAACAGTGCC	NA	NA	NA	NA
WP_155047065.1|552705_553383_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.1	7.0e-40
WP_155047066.1|553876_554605_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.5e-43
WP_016212269.1|554773_555457_+	Fic family protein	NA	NA	NA	NA	NA
WP_016212268.1|555460_556045_+	recombinase family protein	NA	W6CWV1	Ralstonia_phage	38.0	5.9e-27
WP_017375910.1|556201_556930_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_162034407.1|557398_557638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556455.1|557957_558560_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_054300203.1|558564_559023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036781052.1|560399_561002_-	LexA family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211639.1|561381_561684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211644.1|561798_562065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052104773.1|562172_562616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|562677_563563_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047067.1|563663_564557_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047259.1|564701_564917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104771.1|565366_565705_+	hypothetical protein	NA	R9TNL4	Vibrio_phage	54.9	5.4e-25
WP_075274739.1|565697_566045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274717.1|566041_566272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274718.1|566275_566746_+	single-stranded DNA-binding protein	NA	A0A220NRQ8	Escherichia_phage	64.3	1.3e-32
WP_075274740.1|566890_567256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036780395.1|567400_567655_+	addiction module toxin, HicA family	NA	NA	NA	NA	NA
WP_036780392.1|567647_567995_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_075274719.1|568300_569167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047068.1|569652_569853_+	HNH endonuclease	NA	A0A2H4PHY5	Pseudomonas_phage	64.3	3.5e-16
WP_155047069.1|569940_570294_+	hypothetical protein	NA	Q6DMU4	Streptococcus_phage	34.8	8.2e-08
WP_054300202.1|570406_571135_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_155047097.1|571653_572337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047098.1|572412_573705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|573720_574803_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_036780787.1|575171_576131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|576329_576695_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|576640_577216_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_036780594.1|577219_577702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300439.1|577973_579956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210316.1|579962_582116_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.1	1.1e-12
WP_016210310.1|582137_582344_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_032126592.1|582404_583025_-	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	36.3	2.5e-20
WP_016210307.1|583065_583956_-	YicC family protein	NA	NA	NA	NA	NA
WP_016210308.1|584041_584767_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_016210305.1|584827_585232_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_036778435.1|585396_587511_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_016210314.1|587634_588684_+	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_016210313.1|588680_590147_+	succinylglutamate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_032126591.1|590289_591627_+	N-succinylarginine dihydrolase	NA	NA	NA	NA	NA
WP_032126590.1|591689_593222_-	nuclease	NA	NA	NA	NA	NA
WP_155047099.1|593414_593570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047100.1|593714_594074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211719.1|594514_595342_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_036778439.1|595644_596301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211716.1|596248_597172_-	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211720.1|597185_598109_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_155047101.1|598356_599475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052104763.1|599700_600198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036780722.1|600362_601337_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_155049817.1|601398_602284_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047103.1|603078_604200_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_032126362.1|604315_604681_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047104.1|604737_605019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307322.1|605022_605202_+	DDE endonuclease	NA	NA	NA	NA	NA
WP_016210458.1|605475_606024_-	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_016210461.1|606104_606380_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_032126596.1|606379_607432_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_036777098.1|607540_609478_-	AsmA family protein	NA	NA	NA	NA	NA
WP_052104601.1|609625_611338_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_016210468.1|611406_612126_+	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_016210467.1|612122_612725_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_016210471.1|612839_613727_-	ROK family protein	NA	NA	NA	NA	NA
WP_016210463.1|613917_614265_+	cupin domain-containing protein	NA	A0A1V0SH58	Hokovirus	42.1	9.2e-20
WP_016210465.1|614315_615158_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	I6XGV6	Vibriophage	35.3	5.2e-32
WP_026063519.1|615444_615861_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274681.1|615909_616785_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_162034408.1|617335_617752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212445.1|617977_618244_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155047105.1|618486_619368_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.1	3.4e-50
WP_016212526.1|619538_620072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273603.1|620195_620372_-	phosphatase	NA	NA	NA	NA	NA
WP_105962625.1|620451_621337_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_105962625.1|621560_622447_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126745.1|622518_623121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122940402.1|623329_623953_+	porin family protein	NA	NA	NA	NA	NA
WP_016209896.1|624267_624837_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_016209891.1|624983_625682_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_036777115.1|625823_626024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209884.1|626100_626724_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
>prophage 6
NZ_CP048066	Piscirickettsia salmonis strain Ps-8079A chromosome, complete genome	3175218	648429	691063	3175218	transposase	Streptomyces_phage(25.0%)	45	NA	NA
WP_081007045.1|648429_649059_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_162034409.1|649401_649908_+	formylglycine-generating enzyme family protein	NA	NA	NA	NA	NA
WP_054300573.1|650171_651305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211961.1|651332_651914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046743.1|652483_652669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300431.1|652813_653116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059372279.1|653075_653411_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211968.1|653539_653944_+	SufE family protein	NA	NA	NA	NA	NA
WP_017377024.1|653956_654097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126649.1|654193_655390_+	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	33.5	1.2e-42
WP_016211971.1|655410_656022_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_129556499.1|656227_657381_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_155047106.1|657577_658463_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_080728345.1|658504_659113_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_032126790.1|659309_660215_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155047107.1|660240_660693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556559.1|660773_661202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212093.1|661358_662288_+	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	30.1	3.7e-31
WP_059372279.1|662503_662839_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|662798_663254_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016212654.1|663245_663530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212100.1|663940_664861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212098.1|664861_665713_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	2.7e-12
WP_155047108.1|666279_666474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211518.1|666433_667480_+	glutathione synthase	NA	NA	NA	NA	NA
WP_032126840.1|667463_669461_+	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_122941967.1|669639_669945_+	DUF4325 domain-containing protein	NA	NA	NA	NA	NA
WP_032126841.1|670174_670381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211521.1|670641_671343_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046955.1|671584_671764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104686.1|672919_675676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778728.1|675911_677204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075285943.1|677257_678094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212218.1|678238_678589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274679.1|680039_681101_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126801.1|681769_682279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275079.1|682326_683388_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556488.1|683536_684386_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047109.1|685567_685981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|686042_686408_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|686353_686929_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126869.1|687449_687689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047110.1|687666_688728_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047111.1|688844_690173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556490.1|690176_691063_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP048066	Piscirickettsia salmonis strain Ps-8079A chromosome, complete genome	3175218	708814	822533	3175218	tRNA,transposase	Staphylococcus_phage(17.65%)	106	NA	NA
WP_054300173.1|708814_709876_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212519.1|709950_710331_+	taurine catabolism dioxygenase TauD, TfdA family protein	NA	NA	NA	NA	NA
WP_052047081.1|710601_711039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036780900.1|711089_711743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274673.1|711913_712912_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126362.1|712872_713238_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|713183_713759_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|714128_715103_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212585.1|715214_715535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047115.1|715829_716234_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_129556449.1|716230_716737_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300249.1|716751_717117_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211123.1|717178_717670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211126.1|717871_718261_-	lipoprotein	NA	NA	NA	NA	NA
WP_016211125.1|718430_719261_-	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_036779309.1|719483_720389_-	polyprenyl synthetase	NA	NA	NA	NA	NA
WP_016211119.1|720552_721314_+	flagellar motor protein PomA	NA	NA	NA	NA	NA
WP_016211122.1|721317_722184_+	OmpA family protein	NA	NA	NA	NA	NA
WP_032126499.1|722280_722892_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_016211118.1|723270_724518_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	72.2	1.1e-14
WP_032126500.1|724654_725371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300415.1|725504_726206_-	dual specificity protein phosphatase family protein	NA	A0A068QKX9	Armadillidium_vulgare_iridescent_virus	33.0	1.6e-07
WP_155047116.1|726795_727047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|727007_727373_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|727318_727894_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210280.1|728305_729400_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_016210284.1|729481_730003_+	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	53.4	1.7e-25
WP_016210276.1|730057_730534_-	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_016210275.1|730589_730892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210273.1|730956_731664_-	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_036778186.1|732036_732435_+	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_032126334.1|732474_732906_+	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_016210271.1|732916_733600_+	flagellar hook assembly protein FlgD	NA	NA	NA	NA	NA
WP_016210285.1|733676_735872_+	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_016210282.1|735975_736713_+	flagellar basal body rod protein FlgF	NA	NA	NA	NA	NA
WP_016210283.1|736740_737526_+	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_032126333.1|737571_738276_+	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_016210279.1|738263_739430_+	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_016210277.1|739483_740317_+	mannosyl-glycoendo-beta-N-acetylglucosaminidase	NA	NA	NA	NA	NA
WP_016210270.1|740386_743374_+	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_016210281.1|743415_744807_+	flagellar hook-associated protein 3	NA	NA	NA	NA	NA
WP_162034413.1|744820_745396_-	murein L,D-transpeptidase catalytic domain family protein	NA	NA	NA	NA	NA
WP_016211367.1|745691_746474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126330.1|746621_747581_+	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_036779263.1|747923_749933_+	TRAP transporter permease	NA	NA	NA	NA	NA
WP_016211366.1|749988_750276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126332.1|750528_751728_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_155046995.1|752374_753261_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126540.1|753394_754258_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_032126637.1|754488_754782_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_129556495.1|755762_756020_-	VOC family protein	NA	NA	NA	NA	NA
WP_016211589.1|756142_757375_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.8	7.4e-96
WP_036778365.1|757364_758027_-	HAD-IB family phosphatase	NA	NA	NA	NA	NA
WP_129556496.1|758301_759540_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_032126329.1|759725_760355_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016211588.1|760430_761132_+	cyclase family protein	NA	NA	NA	NA	NA
WP_129556499.1|761299_762452_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_016212343.1|762691_763498_-	SDR family NAD(P)-dependent oxidoreductase	NA	W8CYX9	Bacillus_phage	42.9	7.7e-09
WP_016209806.1|764310_764460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209808.1|764802_765171_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_036778458.1|765167_765986_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_016209813.1|766086_766902_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_016209801.1|767186_769241_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_032126324.1|769240_769663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209805.1|769841_771335_-	neurotransmitter symporter family protein	NA	NA	NA	NA	NA
WP_016209818.1|771467_772283_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_016209799.1|772378_772795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209815.1|773181_773721_-	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_036777937.1|774038_775751_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.2	4.3e-25
WP_016209812.1|776197_778021_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	40.5	9.7e-44
WP_016209821.1|778110_778443_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_016209800.1|778473_779070_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_036777933.1|779066_780191_+	2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_016209822.1|780326_780974_+	methyltransferase domain protein	NA	W8CYT3	Bacillus_phage	30.8	1.4e-08
WP_016209810.1|781030_782944_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.3	6.9e-117
WP_155047117.1|784533_787833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209817.1|788534_789503_-	plasmid replication region DNA-binding domain protein	NA	NA	NA	NA	NA
WP_016209809.1|789609_790098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209823.1|790522_790966_+	response regulator	NA	NA	NA	NA	NA
WP_075273327.1|792187_792763_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|792708_793074_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300408.1|793124_793781_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	9.6e-10
WP_080664854.1|794117_794699_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_032126179.1|794656_794908_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_016211113.1|794937_796263_-	ribonuclease HI	NA	G3MB70	Bacillus_virus	36.3	1.7e-37
WP_016211112.1|796318_796966_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211115.1|797158_799111_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.0	2.7e-44
WP_016211114.1|799243_802174_+	peptidase M16 inactive domain protein	NA	NA	NA	NA	NA
WP_075274672.1|802539_803133_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|803170_803536_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|803481_804057_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047118.1|804046_805489_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_016212252.1|805526_805685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212466.1|805999_806725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059372269.1|806929_807301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075285937.1|807657_808338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779996.1|808357_809914_+	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_016211391.1|809925_810501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080728317.1|810567_813933_-	MFS transporter	NA	NA	NA	NA	NA
WP_054300271.1|814123_815098_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556498.1|815277_815886_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036778626.1|815882_817823_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	1.8e-72
WP_016210594.1|817958_818612_+	glutaredoxin 2	NA	NA	NA	NA	NA
WP_016210595.1|818788_819967_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_016210588.1|820334_821660_+	fimV domain protein	NA	NA	NA	NA	NA
WP_032126176.1|821750_822533_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
>prophage 8
NZ_CP048066	Piscirickettsia salmonis strain Ps-8079A chromosome, complete genome	3175218	827081	894188	3175218	tRNA,transposase	uncultured_Mediterranean_phage(30.77%)	57	NA	NA
WP_016210592.1|827081_827738_+|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_016212005.1|828127_829888_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_075273327.1|830226_830802_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|830747_831113_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556499.1|831747_832900_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_032126856.1|833205_833547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|833607_834669_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300406.1|834969_837705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007042.1|840258_841074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047119.1|841482_842805_+	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.3	9.3e-12
WP_155047120.1|843089_843434_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_105962623.1|843442_844596_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_075274669.1|845608_845911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047121.1|846115_847219_+	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.8	9.5e-10
WP_054300405.1|847320_847821_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016209947.1|848342_849005_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_036777555.1|849031_850261_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016209940.1|850417_853189_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.3	1.8e-150
