The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP048052	Piscirickettsia salmonis strain Ps-11091B chromosome, complete genome	3194020	608	56203	3194020	tRNA,transposase	Escherichia_phage(28.57%)	57	NA	NA
WP_017378478.1|608_1988_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_017378477.1|1995_3696_-	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_144420589.1|3910_4285_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_016209359.1|4291_4426_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_017378480.1|6526_7153_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_017378481.1|7172_8057_+	ParA family protein	NA	Q8JL10	Natrialba_phage	28.4	5.8e-18
WP_027242747.1|8089_8980_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	31.8	6.7e-14
WP_017378483.1|9094_9493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378484.1|9497_10313_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_016209328.1|10364_10769_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_017378485.1|10823_11294_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_017378486.1|11305_11833_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_017378487.1|11849_13391_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_027242748.1|13416_14277_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_016209339.1|14307_15699_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_017378489.1|15723_16152_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_027242749.1|16245_17610_+	UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	40.9	3.9e-37
WP_027242750.1|17666_19502_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.7	5.8e-121
WP_036773290.1|19615_20344_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.2	2.3e-44
WP_027242751.1|20870_22412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378498.1|22678_23335_-	2OG-Fe dioxygenase family protein	NA	NA	NA	NA	NA
WP_048876081.1|24032_24692_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_017376300.1|24836_25094_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075275376.1|25206_25959_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_017376303.1|26017_26731_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	36.0	2.2e-28
WP_027242752.1|26922_27555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999959.1|28615_28855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|29289_30693_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046628.1|30689_30914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771332.1|30993_31968_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
WP_036815787.1|31987_32305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376724.1|32382_32595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063559.1|32841_33261_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_036816796.1|33358_33805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242563.1|34149_35148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929590.1|35180_35534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929591.1|35578_35851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376728.1|36246_37665_-	MFS transporter	NA	NA	NA	NA	NA
WP_017376729.1|37891_38833_+	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_026063560.1|38867_40847_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_027242562.1|40843_41449_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_016211294.1|41450_41792_+	prokaryotic cytochrome C oxidase subunit IV family protein	NA	NA	NA	NA	NA
WP_027242561.1|41792_42629_+	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_080963573.1|42794_43112_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_027242560.1|43189_44611_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017376735.1|44607_45303_-	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_047927112.1|45466_45793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420744.1|46489_47335_+	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_017376738.1|47344_47683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876080.1|48251_49655_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048876181.1|49768_50632_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046627.1|50836_51010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876079.1|51617_52667_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275379.1|52821_53040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|53359_54763_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048876179.1|54773_55331_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772663.1|55327_56203_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP048052	Piscirickettsia salmonis strain Ps-11091B chromosome, complete genome	3194020	191881	322808	3194020	tRNA,tail,protease,transposase	Acinetobacter_phage(11.11%)	111	NA	NA
WP_017377604.1|191881_193864_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G9E4U6	Ostreococcus_lucimarinus_virus	41.1	1.0e-115
WP_017377605.1|194073_195417_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_017377606.1|195683_198353_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_017377607.1|198376_200293_+	pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_026063653.1|200462_201884_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.1	3.1e-45
WP_017377609.1|202028_203003_+	phospholipase A	NA	NA	NA	NA	NA
WP_027242692.1|203012_203312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377612.1|203429_203651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377613.1|203814_205476_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	64.5	7.7e-181
WP_016209850.1|205548_205839_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	42.6	3.3e-15
WP_017377614.1|206065_206521_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_017377615.1|206585_207050_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_027242691.1|207141_208488_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_017377618.1|208487_209393_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_017377619.1|209454_210441_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_016209851.1|210433_210676_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_017377620.1|210794_212339_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	46.9	1.6e-63
WP_017377621.1|212385_213672_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_017377622.1|213714_215118_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_144420750.1|215122_217660_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_144420593.1|218056_218305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963589.1|218236_218698_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_017377624.1|219192_219888_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_080963590.1|219989_221552_-	APC family permease	NA	NA	NA	NA	NA
WP_017377626.1|221879_223673_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	41.0	2.2e-117
WP_017377627.1|223759_224032_+	DUF615 domain-containing protein	NA	NA	NA	NA	NA
WP_017377628.1|224037_224664_+	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_017377629.1|224650_226081_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_017377630.1|226402_227458_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.7	5.1e-29
WP_017377631.1|227426_228104_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017377632.1|228093_228942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210080.1|229087_229381_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_036772063.1|229492_230305_-	trfA family protein	NA	NA	NA	NA	NA
WP_017377635.1|230603_231458_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_017377636.1|231611_232661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377637.1|232706_233363_-	DedA family protein	NA	NA	NA	NA	NA
WP_017377638.1|233380_234661_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_017377639.1|234934_236296_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_036772069.1|236356_236908_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_162034387.1|241220_241379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376225.1|242338_243610_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_017376226.1|243666_244650_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_027243088.1|244646_245432_+	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_017376227.1|245739_246189_-	DUF1499 domain-containing protein	NA	NA	NA	NA	NA
WP_048876031.1|246282_247686_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376228.1|248123_249605_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	5.3e-48
WP_017376229.1|249660_250770_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	1.7e-35
WP_017376234.1|252342_252555_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_027243087.1|252595_253291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376236.1|256087_256654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243085.1|256811_257372_+	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_053856766.1|257491_258895_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875886.1|258891_259248_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_017376838.1|259503_260328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243084.1|261025_261550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|261835_262810_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_027243083.1|262909_263461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275261.1|263573_264086_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_144420594.1|264478_265936_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420595.1|266049_266529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243080.1|266724_267372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376843.1|267651_268767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376844.1|268738_269392_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_027243079.1|269385_270363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243078.1|271899_272124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210632.1|272506_272794_-	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_017376847.1|272968_273724_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_036774056.1|273756_274188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376849.1|274163_274640_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376850.1|274646_276224_+	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	31.4	3.6e-10
WP_017376851.1|276226_276991_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_017376852.1|277044_277581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376853.1|277577_278309_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_027243077.1|278533_279295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875887.1|279620_280496_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378284.1|281898_282054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375925.1|282247_283915_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017375924.1|284610_284919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420596.1|284936_287129_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	44.9	3.5e-141
WP_069971668.1|287936_288185_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	56.1	2.9e-07
WP_017375921.1|288297_288531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375920.1|288765_289296_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_017375919.1|289300_290014_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_144420751.1|290641_291367_+	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_048875888.1|291375_293439_+	serine/threonine protein kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	28.0	3.9e-17
WP_027243033.1|293618_294098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062312049.1|294590_295958_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376531.1|296349_297147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243034.1|297258_298548_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_144420597.1|298728_299715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376534.1|299831_300011_+	rubredoxin	NA	NA	NA	NA	NA
WP_017376535.1|300022_300454_-	protoporphyrinogen oxidase HemJ	NA	NA	NA	NA	NA
WP_017376536.1|300666_301026_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.5	4.4e-25
WP_017376537.1|301195_302821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999962.1|303544_304972_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376538.1|305265_306447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243035.1|309049_310348_-	MFS transporter	NA	NA	NA	NA	NA
WP_144420752.1|310703_311597_+	DNA polymerase III subunit delta'	NA	S5WKH4	Pseudomonas_phage	33.8	2.3e-14
WP_047927468.1|311593_311899_+	pilus assembly protein PilZ	NA	NA	NA	NA	NA
WP_017376543.1|311924_312704_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_144420598.1|312733_312964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210862.1|313115_313361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376547.1|313547_314339_+	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_017376548.1|315038_315761_+	putative N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_017376549.1|315757_316639_+	ROK family protein	NA	NA	NA	NA	NA
WP_027243038.1|316662_318153_+	sodium:solute symporter	NA	A0A219Y9P9	Aeromonas_phage	23.8	8.0e-20
WP_027243039.1|318242_319130_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_017376551.1|319802_320294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375625.1|320298_320526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|320618_321593_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_069971669.1|321569_322808_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP048052	Piscirickettsia salmonis strain Ps-11091B chromosome, complete genome	3194020	330774	384187	3194020	transposase	Staphylococcus_phage(57.14%)	48	NA	NA
WP_053856767.1|330774_332178_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420600.1|332283_332469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856766.1|333167_334571_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999963.1|334661_335165_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771639.1|335204_336179_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017376774.1|336175_336745_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	40.3	4.5e-32
WP_017376776.1|337231_337924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420601.1|338531_339524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376778.1|339513_341286_+	single-stranded-DNA-specific exonuclease RecJ	NA	NA	NA	NA	NA
WP_080963634.1|341286_341475_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_036774259.1|341512_342487_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036815640.1|342545_342740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375625.1|342806_343034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971671.1|343163_344039_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046623.1|344266_344416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420602.1|344407_344674_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420603.1|344818_345718_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046619.1|345804_346062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243075.1|346674_347901_+	cysteine desulfurase-like protein	NA	NA	NA	NA	NA
WP_027243074.1|347990_348530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243073.1|348651_349290_-	MFS transporter	NA	NA	NA	NA	NA
WP_075275265.1|349323_349812_-	VUT family protein	NA	NA	NA	NA	NA
WP_162038645.1|350058_350205_-	VUT family protein	NA	NA	NA	NA	NA
WP_036772686.1|350341_350830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162038646.1|351400_352576_-	MFS transporter	NA	NA	NA	NA	NA
WP_017378171.1|352815_353106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420605.1|353144_355799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243070.1|356512_356767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063658.1|357076_357805_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	1.3e-44
WP_017377650.1|358575_359760_+	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_017377649.1|359778_360723_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_027243069.1|361028_361814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377647.1|361927_362296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377646.1|362524_364102_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_144420753.1|364885_369310_+	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_065653746.1|369446_370970_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017377643.1|371174_371402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377642.1|371546_371804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772743.1|372371_373343_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_080999964.1|373267_373507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772729.1|373639_373861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|373980_374955_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036771639.1|376058_377033_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_027242739.1|377393_380063_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	24.5	5.5e-19