WP_052104625.1|853264_853708_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_016209931.1|853860_855333_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	30.4	7.9e-44
WP_016209926.1|855444_856506_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_016209945.1|856502_857537_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_016209932.1|857539_858580_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_036777579.1|858762_859878_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	48.9	4.8e-94
WP_016209930.1|859916_860270_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	45.7	3.1e-07
WP_036777561.1|860290_862159_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_016209935.1|862180_863125_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.2	3.2e-38
WP_016209925.1|863357_863636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209938.1|863845_864484_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_016209944.1|864458_865886_-	aminodeoxychorismate synthase component I	NA	S4VNU7	Pandoravirus	29.8	4.2e-42
WP_036777566.1|866086_866764_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_016209939.1|866898_868173_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.2	1.7e-90
WP_036777569.1|868240_868996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209948.1|869047_869965_+	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_054300404.1|870073_870967_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_075273594.1|871039_872410_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	27.4	4.2e-39
WP_054300276.1|872449_873424_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	4.0e-28
WP_016211771.1|873716_873905_+	Trm112 family protein	NA	NA	NA	NA	NA
WP_016211770.1|873918_875052_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_075285934.1|875251_875560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162034414.1|875547_879342_+	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_016211827.1|879604_880225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376688.1|880556_880910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107517381.1|881123_881318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300400.1|882567_882810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300399.1|882954_883221_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300398.1|883562_884444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210892.1|884501_885098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210891.1|885130_885904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126206.1|886437_886734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210888.1|886756_887008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047123.1|886953_887676_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210886.1|887744_888524_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_016210887.1|888606_889557_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_016210889.1|890066_892913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047008.1|892930_893245_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_129556478.1|893302_894188_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP048066	Piscirickettsia salmonis strain Ps-8079A chromosome, complete genome	3175218	934582	1014509	3175218	tRNA,transposase	Bacillus_phage(18.75%)	76	NA	NA
WP_032126790.1|934582_935488_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016211224.1|935716_936988_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_016211218.1|937012_937750_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_016211221.1|938002_939145_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211223.1|939161_940763_-	cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_080664858.1|941274_941412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211219.1|941408_942686_+	FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	NA	NA	NA	NA	NA
WP_032126789.1|943035_943218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155065716.1|943510_943981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046960.1|944100_944754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212251.1|944915_945452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047127.1|945613_946429_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047128.1|946837_948205_+	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.3	9.6e-12
WP_052133287.1|948260_948659_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016212039.1|948847_949405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212040.1|949581_950931_+	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_054300162.1|951136_952219_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016210803.1|952293_953592_-	PAS domain S-box protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	52.3	7.5e-14
WP_036776426.1|953769_954621_+	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_016210805.1|954629_955301_+	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_032126141.1|955719_956994_+	sphingomyelin phosphodiesterase	NA	NA	NA	NA	NA
WP_016210804.1|957058_958978_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	34.0	4.5e-84
WP_032126139.1|958984_959914_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_054300383.1|960009_962490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300382.1|962760_963183_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047129.1|963453_964110_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300209.1|964313_964679_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556449.1|964693_965200_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211414.1|965415_966234_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_016211418.1|966341_966803_-	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_016211415.1|966819_967743_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_016211417.1|967766_968816_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_051307357.1|968952_969546_+	oligoribonuclease	NA	M4M9I5	Vibrio_phage	34.1	7.1e-20
WP_016211422.1|969568_970039_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_032126143.1|970127_971399_+	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	25.5	9.6e-14
WP_054300250.1|971498_972158_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	1.3e-09
WP_075273327.1|972147_972723_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|972668_973034_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211838.1|973743_973917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211840.1|974387_974852_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_032126147.1|975004_976483_+	catalase	NA	A0A2K9L572	Tupanvirus	46.5	5.0e-99
WP_016211841.1|976600_977053_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_054300173.1|977912_978974_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047130.1|979036_979795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047131.1|979982_980639_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556508.1|980909_981353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126637.1|981414_981708_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_081377879.1|982631_982856_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	46.2	1.2e-07
WP_016212421.1|983207_983390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047133.1|984140_985115_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	2.6e-27
WP_155047134.1|985386_986409_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211470.1|987175_987829_+	tyrosine phosphatase	NA	NA	NA	NA	NA
WP_054300379.1|987888_989874_-	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_032126343.1|990004_990817_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_032126344.1|990937_992026_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_016211467.1|992028_992595_+	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	77.8	1.6e-74
WP_155047135.1|992669_993245_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300249.1|993190_993556_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047136.1|993723_994155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036781272.1|994247_994466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|995061_996214_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_016210508.1|996223_997921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036778516.1|998241_998790_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_075273576.1|998917_999646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210509.1|999705_1003203_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_016210514.1|1003260_1004514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210515.1|1004622_1005525_-	carbon-nitrogen hydrolase	NA	M1HCD5	Acanthocystis_turfacea_Chlorella_virus	40.7	2.7e-55
WP_016210512.1|1005578_1006616_-	agmatine deiminase family protein	NA	NA	NA	NA	NA
WP_016210506.1|1006751_1007990_+	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_016210510.1|1007982_1008711_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	38.7	7.6e-32
WP_081007040.1|1008741_1009398_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_016211831.1|1009535_1011263_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_016211829.1|1011563_1011917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211833.1|1012331_1012832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046962.1|1013483_1013930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273298.1|1013933_1014509_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP048066	Piscirickettsia salmonis strain Ps-8079A chromosome, complete genome	3175218	1035929	1080272	3175218	transposase,protease	Staphylococcus_phage(25.0%)	38	NA	NA
WP_075273327.1|1035929_1036505_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210928.1|1036555_1036861_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_155046723.1|1037019_1037175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080728346.1|1038081_1038414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047138.1|1038431_1038914_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_162034416.1|1038889_1039231_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047140.1|1039317_1039902_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1039847_1040213_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211651.1|1040446_1041982_-	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_016211650.1|1042106_1043591_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_016211648.1|1044538_1045078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047141.1|1046281_1046488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075278621.1|1046676_1047018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126641.1|1047053_1049624_-	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	22.9	3.9e-30
WP_016209840.1|1049731_1050217_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	56.2	1.2e-36
WP_016209844.1|1050389_1051430_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	66.3	1.3e-117
WP_016209835.1|1051407_1051890_+	regulatory protein RecX	NA	NA	NA	NA	NA
WP_016209832.1|1054786_1055050_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	68.6	4.1e-12
WP_016209831.1|1055328_1056027_-	DUF3865 domain-containing protein	NA	NA	NA	NA	NA
WP_016209841.1|1056246_1056441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209827.1|1056516_1058076_-	SH3 domain of the SH3b1 type family protein	NA	NA	NA	NA	NA
WP_161625459.1|1058394_1059267_-	sphingomyelin phosphodiesterase	NA	NA	NA	NA	NA
WP_054300271.1|1059399_1060374_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155064795.1|1060613_1062071_-	amino acid permease	NA	NA	NA	NA	NA
WP_016209826.1|1062899_1063922_-	glycerophosphoryl diester phosphodiesterase	NA	NA	NA	NA	NA
WP_036777393.1|1064252_1065620_+	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_016209846.1|1065855_1066110_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_032126639.1|1066125_1067412_+	GTPase HflX	NA	NA	NA	NA	NA
WP_016209836.1|1067431_1068646_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_016209838.1|1068645_1069539_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_016209839.1|1069736_1071035_+	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	33.5	1.2e-64
WP_016209829.1|1072414_1074814_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.5	2.7e-70
WP_016209834.1|1074810_1075569_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_016209842.1|1075745_1076135_+	flagellar basal body-associated FliL family protein	NA	NA	NA	NA	NA
WP_054300373.1|1076862_1077720_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_054300271.1|1077716_1078691_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155046721.1|1078862_1079030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|1079210_1080272_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP048066	Piscirickettsia salmonis strain Ps-8079A chromosome, complete genome	3175218	1106333	1165963	3175218	tRNA,integrase,transposase,protease	Staphylococcus_phage(30.0%)	51	1119764:1119823	1162587:1163688
WP_036777656.1|1106333_1107113_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_016211286.1|1107130_1107478_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_016211289.1|1107589_1107862_+	hypothetical protein	NA	A0A1B0Z0G5	Vibrio_phage	53.4	3.2e-12
WP_016211767.1|1109478_1110288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211764.1|1111126_1111948_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_032126803.1|1112148_1113381_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	26.6	7.5e-32
WP_032126790.1|1113614_1114520_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_032126804.1|1114679_1115555_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_081007037.1|1116486_1118025_+|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L594	Tupanvirus	36.9	7.5e-05
WP_016211804.1|1118031_1119417_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	32.1	2.5e-47
1119764:1119823	attL	CGCCCTCCGTCATCTGAAGTGCAACACTACTCTATACTAAGCCGCCATCAAATACTCTAA	NA	NA	NA	NA
WP_054300271.1|1119799_1120774_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047144.1|1121218_1122544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300276.1|1122579_1123554_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	4.0e-28
WP_016212498.1|1124307_1124991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273555.1|1125268_1125802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210332.1|1125932_1126676_-	ribonuclease T2 family protein	NA	NA	NA	NA	NA
WP_016210330.1|1126773_1127157_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_036778577.1|1128062_1129346_-	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_016210326.1|1129685_1130984_+	ankyrin repeats family protein	NA	NA	NA	NA	NA
WP_016210325.1|1131137_1132514_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_016210321.1|1135184_1136153_-	threonine/serine dehydratase	NA	NA	NA	NA	NA
WP_016210319.1|1136349_1137762_-	MFS transporter	NA	NA	NA	NA	NA
WP_054300568.1|1137968_1138679_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.3	4.1e-38
WP_054300366.1|1138699_1139113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210320.1|1139262_1140336_-	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_016210322.1|1140472_1141369_-	rasGEF domain protein	NA	NA	NA	NA	NA
WP_016211334.1|1141986_1142175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211336.1|1142223_1142838_+	chorismate mutase	NA	NA	NA	NA	NA
WP_032126265.1|1142903_1143821_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_052104656.1|1144144_1144648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211330.1|1146199_1147300_+	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_032126267.1|1147647_1147890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155064793.1|1147883_1148054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162034417.1|1148309_1149152_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_075273553.1|1149361_1150288_+	MFS transporter	NA	NA	NA	NA	NA
WP_155047145.1|1150277_1150853_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300363.1|1150798_1151146_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047146.1|1151385_1151595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047262.1|1151537_1151654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212589.1|1152042_1152480_+	MFS transporter	NA	NA	NA	NA	NA
WP_129556637.1|1152954_1153734_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_016210843.1|1154348_1154579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210844.1|1154665_1155793_+	Fic family protein	NA	D7RWK9	Brochothrix_phage	23.2	5.7e-10
WP_155047263.1|1156007_1157714_+	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_032126340.1|1157794_1158556_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_155046965.1|1158835_1161292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210839.1|1161443_1162217_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_148037535.1|1162275_1162482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1162622_1163597_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211148.1|1163801_1165130_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
1162587:1163688	attR	CGCCCTCCGTCATCTGAAGTGCAACACTACTCTATACTAAGCCGCCATCAAATACTCTAAAAAAACATGATTAGGTGAGCAATAATTCAAACTCGCTCTTCTTCTGGTGTTCAATGTATGCTCTATTTTTGCTATTTCTTTGTCACTAATTTCATTAAAATCTGTCCCTTTAGGTAGAAAACGCCTTATCAAACCATTTGTGTGCTCATTTAGACCTCTATCACAAGAACGATAAGGTCTAGCAAAGTAAAAGTCTGCTTCAGTGATCTTTGAAATGGCCTCATGACCCGCAAACTCTGTTCCATTGTCAGAGGTGATGGTTTTAAAATCAAAGAAAGTTGAGCCAACCACATTCATGAATGTATTGATAACAGTCTTGGCTTGTTTGTTAGGCATTTTCCTTATACAACACATTTTATTCGCCTTATCGACCAGTGTTAATAAATAAGATTGGTGATCGCGACCCACAACCGTATCAATTTCAAAATGACCAAACTCTGTCTTTTCATCAGCAATAGCAGGCCGGTGTTCAATACCAACGCGATTAGGTATTTTTATTTGATCACCACGATTCACCTTTTTCTTATAAGGTTTTCCCGAATGAGGCAGGTTTTTGTAAAGCTCTCCGCCCTGCTCTCTATCATCATAAATATAACGGTAAATCGTGCTTTCACTCACCTGGATATCATGCTCTCGTATAAGTTCCTGACTGATAACATCGGGGGATGTATGGGTGCTTAACCGTTGATGGATCAACATTTTTGCCTCCTCTGAAATTTGTCGAAAAGCTTGACCTTGCTTAGCGTTAGCTCGTTTTTCTTGTGCACAGCGAGAAGTAAGCCGGTGACAATAAAGACCTTTAAAATCGATTGGGGTGTGCCGTTTAATCTCACGGCTAATCGTGCTAGGAGAAAAGCCAAGTGCTCTAGCAATTGATCTGAGCGAGTCTCCCTCTGATAACCGTTGTTCGATATAAAAACGATCTTTTTCATTTAAGTGCCGATAAACCATCTCTACCCTCTAAGTCAAAAGGCGAACTAGAGAGTTTATCTGTATGAATATGAACTCTCTACTGAGTGTTGCACTTCAGATGACGGAGGGC	NA	NA	NA	NA
WP_016211143.1|1165393_1165963_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	39.5	7.3e-30
>prophage 12
NZ_CP048066	Piscirickettsia salmonis strain Ps-8079A chromosome, complete genome	3175218	1173141	1226063	3175218	integrase,tRNA,transposase	Staphylococcus_phage(20.0%)	49	1176740:1176799	1232724:1233012
WP_081377353.1|1173141_1173807_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300361.1|1173784_1174081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047147.1|1174234_1175209_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.2e-29
WP_155047148.1|1175738_1176776_-|transposase	transposase	transposase	NA	NA	NA	NA
1176740:1176799	attL	ACGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGC	NA	NA	NA	NA
WP_054300359.1|1177134_1177707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212062.1|1177985_1179794_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_081377865.1|1180152_1180437_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556638.1|1181781_1182462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273551.1|1182461_1182764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211974.1|1182863_1183985_-	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_054300357.1|1184267_1185143_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016212011.1|1185376_1186498_+	calcium:proton antiporter	NA	NA	NA	NA	NA
WP_016212013.1|1186719_1187103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212012.1|1187118_1187796_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_075273474.1|1187839_1188814_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	4.0e-28
WP_155047149.1|1188837_1189053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047150.1|1189047_1190274_-	DUF4131 domain-containing protein	NA	NA	NA	NA	NA
WP_155047151.1|1190323_1190863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047152.1|1191872_1192595_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211994.1|1192797_1193334_+	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_032126537.1|1193370_1193556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211991.1|1193796_1194702_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_162034418.1|1195609_1196920_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_016212220.1|1196928_1197084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007034.1|1197292_1197577_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_080728343.1|1197558_1197699_+	hypothetical protein	NA	A0A0U2RK18	Escherichia_phage	69.0	1.6e-07