WP_036774478.1|380233_381115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378307.1|381125_381782_-	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_017378308.1|381848_382553_-	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_048876031.1|382783_384187_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP048052	Piscirickettsia salmonis strain Ps-11091B chromosome, complete genome	3194020	441184	508331	3194020	transposase,tRNA	Acinetobacter_phage(16.67%)	58	NA	NA
WP_048875895.1|441184_442348_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.0	3.8e-25
WP_144420756.1|442401_443403_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_017378362.1|443484_444054_+	elongation factor P	NA	NA	NA	NA	NA
WP_144420608.1|444267_445239_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A1V0SAC0	Catovirus	25.9	7.3e-22
WP_017378364.1|445250_446846_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_036772406.1|446866_447898_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_017378367.1|448229_449333_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_017378368.1|449444_450629_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_017378369.1|450706_452695_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_162038647.1|453275_453485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420609.1|453853_455227_+	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_017378374.1|455244_456231_+	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	K7Y9E1	Megavirus	34.2	2.2e-42
WP_080963622.1|456233_457388_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2D2W2B8	Stenotrophomonas_phage	28.2	2.3e-14
WP_017378376.1|457384_458080_+	pseudaminic acid cytidylyltransferase	NA	A0A1B1IVD3	uncultured_Mediterranean_phage	32.3	8.6e-09
WP_017378377.1|458222_459713_+	UDP-2,4-diacetamido-2,4, 6-trideoxy-beta-L-altropyranose hydrolase	NA	NA	NA	NA	NA
WP_017378378.1|459733_460783_+	pseudaminic acid synthase	NA	NA	NA	NA	NA
WP_027242727.1|460849_462244_-	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_017378381.1|463176_465108_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.0	3.1e-117
WP_075273353.1|465112_465643_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	4.7e-15
WP_017378382.1|465677_465872_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_016210495.1|465914_466274_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_017378383.1|466405_467401_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	36.5	3.2e-33
WP_017378384.1|467413_469795_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211707.1|469800_470088_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	33.7	3.0e-08
WP_017378388.1|472168_472942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378389.1|472943_473885_-	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	26.5	1.7e-20
WP_017378390.1|474018_475596_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_017378391.1|475789_476746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378392.1|476765_476918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378393.1|477188_477395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875897.1|478199_478844_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.2	2.7e-09
WP_069971672.1|478911_480168_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376600.1|480423_480603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927402.1|480825_481053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377704.1|482328_483087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420757.1|483304_483868_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_017377702.1|483971_484520_+	DUF2058 family protein	NA	NA	NA	NA	NA
WP_157894716.1|484977_485115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910634.1|485116_486269_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.5	2.3e-59
WP_017377698.1|486614_486911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420758.1|487170_488082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146619438.1|488316_488868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377695.1|489368_490022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046620.1|490018_490156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377686.1|491176_491785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210764.1|493059_493320_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_017377283.1|493493_495032_+	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_017377282.1|495210_496137_+	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SJE1	Klosneuvirus	34.5	1.6e-10
WP_048875900.1|496241_497174_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.8	9.4e-27
WP_017377279.1|497670_500484_+|tRNA	isoleucine--tRNA ligase	tRNA	K7YVP8	Megavirus	26.8	1.0e-76
WP_017377278.1|500476_500986_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_017377277.1|500989_501433_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_027243089.1|501528_502830_-	MFS transporter	NA	NA	NA	NA	NA
WP_017377276.1|503092_503461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377275.1|503452_504175_-	aquaporin family protein	NA	M1H9L8	Acanthocystis_turfacea_Chlorella_virus	37.6	1.6e-26
WP_017377274.1|505236_506589_+	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	45.7	3.2e-36
WP_017377273.1|506582_506822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875901.1|507356_508331_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.2e-29
>prophage 5
NZ_CP048052	Piscirickettsia salmonis strain Ps-11091B chromosome, complete genome	3194020	517832	630356	3194020	transposase,tRNA,protease	Staphylococcus_phage(25.0%)	111	NA	NA
WP_048876031.1|517832_519236_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275269.1|519542_520163_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875903.1|520342_521317_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.2e-29
WP_017376501.1|521482_521749_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_144420759.1|521745_522246_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_048875904.1|522366_523242_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_075275277.1|524331_524571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375999.1|524901_525432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376000.1|525431_525956_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	58.4	1.5e-50
WP_017376001.1|526118_527234_-	DSD1 family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017376003.1|527470_528631_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.7	2.8e-121
WP_017376004.1|529082_531086_+	transketolase	NA	NA	NA	NA	NA
WP_017376005.1|531154_532162_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_017376006.1|532235_533420_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_017376007.1|533429_534884_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_017376008.1|534914_535952_+	fructose-bisphosphate aldolase class II	NA	NA	NA	NA	NA
WP_017376009.1|536274_536565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|537919_538894_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_155082176.1|539018_539690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377794.1|540213_540465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377795.1|540669_541833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275388.1|541855_542545_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017377798.1|542692_543343_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_017377799.1|543443_544103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875907.1|546164_546926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377800.1|547344_547605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377801.1|547690_548353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377802.1|548469_549597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377803.1|549972_550134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420613.1|552265_552637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155051411.1|552868_554158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275272.1|554295_554526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377811.1|554659_555544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243005.1|555572_556199_-	ribonuclease T	NA	NA	NA	NA	NA
WP_036773165.1|556229_557429_-	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_162038648.1|557667_558765_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	43.1	1.1e-05
WP_017377815.1|558916_560455_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.5	3.5e-87
WP_017375632.1|560775_561111_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_017377701.1|561982_562216_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036773116.1|562586_563561_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017377817.1|564072_564570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377818.1|564805_565450_+	porin family protein	NA	NA	NA	NA	NA
WP_053856754.1|565554_565806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377819.1|565950_566946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210813.1|567023_567452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210814.1|567801_567999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210817.1|568241_568874_-	riboflavin synthase	NA	A0A1V0SE20	Indivirus	32.8	1.1e-13
WP_016210815.1|569294_570245_-	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_017377820.1|570241_571774_-	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_016210812.1|571770_572277_-|protease	ATP-dependent zinc protease family protein	protease	NA	NA	NA	NA
WP_162038649.1|572459_573615_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	4.4e-50
WP_048875857.1|573872_574847_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
WP_048876031.1|575270_576674_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155051409.1|576707_577508_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_017376557.1|577626_578322_-	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	27.4	1.2e-10
WP_017376558.1|578826_579333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242585.1|579426_579984_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_080999966.1|580281_581631_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046619.1|581717_581975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376564.1|582042_582753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420761.1|582897_583077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376566.1|583599_584859_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_017376567.1|584991_585465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376568.1|585473_586856_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_026063542.1|586848_587463_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_017376570.1|587542_588259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376571.1|588433_590758_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	49.7	7.6e-25
WP_036771330.1|590924_591899_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376573.1|592828_594571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376574.1|594742_595834_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376575.1|595866_596505_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_017376576.1|596543_596816_-	DUF1315 family protein	NA	NA	NA	NA	NA
WP_144420763.1|596914_597157_-	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_017376578.1|597174_597477_-	YciI family protein	NA	NA	NA	NA	NA
WP_017376579.1|597560_598103_-	septation protein A	NA	NA	NA	NA	NA
WP_016210074.1|598263_598890_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_017376580.1|598895_599735_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	24.2	4.2e-10
WP_017376581.1|599724_600375_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	33.5	3.9e-19
WP_026063543.1|600378_601212_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_162038650.1|601301_602120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162038651.1|602110_602428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157894717.1|602694_602823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927249.1|602954_603149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376585.1|603341_603992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376586.1|604246_605338_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_017376587.1|605334_606699_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A088FRM7	Mycobacterium_phage	52.2	2.6e-17
WP_017376588.1|606823_608020_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A2I2L594	Orpheovirus	24.8	2.8e-07
WP_144420764.1|608076_608640_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_017376590.1|609572_610241_-	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	44.1	4.7e-28
WP_017376591.1|610387_611689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376593.1|613179_613584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243040.1|613817_614900_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.2	1.4e-18
WP_017376596.1|614884_615505_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376597.1|615569_616445_+	hypothetical protein	NA	A0A140B3P3	Vibrio_phage	24.0	1.8e-11
WP_017376598.1|616522_617098_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_017377700.1|617906_618200_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_080999967.1|618316_618466_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|619794_620769_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420617.1|620867_621023_-	phosphatase	NA	NA	NA	NA	NA
WP_075275275.1|620941_621133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157894718.1|621486_621906_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	48.5	6.7e-33
WP_026063680.1|622160_622385_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	46.2	1.2e-07
WP_144420618.1|622529_623351_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.9	1.2e-41
WP_017377700.1|623308_623602_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_162038639.1|623978_624470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243138.1|625078_625366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875909.1|625858_626629_-|transposase	IS982-like element ISPsa1 family transposase	transposase	NA	NA	NA	NA
WP_027243137.1|626698_628042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910635.1|628477_629848_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046582.1|629844_630009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377223.1|630068_630356_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
>prophage 6
NZ_CP048052	Piscirickettsia salmonis strain Ps-11091B chromosome, complete genome	3194020	636218	679170	3194020	tRNA,transposase	Acinetobacter_phage(27.27%)	44	NA	NA
WP_017377840.1|636218_636938_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_017377841.1|637026_638811_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_155601396.1|639117_639273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377842.1|639199_639454_+	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_027243133.1|639599_640421_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_157894719.1|640693_640828_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_048876031.1|640933_642337_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377200.1|642901_643090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162038652.1|643267_643486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377198.1|643871_645512_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_017377197.1|645624_646974_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.0	3.0e-74
WP_027243130.1|646970_647840_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.2	9.3e-69
WP_017377194.1|648764_650078_+	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_048875913.1|650074_650845_+	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_017375625.1|650841_651069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046617.1|651773_651914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075278729.1|652058_653186_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	31.4	2.1e-20
WP_069971647.1|653190_653787_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_162038649.1|653826_654982_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	4.4e-50
WP_048875916.1|655950_656355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875923.1|656358_657354_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_157894720.1|657339_658512_-	MFS transporter	NA	NA	NA	NA	NA
WP_036774946.1|658468_659083_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	35.1	3.8e-16
WP_155046615.1|659779_659941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377737.1|660220_660766_+	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_017377736.1|660799_661465_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_155764145.1|661524_662136_-	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	31.3	5.1e-13
WP_048875917.1|662075_662480_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_144420767.1|662758_663436_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_048875918.1|663478_664060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046614.1|664204_664876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927746.1|665478_666066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162038649.1|666105_667261_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	4.4e-50
WP_036773915.1|667234_667630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377727.1|668057_668873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377726.1|668963_669950_+	transaldolase	NA	V5UTB0	Synechococcus_phage	33.5	1.3e-13
WP_017377725.1|670119_670641_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	1.8e-27
WP_017377724.1|670674_670926_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	57.6	3.9e-20
WP_017377723.1|670936_672214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377722.1|672905_673433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377721.1|673549_675862_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_036773913.1|675990_676806_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017377718.1|677062_677527_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_162038649.1|678014_679170_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	4.4e-50
>prophage 7
NZ_CP048052	Piscirickettsia salmonis strain Ps-11091B chromosome, complete genome	3194020	686525	758755	3194020	transposase,tRNA	Staphylococcus_phage(44.44%)	56	NA	NA
WP_048875919.1|686525_686843_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377706.1|686860_687073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162038649.1|687097_688253_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	4.4e-50
WP_144420621.1|689411_690173_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275277.1|690043_690283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771325.1|692363_693338_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_027242902.1|693462_694899_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_017376308.1|694978_696439_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_017376309.1|696559_696847_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_016210526.1|697044_698088_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_017376311.1|698103_699003_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_017376312.1|698999_699518_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_017376313.1|699587_700205_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_026063524.1|700214_701702_+	ribonuclease G	NA	NA	NA	NA	NA
WP_027242903.1|701711_705392_+	DUF3971 domain-containing protein	NA	NA	NA	NA	NA
WP_017376318.1|705465_706275_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_017376319.1|706274_706955_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_036773116.1|707579_708554_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_048875923.1|708596_709592_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|709644_710619_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017376224.1|710931_711816_-	DUF2608 domain-containing protein	NA	NA	NA	NA	NA
WP_017376223.1|711946_712768_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_017376222.1|712769_713807_-	asparaginase	NA	NA	NA	NA	NA
WP_017376221.1|713810_716468_-	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
WP_017376220.1|716545_717355_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_017376219.1|717761_718529_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_017376218.1|718693_719572_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_017376217.1|719575_720313_+	UMP kinase	NA	NA	NA	NA	NA
WP_017376216.1|720316_720874_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_026063514.1|720881_721628_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	44.0	6.6e-23
WP_027242904.1|721635_722442_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_036771906.1|722530_723406_+	lipid A biosynthesis acyltransferase	NA	NA	NA	NA	NA
WP_144420622.1|723502_725080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242905.1|725288_725477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376212.1|725524_727435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376211.1|727971_728511_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_017376210.1|728507_729536_-	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_017376209.1|729525_730590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065653749.1|730577_732806_-	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_027242906.1|732792_733860_-	hydroxymethylglutaryl-CoA reductase	NA	NA	NA	NA	NA
WP_036771893.1|734144_736562_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_017376207.1|736642_737176_+	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_017376206.1|737286_738336_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_075275393.1|738353_738800_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_017376204.1|738799_739573_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_027242907.1|739591_740746_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_017376201.1|740959_741529_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	43.4	3.4e-27
WP_017376200.1|741552_745059_+	DNA polymerase III subunit alpha	NA	A0A291AVA6	Streptomyces_phage	38.6	1.9e-192
WP_027242908.1|745136_746096_+	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_017376198.1|746070_747531_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_017376197.1|747566_749096_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.6	1.1e-85
WP_080999970.1|749129_750533_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155635845.1|752690_754259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|754343_755747_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048876012.1|755892_757296_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|757780_758755_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 8
NZ_CP048052	Piscirickettsia salmonis strain Ps-11091B chromosome, complete genome	3194020	771228	831498	3194020	transposase	Acinetobacter_phage(27.27%)	51	NA	NA
WP_048876012.1|771228_772632_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_082300719.1|772850_773276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243151.1|773327_774815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377221.1|775124_775664_-	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_162038653.1|775953_777110_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.9	2.0e-50
WP_017377224.1|777426_778002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999971.1|778115_779519_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377226.1|779515_779806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377227.1|780173_780587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052106211.1|781275_783063_+	protein kinase family protein	NA	NA	NA	NA	NA
WP_017377229.1|783229_783850_+	DUF2272 domain-containing protein	NA	NA	NA	NA	NA
WP_155046612.1|784196_784337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377231.1|786703_788161_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	42.1	9.4e-98
WP_017377232.1|788229_789810_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	27.3	1.1e-16
WP_017377234.1|790450_794347_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	54.4	3.4e-118
WP_016210741.1|794353_794677_-	late competence development ComFB family protein	NA	NA	NA	NA	NA
WP_017377235.1|794750_795224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772195.1|795255_796251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162038654.1|796502_796769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082303845.1|796768_798139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910659.1|798498_799446_+	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	35.2	4.3e-35
WP_017377238.1|799764_800109_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_144420626.1|800202_800874_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_017377240.1|800913_801741_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_036772199.1|801827_802355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243013.1|803240_803660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052106212.1|803768_804350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377245.1|804704_805985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377246.1|806105_806969_-	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
WP_017377247.1|807057_807852_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_036772212.1|808089_809076_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_027243014.1|809081_810608_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_144420771.1|810703_811948_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_017377251.1|812001_813381_+	leucyl aminopeptidase family protein	NA	Q6GYZ8	Mycoplasma_phage	35.8	2.4e-34
WP_026063614.1|813498_814284_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.3	3.7e-32
WP_016211687.1|814626_815271_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_016211684.1|817133_817709_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_036771330.1|818758_819733_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_081377824.1|820616_820955_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_053093666.1|822268_822946_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	47.4	1.4e-48
WP_144420627.1|824444_824666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274768.1|825146_825446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081000005.1|825546_825708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999972.1|825644_826145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376821.1|826240_826669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275303.1|826928_827918_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999973.1|827894_828860_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.6	2.0e-48
WP_017377288.1|829078_829339_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_087910637.1|829433_830168_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.3	2.0e-24
WP_155046611.1|830196_830349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875930.1|830553_831498_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP048052	Piscirickettsia salmonis strain Ps-11091B chromosome, complete genome	3194020	867302	989629	3194020	transposase,integrase,tRNA	Staphylococcus_phage(22.73%)	95	869938:869997	920359:921119
WP_048875933.1|867302_868247_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999974.1|868520_869924_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420631.1|869928_870714_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	29.7	1.2e-06
869938:869997	attL	GTCTTAGAGGTCATTGAAGGAGATCAGACGCTCAACCAAATATGCTCGAAATATGAGCTA	NA	NA	NA	NA
WP_075275282.1|871104_871947_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377467.1|871943_872240_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_017377471.1|873721_874333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377472.1|874401_875208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|875511_876486_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377475.1|876657_878550_+	DNA topoisomerase IV subunit B	NA	A0A172JHT4	Bacillus_phage	32.3	3.6e-81
WP_027243186.1|879056_881438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|881852_883256_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875935.1|883696_884176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420633.1|884243_885500_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036772665.1|885646_886171_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_017376899.1|886575_886716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929562.1|886913_887618_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376902.1|888472_888784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376903.1|888847_889027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243159.1|889589_889772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376905.1|889835_890063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063576.1|890270_891035_+	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	33.0	6.3e-29
WP_026063577.1|891261_891555_+	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	52.8	4.7e-17
WP_048875878.1|892080_893484_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376909.1|893953_894931_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_027243158.1|895027_896488_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_017376911.1|896514_897168_-	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_017376912.1|897292_897859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774028.1|898155_899889_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	30.0	1.6e-32
WP_047927497.1|899960_901667_+	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	26.3	3.6e-24
WP_017376916.1|901658_902717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875936.1|902970_903819_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.4	1.4e-16
WP_017375855.1|904413_904860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063481.1|905549_906971_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_017375857.1|907353_908796_+	MFS transporter	NA	NA	NA	NA	NA
WP_144420634.1|909194_910526_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036771639.1|910630_911605_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377669.1|911654_912359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420635.1|912799_913612_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420636.1|913670_916181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036815620.1|916526_917702_+	outer membrane transport family protein	NA	NA	NA	NA	NA
WP_144420637.1|919049_919274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875940.1|919302_920466_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.4e-25
WP_036774146.1|922708_923854_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
920359:921119	attR	TAGCTCATATTTCGAGCATATTTGGTTGAGCGTCTGATCTCCTTCAATGACCTCTAAGACAACTTTAGTTTTAAATTCAGCGCTTGGCTTCTTTCTTTTTTGACTCATCTCATAGCTCCTAAAATGTTAAGCATCATTTTAACCTTTCAGGAATAAATCGTTAAATTATCCTGTCTGAAAACTCGGGAGCATTCGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTTTAGCAGAGCGGAGTTGCGAAAGGCCGTTAGGTCTGTAGCAAGCGTAACGAGTGTCTAAAAATCTATACGAACCGTAGAGTCATGTGAGAGCACAGTAGTGGAGTGTGCCGATTCAAGGCACGTAACGCTGTGTGACGCGGACAGCCGAGGGTTTATAGTCGTCGCGTTTTGCTCGGCGATTTTGCATCATTGGATGTGCAAAATACCTACCGAGGTAGCGACGCTTACGATATTGCGTTGGCGGTTGCGGCCATTCCAGAAGGTTTACCGGCGGCGTTTACAATTATTTTAGCGATTGGTGTGTCGCGTATGGCACGTAAAGGTGCGATTATTCGTAAGTTACCCGCAGTGGAAACATTGGGTAGTACGACGGTCGTCTGTTCTGATAAAACGGGTACACTGACAAAAAATCAGATGACAGTAAAAGAAGTGGTGGTTGGTCAGGAGCGTTATACTATCAGCGGCGCCGGTTATGAGCCTGTTGGTACGGTGAAAAATTCGGCAGGGCA	NA	NA	NA	NA
WP_027243152.1|924445_925381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875941.1|926878_927190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420638.1|927186_928269_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377679.1|928584_928791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243160.1|928888_929419_+	prokaryotic cytochrome b561 family protein	NA	NA	NA	NA	NA
WP_017377681.1|929706_930885_-	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	31.6	7.7e-50
WP_027243161.1|931033_934870_-	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
WP_017377683.1|934856_936359_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_036773927.1|936910_937546_+	peroxiredoxin C	NA	NA	NA	NA	NA
WP_016211781.1|938036_939284_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_075275285.1|939506_940943_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_048875943.1|941118_942336_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999976.1|942797_943577_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_036771330.1|944583_945558_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_048875941.1|946603_946915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420638.1|946911_947994_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046609.1|948304_948511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243178.1|950231_951593_-	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	35.5	4.3e-12