WP_052104693.1|1197780_1201647_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.2	1.9e-49
WP_016211564.1|1201812_1202688_+	ParA family protein	NA	NA	NA	NA	NA
WP_016211563.1|1202720_1202882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300355.1|1203092_1203278_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273327.1|1203267_1203843_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1203788_1204154_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_162034389.1|1204234_1204495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1204567_1205542_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047155.1|1205585_1205735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300354.1|1205680_1206199_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	42.9	1.3e-30
WP_054300353.1|1206345_1206573_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_162034387.1|1207723_1207882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126690.1|1212615_1213098_+	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_016210112.1|1213791_1215219_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	35.0	2.5e-55
WP_122943012.1|1215335_1215791_-	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_016210108.1|1215976_1217242_+	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	42.8	9.1e-49
WP_016210114.1|1217334_1218594_+	calcineurin-like phosphoesterase	NA	NA	NA	NA	NA
WP_016210107.1|1218665_1218938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036793752.1|1219227_1220700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210113.1|1221146_1222196_-	RNA polymerase sigma factor RpoS	NA	M4SMP8	Cyanophage	31.5	7.9e-30
WP_016210110.1|1222383_1223139_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.0	5.4e-65
WP_036777611.1|1223199_1224789_-	APC family permease	NA	NA	NA	NA	NA
WP_016210106.1|1224971_1226063_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
1232724:1233012	attR	ACGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCAAAACGCGACGACTATAAACCCTCGGCTGTCCGCGTCACACAGCGTTGCGTGCCTTGAATCGGCACACTCCACCACTGTGCTCTCACATGACTCTACGGTTCGTATAGATTTTTAGACACTCGTTACGCTTGCTACAGACCTAACGGTCTTTCGCAACTCCGCTCTGCTAAAAACCCGAACCTACCTCGGCCTACTCACCCCGTGCTTAGCACTCCATGGCTCGCAGCG	NA	NA	NA	NA
>prophage 13
NZ_CP048066	Piscirickettsia salmonis strain Ps-8079A chromosome, complete genome	3175218	1234004	1287941	3175218	tRNA,transposase	Staphylococcus_phage(20.0%)	49	NA	NA
WP_081007023.1|1234004_1234661_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_016211627.1|1234966_1235131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211632.1|1235356_1236211_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_054300351.1|1236246_1237068_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016211631.1|1237323_1238130_+	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_155047156.1|1238388_1239012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047157.1|1239183_1239588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|1239652_1240805_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_129556521.1|1240756_1240945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046942.1|1241478_1242365_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046942.1|1242528_1243415_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300349.1|1244475_1246200_-	protein kinase	NA	M1I1A9	Paramecium_bursaria_Chlorella_virus	25.6	1.7e-05
WP_032126825.1|1246751_1248065_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	3.5e-51
WP_016211481.1|1248297_1249440_+	carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_098082850.1|1249514_1249691_+	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
WP_052104609.1|1249726_1250359_-	MarC family protein	NA	NA	NA	NA	NA
WP_032126823.1|1250469_1251192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047158.1|1251180_1253454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059372279.1|1253592_1253928_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1253887_1254343_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016212267.1|1254509_1254869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212266.1|1255149_1255797_+	LysE family translocator	NA	NA	NA	NA	NA
WP_155046730.1|1256064_1256205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|1256423_1257485_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211733.1|1258099_1258924_+	DNA/RNA non-specific endonuclease	NA	X2KR27	Campylobacter_phage	28.3	2.4e-05
WP_155047159.1|1258979_1260371_-	protein kinase	NA	NA	NA	NA	NA
WP_016211732.1|1260792_1261491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144019306.1|1261854_1262034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126682.1|1262095_1262422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777261.1|1262529_1263273_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_016211403.1|1263286_1264330_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_016211405.1|1264465_1266238_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	41.9	4.9e-08
WP_129556522.1|1266444_1267677_-	MFS transporter	NA	S4TR35	Salmonella_phage	23.2	9.0e-17
WP_054300271.1|1268987_1269962_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_162034419.1|1270278_1270425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211669.1|1270786_1271137_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211666.1|1271291_1274111_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.2	1.0e-311
WP_016211664.1|1274483_1275212_+	single-stranded DNA-binding protein	NA	A0A2I7QWB5	Vibrio_phage	65.6	6.2e-42
WP_032126677.1|1277180_1277744_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211557.1|1277938_1279168_-	na+ dependent nucleoside transporter family protein	NA	B2YG43	Musca_hytrovirus	22.0	2.0e-08
WP_016211554.1|1279213_1279840_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.3	1.6e-33
WP_032126678.1|1280166_1281177_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.6	1.2e-22
WP_162034420.1|1281187_1282045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|1282191_1283274_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_036781387.1|1283391_1283664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212424.1|1283656_1283935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1284278_1285253_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300148.1|1285807_1286869_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1286966_1287941_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
>prophage 14
NZ_CP048066	Piscirickettsia salmonis strain Ps-8079A chromosome, complete genome	3175218	1316587	1352136	3175218	transposase	Staphylococcus_phage(50.0%)	34	NA	NA
WP_105962625.1|1316587_1317473_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300343.1|1317477_1317705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162034423.1|1317740_1318574_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_051307341.1|1319405_1321004_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.9	1.5e-56
WP_016210848.1|1321170_1322355_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126446.1|1322938_1323493_-	hypoxanthine-guanine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	25.7	3.2e-06
WP_016210850.1|1323741_1324995_+	MFS transporter	NA	NA	NA	NA	NA
WP_016210851.1|1324979_1325651_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_016210847.1|1325673_1326678_+	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_016210849.1|1326706_1328155_-	dihydrolipoyl dehydrogenase	NA	NA	NA	NA	NA
WP_016210855.1|1328272_1329250_+	DMT family transporter	NA	NA	NA	NA	NA
WP_054300249.1|1329403_1329769_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047162.1|1329783_1330221_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1330240_1331215_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273543.1|1331254_1331497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036776661.1|1332481_1332811_-	DUF4404 family protein	NA	NA	NA	NA	NA
WP_032126448.1|1332842_1333223_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_016211178.1|1333313_1334342_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_016211180.1|1334404_1334869_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_032126449.1|1334889_1335813_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_052104569.1|1335957_1336488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036776658.1|1336600_1338595_+	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_016211177.1|1338980_1340201_+	amino acid permease	NA	NA	NA	NA	NA
WP_155046970.1|1341625_1341874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155049812.1|1341951_1342497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126783.1|1342607_1343849_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016211741.1|1343994_1344771_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_059372279.1|1346833_1347169_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007028.1|1347128_1347584_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_032126602.1|1347736_1349044_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211857.1|1349294_1350173_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_016211855.1|1350169_1350637_-	bacterioferritin	NA	NA	NA	NA	NA
WP_016211856.1|1350763_1350949_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_054300339.1|1351164_1352136_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.8	9.2e-25
>prophage 16
NZ_CP048066	Piscirickettsia salmonis strain Ps-8079A chromosome, complete genome	3175218	1510557	1569023	3175218	transposase	Escherichia_phage(33.33%)	59	NA	NA
WP_155047178.1|1510557_1511286_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	2.5e-43
WP_155047179.1|1511354_1511699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211983.1|1511946_1512606_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_016212551.1|1514522_1515017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211946.1|1516372_1517128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211943.1|1517388_1517742_+	ArsC family reductase	NA	NA	NA	NA	NA
WP_033923708.1|1518993_1519869_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_036776195.1|1520280_1521528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047180.1|1522170_1522374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300304.1|1522426_1522705_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016209473.1|1522777_1523161_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_016209489.1|1523157_1523889_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_016209497.1|1523891_1524635_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_016209492.1|1524648_1525548_-	GTPase Era	NA	NA	NA	NA	NA
WP_016209466.1|1525553_1526228_-	ribonuclease III	NA	E5EQH1	Micromonas_sp._RCC1109_virus	34.5	8.9e-27
WP_129556644.1|1526633_1527521_-	signal peptidase I	NA	NA	NA	NA	NA
WP_016209482.1|1527571_1529374_-	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	39.2	5.1e-21
WP_016209457.1|1529673_1530255_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_036776203.1|1530398_1531973_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_155047181.1|1531980_1532322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209486.1|1532419_1532671_-	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_016209469.1|1532751_1533750_+	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_016209471.1|1533896_1534223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209462.1|1534232_1534376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209474.1|1534385_1534796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162034426.1|1534937_1535162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162034427.1|1535053_1535239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047182.1|1535952_1537983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209467.1|1538052_1539078_-	FUSC family protein	NA	NA	NA	NA	NA
WP_162034462.1|1539070_1539352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036776209.1|1540555_1541551_+	glycosyl hydrolase family 17	NA	NA	NA	NA	NA
WP_016209459.1|1541810_1542977_+	rasGEF domain protein	NA	NA	NA	NA	NA
WP_016209478.1|1543140_1544094_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036776213.1|1544116_1546135_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_016209490.1|1546225_1546549_-	YqcC family protein	NA	NA	NA	NA	NA
WP_016209463.1|1546975_1547359_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_032126730.1|1547713_1548202_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_016209472.1|1548304_1549675_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_016209456.1|1549788_1550520_+	mannosyl-glycoendo-beta-N-acetylglucosaminidase family protein	NA	M1IDP9	Pelagibacter_phage	35.8	5.3e-09
WP_016209491.1|1550544_1551642_-	alanine racemase	NA	NA	NA	NA	NA
WP_016209475.1|1551674_1553096_-	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	62.1	1.7e-152
WP_016209484.1|1553305_1553758_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_016209480.1|1553769_1553997_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_016209481.1|1554046_1554373_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_052104552.1|1554575_1555265_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016209488.1|1555414_1555903_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_016209465.1|1555943_1557044_-	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_016209460.1|1557090_1558173_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	42.1	1.0e-72
WP_075274651.1|1558162_1558729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007071.1|1558719_1560075_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_016209485.1|1560076_1561099_-	chorismate mutase	NA	NA	NA	NA	NA
WP_155047183.1|1561123_1561897_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_016209496.1|1561926_1562139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047184.1|1562544_1563564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047185.1|1563663_1564549_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047186.1|1564553_1565783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126540.1|1565812_1566676_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_155046981.1|1567674_1567851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300299.1|1567940_1569023_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP048066	Piscirickettsia salmonis strain Ps-8079A chromosome, complete genome	3175218	1572928	1642079	3175218	transposase	Bacillus_phage(33.33%)	59	NA	NA
WP_075273524.1|1572928_1573894_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047187.1|1573934_1574909_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	8.9e-28
WP_098082828.1|1575272_1575530_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036779544.1|1575529_1576537_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_016212247.1|1576903_1577659_+	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_054300271.1|1578286_1579261_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300162.1|1579600_1580683_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016212246.1|1580786_1581443_-	AT hook motif family protein	NA	NA	NA	NA	NA
WP_054300297.1|1582378_1583446_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300162.1|1583508_1584591_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016210771.1|1584682_1588084_-	UvrD-helicase domain-containing protein	NA	S5M596	Bacillus_phage	23.1	2.2e-09
WP_016210773.1|1588080_1590774_-	DNA repair family protein	NA	NA	NA	NA	NA
WP_016210769.1|1591077_1592580_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	28.1	2.2e-33
WP_033923762.1|1592880_1593114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126667.1|1593241_1594051_-	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
WP_016210772.1|1594134_1595688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210397.1|1596896_1599071_+	glycosyl transferase 41 family protein	NA	NA	NA	NA	NA
WP_016210388.1|1599067_1599742_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_162034428.1|1599767_1600271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162034429.1|1600225_1601758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162034430.1|1601772_1602075_-	flagellar protein FliT	NA	NA	NA	NA	NA
WP_032126670.1|1602118_1602556_-	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_016210394.1|1602581_1603967_-	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_122940572.1|1604077_1604503_-	flaG family protein	NA	NA	NA	NA	NA
WP_032126669.1|1604614_1606192_-	B-type flagellin	NA	NA	NA	NA	NA
WP_016210398.1|1606416_1608009_-	B-type flagellin	NA	NA	NA	NA	NA
WP_016210393.1|1608497_1610699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778065.1|1610792_1612226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307351.1|1612268_1612784_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_155046736.1|1612783_1613737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211168.1|1613714_1614374_-	wbqC-like family protein	NA	NA	NA	NA	NA
WP_036778066.1|1614370_1615099_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_051307350.1|1615088_1615835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211166.1|1615818_1616871_-	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	NA	NA	NA	NA
WP_016211172.1|1617071_1618268_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_036781047.1|1620050_1620908_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_129556646.1|1622225_1623611_+	PLD-like domain protein	NA	NA	NA	NA	NA
WP_016211278.1|1623662_1624922_-	threonine synthase	NA	NA	NA	NA	NA
WP_016211277.1|1624908_1625877_-	homoserine kinase	NA	NA	NA	NA	NA
WP_016211279.1|1625890_1628359_-	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_054300294.1|1629102_1630164_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300293.1|1630435_1630801_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047188.1|1630857_1631022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007016.1|1631011_1631185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007069.1|1631157_1631310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300292.1|1631765_1632767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036779544.1|1633021_1634029_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_098082828.1|1634028_1634286_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300291.1|1634548_1634923_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_054300290.1|1635024_1635282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|1635415_1636568_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_155047265.1|1636577_1637171_-	reverse transcriptase	NA	A0A0N7AE80	Bacillus_phage	28.9	4.0e-07
WP_155047189.1|1637460_1637634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|1637693_1638269_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1638214_1638580_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047175.1|1639110_1640433_-	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.3	9.3e-12
WP_054300287.1|1640841_1641171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1641192_1641558_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556556.1|1641503_1642079_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP048066	Piscirickettsia salmonis strain Ps-8079A chromosome, complete genome	3175218	1707912	1762798	3175218	tRNA,transposase,protease	Orpheovirus(16.67%)	54	NA	NA
WP_016209434.1|1707912_1709334_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_129556553.1|1709423_1711016_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_016209439.1|1711179_1711806_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_054300277.1|1711886_1714568_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_016209445.1|1715050_1716007_+	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_016209435.1|1716107_1716479_+	response regulator	NA	W8CYM9	Bacillus_phage	29.4	1.1e-05
WP_016209404.1|1716505_1717369_+	chemotaxis phosphatase CheX family protein	NA	NA	NA	NA	NA
WP_155047194.1|1717358_1718117_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_036776598.1|1718405_1718891_-	DUF2802 domain-containing protein	NA	NA	NA	NA	NA
WP_016209443.1|1718965_1719487_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_016209406.1|1720421_1721243_-	ParA family protein	NA	Q8JL10	Natrialba_phage	32.2	5.0e-16
WP_016209408.1|1721557_1721728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209427.1|1721881_1723285_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_016209446.1|1723378_1724602_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_016209402.1|1724615_1725344_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_016209424.1|1725358_1726636_-|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	25.1	6.6e-23
WP_016209433.1|1726735_1727110_-	rhodanese-like domain protein	NA	NA	NA	NA	NA
WP_016209412.1|1727194_1728082_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016209436.1|1728139_1728868_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_129556555.1|1728864_1729995_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_016209444.1|1730125_1730554_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	39.4	1.1e-17
WP_032126508.1|1730648_1731008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036776605.1|1730997_1732209_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_016209421.1|1732205_1732994_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_016209411.1|1733156_1733951_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_054300271.1|1734156_1735131_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155049809.1|1735305_1736601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|1736604_1736904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|1736893_1737058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300209.1|1737114_1737480_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211553.1|1737819_1738560_-	outer membrane lipocarrier LolA family protein	NA	NA	NA	NA	NA
WP_016211549.1|1738563_1741068_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	43.1	4.9e-86
WP_016211548.1|1741330_1742287_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.7	1.6e-61
WP_016211550.1|1742270_1743032_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_054300275.1|1743109_1743985_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211259.1|1744109_1744355_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_016211262.1|1744414_1746688_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.8	1.0e-167
WP_075273504.1|1746742_1747096_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	40.0	6.7e-10
WP_016211261.1|1747285_1747579_+	cold shock domain-containing protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.5	5.8e-15
WP_032126515.1|1747751_1747931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307354.1|1748006_1748582_-	DedA family protein	NA	NA	NA	NA	NA
WP_032126514.1|1748864_1750181_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211263.1|1750191_1750560_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_016211265.1|1750590_1751253_-	adenylate kinase	NA	NA	NA	NA	NA
WP_155046731.1|1751427_1752312_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126519.1|1752480_1753200_+	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	34.8	1.9e-19
WP_016211478.1|1753179_1753995_-	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_032126518.1|1754011_1756213_-	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_016211474.1|1756295_1757645_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	27.6	5.7e-33
WP_016211473.1|1757719_1758319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211476.1|1758302_1758512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036777061.1|1758829_1760017_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211932.1|1760212_1761502_+	GDA1/CD39 family protein	NA	NA	NA	NA	NA
WP_129556478.1|1761912_1762798_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP048066	Piscirickettsia salmonis strain Ps-8079A chromosome, complete genome	3175218	1775307	1820428	3175218	tRNA,transposase	Moraxella_phage(16.67%)	43	NA	NA
WP_054300268.1|1775307_1776369_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036776407.1|1776617_1777754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211446.1|1777937_1779665_+	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_016211448.1|1779654_1780863_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211450.1|1780961_1781984_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_155047009.1|1782759_1782933_+	phosphatase	NA	NA	NA	NA	NA
WP_052104774.1|1783077_1783710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556557.1|1783757_1784069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047067.1|1784213_1785107_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126170.1|1785270_1785543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211040.1|1785769_1786981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211037.1|1787331_1787961_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_016211042.1|1788009_1789026_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.2	5.3e-100
WP_016211035.1|1789272_1789488_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_016211043.1|1789540_1789990_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.2	4.1e-20
WP_036779409.1|1790069_1791815_+	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	37.1	2.6e-46
WP_016211036.1|1791906_1793778_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	30.7	2.7e-33
WP_054300173.1|1794621_1795683_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273494.1|1796273_1796834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211091.1|1797898_1800379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047195.1|1800453_1801356_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_033923708.1|1801368_1802244_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016210899.1|1802853_1804737_-	APC family permease	NA	NA	NA	NA	NA
WP_016210896.1|1804790_1805873_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_016210904.1|1805915_1806566_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210903.1|1806787_1807159_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_129556487.1|1807277_1808615_+	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	34.8	9.4e-12
WP_054300270.1|1808693_1809671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210894.1|1810011_1810314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923728.1|1810788_1811079_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016210898.1|1811167_1811518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|1811774_1812503_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_155047196.1|1812573_1813155_+	queuosine precursor transporter	NA	NA	NA	NA	NA
WP_054300269.1|1813299_1813668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|1813689_1814055_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|1814111_1814276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007012.1|1814265_1814436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300268.1|1814430_1815492_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273492.1|1815600_1815720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556486.1|1815810_1816158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779112.1|1816243_1817680_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016211781.1|1817902_1819150_-	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_054300173.1|1819366_1820428_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP048066	Piscirickettsia salmonis strain Ps-8079A chromosome, complete genome	3175218	1840969	1949553	3175218	integrase,transposase,protease	Staphylococcus_phage(26.67%)	105	1864994:1865053	1886188:1887290
WP_105962625.1|1840969_1841856_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_059372279.1|1842242_1842578_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300265.1|1842537_1842798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047198.1|1842942_1843110_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300263.1|1843097_1843538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273474.1|1843609_1844584_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	4.0e-28
WP_016212461.1|1844959_1845334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|1845337_1845913_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1845858_1846224_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300262.1|1846686_1846977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052104721.1|1846968_1848675_-	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	26.7	7.3e-25
WP_051307331.1|1848746_1850525_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	30.6	1.5e-33
WP_036779374.1|1850879_1851446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210553.1|1851570_1852224_+	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_155047199.1|1852250_1853693_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_016210545.1|1853789_1854767_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_129556482.1|1854915_1855521_+	NUDIX domain-containing protein	NA	A0A1S6L1P8	Vibrio_phage	30.9	1.2e-17
WP_026063577.1|1855592_1855886_-	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	52.8	4.7e-17
WP_129556629.1|1856112_1856859_-	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	33.0	3.6e-29
WP_017376905.1|1857089_1857317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210551.1|1857381_1857564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210555.1|1858000_1858555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162034432.1|1858808_1858982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046716.1|1859252_1859399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046984.1|1859820_1860939_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_052047108.1|1861750_1862149_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155049808.1|1862233_1862842_-	DNA polymerase	NA	NA	NA	NA	NA
WP_032126362.1|1862926_1863292_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1863237_1863813_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211578.1|1863882_1864227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211586.1|1864242_1864437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211584.1|1864503_1864857_-	hypothetical protein	NA	NA	NA	NA	NA
1864994:1865053	attL	CGCCCTCCGTCATCTGAAGTGCAACACTACTCTATACTAAGCCGCCATCAAATACTCTAA	NA	NA	NA	NA
WP_054300271.1|1865029_1866004_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211583.1|1866208_1867117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211579.1|1867184_1867670_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_155047202.1|1868174_1869239_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.2	4.7e-139
WP_036781361.1|1869521_1869911_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_155047203.1|1869930_1870992_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212302.1|1871292_1871592_+	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	44.4	3.9e-11
WP_081007067.1|1871812_1877287_+	DUF4011 domain-containing protein	NA	NA	NA	NA	NA
WP_036780532.1|1877798_1878839_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_054300162.1|1878916_1879999_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_036781387.1|1880116_1880389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212424.1|1880381_1880660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1881003_1881978_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047204.1|1882001_1882559_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0V4T7	Roseobacter_phage	33.3	8.4e-15
WP_016211531.1|1882622_1883303_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_016211530.1|1883656_1884553_+	Abi family protein	NA	A3QSC6	Clostridium_virus	32.0	5.3e-35
WP_016211534.1|1884558_1885068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300253.1|1885054_1886005_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	34.7	6.9e-09
WP_054300271.1|1886223_1887198_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211528.1|1887757_1888063_-	hypothetical protein	NA	NA	NA	NA	NA
1886188:1887290	attR	CGCCCTCCGTCATCTGAAGTGCAACACTACTCTATACTAAGCCGCCATCAAATACTCTAAAAAAACATGATTAGGTGAGCAATAATTCAAACTCGCTCTTCTTCTGGTGTTCAATGTATGCTCTATTTTTGCTATTTCTTTGTCACTAATTTCATTAAAATCTGTCCCTTTAGGTAGAAAACGCCTTATCAAACCATTTGTGTGCTCATTTAGACCTCTATCACAAGAACGATAAGGTCTAGCAAAGTAAAAGTCTGCTTCAGTGATCTTTGAAATGGCCTCATGACCCGCAAACTCTGTTCCATTGTCAGAGGTGATGGTTTTAAAATCAAAGAAAGTTGAGCCAACCACATTCATGAATGTATTGATAACAGTCTTGGCTTGTTTGTTAGGCATTTTCCTTATACAACACATTTTATTCGCCTTATCGACCAGTGTTAATAAATAAGATTGGTGATCGCGACCCACAACCGTATCAATTTCAAAATGACCAAACTCTGTCTTTTCATCAGCAATAGCAGGCCGGTGTTCAATACCAACGCGATTAGGTATTTTTATTTGATCACCACGATTCACCTTTTTCTTATAAGGTTTTCCCGAATGAGGCAGGTTTTTGTAAAGCTCTCCGCCCTGCTCTCTATCATCATAAATATAACGGTAAATCGTGCTTTCACTCACCTGGATATCATGCTCTCGTATAAGTTCCTGACTGATAACATCGGGGGATGTATGGGTGCTTAACCGTTGATGGATCAACATTTTTGCCTCCTCTGAAATTTGTCGAAAAGCTTGACCTTGCTTAGCGTTAGCTCGTTTTTCTTGTGCACAGCGAGAAGTAAGCCGGTGACAATAAAGACCTTTAAAATCGATTGGGGTGTGCCGTTTAATCTCACGGCTAATCGTGCTAGGAGAAAAGCCAAGTGCTCTAGCAATTGATCTGAGCGAGTCTCCCTCTGATAACCGTTGTTCGATATAAAAACGATCTTTTTCATTTAAGTGCCGATAAACCATCTCTACCCTCTAAGTCAAAAGGCGAACTAGAGAGTTTATCTGTATGAATATGAACTCTCTACTGAGTGTTGCACTTCAGATGACGGAGGGCG	NA	NA	NA	NA
WP_080664862.1|1888043_1888742_-	P-loop NTPase	NA	NA	NA	NA	NA
WP_016211529.1|1889304_1889457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|1889915_1890491_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1890436_1890802_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047205.1|1891289_1891511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212436.1|1891685_1892096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556478.1|1892434_1893320_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_033923634.1|1893310_1893859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126157.1|1894063_1894468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211514.1|1894754_1896647_-	DNA topoisomerase IV subunit B	NA	A0A172JHT4	Bacillus_phage	32.9	1.4e-80
WP_036780074.1|1896989_1897796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307360.1|1898887_1899817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|1899933_1900839_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_075275067.1|1901901_1902969_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_059372266.1|1903301_1903787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036776625.1|1903876_1905391_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_016209659.1|1905517_1906546_+	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_016209654.1|1906610_1907753_+	galactokinase	NA	NA	NA	NA	NA
WP_016209656.1|1907871_1909575_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	24.8	2.8e-21
WP_016209642.1|1909571_1911692_+	ATP-binding cassette domain-containing protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	28.1	2.0e-16
WP_016209652.1|1911688_1913038_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209662.1|1913009_1915157_-	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	36.7	1.8e-25
WP_016209657.1|1915584_1915980_+	CrcB family protein	NA	NA	NA	NA	NA
WP_016209643.1|1915988_1916873_-	lipid A biosynthesis acyltransferase	NA	A0A1W6JP29	Morganella_phage	35.3	2.4e-40
WP_075273480.1|1916904_1918803_-	surA N-terminal domain protein	NA	NA	NA	NA	NA
WP_016209655.1|1918885_1919158_-	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	62.9	2.0e-22
WP_032126161.1|1919261_1921694_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.7	9.5e-220
WP_016209663.1|1921761_1923063_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	1.5e-134
WP_016209647.1|1923144_1923750_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.8	8.4e-61
WP_016209645.1|1923862_1925167_-	trigger factor	NA	NA	NA	NA	NA
WP_016209661.1|1925770_1926646_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.7	1.5e-34
WP_075273478.1|1926761_1927433_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_016209658.1|1927609_1928965_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_016209641.1|1929085_1929823_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_032126159.1|1929902_1930616_-	aldolase	NA	NA	NA	NA	NA
WP_016209651.1|1931260_1932535_+	MFS transporter	NA	NA	NA	NA	NA
WP_016209646.1|1932565_1933141_+	VOC family protein	NA	NA	NA	NA	NA
WP_016209649.1|1933185_1934151_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.8	7.9e-45
WP_016209640.1|1934609_1935629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300250.1|1936046_1936706_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	1.3e-09
WP_054300271.1|1936788_1937763_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047206.1|1937798_1938308_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300249.1|1938322_1938688_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046989.1|1939178_1940243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1940475_1941450_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155083645.1|1941542_1941830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162034433.1|1942177_1942606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1942838_1943813_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047207.1|1943922_1944996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211684.1|1945342_1945918_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_016211685.1|1945941_1947747_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_016211687.1|1947777_1948422_-	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_033923708.1|1948677_1949553_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 21
NZ_CP048066	Piscirickettsia salmonis strain Ps-8079A chromosome, complete genome	3175218	1966234	2014157	3175218	tRNA,transposase	Staphylococcus_phage(42.86%)	38	NA	NA
WP_054300237.1|1966234_1967296_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210741.1|1967981_1968305_+	late competence development ComFB family protein	NA	NA	NA	NA	NA
WP_016210746.1|1968311_1972208_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	54.4	4.4e-118
WP_054300242.1|1972253_1972790_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_016210743.1|1972830_1974411_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	27.3	8.8e-17
WP_016210739.1|1974479_1975937_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	42.6	7.2e-98
WP_054300241.1|1976091_1978068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210745.1|1978386_1979007_-	DUF2272 domain-containing protein	NA	NA	NA	NA	NA
WP_016210742.1|1979172_1979448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1979598_1980573_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_162034434.1|1980592_1981075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162034435.1|1981110_1982064_-	kinase	NA	NA	NA	NA	NA
WP_054300271.1|1982366_1983341_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300240.1|1983640_1983844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273460.1|1984100_1984985_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036777316.1|1985294_1985708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211818.1|1986064_1987321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126399.1|1987523_1988024_+	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_016211819.1|1988320_1988551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162034436.1|1989159_1989324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556478.1|1989673_1990559_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300237.1|1990674_1991736_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273327.1|1991762_1992338_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1992283_1992649_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047266.1|1993364_1993796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|1994903_1995790_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047210.1|1995851_1996214_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273456.1|1996173_1996473_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1996595_1997570_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016209398.1|1998122_1999349_-	MFS transporter	NA	NA	NA	NA	NA
WP_016209362.1|1999947_2001654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007011.1|2001821_2003042_-	MFS transporter	NA	NA	NA	NA	NA
WP_016209395.1|2003290_2005981_-	DUF4135 domain-containing protein	NA	NA	NA	NA	NA
WP_016209384.1|2006272_2007088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047211.1|2007438_2008380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047212.1|2008921_2010565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209368.1|2011140_2012670_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.2	1.6e-84
WP_016209374.1|2012705_2014157_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
>prophage 22
NZ_CP048066	Piscirickettsia salmonis strain Ps-8079A chromosome, complete genome	3175218	2049574	2091755	3175218	tRNA,transposase,protease	Prochlorococcus_phage(50.0%)	42	NA	NA