WP_017375734.1|951703_952075_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_017375735.1|952297_952948_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017375736.1|952990_954073_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_069971648.1|954799_955774_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	4.7e-29
WP_162038655.1|959052_960102_+	protein kinase family protein	NA	NA	NA	NA	NA
WP_162038656.1|960387_960894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376859.1|961682_961919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275287.1|962038_963082_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375571.1|963328_963730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774710.1|963903_964803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875946.1|965197_966409_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.8e-25
WP_036771959.1|966419_966644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046608.1|966965_967130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|967222_968626_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027243219.1|968792_969101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375595.1|969385_969559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875947.1|970184_971234_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875948.1|971302_972325_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.4	3.9e-135
WP_017378198.1|972370_973285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162038649.1|973324_974480_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	4.4e-50
WP_017378197.1|974437_975307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053093667.1|976744_977461_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376026.1|977905_979777_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	28.4	1.4e-34
WP_027243175.1|979868_981614_-	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	36.7	7.6e-46
WP_017376029.1|981693_982143_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.9	1.4e-20
WP_016211035.1|982195_982411_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_017376030.1|982657_983674_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.2	1.8e-100
WP_017376031.1|983722_984352_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_017376032.1|984692_985904_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_048875949.1|985936_986287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420640.1|986252_986933_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376035.1|987209_987629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157894724.1|987774_988575_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771639.1|988654_989629_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
>prophage 10
NZ_CP048052	Piscirickettsia salmonis strain Ps-11091B chromosome, complete genome	3194020	1008689	1051881	3194020	transposase,tRNA,protease	Orpheovirus(22.22%)	43	NA	NA
WP_026063502.1|1008689_1009565_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420642.1|1009829_1010024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773960.1|1010168_1010642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046586.1|1010911_1011085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420643.1|1011289_1012603_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376055.1|1012599_1013244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772015.1|1013762_1014950_-	MFS transporter	NA	NA	NA	NA	NA
WP_036772012.1|1015082_1015772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376060.1|1015845_1017195_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	27.6	7.5e-33
WP_048876123.1|1017298_1019479_+	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_036772169.1|1019548_1020424_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376064.1|1020566_1020767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376065.1|1020890_1021298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420776.1|1021277_1021856_-	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	34.3	6.9e-20
WP_017376067.1|1022278_1022941_+	adenylate kinase	NA	NA	NA	NA	NA
WP_016211263.1|1022971_1023340_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_017376068.1|1023350_1024667_-	MFS transporter	NA	NA	NA	NA	NA
WP_144420644.1|1024913_1025525_+	DedA family protein	NA	NA	NA	NA	NA
WP_017376070.1|1025627_1025780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211261.1|1025950_1026244_-	cold shock domain-containing protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.5	5.8e-15
WP_036772670.1|1026484_1026787_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	40.0	7.5e-10
WP_017376072.1|1026841_1029115_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.3e-167
WP_016211259.1|1029174_1029420_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_048875954.1|1029544_1030300_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048875955.1|1030408_1031383_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	4.3e-30
WP_036771709.1|1031590_1032352_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_017376076.1|1032335_1033292_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.7	1.6e-61
WP_017376078.1|1036055_1036796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376079.1|1037245_1038040_-	inositol monophosphatase	NA	NA	NA	NA	NA
WP_017376080.1|1038202_1038991_+|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_017376081.1|1038987_1040199_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_144420777.1|1040191_1040548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376083.1|1040642_1041071_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	39.4	1.8e-17
WP_036771725.1|1041222_1042332_+	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_017376085.1|1042328_1043057_+	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_017376086.1|1043114_1044002_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017376087.1|1044086_1044461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376088.1|1044560_1045838_+|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	24.8	3.6e-21
WP_027242842.1|1045852_1046581_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_048875956.1|1046567_1047809_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_027242841.1|1047918_1049322_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_155046606.1|1049474_1049645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275292.1|1051050_1051881_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP048052	Piscirickettsia salmonis strain Ps-11091B chromosome, complete genome	3194020	1055427	1112675	3194020	transposase,tRNA,protease	Staphylococcus_phage(20.0%)	51	NA	NA
WP_048875957.1|1055427_1056084_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.9	9.6e-10
WP_017375746.1|1056080_1056389_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	41.4	1.7e-09
WP_036771957.1|1056737_1057709_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377899.1|1058012_1058804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875958.1|1058793_1059657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377897.1|1059683_1060103_-	response regulator	NA	W8CYM9	Bacillus_phage	29.4	1.2e-05
WP_017377896.1|1060155_1061112_-	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_027242839.1|1061594_1064267_+	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_017377894.1|1064347_1064974_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_026063687.1|1065130_1066729_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_017377892.1|1066818_1068240_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_017377891.1|1068270_1068792_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	34.2	2.0e-10
WP_017377890.1|1068788_1069394_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_017377889.1|1069470_1070481_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	30.8	6.9e-07
WP_017377888.1|1070593_1071298_+	protein TolQ	NA	NA	NA	NA	NA
WP_017377887.1|1071332_1071764_+	protein TolR	NA	NA	NA	NA	NA
WP_036771700.1|1071766_1072861_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_048875959.1|1072920_1074273_+	Tol-Pal system beta propeller repeat protein TolB	NA	NA	NA	NA	NA
WP_017377882.1|1074308_1074950_+	OmpA family protein	NA	NA	NA	NA	NA
WP_144420778.1|1075022_1075922_+	tol-pal system protein YbgF	NA	NA	NA	NA	NA
WP_027242836.1|1075924_1076572_+	7-carboxy-7-deazaguanine synthase QueE	NA	J9PV61	Bacillus_phage	38.6	1.6e-36
WP_027242835.1|1076622_1077426_-	AAA family ATPase	NA	A0A0E3G5H5	Synechococcus_phage	43.1	6.8e-42
WP_017377879.1|1077607_1077823_+	SlyX family protein	NA	NA	NA	NA	NA
WP_017377878.1|1077826_1078060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377877.1|1078121_1079714_-	exodeoxyribonuclease VII large subunit	NA	NA	NA	NA	NA
WP_017377875.1|1079916_1080846_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	31.9	7.0e-14
WP_017377874.1|1080847_1081615_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_047927659.1|1081980_1082751_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_048875960.1|1082809_1083784_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017377870.1|1083891_1084254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377869.1|1084423_1086133_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_048875961.1|1086373_1087777_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_146619530.1|1087828_1088086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242834.1|1088834_1090142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773793.1|1090601_1090979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376708.1|1091123_1091525_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875964.1|1092089_1092869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046604.1|1092936_1093077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420647.1|1093277_1093475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053093668.1|1093612_1094212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771696.1|1094394_1095855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378009.1|1096269_1098015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243143.1|1098450_1099311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378007.1|1099828_1101772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875961.1|1101917_1103321_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378006.1|1103440_1104070_-	response regulator	NA	NA	NA	NA	NA
WP_017378005.1|1104308_1105028_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_017378004.1|1105141_1108681_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_017378003.1|1108747_1109578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773465.1|1109564_1111604_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	40.9	7.1e-128
WP_027243145.1|1111619_1112675_+|protease	protease SohB	protease	NA	NA	NA	NA
>prophage 12
NZ_CP048052	Piscirickettsia salmonis strain Ps-11091B chromosome, complete genome	3194020	1119539	1153681	3194020	transposase	Acinetobacter_phage(33.33%)	28	NA	NA
WP_144420650.1|1119539_1120796_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376600.1|1121051_1121231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162038657.1|1121571_1122204_+|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	33.1	5.6e-15
WP_157894725.1|1122501_1122735_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999971.1|1123506_1124910_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377761.1|1125080_1126451_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_144420780.1|1126497_1127397_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377763.1|1127377_1130182_-	response regulator	NA	A0A1V0SGX0	Hokovirus	31.8	6.9e-57
WP_017377764.1|1130261_1130858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377765.1|1131271_1132027_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_162038649.1|1132116_1133273_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	4.4e-50
WP_027242898.1|1133460_1134102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377768.1|1134371_1135697_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_047927230.1|1135693_1137751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377771.1|1137728_1138301_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_144420781.1|1138383_1138716_+	DUF1820 family protein	NA	NA	NA	NA	NA
WP_017377773.1|1138780_1139815_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_027242897.1|1139802_1140924_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_107517353.1|1141017_1141965_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_027242896.1|1142157_1143825_+	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	25.3	1.2e-19
WP_027242895.1|1144111_1144963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377782.1|1145371_1147840_+	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_017377783.1|1147853_1148828_+	homoserine kinase	NA	NA	NA	NA	NA
WP_017377784.1|1148814_1150083_+	threonine synthase	NA	NA	NA	NA	NA
WP_027242894.1|1150116_1151865_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_017375591.1|1152044_1152248_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_144420652.1|1152466_1153144_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.8	2.6e-34
WP_017377787.1|1153453_1153681_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
>prophage 13
NZ_CP048052	Piscirickettsia salmonis strain Ps-11091B chromosome, complete genome	3194020	1193868	1254146	3194020	transposase,tRNA	uncultured_Mediterranean_phage(28.57%)	51	NA	NA
WP_051929562.1|1193868_1194573_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_036771332.1|1194823_1195798_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
WP_017376395.1|1196685_1199412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|1199935_1200910_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017376397.1|1201107_1202589_-	MFS transporter	NA	NA	NA	NA	NA
WP_016209947.1|1203048_1203711_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_017376398.1|1203952_1205185_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_017376399.1|1205341_1208113_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.4	6.9e-150
WP_017376400.1|1208181_1208625_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_017376401.1|1208777_1210250_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	30.2	1.8e-43
WP_017376402.1|1210361_1211423_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_027242800.1|1211419_1212454_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_017376405.1|1212456_1213497_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_026063528.1|1213681_1214797_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	49.2	2.2e-94
WP_017376407.1|1214835_1215189_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	46.5	1.1e-07
WP_017376408.1|1215209_1217078_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_017376409.1|1217099_1218044_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.2	2.4e-38
WP_017376410.1|1218277_1218556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209938.1|1218918_1219557_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_017376411.1|1219531_1220956_-	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	33.4	3.9e-40
WP_017376412.1|1221156_1221834_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_027242801.1|1221954_1223229_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	50.9	1.7e-90
WP_017376414.1|1223296_1224052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376415.1|1224103_1225021_+	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_144420654.1|1225445_1226225_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1226277_1226565_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_051929627.1|1226624_1226975_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155046603.1|1227168_1227321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999981.1|1227248_1227722_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	48.0	2.9e-32
WP_048875973.1|1227734_1228370_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036773947.1|1228881_1229757_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_036772615.1|1230543_1230867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376433.1|1231363_1232722_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	26.0	3.9e-37