WP_075273327.1|2049574_2050150_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2050095_2050461_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047215.1|2051366_2052620_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_054300237.1|2052597_2053659_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210612.1|2054944_2056195_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016210605.1|2056183_2057065_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_016210611.1|2057057_2058143_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	4.3e-07
WP_016210607.1|2058139_2059399_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_036778813.1|2059567_2060227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210600.1|2060377_2061040_+	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_016210609.1|2061399_2062335_+	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.4	6.3e-39
WP_016210606.1|2062431_2063058_+	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_016210603.1|2063063_2063645_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_016210601.1|2063716_2064808_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_016210599.1|2064890_2065604_+	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_122940948.1|2065697_2066402_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_054300148.1|2066724_2067786_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126800.1|2067910_2068645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046954.1|2068871_2069045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162034437.1|2069217_2069571_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_155046715.1|2070533_2070779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556478.1|2071078_2071964_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300223.1|2072201_2073173_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.9	1.3e-34
WP_075273327.1|2073267_2073843_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2073788_2074154_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016209900.1|2074611_2076081_-	glycine dehydrogenase subunit 2	NA	M4QFZ1	Prochlorococcus_phage	41.9	2.7e-84
WP_016209924.1|2076074_2077451_-	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	34.6	4.2e-47
WP_016209906.1|2077462_2077855_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_016209919.1|2077851_2078955_-	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_032126654.1|2079132_2080434_-	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_016209907.1|2080441_2081389_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.9	1.6e-37
WP_016209913.1|2081400_2082219_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_032126655.1|2082221_2083022_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_016209910.1|2083015_2084074_-	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_016209903.1|2084070_2085081_-	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_016209904.1|2085087_2085285_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_155047216.1|2085345_2088252_-	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_016209918.1|2088293_2089148_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_032126652.1|2089180_2089747_-	chorismate lyase	NA	NA	NA	NA	NA
WP_016209915.1|2089829_2090690_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016209922.1|2090781_2091198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300221.1|2091257_2091755_+|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
>prophage 23
NZ_CP048066	Piscirickettsia salmonis strain Ps-8079A chromosome, complete genome	3175218	2098689	2142198	3175218	plate,transposase	Bacteriophage(14.29%)	50	NA	NA
WP_075273327.1|2098689_2099265_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212369.1|2099268_2099715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212599.1|2100949_2101159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047217.1|2101208_2102270_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126790.1|2102344_2103250_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_059372279.1|2104017_2104353_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|2104312_2104768_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_036780649.1|2104878_2105865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126181.1|2105880_2106501_-	dTMP kinase	NA	A0A1L2BX49	Bacteriophage	44.2	4.2e-39
WP_016210401.1|2106621_2107674_-	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_016210400.1|2107670_2108519_-	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_016210403.1|2108550_2109774_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_016210413.1|2109848_2110091_-	acyl carrier protein	NA	A0A1P8VVJ5	Erythrobacter_phage	39.7	2.0e-05
WP_016210415.1|2110179_2110917_-	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_016210406.1|2110944_2111889_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_016210405.1|2111942_2112893_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_016210402.1|2112899_2113949_-	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_016210404.1|2114007_2114181_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_075273448.1|2114198_2114729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210411.1|2114970_2115612_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_016210409.1|2115774_2117604_-	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_016210408.1|2117771_2118644_+	DNA replication terminus site-binding family protein	NA	NA	NA	NA	NA
WP_129556468.1|2118635_2118938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162034438.1|2119143_2120802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273445.1|2121074_2121332_+	DUF4286 family protein	NA	NA	NA	NA	NA
WP_016209511.1|2121417_2122101_-	uracil-DNA glycosylase	NA	A0A0R5YU95	Harp_seal_herpesvirus	49.5	2.3e-46
WP_016209508.1|2122151_2123042_-	OmpA family protein	NA	NA	NA	NA	NA
WP_016209527.1|2123103_2123862_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_016209518.1|2123864_2125133_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_016209505.1|2125208_2125460_-	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_016209517.1|2125493_2125841_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_016209507.1|2125844_2126498_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016209535.1|2126520_2126985_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_036780687.1|2126981_2127749_-	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_016209539.1|2127752_2128553_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	7.6e-25
WP_016209498.1|2128692_2129673_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	30.4	6.0e-32
WP_016209499.1|2129678_2130236_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_129556465.1|2130222_2130795_+	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_016209538.1|2130791_2131523_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	1.3e-20
WP_016209519.1|2131678_2133070_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_016209537.1|2133094_2133406_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_016209512.1|2133762_2134617_+	RNase adapter RapZ	NA	NA	NA	NA	NA
WP_016209502.1|2134617_2135220_-	signal peptidase I	NA	NA	NA	NA	NA
WP_016209530.1|2136314_2136959_+	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_016209534.1|2136975_2137362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209526.1|2137581_2138514_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	25.8	1.2e-21
WP_016209515.1|2138618_2139134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209506.1|2139176_2140133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209524.1|2140114_2141803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126187.1|2141799_2142198_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 24
NZ_CP048066	Piscirickettsia salmonis strain Ps-8079A chromosome, complete genome	3175218	2173634	2221585	3175218	tRNA,transposase	Synechococcus_phage(33.33%)	52	NA	NA
WP_081007066.1|2173634_2173973_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300215.1|2173967_2174462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556461.1|2175265_2175556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047073.1|2175605_2176163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047260.1|2176355_2176514_+	phosphatase	NA	NA	NA	NA	NA
WP_016210530.1|2177354_2178035_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_036776215.1|2178031_2178844_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_016210534.1|2178917_2182598_-	DUF3971 domain-containing protein	NA	NA	NA	NA	NA
WP_036776217.1|2182607_2184095_-	ribonuclease G	NA	NA	NA	NA	NA
WP_016210527.1|2184104_2184722_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_016210528.1|2184791_2185310_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_016210536.1|2185306_2186206_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_016210526.1|2186221_2187265_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_016210537.1|2187454_2187742_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_016210532.1|2187853_2189305_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_032126195.1|2189346_2190783_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_155046713.1|2191077_2191242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047072.1|2191379_2191694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|2191683_2191848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300209.1|2191904_2192270_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212074.1|2192296_2192518_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_142396463.1|2192604_2192721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126198.1|2192831_2193032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212075.1|2193277_2193475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779278.1|2193588_2194542_+	DMT family transporter	NA	NA	NA	NA	NA
WP_054300208.1|2195699_2196491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126199.1|2196620_2196932_+	DOPA 4,5-dioxygenase	NA	NA	NA	NA	NA
WP_155047071.1|2197279_2197603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779281.1|2197627_2198083_-	arginine repressor	NA	NA	NA	NA	NA
WP_016211489.1|2198072_2199125_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	M4QRZ2	Synechococcus_phage	41.1	5.3e-10
WP_016211493.1|2199127_2200591_-	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_016211491.1|2200873_2201170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2201430_2202492_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210915.1|2202621_2203086_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_032126715.1|2203283_2204099_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016210906.1|2204227_2206540_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_051307343.1|2206659_2207187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210909.1|2207879_2209157_+	na+ dependent nucleoside transporter family protein	NA	NA	NA	NA	NA
WP_036779246.1|2209159_2209414_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	58.8	1.4e-20
WP_016210913.1|2209447_2209969_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	1.8e-27
WP_032126716.1|2210139_2211123_-	transaldolase	NA	V5UTB0	Synechococcus_phage	32.9	2.2e-13
WP_016210908.1|2211213_2212029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2213240_2214302_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212580.1|2215037_2215388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2215475_2215841_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2215786_2216362_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_162034440.1|2216965_2217493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162034441.1|2217489_2218077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126810.1|2218119_2218818_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211661.1|2219076_2220033_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	31.9	1.4e-33
WP_016211663.1|2220097_2220763_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_054300202.1|2220856_2221585_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
>prophage 25
NZ_CP048066	Piscirickettsia salmonis strain Ps-8079A chromosome, complete genome	3175218	2229283	2276648	3175218	transposase	Staphylococcus_phage(41.67%)	53	NA	NA
WP_054300202.1|2229283_2230012_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211538.1|2230436_2231360_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	42.1	1.1e-24
WP_054300443.1|2231598_2231877_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007046.1|2231929_2232178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300444.1|2232135_2233197_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212179.1|2233617_2233770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212177.1|2234192_2234366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212174.1|2234442_2234700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036781320.1|2236917_2237145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212320.1|2237131_2237458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212318.1|2237459_2237891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|2238419_2239481_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300445.1|2239575_2240127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210829.1|2240396_2241416_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_016210832.1|2241402_2241825_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_016210828.1|2241826_2242300_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	42.8	6.9e-26
WP_052133275.1|2242415_2243039_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.7	1.1e-39
WP_016210836.1|2243068_2243743_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	3.0e-30
WP_016210835.1|2243748_2244897_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.4	1.0e-43
WP_032126465.1|2244893_2245355_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_016210830.1|2245430_2246681_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.7	6.3e-103
WP_016210824.1|2246807_2248487_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.7	4.3e-38
WP_016210826.1|2248596_2249463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2250365_2251340_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_036781250.1|2251435_2252221_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_051307345.1|2252364_2253051_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_016211002.1|2253084_2253483_-	VOC family protein	NA	NA	NA	NA	NA
WP_016211001.1|2253646_2253952_-	competence protein ComEA	NA	NA	NA	NA	NA
WP_016210998.1|2254029_2254284_-	LapA family protein	NA	NA	NA	NA	NA
WP_032126469.1|2254437_2256099_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_016210997.1|2256158_2256842_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_080664849.1|2256841_2257930_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	43.3	4.9e-75
WP_016211004.1|2257978_2260615_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.6	2.0e-98
WP_054300173.1|2261027_2262089_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300448.1|2262278_2264648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2264691_2265666_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300449.1|2265685_2266465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059372279.1|2266597_2266933_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|2266892_2267348_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016211507.1|2267673_2268993_+	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
WP_016211505.1|2268996_2269713_+	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_016211506.1|2269709_2270351_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_081007048.1|2270343_2270442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2270782_2271148_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2271093_2271669_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047096.1|2271700_2271973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047095.1|2272029_2272170_+	phosphatase	NA	NA	NA	NA	NA
WP_155047094.1|2272314_2272782_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211503.1|2272932_2273388_-	cadmium-induced protein CadI	NA	NA	NA	NA	NA
WP_016211508.1|2273442_2273787_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211502.1|2273816_2274860_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_129556569.1|2275562_2275772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|2275761_2276648_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 26
NZ_CP048066	Piscirickettsia salmonis strain Ps-8079A chromosome, complete genome	3175218	2346835	2409175	3175218	tRNA,transposase	Planktothrix_phage(18.18%)	56	NA	NA
WP_129556571.1|2346835_2347546_+|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_017376619.1|2347574_2347979_+	RidA family protein	NA	NA	NA	NA	NA
WP_036777168.1|2348003_2348963_-	response regulator	NA	NA	NA	NA	NA
WP_155049839.1|2349094_2349616_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126712.1|2350146_2350605_-	MFS transporter	NA	NA	NA	NA	NA
WP_016209553.1|2351349_2352360_+	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	42.2	2.9e-58
WP_016209566.1|2352844_2353756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209545.1|2354081_2357576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209551.1|2357613_2358453_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	45.0	1.8e-45
WP_036777155.1|2358639_2358855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209547.1|2358903_2359479_-	ribonuclease HI	NA	V9M0C8	Vibrio_phage	46.6	1.3e-29
WP_016209540.1|2359475_2359814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209568.1|2359982_2360972_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G9BWD6	Planktothrix_phage	32.7	1.7e-18
WP_016209572.1|2360972_2361935_-	oligopeptide ABC transporter ATP-binding protein OppD	NA	G9BWD6	Planktothrix_phage	32.1	7.7e-16
WP_054300271.1|2362890_2363865_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212612.1|2364002_2364236_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_054300455.1|2364329_2364695_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556449.1|2364709_2365216_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212572.1|2365273_2365666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300209.1|2365795_2366161_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300461.1|2366217_2366526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046731.1|2366617_2367503_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_080728364.1|2367655_2367928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126774.1|2368536_2368872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307356.1|2369031_2370564_-	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_016211407.1|2370596_2371436_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016211411.1|2371432_2371930_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_036779082.1|2371933_2372926_-	AAA family ATPase	NA	A0A0S0MVD6	Pseudomonas_phage	45.1	9.3e-49
WP_155047091.1|2373040_2374387_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_054300173.1|2374610_2375672_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212287.1|2375750_2376896_+|tRNA	multifunctional tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/2'phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	41.7	2.7e-60
WP_162034387.1|2378199_2378358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211372.1|2382703_2383561_-	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_016211371.1|2383547_2384471_-	badF/BadG/BcrA/BcrD ATPase	NA	NA	NA	NA	NA
WP_036778204.1|2384667_2386059_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_016211369.1|2386105_2387149_+	SIS domain-containing protein	NA	F2Y1G4	Organic_Lake_phycodnavirus	28.4	5.2e-18
WP_016211370.1|2387191_2387635_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211374.1|2387767_2388958_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_016211373.1|2389012_2389159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212140.1|2389709_2390627_-	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_036794860.1|2390894_2391188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664878.1|2391264_2391459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300462.1|2392477_2393395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210876.1|2393860_2394703_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_016210873.1|2394770_2395421_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.6	4.1e-21
WP_016210874.1|2395435_2396476_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.0	1.5e-68
WP_036794016.1|2396613_2397684_+	DUF2066 domain-containing protein	NA	NA	NA	NA	NA
WP_016210872.1|2397710_2398820_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_016210871.1|2398836_2399154_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_016210879.1|2399150_2399510_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_016210881.1|2402841_2403657_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_054300173.1|2403867_2404929_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212048.1|2405691_2406249_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_032126664.1|2406442_2407126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126663.1|2407844_2408087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300237.1|2408113_2409175_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 27
NZ_CP048066	Piscirickettsia salmonis strain Ps-8079A chromosome, complete genome	3175218	2499065	2581775	3175218	tRNA,transposase	Escherichia_phage(37.93%)	81	NA	NA
WP_054300202.1|2499065_2499794_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_144019244.1|2499883_2500495_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_036779399.1|2500851_2501106_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_016210954.1|2501204_2502989_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_036779389.1|2503077_2503797_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_016210951.1|2503979_2504186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036779393.1|2504185_2504422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126574.1|2504434_2504812_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_032126573.1|2505318_2506137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779396.1|2506230_2506428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210946.1|2506522_2507908_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_016210945.1|2508034_2508625_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_155047083.1|2510816_2511545_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	4.3e-43
WP_016211816.1|2512612_2512966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211812.1|2513007_2514621_+	DEAD/DEAH box helicase	NA	A0A2I7RG64	Vibrio_phage	32.6	9.2e-62
WP_075274932.1|2514842_2515064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|2515372_2516101_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211951.1|2516717_2517815_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	34.3	3.9e-48
WP_016211949.1|2517848_2519099_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.3	1.6e-93
WP_054300202.1|2519238_2519967_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016212193.1|2520089_2520428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212195.1|2520495_2520882_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_016212196.1|2520878_2521124_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_054300475.1|2521532_2522261_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	5.6e-43
WP_016211625.1|2522744_2523614_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.5	1.2e-68
WP_036779883.1|2523610_2524960_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.2	2.1e-75
WP_016211623.1|2525072_2526713_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_054300202.1|2527527_2528256_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_054300478.1|2528535_2530272_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	44.0	1.3e-24
WP_155047082.1|2530433_2530613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300477.1|2530775_2531504_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	5.6e-43
WP_016212214.1|2531662_2532163_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036780855.1|2532137_2532635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|2533400_2534129_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_054300479.1|2534279_2535320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211653.1|2535517_2536543_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	78.8	2.3e-18
WP_016211652.1|2536650_2537856_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	26.6	2.5e-35
WP_016211655.1|2538115_2538529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211654.1|2538657_2539227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211657.1|2539230_2539563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300480.1|2539555_2540395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047081.1|2540482_2542030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211051.1|2542479_2542983_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A167R6J9	Powai_lake_megavirus	43.5	1.1e-13
WP_016211050.1|2542945_2543653_-	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_016211044.1|2543721_2544582_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_036777969.1|2544562_2545336_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016211052.1|2545366_2546620_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_016211049.1|2546619_2547582_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_016211056.1|2547625_2548378_+	ComF family protein	NA	NA	NA	NA	NA
WP_036777977.1|2548431_2550312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210615.1|2550459_2550930_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	35.7	2.1e-19
WP_016210624.1|2550975_2551215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777984.1|2551233_2551683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210617.1|2551903_2553328_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	M4QSA2	Synechococcus_phage	42.3	1.4e-16
WP_032126482.1|2553392_2554430_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_051307334.1|2554708_2555488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556587.1|2555539_2556442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047080.1|2556500_2557247_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.8	4.4e-19
WP_016210616.1|2557495_2560306_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_036778141.1|2560576_2561401_+	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_155047079.1|2562243_2562486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|2562640_2563793_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_155047078.1|2563979_2564315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|2564407_2564707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|2564696_2564861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047077.1|2565092_2566245_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	4.4e-58
WP_155047076.1|2566254_2566530_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212641.1|2566725_2567172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273369.1|2567700_2568516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047075.1|2568589_2569510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300481.1|2569521_2570250_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_080664881.1|2570339_2570546_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_081007054.1|2570708_2571941_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.6	1.1e-27
WP_054300482.1|2572456_2573746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155049821.1|2574904_2575093_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047219.1|2575139_2575868_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_032127022.1|2576544_2578731_+	ATP-dependent RecD-like DNA helicase	NA	A0A1P8DII4	Virus_Rctr197k	29.9	6.6e-47
WP_087910645.1|2578792_2579946_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_075274943.1|2580231_2580756_+	helix-turn-helix domain-containing protein	NA	Q9MBM9	Staphylococcus_prophage	33.1	1.5e-05
WP_129556588.1|2580946_2581114_-	phosphatase	NA	NA	NA	NA	NA
WP_075274944.1|2581058_2581775_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.8	3.2e-43
>prophage 28
NZ_CP048066	Piscirickettsia salmonis strain Ps-8079A chromosome, complete genome	3175218	2597116	2625297	3175218	integrase,tRNA,transposase,protease	Acinetobacter_phage(12.5%)	29	2594505:2594564	2612339:2612627
2594505:2594564	attL	ACGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTT	NA	NA	NA	NA
WP_155047267.1|2597116_2597326_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212679.1|2598689_2599070_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_087910645.1|2599127_2600280_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_016212230.1|2600336_2601785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126389.1|2603318_2603507_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_162034463.1|2604908_2605175_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_054300489.1|2605185_2605788_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	46.2	6.5e-37
WP_155046749.1|2605851_2606139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162034444.1|2606681_2607005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075285958.1|2607031_2607760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162034445.1|2608077_2609331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162034446.1|2609345_2609795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|2609838_2610744_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155049822.1|2611214_2611370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047221.1|2611761_2612241_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	42.0	1.7e-11
WP_155047222.1|2612349_2613024_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.8	2.2e-09
2612339:2612627	attR	AAAACCCGAACCTACCTCGGCCTACTCACCCCGTGCTTAGCACTCCATGGCTCGCAGCGTTTGTTAGGCATTTTCCTTATACAACACATTTTATTCGCCTTATCGACCAGTGTTAATAAATAAGATTGGTGATCGCGACCCACAACCGTATCAATTTCAAAATGACCAAACTCTGTCTTTTCATCAGCAATAGCAGGCCGGTGTTCAATACCAACGCGATTAGGTATTTTTATTTGATCACCACGATTCACCTTTTTCTTATAAGGTTTTCCCGAATGAGGCAGGTTTT	NA	NA	NA	NA
WP_155047223.1|2613067_2613313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210068.1|2613943_2614519_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_036778086.1|2614594_2615470_-	6-pyruvoyltetrahydropterin synthase	NA	A0A140B3P3	Vibrio_phage	24.0	8.0e-12
WP_075275277.1|2615760_2616000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052104629.1|2615870_2616896_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047224.1|2617039_2617516_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036778088.1|2617500_2618583_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.5	2.0e-20
WP_036777829.1|2618823_2619228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210073.1|2619940_2620672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210076.1|2620928_2622230_+	inosine/guanosine kinase	NA	NA	NA	NA	NA
WP_016210066.1|2622371_2623040_+|protease	modulator of FtsH protease YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	44.1	3.6e-28
WP_032126425.1|2623483_2624080_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_016210052.1|2624100_2625297_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A2I2L594	Orpheovirus	24.4	8.2e-07
>prophage 29
NZ_CP048066	Piscirickettsia salmonis strain Ps-8079A chromosome, complete genome	3175218	2681394	2728474	3175218	tRNA,transposase	Staphylococcus_phage(28.57%)	45	NA	NA
WP_054300148.1|2681394_2682456_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126306.1|2682680_2682977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556591.1|2683081_2683738_-	porin family protein	NA	NA	NA	NA	NA
WP_017377817.1|2683961_2684459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047229.1|2685668_2686130_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_059372279.1|2686089_2686425_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036778253.1|2686485_2688024_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.5	3.5e-87
WP_098082804.1|2688135_2689234_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	43.1	1.1e-05
WP_016210987.1|2689471_2690671_+	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_016210981.1|2690700_2691339_+	ribonuclease T	NA	NA	NA	NA	NA
WP_162034447.1|2691354_2693115_-	protein kinase family protein	NA	A0A1S5XZ05	Kurlavirus	34.9	9.2e-07
WP_032126304.1|2693775_2694120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300193.1|2695165_2695372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104666.1|2695536_2695995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212032.1|2696582_2697710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212033.1|2697833_2698496_-	O-methyltransferase	NA	NA	NA	NA	NA
WP_016212030.1|2698587_2698833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211963.1|2699906_2700566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211965.1|2700667_2701318_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_054300271.1|2701809_2702784_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_032126299.1|2703034_2703256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047230.1|2703544_2703967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047231.1|2703967_2704501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300190.1|2704995_2705958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046995.1|2706084_2706970_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210162.1|2707655_2708693_-	fructose-bisphosphate aldolase class II	NA	NA	NA	NA	NA
WP_032126295.1|2708723_2710178_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_016210181.1|2710187_2711372_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_016210176.1|2711445_2712453_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_016210183.1|2712521_2714525_-	transketolase	NA	NA	NA	NA	NA
WP_016210174.1|2714975_2716136_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.5	8.2e-121
WP_036776947.1|2716372_2717488_+	DSD1 family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_016210172.1|2717650_2718175_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	59.6	6.9e-51
WP_016210163.1|2718174_2718705_+	ferric uptake regulator family protein	NA	NA	NA	NA	NA
WP_016210178.1|2718794_2719262_-	DoxX family protein	NA	NA	NA	NA	NA
WP_016210161.1|2719763_2720018_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_016210179.1|2720218_2720722_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_129556592.1|2721012_2721543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162034448.1|2721778_2722387_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210164.1|2722462_2723242_-	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_032126297.1|2723228_2724089_-	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_016210177.1|2724213_2724579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210175.1|2724964_2725294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300188.1|2725607_2727167_-	methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	50.4	9.9e-37
WP_155047232.1|2727412_2728474_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 30
NZ_CP048066	Piscirickettsia salmonis strain Ps-8079A chromosome, complete genome	3175218	2732819	2825880	3175218	tRNA,transposase,protease	Staphylococcus_phage(23.08%)	91	NA	NA
WP_075273327.1|2732819_2733395_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047233.1|2733391_2734033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210766.1|2734121_2734565_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_032126291.1|2734568_2735078_-	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_016210756.1|2735070_2737884_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A167RAL2	Powai_lake_megavirus	26.5	1.3e-76
WP_036778399.1|2739105_2740644_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_016210764.1|2740817_2741078_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_016210763.1|2741386_2742631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161625465.1|2742773_2743463_+	SIMPL domain-containing protein	NA	NA	NA	NA	NA
WP_016210761.1|2743566_2744304_+	tryptophan 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_054300187.1|2744658_2745441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307321.1|2745503_2746052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209980.1|2746138_2747305_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.7	1.7e-25
WP_032126286.1|2747610_2750409_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	45.1	4.9e-180
WP_016209981.1|2750467_2751688_+	ribonucleotide-diphosphate reductase subunit beta	NA	A0A1V0EEL7	Caulobacter_phage	28.7	8.5e-36
WP_016209998.1|2751717_2752119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209994.1|2752785_2753073_+	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_016209985.1|2753229_2753568_+	integration host factor subunit beta	NA	NA	NA	NA	NA
WP_016209995.1|2753602_2755240_-	response regulator	NA	NA	NA	NA	NA
WP_016209992.1|2755341_2756391_+	WD domain, G-beta repeat family protein	NA	NA	NA	NA	NA
WP_016209988.1|2756463_2757108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556662.1|2757104_2758352_-	UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase	NA	NA	NA	NA	NA
WP_016209986.1|2758357_2759647_-	ubiquinone biosynthesis hydroxylase UbiH/UbiF/VisC/COQ6 family protein	NA	NA	NA	NA	NA
WP_016209989.1|2759671_2760262_-	UPF0149 family protein	NA	NA	NA	NA	NA
WP_016209996.1|2760406_2760631_+	TIGR02449 family protein	NA	NA	NA	NA	NA
WP_016209991.1|2760611_2760941_+	cell division protein ZapA	NA	NA	NA	NA	NA
WP_033923658.1|2761166_2761730_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_016209997.1|2761764_2762226_+	EVE domain-containing protein	NA	NA	NA	NA	NA
WP_016209977.1|2762302_2763988_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.6	2.9e-26
WP_032126288.1|2764037_2764838_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_016210000.1|2764864_2765413_-	ADP compounds hydrolase NudE	NA	NA	NA	NA	NA
WP_016209993.1|2765542_2765935_+	ribosome-associated heat shock protein Hsp15	NA	NA	NA	NA	NA
WP_016209990.1|2765991_2766396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144019123.1|2766428_2767172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047234.1|2767661_2767805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2767848_2768823_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047235.1|2768842_2769829_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212415.1|2769919_2770666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275004.1|2770790_2771654_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_054300185.1|2771897_2772260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162034464.1|2772494_2772974_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556595.1|2773118_2773535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212038.1|2775631_2776543_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_016212036.1|2776594_2777443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126284.1|2777887_2778598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210379.1|2778689_2779649_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_032126283.1|2779645_2780293_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_036779767.1|2780321_2781173_-	D-amino acid aminotransferase	NA	NA	NA	NA	NA
WP_016210380.1|2781187_2782465_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	39.0	2.8e-66
WP_016210373.1|2782505_2783021_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_054300183.1|2783099_2784161_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_032126285.1|2784182_2785271_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_016210381.1|2787192_2787663_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_016210374.1|2787699_2788035_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_032126282.1|2788047_2788704_-	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_129556597.1|2788700_2789717_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_016210384.1|2789713_2790193_-	LPS-assembly family protein	NA	NA	NA	NA	NA
WP_016210376.1|2790276_2792757_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	44.3	4.1e-194
WP_129556663.1|2792819_2793185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059372279.1|2793526_2793862_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|2793821_2794277_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016210577.1|2794291_2794582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777784.1|2794647_2796246_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	64.3	1.5e-08
WP_016210576.1|2796376_2796712_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_036777781.1|2796739_2798404_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5ERK4	Ostreococcus_lucimarinus_virus	28.5	5.4e-33
WP_016210581.1|2798400_2799045_-	SCP-2 sterol transfer family protein	NA	NA	NA	NA	NA