WP_026063530.1|1232945_1233134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376430.1|1233147_1234281_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_048875975.1|1234481_1238354_+	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_162038658.1|1238615_1239113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|1239502_1240231_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017375910.1|1240633_1241362_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_075275409.1|1241425_1242253_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242802.1|1242434_1242803_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_017376425.1|1242799_1243618_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_017376424.1|1243718_1244534_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_017376423.1|1244817_1246878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420655.1|1246874_1247300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376421.1|1247485_1248979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376420.1|1249111_1249927_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_017376419.1|1250022_1250439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376418.1|1250821_1251361_-	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_144420656.1|1252277_1252439_-	phosphatase	NA	NA	NA	NA	NA
WP_048875923.1|1253150_1254146_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP048052	Piscirickettsia salmonis strain Ps-11091B chromosome, complete genome	3194020	1282885	1298201	3194020	transposase	Acinetobacter_phage(50.0%)	15	NA	NA
WP_048875980.1|1282885_1284289_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378296.1|1285729_1286515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378295.1|1286605_1288255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378294.1|1288399_1289245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1289358_1290762_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_047927801.1|1290758_1291205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157894727.1|1291446_1292097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378290.1|1292124_1293000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275303.1|1293135_1294125_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_053093670.1|1294101_1294782_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.0	1.1e-43
WP_155046602.1|1294895_1295675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875973.1|1295951_1296587_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046582.1|1296583_1296748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1296946_1297921_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017378288.1|1297979_1298201_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP048052	Piscirickettsia salmonis strain Ps-11091B chromosome, complete genome	3194020	1358178	1398583	3194020	tRNA,transposase	Tupanvirus(22.22%)	39	NA	NA
WP_017378228.1|1358178_1359099_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_155048048.1|1359150_1359684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046600.1|1363262_1363406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378223.1|1364015_1364834_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_016211418.1|1364941_1365403_-	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_017378221.1|1365419_1366343_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_027242798.1|1366366_1367416_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_047927040.1|1367553_1368147_+	oligoribonuclease	NA	A0A1B3B0T8	Gordonia_phage	29.6	1.2e-14
WP_017378219.1|1368169_1368640_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_144420785.1|1368749_1370000_+	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	27.4	1.7e-15
WP_016211840.1|1370688_1371153_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_036773427.1|1371585_1373064_+	catalase	NA	A0A2K9L572	Tupanvirus	46.5	3.3e-98
WP_017378213.1|1373180_1373633_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_155046599.1|1373757_1373913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420662.1|1374057_1374261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378212.1|1374451_1374850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875983.1|1375035_1375641_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	49.5	6.3e-48
WP_017375549.1|1375649_1375946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875984.1|1375950_1376487_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046598.1|1376631_1377201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1377280_1378255_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_048875986.1|1378251_1378749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910640.1|1379156_1379573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|1379640_1381044_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275305.1|1381040_1381661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|1381932_1382907_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_036773538.1|1383071_1383695_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017376442.1|1383691_1385632_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	1.8e-72
WP_017376443.1|1385787_1386441_+	glutaredoxin 2	NA	NA	NA	NA	NA
WP_017376444.1|1386609_1387785_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_017376445.1|1388138_1389464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063532.1|1389556_1390345_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_017376447.1|1390446_1391319_+	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_017376448.1|1391504_1392767_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_017376449.1|1392840_1393371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376450.1|1393392_1394898_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	40.4	7.7e-87
WP_017376451.1|1394910_1395576_+|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_017376452.1|1395669_1397430_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_036773947.1|1397707_1398583_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP048052	Piscirickettsia salmonis strain Ps-11091B chromosome, complete genome	3194020	1404249	1509675	3194020	tRNA,protease,transposase	Burkholderia_phage(13.04%)	94	NA	NA
WP_017376460.1|1404249_1406844_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	41.3	2.4e-88
WP_017376461.1|1407150_1407414_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	68.6	4.1e-12
WP_069971651.1|1407786_1408662_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046597.1|1408776_1408953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376465.1|1409497_1411060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772167.1|1411601_1412549_-	sphingomyelin phosphodiesterase	NA	NA	NA	NA	NA
WP_017376467.1|1412768_1414244_-	APC family permease	NA	NA	NA	NA	NA
WP_017376469.1|1414763_1415786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376470.1|1416142_1417510_+	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_026063533.1|1417785_1418040_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_048876132.1|1418088_1419342_+	GTPase HflX	NA	NA	NA	NA	NA
WP_027242811.1|1419361_1420576_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_017376474.1|1420575_1421469_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_017376475.1|1421666_1422965_+	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	34.1	2.4e-65
WP_027242812.1|1423054_1424332_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	33.1	7.5e-51
WP_036772166.1|1424345_1426745_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.3	5.2e-69
WP_017376476.1|1426741_1427500_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_017376477.1|1427676_1428066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162038641.1|1428674_1428818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376231.1|1430188_1430476_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_081078114.1|1430841_1431633_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.4	1.9e-44
WP_017377694.1|1432771_1433500_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_017377465.1|1433518_1434376_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	31.3	5.3e-16
WP_027242813.1|1434381_1435635_-	type III PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_027242814.1|1435668_1437537_-	IucA/IucC family siderophore biosynthesis protein	NA	NA	NA	NA	NA
WP_047927302.1|1437523_1438747_-	MFS transporter	NA	NA	NA	NA	NA
WP_048875988.1|1438746_1440582_-	IucA/IucC family siderophore biosynthesis protein	NA	NA	NA	NA	NA
WP_017377461.1|1440578_1441784_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_017377460.1|1441795_1443985_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_017377459.1|1444553_1445183_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_075275307.1|1445205_1445625_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_036772544.1|1445605_1446022_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_075275308.1|1446021_1446864_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_027242817.1|1446919_1447900_+	iron-siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017377453.1|1447880_1449878_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_027242818.1|1449895_1451071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875989.1|1451352_1452756_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242819.1|1452904_1453267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377447.1|1453438_1453657_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_027242820.1|1454202_1456230_+	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_017377445.1|1456311_1457562_-	MFS transporter	NA	NA	NA	NA	NA
WP_017377444.1|1457861_1458197_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_016211283.1|1458508_1458757_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_017377443.1|1458792_1459302_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_017377442.1|1459301_1460081_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_017377441.1|1460098_1460446_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_017377440.1|1460555_1460831_+	hypothetical protein	NA	A0A1B0Z0G5	Vibrio_phage	50.6	6.6e-13
WP_080963600.1|1460992_1461349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036816484.1|1461747_1462083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875990.1|1462287_1463064_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420664.1|1463020_1463893_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.8e-49
WP_017376231.1|1464177_1464465_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_051929871.1|1464587_1465268_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036773116.1|1466812_1467787_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_051929549.1|1467866_1468244_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_047927093.1|1468342_1469446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856757.1|1471106_1471604_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875992.1|1471748_1472147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420665.1|1472232_1473138_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.5	1.3e-49
WP_047927606.1|1473356_1473677_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	36.6	3.1e-06
WP_144420666.1|1473758_1474535_-	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_027242597.1|1475108_1475942_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_144420786.1|1475971_1476826_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_144420667.1|1477202_1478213_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.5	2.5e-25
WP_017377585.1|1478357_1478615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875994.1|1478728_1479985_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376600.1|1480240_1480420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377584.1|1480913_1481156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377583.1|1481181_1482540_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	37.9	3.1e-71
WP_026063647.1|1482821_1483181_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_017377580.1|1483612_1485247_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.5	1.7e-143
WP_017377579.1|1485253_1486090_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.3	1.7e-51
WP_017377578.1|1486111_1487389_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.9	9.6e-139
WP_017377577.1|1487475_1487793_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_017377576.1|1487815_1488907_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_017377575.1|1489097_1490687_+	APC family permease	NA	NA	NA	NA	NA
WP_017377574.1|1490747_1491521_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.4	6.5e-66
WP_017377573.1|1491691_1492741_+	RNA polymerase sigma factor RpoS	NA	M4SMP8	Cyanophage	30.8	1.7e-29
WP_017377572.1|1493490_1493661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772584.1|1494490_1495267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772586.1|1495512_1495779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875874.1|1495871_1496837_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275315.1|1498047_1498302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420669.1|1498708_1498951_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875996.1|1498963_1499839_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_036816928.1|1500165_1500606_-	universal stress protein	NA	NA	NA	NA	NA
WP_081000007.1|1502189_1502594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999986.1|1502755_1502953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771332.1|1503156_1504131_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
WP_017377185.1|1504479_1505418_+	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_027242821.1|1505481_1507476_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_026063604.1|1507478_1508075_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_017377182.1|1508071_1508410_+	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_036774017.1|1508799_1509675_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP048052	Piscirickettsia salmonis strain Ps-11091B chromosome, complete genome	3194020	1568009	1583868	3194020	transposase	unidentified_phage(25.0%)	14	NA	NA
WP_048876002.1|1568009_1568993_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.0	4.5e-27
WP_087910642.1|1569792_1570946_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	6.8e-59
WP_048876004.1|1571067_1571760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242833.1|1571768_1572956_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.3	5.2e-22
WP_017376484.1|1573105_1573732_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.3	1.2e-33
WP_017376485.1|1573777_1575007_+	hypothetical protein	NA	B2YG43	Musca_hytrovirus	21.9	2.6e-08
WP_144420789.1|1575201_1575648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376487.1|1575839_1577198_+	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_075275317.1|1577863_1578037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876005.1|1578166_1579084_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.4	4.6e-26
WP_053093673.1|1579425_1580085_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420674.1|1580165_1580669_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.7	3.0e-19
WP_017376491.1|1580641_1580929_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1582893_1583868_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 18
NZ_CP048052	Piscirickettsia salmonis strain Ps-11091B chromosome, complete genome	3194020	1598853	1703387	3194020	transposase,integrase,tRNA,protease	Staphylococcus_phage(24.0%)	102	1599921:1599980	1658487:1659027
WP_036771330.1|1598853_1599828_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420675.1|1599903_1600221_-	hypothetical protein	NA	NA	NA	NA	NA
1599921:1599980	attL	ACTTAATGAGCTGCATGGTCGCTAGGGCTTTGTGGTGCTTCATGATTACTGACAAGCGTT	NA	NA	NA	NA
WP_075275321.1|1600224_1600593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243029.1|1601326_1602295_-	threonine/serine dehydratase	NA	NA	NA	NA	NA
WP_027243028.1|1602504_1603917_-	MFS transporter	NA	NA	NA	NA	NA
WP_017375994.1|1604104_1604818_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	1.7e-36
WP_017375995.1|1604838_1605252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375996.1|1605352_1606426_-	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_027243027.1|1606562_1607462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772860.1|1607717_1607969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243025.1|1608017_1608653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772872.1|1608777_1609635_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_053856766.1|1609822_1611226_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_047927520.1|1611401_1611905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377328.1|1611981_1613283_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.3	8.2e-29
WP_027243024.1|1613451_1614552_+	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_027243023.1|1614902_1615145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772851.1|1615138_1615456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162038662.1|1615749_1616905_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.5	2.2e-49
WP_075275277.1|1617116_1617356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774927.1|1617516_1617987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212018.1|1618209_1618509_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_047927838.1|1618505_1618751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420676.1|1619043_1620000_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.5	1.8e-49
WP_017375591.1|1620284_1620488_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_065653736.1|1620618_1621647_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_047927336.1|1622010_1622256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971648.1|1622618_1623593_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	4.7e-29
WP_075275420.1|1625064_1626771_+	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_036773893.1|1626816_1627668_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_027243019.1|1627756_1630327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420677.1|1630846_1631248_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771639.1|1631834_1632809_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017378512.1|1632849_1634178_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_016211143.1|1634441_1635011_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	39.5	7.3e-30
WP_017378513.1|1635026_1635338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378514.1|1635347_1636316_-	ferrochelatase	NA	NA	NA	NA	NA
WP_016211147.1|1636428_1636782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378515.1|1636785_1637850_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_017378516.1|1637850_1639590_-	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	31.2	5.8e-54
WP_017378517.1|1639596_1640019_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_017378518.1|1640002_1640632_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_075275322.1|1640867_1640966_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_027243018.1|1641052_1642870_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_048876007.1|1643017_1643992_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	2.1e-29
WP_155046591.1|1644071_1644215_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_027243017.1|1644388_1645732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420678.1|1646230_1646509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420679.1|1646776_1647733_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	3.6e-50
WP_017375696.1|1648059_1648443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162038663.1|1648458_1649259_-	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_162038664.1|1649185_1649404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774017.1|1649694_1650570_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046590.1|1650571_1650736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046589.1|1650915_1651065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876008.1|1651144_1652119_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	8.1e-29
WP_162038665.1|1652115_1653327_-	ComEC family competence protein	NA	NA	NA	NA	NA
WP_027242578.1|1653434_1653971_+	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_017376784.1|1654007_1654193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376785.1|1654433_1655339_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_144420682.1|1656745_1656907_+	phosphatase	NA	NA	NA	NA	NA
WP_155046588.1|1657441_1657651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243099.1|1658766_1660080_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	7.7e-51
1658487:1659027	attR	AACGCTTGTCAGTAATCATGAAGCACCACAAAGCCCTAGCGACCATGCAGCTCATTAAGTTCTAACAGGAGCAGTCCGTCTATAATCAGGTTTTAAGCCTATTTTTAGCTGCTTTATCGATTATTGGCACCTGCACTTCGAATACTGGGAGTAATTTTTAGTCGAATTATCACAATTTCACAATATGGCTGATTTTCAGAATATTGTATTACCTAAGCGCAGATTTAGTTATTTAACTATTAAAATGAAAATCGGGATAACGCACTGTAGCCCGCTTTCTTTATTTAGACCGACACAGTTGAGGCCTTCGACGTTTTCGGCCTGGCTGCTGCTGACTATTACGATGATCTTCCCTGCGTTTTCCTTGCATGCTGCCTCCCAAGCGCTGCCCTCCCTGATGTTCGATTTCTGGTTTTTTAGGCGCTTTTGATCTGCGATCTAAACTAGAAACAGGTACATCATGCACTGGCTCAAATCCATCAACGAGTTTACGGGCTAATAACTGTCCGATTAAATGTTCAATATCAGATAATTGTTTGAT	NA	NA	NA	NA
WP_027243098.1|1660315_1661461_+	carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_155049745.1|1661535_1661712_+	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
WP_027243096.1|1661747_1662380_-	MarC family protein	NA	NA	NA	NA	NA
WP_144420683.1|1662556_1663213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243095.1|1663201_1665487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376797.1|1665760_1666120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376798.1|1666401_1667037_+	LysE family translocator	NA	NA	NA	NA	NA
WP_017376801.1|1668223_1669048_+	hypothetical protein	NA	X2KR27	Campylobacter_phage	28.3	6.2e-06
WP_144420791.1|1669103_1670315_-	protein kinase	NA	NA	NA	NA	NA
WP_027243094.1|1671098_1671806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146619422.1|1671868_1672048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243093.1|1672109_1672427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376807.1|1672538_1673282_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_017376808.1|1673295_1674339_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_017376809.1|1674477_1676247_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	40.7	4.9e-08
WP_048876146.1|1676471_1677605_-	MFS transporter	NA	S4TR35	Salmonella_phage	23.0	2.6e-15
WP_026063564.1|1678454_1681274_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.3	5.2e-312
WP_017376814.1|1681648_1682374_+	single-stranded DNA-binding protein	NA	A0A2I7QWB5	Vibrio_phage	65.6	6.2e-42
WP_157894730.1|1684968_1685493_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.6	2.5e-37
WP_051929542.1|1685733_1686066_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1686125_1686413_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_075275277.1|1686955_1687195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876009.1|1687065_1688091_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1688218_1689193_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_027243041.1|1689387_1690341_-	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_017376824.1|1690510_1690669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420792.1|1690940_1691465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376827.1|1691919_1692747_+	DsbA family protein	NA	NA	NA	NA	NA
WP_144420685.1|1692815_1693001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376828.1|1693201_1693660_+	amino acid permease	NA	NA	NA	NA	NA
WP_017376829.1|1693800_1694028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876010.1|1694192_1695578_-	protein kinase family protein	NA	A0A1M7XTW9	Cedratvirus	27.7	1.4e-05
WP_017376830.1|1695873_1696188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243043.1|1696296_1697922_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	25.3	3.9e-28
WP_017376832.1|1698334_1699324_-	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_016212182.1|1699645_1699831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376833.1|1700220_1702176_+	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	39.7	9.2e-16
WP_080963614.1|1702247_1702370_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1702412_1703387_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 19
NZ_CP048052	Piscirickettsia salmonis strain Ps-11091B chromosome, complete genome	3194020	1723151	1782065	3194020	transposase,tRNA	Acinetobacter_phage(25.0%)	53	NA	NA
WP_048876011.1|1723151_1724201_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772296.1|1724400_1724778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376231.1|1725967_1726255_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_036773200.1|1726314_1726611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420686.1|1726755_1727412_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.8	4.7e-41
WP_017377324.1|1727651_1728032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|1728683_1730087_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_087910660.1|1730083_1730365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876013.1|1730759_1731224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927610.1|1731404_1731998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876007.1|1732183_1733158_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	2.1e-29
WP_051929845.1|1733561_1734386_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_027243222.1|1734460_1735609_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_027243221.1|1735624_1737253_-	cytochrome d terminal oxidase subunit I	NA	NA	NA	NA	NA
WP_017375698.1|1737596_1738790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162034387.1|1740302_1740461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063486.1|1744904_1745405_+	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_155046587.1|1745818_1745959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772592.1|1746081_1747542_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	33.4	2.3e-56
WP_026063485.1|1747619_1748102_-	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_017375881.1|1748260_1749526_+	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	42.8	1.2e-48
WP_027243180.1|1749610_1750870_+	phosphoesterase	NA	NA	NA	NA	NA
WP_017375878.1|1750941_1751214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876014.1|1751551_1751887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155069586.1|1752112_1752496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876016.1|1752766_1753177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875984.1|1753321_1753858_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420687.1|1753868_1754054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376772.1|1754489_1755461_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_027243181.1|1755442_1756414_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_144420793.1|1756527_1757301_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_146619432.1|1757709_1757901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155082172.1|1758147_1758675_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_162038666.1|1758727_1759884_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	4.4e-50
WP_075275326.1|1759936_1760788_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_051929549.1|1761003_1761381_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_048876011.1|1761940_1762990_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376108.1|1763303_1764689_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	29.7	3.4e-49
WP_017376107.1|1764695_1766234_-|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L594	Tupanvirus	22.4	2.6e-05
WP_017376106.1|1766276_1767002_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_017376105.1|1767172_1768405_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	27.2	8.9e-33
WP_017376104.1|1768604_1769426_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_017376103.1|1769475_1770285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876018.1|1770440_1774307_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.5	1.6e-51
WP_017376100.1|1774472_1775348_+	ParA family protein	NA	NA	NA	NA	NA
WP_075275424.1|1775412_1775691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420689.1|1775835_1776411_+	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_017376099.1|1776459_1776618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929528.1|1777366_1778083_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_026063521.1|1779211_1779628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420690.1|1780542_1781472_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.9	2.2e-60
WP_144420691.1|1781443_1781602_+	phosphatase	NA	NA	NA	NA	NA
WP_017376276.1|1781750_1782065_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.9e-06
>prophage 20
NZ_CP048052	Piscirickettsia salmonis strain Ps-11091B chromosome, complete genome	3194020	1785979	1846115	3194020	transposase,tRNA,plate	Acinetobacter_phage(50.0%)	47	NA	NA
WP_048876152.1|1785979_1786924_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420693.1|1786911_1787055_+	phosphatase	NA	NA	NA	NA	NA
WP_036771585.1|1787416_1787749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275332.1|1790641_1791643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157894731.1|1791799_1792180_+	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_081329473.1|1792552_1792972_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420694.1|1793832_1794069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376672.1|1794362_1797419_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_027242910.1|1797500_1798955_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_027242911.1|1799389_1800406_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_017376669.1|1800514_1800913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376668.1|1800952_1802776_+	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_027242912.1|1802772_1806075_+	DUF490 domain-containing protein	NA	NA	NA	NA	NA
WP_036772026.1|1806179_1807055_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376663.1|1807092_1808007_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_027242913.1|1808071_1808701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376662.1|1808745_1809180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376661.1|1809160_1809901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376660.1|1809914_1811312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242914.1|1811314_1814263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772028.1|1814262_1815984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242917.1|1815998_1816403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376655.1|1816403_1819283_-	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
WP_075275426.1|1819285_1820008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242919.1|1820369_1822262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376650.1|1822293_1824834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157894732.1|1824865_1825957_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_027242921.1|1826034_1826658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242922.1|1826672_1828172_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_036772036.1|1828188_1828695_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_075275427.1|1829950_1830022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275333.1|1830204_1830387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971656.1|1831588_1831861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420695.1|1831876_1833310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420696.1|1833454_1834720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242924.1|1835005_1836757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157894733.1|1836769_1837861_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_036774095.1|1837936_1838215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162038649.1|1838272_1839429_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	4.4e-50
WP_036771639.1|1840368_1841343_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_081000010.1|1841401_1841665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420643.1|1841674_1842988_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046586.1|1843192_1843366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420794.1|1843433_1843577_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_027243218.1|1843595_1843793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772025.1|1843810_1844317_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_036772663.1|1845239_1846115_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 21
NZ_CP048052	Piscirickettsia salmonis strain Ps-11091B chromosome, complete genome	3194020	1877132	1989656	3194020	transposase,tRNA	Acinetobacter_phage(23.08%)	97	NA	NA
WP_087910645.1|1877132_1878286_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_048876023.1|1878376_1879480_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.0e-25
WP_017375861.1|1879819_1880320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211829.1|1881016_1881370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375862.1|1881670_1883398_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_047927270.1|1883501_1884227_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	38.7	6.4e-31
WP_017375864.1|1884219_1885458_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_017375865.1|1885595_1886633_+	agmatine deiminase family protein	NA	NA	NA	NA	NA
WP_017375866.1|1886687_1887590_+	carbon-nitrogen hydrolase	NA	M1HCD5	Acanthocystis_turfacea_Chlorella_virus	40.7	3.2e-56