WP_016210582.1|2799044_2799788_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_032126279.1|2799846_2800086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126276.1|2800236_2801604_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	30.1	9.5e-44
WP_032126275.1|2801614_2802166_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_032126278.1|2802246_2803230_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_016210572.1|2803351_2805109_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_032126277.1|2805331_2805922_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_155049840.1|2806010_2806430_-	DksA protein	NA	NA	NA	NA	NA
WP_075273416.1|2806570_2807185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212327.1|2807245_2808031_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_059372279.1|2808287_2808623_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007003.1|2808582_2809044_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|2809416_2810391_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212084.1|2810672_2811689_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_032126534.1|2811688_2812204_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_016212085.1|2812245_2812719_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_155047236.1|2812774_2813317_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016212310.1|2813340_2813796_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_155046996.1|2815569_2818083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046997.1|2819017_2821540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|2822114_2823176_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273327.1|2823202_2823778_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2823723_2824089_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046755.1|2824160_2824337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|2824727_2825880_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
>prophage 31
NZ_CP048066	Piscirickettsia salmonis strain Ps-8079A chromosome, complete genome	3175218	2950745	3014875	3175218	transposase	Staphylococcus_phage(16.67%)	53	NA	NA
WP_054300271.1|2950745_2951720_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211161.1|2952302_2953412_-	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	23.8	2.5e-18
WP_016211154.1|2953423_2954068_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_016211163.1|2954086_2955073_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_016211162.1|2955152_2956229_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_016211156.1|2956431_2957256_+	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_016211160.1|2957572_2958577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211155.1|2958785_2959751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047242.1|2959889_2960765_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211700.1|2961061_2962114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211698.1|2962381_2962810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211697.1|2963035_2963515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211702.1|2963570_2964821_-	malic enzyme, NAD-binding domain protein	NA	NA	NA	NA	NA
WP_032127042.1|2964923_2965142_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_036777591.1|2965599_2966454_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_016210728.1|2966508_2966979_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_016210732.1|2967366_2968746_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	31.6	5.1e-53
WP_016210726.1|2968773_2969232_-	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	69.6	4.2e-52
WP_032126740.1|2969209_2970427_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.2	3.7e-39
WP_017375944.1|2970618_2970855_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_016210730.1|2970868_2971024_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_016210731.1|2971104_2972067_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210735.1|2972226_2973543_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_016210727.1|2973552_2974221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210734.1|2974583_2976398_+	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	45.1	3.8e-24
WP_054300166.1|2976515_2977304_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_016211543.1|2977884_2979636_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_016211544.1|2979646_2980447_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.6	5.8e-33
WP_016211545.1|2980549_2981038_-	dihydrofolate reductase	NA	A0A1B2IDT7	Erwinia_phage	43.7	2.4e-29
WP_032126435.1|2981211_2981526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375799.1|2982546_2982891_+	DMT family protein	NA	NA	NA	NA	NA
WP_162034387.1|2983802_2983961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210038.1|2988584_2989547_-	D-2-hydroxyacid dehydrogenase	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	27.0	8.8e-20
WP_016210039.1|2989733_2990993_-	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_016210045.1|2991216_2991543_-	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	46.2	1.5e-16
WP_052104566.1|2991737_2992688_+	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
WP_032126434.1|2992745_2994812_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_016210042.1|2996397_2997978_+	APC family permease	NA	NA	NA	NA	NA
WP_016210041.1|2998134_2999544_-	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_016210047.1|2999603_3000737_-	cation transporter	NA	NA	NA	NA	NA
WP_016210033.1|3000876_3001701_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_016210034.1|3001928_3002558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210044.1|3002893_3003265_-	isochorismatase	NA	NA	NA	NA	NA
WP_016210046.1|3003568_3003856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126431.1|3004007_3004856_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_016210037.1|3004983_3006024_+	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_155047244.1|3006096_3008034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300165.1|3008317_3008977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|3009131_3010106_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300164.1|3010181_3011201_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556602.1|3011599_3011809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273820.1|3012683_3013766_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	71.8	1.2e-142
WP_054300161.1|3013813_3014875_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 32
NZ_CP048066	Piscirickettsia salmonis strain Ps-8079A chromosome, complete genome	3175218	3022760	3046380	3175218	tRNA,transposase	unidentified_phage(50.0%)	24	NA	NA
WP_155047053.1|3022760_3023646_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212222.1|3024122_3024596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556669.1|3024592_3024988_-	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|3025917_3026493_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|3026438_3026804_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036778680.1|3027068_3029399_+	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_129556603.1|3029519_3031535_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_162034450.1|3031718_3032837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162034451.1|3033768_3033918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162034452.1|3034089_3034293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162034453.1|3034250_3035102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212386.1|3035166_3035472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307322.1|3035662_3035842_-	DDE endonuclease	NA	NA	NA	NA	NA
WP_155047245.1|3035845_3036034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047246.1|3036057_3037032_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	1.8e-28
WP_032126362.1|3037289_3037655_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047247.1|3037718_3038087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556478.1|3038090_3038977_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047248.1|3039040_3039727_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047249.1|3039979_3041080_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556605.1|3041474_3042584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300209.1|3043626_3043992_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047002.1|3044006_3044612_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_036776867.1|3044982_3046380_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	34.4	1.8e-77
>prophage 33
NZ_CP048066	Piscirickettsia salmonis strain Ps-8079A chromosome, complete genome	3175218	3077193	3129642	3175218	tRNA,transposase	Acinetobacter_phage(28.57%)	52	NA	NA
WP_075273401.1|3077193_3077646_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047251.1|3077683_3077908_+	EamA family transporter	NA	NA	NA	NA	NA
WP_155047003.1|3079503_3080389_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212372.1|3080575_3080797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047252.1|3080912_3081491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047253.1|3081635_3081830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|3081888_3082863_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300148.1|3082916_3083978_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036776841.1|3084705_3085245_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_032126699.1|3085329_3085866_+	alkyl hydroperoxide reductase	NA	NA	NA	NA	NA
WP_016211866.1|3086517_3086820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126698.1|3087269_3087578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556607.1|3088186_3088636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556608.1|3088918_3089629_+	VUT family protein	NA	NA	NA	NA	NA
WP_016211232.1|3089855_3090254_-	DUF3135 domain-containing protein	NA	NA	NA	NA	NA
WP_036778156.1|3091121_3092072_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_016211227.1|3092071_3094150_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211228.1|3094297_3094813_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016211234.1|3094821_3095385_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_016211229.1|3095365_3096112_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_016211230.1|3096251_3096704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162034456.1|3097316_3097964_+	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_016210335.1|3097960_3098857_+	EamA family transporter	NA	NA	NA	NA	NA
WP_016210345.1|3098889_3099957_+	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_016210352.1|3099975_3100344_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_129556609.1|3100369_3101818_-	potassium transporter	NA	NA	NA	NA	NA
WP_016210336.1|3101827_3103207_-	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_051307328.1|3103247_3104579_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_032126694.1|3104550_3105510_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	2.2e-10
WP_016210340.1|3105602_3106106_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	1.4e-13
WP_016210346.1|3106240_3107392_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_016210342.1|3107388_3107868_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_032126693.1|3108014_3110336_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	35.7	2.3e-98
WP_016210343.1|3110337_3110907_+|tRNA	tRNA threonylcarbamoyladenosine biosynthesis protein RimN	tRNA	NA	NA	NA	NA
WP_129556610.1|3111882_3112461_+	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_016210347.1|3112761_3113019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556718.1|3113027_3114214_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.7e-58
WP_155046758.1|3115028_3115160_+	phosphatase	NA	NA	NA	NA	NA
WP_162034457.1|3115707_3116607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910645.1|3117501_3118654_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_155047031.1|3118889_3119486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046697.1|3119533_3119677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|3119724_3120630_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016211194.1|3120817_3121207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211196.1|3121485_3122211_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_016211199.1|3122265_3123435_-	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_016211200.1|3123409_3124717_-	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.6	2.1e-24
WP_129556617.1|3124756_3125596_-	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_036779326.1|3125967_3127494_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_036776493.1|3127795_3128557_+	DUF3750 domain-containing protein	NA	NA	NA	NA	NA
WP_032126362.1|3128755_3129121_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273371.1|3129066_3129642_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP048067	Piscirickettsia salmonis strain Ps-8079A plasmid Ps8079A-p1, complete sequence	200877	1333	45290	200877	protease,transposase,integrase	Indivirus(17.65%)	55	9609:9668	37706:38881
WP_162034468.1|1333_1918_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.6	3.3e-09
WP_162034465.1|1946_2132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273816.1|4504_5341_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	5.9e-20
WP_016212398.1|5603_6065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047268.1|6231_6612_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126362.1|7700_8066_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|8011_8587_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_105962623.1|9570_10724_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
9609:9668	attL	ATAAATAATCATTAGCTGAGTGAATGCGTTTTCTGTTATAAAAAACTTCGATATACTCAA	NA	NA	NA	NA
WP_075273810.1|10744_11452_-	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	34.2	1.4e-11
WP_081007042.1|13611_14427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080728342.1|14741_15245_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_105962174.1|15388_15553_+	phosphatase	NA	NA	NA	NA	NA
WP_155047269.1|15701_16097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273806.1|16358_16922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007004.1|17027_17483_-|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	36.7	6.2e-16
WP_081377347.1|17442_17778_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377694.1|17865_18594_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_016212413.1|18927_19356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923775.1|19403_20144_+	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	28.0	4.6e-08
WP_032126346.1|20210_20453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273798.1|20544_20769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307367.1|20877_21402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047270.1|21522_21669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047297.1|21813_21960_-	phosphatase	NA	NA	NA	NA	NA
WP_032126138.1|23168_23432_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_016211871.1|23997_24333_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_129556699.1|24326_24527_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_054300590.1|24834_25059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275277.1|25565_25805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300594.1|25675_26701_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075273790.1|27245_27548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059372613.1|27537_28164_-	hypothetical protein	NA	A0A222ZGQ4	Arthrobacter_phage	33.7	1.8e-21
WP_016212412.1|28464_28629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212408.1|28621_29071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212410.1|29318_29492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212499.1|29696_30071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556499.1|31069_32222_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_075273786.1|32231_32630_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211913.1|33062_34184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211910.1|34509_34782_-	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_032126795.1|34785_35046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211912.1|35318_35909_+|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	33.3	2.1e-19
WP_129556698.1|35998_36700_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.8e-38
WP_054300249.1|36813_37179_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556449.1|37193_37700_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	25.5	1.0e-06
WP_155047271.1|37703_38821_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	3.6e-57
WP_051307374.1|38935_39412_-|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	39.2	3.2e-15
37706:38881	attR	ATAAATAATCATTAGCTGAGTGAATGCGTTTTCTGTTATAAAAAACTTCGATATACTCAAAGATCGCTGATTTAGCCTCCTGTCGATTTTTAAAATTCATGTGATGAACTAACTCCGTTTTTAAGGTATGAAAGAAACTCTCTGAAACAGCGTTATCCCAGCAGTCTCCCTTACGACTCATACTTTGCTTAATTTGATGATCTTTAAGAATCTCACGATGACTTTCTGAAGCATATTGGCTTCCGCGATCTGAATGCCAAATTAACCCAGCTTTAGGCTTTCGTTTCCATAAGGCCATCAACAGAGCATCATTGACGAGTGATGCTTCCATATGATCCTCCATGGCCCAGCCAACAACTTTTCGTGAGAATAAGTCAATCACAACAGCCAAGTACAACCAGCCTTGTTGGGTCCGTATGTAGGTAATATCACCAACATATTTTTGGTTAGGGCCTGTTGCTGAAAAATTCCGGTCCAACACGTTTTTCGCAATTGGCAATCGATGTTTAGAATCCGTAGTTACTTTGAATTTACGCTTTATCTTGCAGCAAAGCTGGTTCTGCTTCATTAAACGGCCAACTCGCTTACGGCTTACAGAAATTTCCTGTGTTGCCAACTGTTTTCTAATTCTTCGAGTACCATAGGTTGCACGGCTTTCGATGAATATTTCCTTGATTCGCCTAGCTAATTTTTGGTTCTCTATCATTCGCTTGGAAGGCTGTACCTTTAACCAACTGTAATAACCTGATCGGCTAACACCTAAGATTGAGCACACCCTATCTACTGGAAAAACACATTTATTTTCTTTGATCCAGGCATACTTTACTGTGTTTCGCTTGCAAAGTACGCCGCCGCTTTTTTTAGTATTTCACGTTCCTGTGTCACTCTAGCCAACTCTTTTTTTAACTGTTTTATTTCAGCAGCCATATCACTAACTTCATCTTTAACAGTATTTGGACTGTTTGGATGATATTTATTGACCCAACCATGCAGTGTACTTGAGTGAATACCCAATTCCTGTGCTGTATGACTGATTGCTTGATTTGAATCGACTGCAAGCTTGGCAGATGATTTTTTAAATTCTTCGGTGTACTTGGTGACGTGACGCTTTCCCATTGTGATTCCTCCGGCTCGGATTATTGTAATTTATTTGTCCGGAATAGGGTAGCCTGATCA	NA	NA	NA	NA
WP_016212298.1|39652_39979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275277.1|40535_40775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052104629.1|40645_41671_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047272.1|41880_42609_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_075275277.1|42861_43101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300594.1|42971_43997_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047273.1|44127_44265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046942.1|44403_45290_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	22.8	2.6e-10
>prophage 2
NZ_CP048067	Piscirickettsia salmonis strain Ps-8079A plasmid Ps8079A-p1, complete sequence	200877	55200	161976	200877	integrase,capsid,head,transposase,tail	Streptococcus_phage(21.28%)	112	93570:93629	146110:147354
WP_032126790.1|55200_56106_-|transposase	IS481 family transposase	transposase	A8RHK4	Spiroplasma_virus	26.0	6.8e-14
WP_016210664.1|56403_56826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210651.1|56825_57176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210658.1|57172_57568_-	hypothetical protein	NA	Q7Y404	Yersinia_phage	40.0	1.6e-07
WP_016210667.1|57560_57884_-|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	39.0	1.0e-12
WP_016210663.1|57880_58192_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	30.8	4.3e-08
WP_016210655.1|58509_59106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556716.1|59119_59410_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	42.7	2.7e-12
WP_052047108.1|59543_59942_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047275.1|59997_60495_-	DNA polymerase	NA	NA	NA	NA	NA
WP_155047276.1|60491_61271_-	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	31.7	1.8e-18
WP_129556718.1|61299_62485_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.7e-58
WP_081377350.1|63018_63834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047277.1|63898_64507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211936.1|65241_66264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162034469.1|66753_67134_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_054300594.1|67272_68298_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075274768.1|68168_68468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046767.1|68872_69034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047048.1|69033_69534_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075273747.1|69795_70386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126637.1|70448_70742_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_052047135.1|70824_71637_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.0	4.9e-56