WP_017375867.1|1887699_1888953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242968.1|1889010_1892502_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_144420795.1|1892618_1893296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375871.1|1893423_1893972_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_017375873.1|1895842_1896004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063558.1|1897195_1897762_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	77.8	2.8e-74
WP_087910646.1|1897764_1898889_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_026063557.1|1898973_1899792_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_027242970.1|1899922_1901902_+	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_017376714.1|1901961_1902615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999995.1|1903299_1904670_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376707.1|1906385_1907033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376706.1|1907070_1907463_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017376705.1|1907715_1908462_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027243123.1|1909060_1909966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1910081_1911056_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376701.1|1911201_1911930_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_162038667.1|1912064_1912631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243124.1|1912653_1915494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376696.1|1917536_1918487_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_017376695.1|1918569_1919352_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_027243125.1|1919450_1919744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376693.1|1920266_1920911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376692.1|1920944_1921589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376691.1|1921637_1922492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376690.1|1922629_1923142_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_107517381.1|1923209_1923404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376688.1|1923617_1923971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1925179_1926154_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376683.1|1926901_1927603_-	cyclase family protein	NA	NA	NA	NA	NA
WP_027243126.1|1927677_1928307_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_026063554.1|1928474_1929731_+	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_017376681.1|1930005_1930668_+	HAD-IB family phosphatase	NA	NA	NA	NA	NA
WP_017376680.1|1930657_1931890_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.3	8.2e-95
WP_027243127.1|1932021_1932639_+	VOC family protein	NA	NA	NA	NA	NA
WP_036773258.1|1932716_1933223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162038649.1|1933233_1934390_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	4.4e-50
WP_157894734.1|1934743_1934986_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420796.1|1935239_1936358_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036774270.1|1936502_1936838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929523.1|1936848_1937262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375562.1|1938470_1938635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|1938671_1939547_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_051929862.1|1939733_1940246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162038642.1|1942381_1942621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375899.1|1942677_1943877_-	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_017375900.1|1944130_1944412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927375.1|1944467_1946459_-	TRAP transporter permease	NA	NA	NA	NA	NA
WP_026063491.1|1946532_1947510_-	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_027242984.1|1947645_1948428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774087.1|1948584_1948908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876030.1|1948975_1950079_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036772169.1|1950148_1951024_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_047927184.1|1951020_1951365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275338.1|1951386_1951836_+	murein L,D-transpeptidase catalytic domain family protein	NA	NA	NA	NA	NA
WP_027242985.1|1951849_1953241_-	flagellar hook-associated protein 3	NA	NA	NA	NA	NA
WP_027242986.1|1953282_1956270_-	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_027242987.1|1956339_1957173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910648.1|1957227_1958415_-	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_027242989.1|1958402_1959107_-	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_027242990.1|1959152_1959938_-	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_027242991.1|1959965_1960703_-	flagellar basal body rod protein FlgF	NA	NA	NA	NA	NA
WP_016210285.1|1960807_1963003_-	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_027242992.1|1963077_1963761_-	flagellar hook assembly protein FlgD	NA	NA	NA	NA	NA
WP_027242993.1|1963771_1964203_-	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_027242994.1|1964248_1964647_-	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_027242995.1|1965023_1965731_+	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_027242996.1|1965795_1966092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146619421.1|1966130_1966610_+	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_027242998.1|1966663_1967185_-	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	53.4	3.8e-25
WP_027242999.1|1967266_1968361_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_048876031.1|1969327_1970731_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375890.1|1970900_1971464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375891.1|1971599_1973075_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_017375892.1|1973081_1973288_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_017375893.1|1973345_1974416_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_162038668.1|1974613_1974991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375757.1|1977232_1978792_+	APC family permease	NA	NA	NA	NA	NA
WP_144420701.1|1979388_1979745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243002.1|1980584_1981244_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_027243003.1|1981339_1982701_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_162038649.1|1982842_1983999_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	4.4e-50
WP_017375762.1|1984121_1985462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963648.1|1986112_1986274_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036815628.1|1986373_1987201_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_157894735.1|1987554_1988394_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.3	1.3e-19
WP_036771330.1|1988473_1989448_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_047927692.1|1989467_1989656_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_CP048052	Piscirickettsia salmonis strain Ps-11091B chromosome, complete genome	3194020	2007158	2074734	3194020	transposase	Acinetobacter_phage(22.22%)	49	NA	NA
WP_062365727.1|2007158_2007851_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375561.1|2007847_2007991_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_162038649.1|2009334_2010491_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	4.4e-50
WP_017375766.1|2010868_2012899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375767.1|2012965_2013991_-	FUSC family protein	NA	NA	NA	NA	NA
WP_036771312.1|2015458_2016454_+	glycosyl hydrolase family 17	NA	NA	NA	NA	NA
WP_048876036.1|2016751_2017390_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	2.1e-09
WP_017375978.1|2018103_2019291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375977.1|2019456_2020410_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036771316.1|2020432_2022451_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_017375975.1|2022539_2022863_-	YqcC family protein	NA	NA	NA	NA	NA
WP_155046584.1|2023111_2023288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053093677.1|2023515_2024235_+|transposase	IS982-like element ISPsa1 family transposase	transposase	NA	NA	NA	NA
WP_016209463.1|2024850_2025234_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_048876037.1|2025878_2026352_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_027242774.1|2026457_2027828_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_048876038.1|2027943_2028675_+	hypothetical protein	NA	M1IDP9	Pelagibacter_phage	35.8	9.1e-09
WP_027242775.1|2028699_2029797_-	alanine racemase	NA	NA	NA	NA	NA
WP_048876039.1|2029832_2031251_-	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	62.1	2.0e-153
WP_027242777.1|2031460_2031913_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_016209480.1|2031924_2032152_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_027242778.1|2032201_2032528_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_027242779.1|2032731_2033421_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_036771340.1|2033569_2034058_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_036771342.1|2034098_2035199_-	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_027242782.1|2035244_2036327_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	42.4	4.5e-73
WP_080963651.1|2036319_2036880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771345.1|2036870_2038175_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_144420704.1|2038228_2039257_-	chorismate mutase	NA	NA	NA	NA	NA
WP_027242785.1|2039275_2040292_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_146619549.1|2040723_2043891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929877.1|2044242_2044866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378208.1|2045648_2047199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378207.1|2047493_2048249_+	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_036771639.1|2048957_2049932_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017378201.1|2052840_2053512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875961.1|2054590_2055994_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378195.1|2056688_2056937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242788.1|2057581_2060983_-	UvrD-helicase domain-containing protein	NA	S5M596	Bacillus_phage	23.3	4.5e-10
WP_017378193.1|2060979_2063673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378192.1|2063976_2065476_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	28.1	2.2e-33
WP_027242789.1|2066142_2066964_-	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
WP_146619408.1|2067035_2067521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|2067669_2069073_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378188.1|2069069_2070140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242790.1|2070385_2072560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378184.1|2072582_2073263_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_036774233.1|2073291_2073525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162038666.1|2073577_2074734_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	4.4e-50
>prophage 23
NZ_CP048052	Piscirickettsia salmonis strain Ps-11091B chromosome, complete genome	3194020	2084840	2135918	3194020	transposase	Acinetobacter_phage(27.27%)	48	NA	NA
WP_075275340.1|2084840_2085449_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375657.1|2085592_2085775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875904.1|2085979_2086855_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_051929548.1|2087095_2087770_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999996.1|2087798_2088287_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	30.9	7.4e-15
WP_080999997.1|2089332_2089767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|2089972_2091376_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_162038669.1|2091623_2091986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162038670.1|2091982_2093134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876046.1|2094094_2094388_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.4	4.1e-05
WP_144420706.1|2094345_2094924_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.8	1.1e-28
WP_048876047.1|2095009_2095885_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378015.1|2095877_2096234_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	52.0	3.5e-22
WP_017378014.1|2096242_2096638_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_082300708.1|2097962_2098523_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876048.1|2099645_2101535_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_027243106.1|2101569_2102775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420707.1|2102777_2104076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243104.1|2104056_2105280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243103.1|2105329_2106130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155048038.1|2106126_2106489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243102.1|2106521_2106830_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_017377694.1|2107223_2107952_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_017377851.1|2107992_2108637_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_017377852.1|2108649_2109117_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_036771330.1|2109171_2110146_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017377854.1|2110175_2110775_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_017377855.1|2110771_2111233_-	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_017377856.1|2111276_2112212_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_017377857.1|2112239_2113235_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_017377858.1|2113458_2114421_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377694.1|2115848_2116577_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_080963626.1|2116627_2118262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377862.1|2118532_2119720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377863.1|2120321_2120759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377865.1|2123292_2123565_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_036772457.1|2123640_2123949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772454.1|2126424_2126742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2126898_2127873_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_048876051.1|2127869_2128226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876052.1|2128339_2129086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|2129054_2129783_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017377223.1|2130527_2130815_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_155046582.1|2130874_2131039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876053.1|2131035_2132439_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_053093670.1|2132552_2133233_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.0	1.1e-43
WP_155046684.1|2133518_2134220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876055.1|2135012_2135918_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP048052	Piscirickettsia salmonis strain Ps-11091B chromosome, complete genome	3194020	2151081	2199010	3194020	transposase,tRNA,protease	Bacillus_thuringiensis_phage(14.29%)	42	NA	NA
WP_036771957.1|2151081_2152053_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_157894741.1|2154276_2155407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162038643.1|2155375_2155519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377033.1|2155746_2156058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420710.1|2156535_2156841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242870.1|2157162_2157693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377031.1|2158139_2159069_-	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	30.6	2.2e-31
WP_144420711.1|2159225_2159651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375625.1|2159767_2159995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162038671.1|2160148_2161102_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	1.8e-28
WP_080999998.1|2161388_2161658_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420803.1|2161802_2162759_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377028.1|2162919_2163825_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_027242871.1|2164141_2164903_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211971.1|2165104_2165716_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_051929560.1|2165736_2166936_-	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	33.2	2.7e-42
WP_017377024.1|2167030_2167171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377023.1|2167183_2167588_-	SufE family protein	NA	NA	NA	NA	NA