WP_052104629.1|71817_72843_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075274768.1|72713_73013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047281.1|73069_73399_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.8	5.5e-06
WP_155047018.1|73466_74270_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.9e-55
WP_075274752.1|74305_74605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|74601_75177_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_032126362.1|75122_75488_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212061.1|76392_78435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274748.1|79204_79405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047246.1|79545_80520_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.0	1.9e-25
WP_016212579.1|82016_82214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|82813_83788_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_016212456.1|83831_84119_+	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	39.2	2.9e-11
WP_036779532.1|84115_84517_+	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	47.0	3.9e-22
WP_075273881.1|84526_86713_-	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	30.2	9.2e-73
WP_016212404.1|86833_87067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273857.1|87843_88578_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.6	8.4e-39
WP_016212311.1|88731_89463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047129.1|89583_91167_-	protein kinase	NA	NA	NA	NA	NA
WP_075274745.1|91449_92178_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	1.2e-37
WP_016212365.1|92890_93133_+	antidote-toxin recognition MazE family protein	NA	NA	NA	NA	NA
WP_036781349.1|93134_93461_+	potassium ABC transporter ATPase	NA	A9D9Y1	Lactobacillus_prophage	36.6	1.1e-11
93570:93629	attL	AATTGCTGTGGGTAGACGTAAACGATTTAAGAAGAATCAACCCTTTAAATGGAAGCATTA	NA	NA	NA	NA
WP_054300202.1|93576_94305_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
93570:93629	attL	AATTGCTGTGGGTAGACGTAAACGATTTAAGAAGAATCAACCCTTTAAATGGAAGCATTA	NA	NA	NA	NA
WP_016212152.1|94774_95158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212154.1|95464_95842_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q716C2	Shigella_phage	46.0	1.2e-17
WP_155047283.1|96006_96339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155085000.1|96527_97109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047298.1|97836_98022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212019.1|98408_99104_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.9	2.2e-41
WP_105962690.1|99572_99848_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_047927838.1|99844_100090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047016.1|100119_100347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212014.1|100750_101164_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_054300202.1|101261_101990_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_105962623.1|102056_103209_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
101938:102738	attR	TAATGCTTCCATTTAAAGGGTTGATTCTTCTTAAATCGTTTACGTCTACCCACAGCAATTGATCAGGCTACCCTATTCCGGACAAATAAATTACAATAATCCGAGCCGGAGGAATCACAATGGGAAAGCGTCACGTCACCAAGTACACCGAAGAATTTAAAAAATCATCTGCCAAGCTTGCAGTCGATTCAAATCAAGCAATCAGTCATACAGCACAGGAATTGGGTATTCACTCAAGTACACTGCATGGTTGGGTCAATAAATATCATCCAAACAGTCCAAATACTGTTAAAGATGAAGTTAGTGATATGGCTGCTGAAATAAAACAGTTAAAAAAAGAGTTGGCTAGAGTGACACAGGAACGTGAAATACTAAAAAAAGCGGCGGCGTACTTTGCAAGCGAAACACAGTAAAGTATGCCTGGATCAAAGAAAATAAATGTGTTTTTCCAGTAGATAGGGTGTGCTCAATCTTAGGTGTTAGCCGATCAGGTTATTACAGTTGGTTAAAGGTACAGCCTTCCAAGCGAATGATAGAGAACCAAAAATTAGCTAGGCGAATCAAGGAAATATTCATCGAAAGCCGTGCAACCTATGGTACTCGAAGAATTAGAAAACAGTTGGCAACACAGGAAATTTCTGTAAGCCGTAAGCGAGTTGGCCGTTTAATGAAGCAGAACCAGCTTTGCTGCAAGATAAAGCGTAAATTCAAAGTAACTACGGATTCTAAACATCGATTGCCAATTGCGAAAAACGTGTTGGACCGGAATTTTTCAGCAACAGGCCCTAACCAAAAATATGT	NA	NA	NA	NA
WP_155047284.1|103838_104867_+	hypothetical protein	NA	NA	NA	NA	NA
101938:102738	attR	TAATGCTTCCATTTAAAGGGTTGATTCTTCTTAAATCGTTTACGTCTACCCACAGCAATTGATCAGGCTACCCTATTCCGGACAAATAAATTACAATAATCCGAGCCGGAGGAATCACAATGGGAAAGCGTCACGTCACCAAGTACACCGAAGAATTTAAAAAATCATCTGCCAAGCTTGCAGTCGATTCAAATCAAGCAATCAGTCATACAGCACAGGAATTGGGTATTCACTCAAGTACACTGCATGGTTGGGTCAATAAATATCATCCAAACAGTCCAAATACTGTTAAAGATGAAGTTAGTGATATGGCTGCTGAAATAAAACAGTTAAAAAAAGAGTTGGCTAGAGTGACACAGGAACGTGAAATACTAAAAAAAGCGGCGGCGTACTTTGCAAGCGAAACACAGTAAAGTATGCCTGGATCAAAGAAAATAAATGTGTTTTTCCAGTAGATAGGGTGTGCTCAATCTTAGGTGTTAGCCGATCAGGTTATTACAGTTGGTTAAAGGTACAGCCTTCCAAGCGAATGATAGAGAACCAAAAATTAGCTAGGCGAATCAAGGAAATATTCATCGAAAGCCGTGCAACCTATGGTACTCGAAGAATTAGAAAACAGTTGGCAACACAGGAAATTTCTGTAAGCCGTAAGCGAGTTGGCCGTTTAATGAAGCAGAACCAGCTTTGCTGCAAGATAAAGCGTAAATTCAAAGTAACTACGGATTCTAAACATCGATTGCCAATTGCGAAAAACGTGTTGGACCGGAATTTTTCAGCAACAGGCCCTAACCAAAAATATGT	NA	NA	NA	NA
WP_105962623.1|105146_106300_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_075273826.1|106259_107387_-	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	30.3	1.9e-18
WP_155047013.1|107607_107754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377350.1|108083_108899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036780064.1|109144_109735_+|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	38.3	2.0e-22
WP_016211879.1|110689_111709_+	ParA family protein	NA	NA	NA	NA	NA
WP_075274742.1|111721_112603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|112632_113361_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016211890.1|113564_116141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|116257_117235_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_162034470.1|117359_117473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047299.1|117562_118921_+	DEAD/DEAH box helicase family protein	NA	D2J050	Enterococcus_phage	50.5	2.6e-126
WP_017375910.1|119104_119833_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_157894761.1|121503_121650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774631.1|122012_122477_-	hypothetical protein	NA	H6WFS7	Cyanophage	38.2	2.9e-21
WP_155047285.1|123610_123868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|123886_124864_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_162034471.1|124891_125338_-	recombinase family protein	NA	A0A1B0VBM1	Salmonella_phage	37.4	1.5e-17
WP_017377658.1|125341_126028_-	Fic family protein	NA	NA	NA	NA	NA
WP_017375910.1|126275_127004_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_129556703.1|127733_128222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211956.1|128279_129008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211955.1|129464_130445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275154.1|130581_131238_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	40.7	7.6e-31
WP_036771347.1|131600_132578_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_027242575.1|133207_133693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242576.1|133726_135589_-	UvrD-helicase domain-containing protein	NA	A0A088C4M0	Shewanella_sp._phage	30.9	1.0e-56
WP_036771347.1|135781_136759_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155047288.1|136773_136899_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_162034472.1|136837_137008_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275025.1|137257_139273_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_162034473.1|140934_142164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|142193_143171_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155047292.1|143248_144166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|144955_146109_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_075273751.1|146458_148189_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_155047019.1|148201_148354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047293.1|148843_149569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|149721_150450_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_032126843.1|150826_151006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126844.1|151224_151521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212118.1|151615_152077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036780014.1|152430_153873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036780017.1|154033_154408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047014.1|154478_154820_-	hypothetical protein	NA	A0A1B1IQX9	uncultured_Mediterranean_phage	60.3	1.7e-21
WP_054300202.1|155038_155767_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_155047294.1|155973_156636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047295.1|156881_157943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|157972_159055_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_155047300.1|159174_159447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047296.1|159555_160191_-|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	42.5	1.4e-34
WP_155046765.1|161077_161272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047015.1|161652_161976_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP048068	Piscirickettsia salmonis strain Ps-8079A plasmid Ps8079A-p2, complete sequence	73896	1475	48729	73896	capsid,head,tail,portal,transposase	Streptococcus_phage(31.58%)	53	NA	NA
WP_162034482.1|1475_1745_+	hypothetical protein	NA	A0A1X9I6U5	Streptococcus_phage	37.5	8.2e-08
WP_162034483.1|1683_2718_+|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	45.1	1.5e-70
WP_162034484.1|2680_2911_+	hypothetical protein	NA	Q8VNN5	Enterobacteria_phage	52.9	3.2e-13
WP_162034485.1|2927_3023_+	hypothetical protein	NA	Q8VNN5	Enterobacteria_phage	67.7	5.9e-06
WP_162034486.1|3033_3261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162034487.1|3459_3801_+|capsid	phage major capsid protein	capsid	NA	NA	NA	NA
WP_162034502.1|3800_4106_+|capsid	phage major capsid protein	capsid	M1Q1R5	Streptococcus_phage	28.7	1.6e-07
WP_162034488.1|4219_4546_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	43.6	1.5e-16
WP_036778347.1|4581_5163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274765.1|5475_5787_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	31.7	2.5e-08
WP_075274764.1|5783_6107_+|head	phage head closure protein	head	K7PH08	Enterobacteria_phage	41.7	5.4e-14
WP_162034503.1|7258_7567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047304.1|10536_10668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377927.1|12186_12501_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_162034489.1|12831_13557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211377.1|13580_14603_-	AAA family ATPase	NA	A0A1V0DZZ0	Clostridioides_phage	27.5	3.2e-12
WP_162034490.1|15363_15765_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_162034491.1|15977_16388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126623.1|16500_17733_+	MFS transporter	NA	NA	NA	NA	NA
WP_054300271.1|17909_18884_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_027242955.1|19131_19392_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_036780061.1|19384_19738_+	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	35.8	1.1e-12
WP_017375910.1|20014_20743_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_162034492.1|21136_22063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|22204_22933_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_162034493.1|22962_23577_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_162034494.1|23938_24481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162034495.1|24522_24801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007075.1|26704_27046_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_032126154.1|27913_28108_+	addiction module toxin, HicA family	NA	A0A1X9I5T5	Streptococcus_phage	48.4	2.8e-10
WP_016212274.1|28118_28583_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_162034496.1|29314_30115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275277.1|30731_30971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052104629.1|30841_31867_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_032126136.1|32900_33446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273298.1|33511_34087_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	6.0e-08
WP_155053580.1|34032_34506_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047301.1|34707_34980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212188.1|35157_35898_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_054300276.1|36987_37962_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.8	2.4e-25
WP_032126138.1|38892_39156_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_016211928.1|39706_40147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211925.1|40139_40925_-	ParA family protein	NA	A0A0K2FLP4	Brevibacillus_phage	28.7	9.7e-17
WP_027242955.1|41442_41703_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_155047312.1|41695_42037_+	toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	34.7	2.0e-11
WP_054300271.1|42072_43047_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_016211074.1|43258_44059_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016211068.1|44055_44868_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211075.1|44871_46113_-	MFS transporter	NA	NA	NA	NA	NA
WP_155047030.1|46327_46471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162034497.1|46495_46807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162034498.1|46800_47556_+	VUT family protein	NA	NA	NA	NA	NA
WP_054300594.1|47703_48729_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP048068	Piscirickettsia salmonis strain Ps-8079A plasmid Ps8079A-p2, complete sequence	73896	51831	64944	73896	protease,capsid,head,portal,tail,transposase,terminase	Enterobacteria_phage(21.43%)	21	NA	NA
WP_016211080.1|51831_52818_+	helix-turn-helix domain-containing protein	NA	A0A0S2MVA0	Bacillus_phage	45.4	4.3e-14
WP_036780304.1|52858_53395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047314.1|53363_53726_+	hypothetical protein	NA	R9TNL4	Vibrio_phage	53.8	2.9e-24
WP_155047315.1|53718_54066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210963.1|54062_54302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162034499.1|54294_54684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047311.1|54680_54983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162034500.1|54970_55420_+	single-stranded DNA-binding protein	NA	G8EYH4	Enterobacteria_phage	64.9	7.2e-33
WP_052047121.1|55584_55986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126915.1|56164_56548_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	45.5	4.7e-25
WP_155047310.1|56634_57117_+	hypothetical protein	NA	Q9B019	Phage_GMSE-1	33.3	1.1e-13
WP_162034501.1|57384_58275_+|terminase	terminase large subunit	terminase	A0A1W6JP18	Morganella_phage	55.7	2.3e-83
WP_155047308.1|58294_59269_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.5	8.3e-26
WP_155047307.1|59312_59909_+	hypothetical protein	NA	E4ZFM0	Streptococcus_phage	45.3	2.0e-38
WP_054300593.1|59905_61147_+|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	43.6	2.7e-85
WP_054300592.1|61109_61766_+|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	45.9	5.4e-45
WP_155047306.1|61821_62988_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	38.7	1.2e-66
WP_036778347.1|63023_63605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274765.1|63924_64236_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	31.7	2.5e-08
WP_075274764.1|64232_64556_+|head	phage head closure protein	head	K7PH08	Enterobacteria_phage	41.7	5.4e-14
WP_075274763.1|64548_64944_+	HK97 gp10 family phage protein	NA	Q7Y404	Yersinia_phage	39.1	6.0e-07
>prophage 1
NZ_CP048069	Piscirickettsia salmonis strain Ps-8079A plasmid Ps8079A-p3, complete sequence	49987	4736	45056	49987	capsid,head,portal,transposase,terminase,protease,tail	unidentified_phage(19.05%)	57	NA	NA
WP_054300271.1|4736_5711_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_162034508.1|5845_6190_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_162034509.1|6195_6681_+|transposase	transposase family protein	transposase	S5WIU1	Leptospira_phage	42.4	8.1e-30
WP_016211139.1|6760_7156_-	HK97 gp10 family phage protein	NA	Q7Y404	Yersinia_phage	40.7	2.1e-07
WP_016211132.1|7148_7472_-|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	39.8	5.0e-12
WP_016211137.1|7468_7780_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J711	uncultured_Caudovirales_phage	34.7	1.1e-08
WP_155047318.1|7970_9305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211140.1|9425_10619_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	40.1	2.7e-66
WP_016211130.1|10676_11333_-|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	44.9	3.9e-43
WP_155047319.1|11295_11916_-|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	50.9	5.5e-39
WP_075275277.1|12008_12248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052104629.1|12118_13144_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047320.1|13274_13997_-|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	40.8	2.6e-40
WP_155047321.1|13993_15676_-|terminase	terminase large subunit	terminase	A0A1P8DTK0	Proteus_phage	45.7	6.9e-137
WP_016212234.1|15678_16158_-|terminase	P27 family phage terminase small subunit	terminase	NA	NA	NA	NA
WP_155047322.1|16234_16627_-	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	47.2	4.4e-26
WP_054300271.1|16961_17936_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_016212235.1|18033_18399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036780870.1|18551_18881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047323.1|18880_19207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047324.1|19635_20421_-	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	36.4	7.6e-38
WP_016210974.1|20432_20840_-	DUF4411 family protein	NA	NA	NA	NA	NA
WP_016210972.1|20848_21076_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_054300271.1|21371_22346_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_155047330.1|22365_22695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210960.1|22836_23310_-	single-stranded DNA-binding protein	NA	A0A220NRQ8	Escherichia_phage	63.4	4.9e-32
WP_036794070.1|23311_23596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036780969.1|23592_23982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047325.1|23974_24214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047331.1|24210_24558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210959.1|24550_24913_-	hypothetical protein	NA	R9TNL4	Vibrio_phage	53.8	2.9e-24
WP_016210973.1|24881_25442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210962.1|25464_26280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210976.1|26326_26626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210958.1|26779_27085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162034504.1|27344_27497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210971.1|27753_28509_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210975.1|28585_29311_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036780204.1|29331_30693_-	MFS transporter	NA	NA	NA	NA	NA
WP_155047327.1|30780_31134_-	toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	35.8	1.1e-12
WP_155047328.1|31126_31339_-	addiction module toxin, HicA family	NA	NA	NA	NA	NA
WP_155047329.1|32715_33045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963666.1|33502_33742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876259.1|33612_34629_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_027243195.1|34954_36001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375692.1|36408_36642_+	hypothetical protein	NA	Q7Y5W4	Haemophilus_phage	42.6	1.3e-06
WP_017375691.1|36665_37367_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	37.6	9.6e-32
WP_036773107.1|37350_37668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126713.1|37994_39032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212089.1|39130_39361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126714.1|39597_40137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047316.1|40304_40754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300598.1|40753_41191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104629.1|41360_42386_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075274768.1|42256_42556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|43110_44085_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_155047317.1|44219_45056_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.7	1.9e-42