WP_017377022.1|2167818_2168388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377021.1|2168454_2169495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162038649.1|2169521_2170678_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	4.4e-50
WP_027242872.1|2170799_2171657_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_144420712.1|2171653_2172415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242873.1|2172499_2175229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875904.1|2175362_2176238_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_065653747.1|2176502_2177843_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_016209885.1|2177905_2178619_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_027242875.1|2178787_2179279_+	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_017377014.1|2179418_2179910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242876.1|2180112_2181003_+	Rossmann-like and DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_026063591.1|2181387_2181972_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_027242877.1|2182052_2182991_-	signal peptide peptidase SppA	NA	A0A2I6UGK8	Salinibacter_virus	30.1	4.9e-15
WP_036771855.1|2183042_2184137_-	fusaric acid resistance family protein	NA	NA	NA	NA	NA
WP_047927528.1|2184261_2185584_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	39.9	7.3e-65
WP_017377008.1|2185631_2190518_-	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_017377007.1|2190612_2190915_-	DUF2835 family protein	NA	NA	NA	NA	NA
WP_027242879.1|2191025_2192948_+	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_027242880.1|2192969_2194265_+	YeaH/YhbH family protein	NA	A0A219UQP6	Bacillus_phage	32.8	1.2e-06
WP_017377006.1|2194261_2195872_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_052106204.1|2195978_2196872_-	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
WP_017377003.1|2196981_2197605_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_017377001.1|2198311_2199010_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
>prophage 25
NZ_CP048052	Piscirickettsia salmonis strain Ps-11091B chromosome, complete genome	3194020	2211708	2264481	3194020	transposase	Staphylococcus_phage(41.67%)	43	NA	NA
WP_162038666.1|2211708_2212865_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	4.4e-50
WP_017376987.1|2213635_2214319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774751.1|2214566_2215490_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_047927028.1|2215503_2216427_+	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_027243112.1|2216374_2217031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243113.1|2217333_2218161_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_017376518.1|2218311_2218683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927029.1|2218909_2220400_+	nuclease	NA	NA	NA	NA	NA
WP_017376516.1|2220467_2221805_-	N-succinylarginine dihydrolase	NA	NA	NA	NA	NA
WP_017376515.1|2221947_2223414_-	succinylglutamate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_017376514.1|2223410_2224460_-	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_027243115.1|2224583_2226692_-	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_016210305.1|2226854_2227259_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016210308.1|2227320_2228046_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_017376511.1|2228131_2229025_+	YicC family protein	NA	NA	NA	NA	NA
WP_017376510.1|2229065_2229686_+	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	34.5	1.4e-18
WP_016210310.1|2229746_2229953_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_017376509.1|2229974_2232119_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.1	1.0e-12
WP_017376506.1|2234314_2235238_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	40.4	4.3e-24
WP_017376505.1|2235304_2236588_+	MFS transporter	NA	NA	NA	NA	NA
WP_036771330.1|2236828_2237803_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155046579.1|2238118_2238280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|2238276_2239680_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377823.1|2239793_2240561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999971.1|2240919_2242323_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080963604.1|2243143_2243344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377826.1|2243584_2245030_+	MFS transporter	NA	NA	NA	NA	NA
WP_036772169.1|2246225_2247101_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027243174.1|2248552_2248834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927196.1|2249391_2250411_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_017376520.1|2250397_2250820_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_017376521.1|2250821_2251295_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	43.4	2.4e-26
WP_017376522.1|2251420_2252077_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	6.8e-40
WP_017376523.1|2252073_2252748_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	6.0e-31
WP_017376524.1|2252753_2253902_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.8	4.7e-44
WP_017376525.1|2253898_2254360_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_017376526.1|2254435_2255686_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.4	2.4e-102
WP_017376527.1|2255812_2257492_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.6	3.0e-39
WP_027243172.1|2257603_2258485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772261.1|2259614_2260208_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017375618.1|2262024_2262309_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420804.1|2262858_2263134_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|2263506_2264481_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 26
NZ_CP048052	Piscirickettsia salmonis strain Ps-11091B chromosome, complete genome	3194020	2336052	2382759	3194020	transposase,tRNA	Synechococcus_phage(20.0%)	41	NA	NA
WP_048875859.1|2336052_2336847_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_036773621.1|2337136_2338060_-	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_017377984.1|2338327_2338621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377983.1|2339823_2340747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377982.1|2340882_2341725_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_017377981.1|2341812_2342463_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	34.6	2.7e-20
WP_026063695.1|2342476_2343535_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SR00	Cyanophage	45.3	3.0e-69
WP_036773623.1|2343639_2344725_+	DUF2066 domain-containing protein	NA	NA	NA	NA	NA
WP_162038674.1|2344751_2345861_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_017377976.1|2346165_2346483_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_017377975.1|2346479_2346839_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_017377974.1|2346941_2349674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052106250.1|2351163_2351688_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_144420807.1|2352087_2352306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420716.1|2352450_2353659_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_065653755.1|2354086_2355544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375695.1|2356378_2356654_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036773050.1|2359357_2359537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063690.1|2359533_2359905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420717.1|2359915_2360998_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420718.1|2360994_2361216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275437.1|2362201_2362420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212534.1|2362910_2363177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420719.1|2363435_2363756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243154.1|2365141_2366392_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_017377905.1|2366380_2367262_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_017377906.1|2367254_2368340_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	4.3e-07
WP_017377907.1|2368336_2369596_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_017377908.1|2369764_2370424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065653730.1|2370594_2371257_+	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_026063691.1|2371603_2372551_+	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.3	3.4e-40
WP_017377911.1|2372647_2373274_+	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_017377912.1|2373279_2373861_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_017377913.1|2373932_2375024_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_017377914.1|2375113_2375827_+	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_027243155.1|2375920_2376745_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_144420808.1|2376978_2377656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377920.1|2379333_2379591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|2379991_2380966_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_048876067.1|2381140_2381785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046574.1|2381964_2382759_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 27
NZ_CP048052	Piscirickettsia salmonis strain Ps-11091B chromosome, complete genome	3194020	2388454	2424733	3194020	transposase,protease	Acinetobacter_phage(25.0%)	34	NA	NA
WP_087910651.1|2388454_2388631_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	46.2	5.5e-05
WP_053856762.1|2388926_2389361_-	hypothetical protein	NA	A0A0P0IY73	Acinetobacter_phage	38.0	7.7e-16
WP_017377929.1|2389554_2391024_-	glycine dehydrogenase subunit 2	NA	M4QFZ1	Prochlorococcus_phage	41.7	2.7e-84
WP_027243054.1|2391017_2392394_-	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	34.6	4.2e-47
WP_017377930.1|2392406_2392799_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_017377931.1|2392795_2393899_-	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_144420809.1|2394077_2395370_-	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_017377933.1|2395380_2396328_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.6	3.5e-37
WP_027243055.1|2396339_2397152_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_087910662.1|2397154_2397934_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_017377934.1|2397948_2399007_-	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_017377935.1|2399003_2400014_-	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_016209904.1|2400020_2400218_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_048876070.1|2400278_2403185_-	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_017377937.1|2403226_2404078_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_144420810.1|2404160_2404706_-	chorismate lyase	NA	NA	NA	NA	NA
WP_027243057.1|2404803_2405664_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_027243058.1|2405755_2406172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377942.1|2406253_2406760_+|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_027243059.1|2406805_2409757_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_017377945.1|2409778_2410111_+	GIY-YIG nuclease family protein	NA	D7F5V9	Apocheima_cinerarium_nucleopolyhedrovirus	34.2	4.7e-05
WP_047927125.1|2410228_2410738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046571.1|2411271_2411427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774650.1|2412501_2413668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377687.1|2413812_2414565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2414920_2415895_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_016209908.1|2416027_2416738_+	response regulator	NA	W8CYM9	Bacillus_phage	34.8	2.2e-31
WP_017377690.1|2416734_2417769_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	34.2	1.3e-32
WP_017377691.1|2417872_2418214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876071.1|2418724_2419885_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.0	3.8e-25
WP_069971647.1|2419853_2420450_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046570.1|2421418_2421589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2421585_2422560_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_087910645.1|2423579_2424733_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
>prophage 28
NZ_CP048052	Piscirickettsia salmonis strain Ps-11091B chromosome, complete genome	3194020	2469862	2535469	3194020	transposase,tRNA,plate	Staphylococcus_phage(18.18%)	58	NA	NA
WP_027242858.1|2469862_2471170_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_027242859.1|2471174_2471885_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_162038675.1|2472337_2475067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242861.1|2475132_2476269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376336.1|2477131_2477989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376335.1|2478130_2478931_-	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_017376334.1|2479029_2479605_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	50.0	3.2e-57
WP_027242862.1|2479687_2480359_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_027242863.1|2480404_2481304_+	DUF3530 family protein	NA	NA	NA	NA	NA
WP_017376331.1|2481338_2481722_-	response regulator	NA	NA	NA	NA	NA
WP_017376330.1|2481871_2482636_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_017376329.1|2482626_2483337_-	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_017376328.1|2483333_2484359_-	phosphotransferase	NA	NA	NA	NA	NA
WP_048876074.1|2484489_2486994_+	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_017376325.1|2487000_2488269_+	peptidyl-prolyl cis-trans isomerase SurA	NA	NA	NA	NA	NA
WP_017376324.1|2488270_2489254_+	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_017376323.1|2489266_2490088_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_017376322.1|2490132_2490525_+	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_017376321.1|2490599_2491406_+	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	NA	NA	NA	NA
WP_036774104.1|2491593_2492022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2492080_2493055_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017375660.1|2493078_2493516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|2493550_2494954_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376011.1|2495534_2495696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376015.1|2496916_2497288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242569.1|2497395_2498946_-	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_017376017.1|2498978_2499818_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_017376018.1|2499814_2500330_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_017376019.1|2500333_2501326_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.1	9.3e-49
WP_017376020.1|2501704_2503075_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_027242570.1|2503283_2504423_+	hypothetical protein	NA	A0A0F6YPT7	Sinorhizobium_phage	41.7	9.3e-61
WP_075275355.1|2504636_2505611_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	4.3e-30
WP_036816881.1|2505634_2505853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376024.1|2505930_2506179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162034387.1|2507037_2507196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772149.1|2511832_2512513_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017376634.1|2512577_2513864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376633.1|2514465_2514735_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_144420813.1|2514918_2515890_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.3	3.0e-15
WP_017376631.1|2515957_2516932_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.3	7.3e-14
WP_017376630.1|2517029_2518106_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_144420721.1|2518186_2519179_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_036772145.1|2519183_2520986_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_027243119.1|2521003_2522305_-	aspartate kinase	NA	NA	NA	NA	NA
WP_157894744.1|2522320_2523553_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_017376625.1|2523736_2524129_+	RidA family protein	NA	NA	NA	NA	NA
WP_017376624.1|2524235_2525321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376623.1|2525536_2526553_-	bifunctional UDP-4-keto-pentose/UDP-xylose synthase	NA	D5GW02	Campylobacter_virus	28.7	1.9e-12
WP_017376622.1|2526555_2527563_-	glycosyltransferase	NA	B9UDL7	Salmonella_phage	34.4	2.2e-37
WP_026063550.1|2527566_2528721_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L0G1	Tupanvirus	33.0	3.9e-38
WP_016209558.1|2528735_2529098_-	small Multidrug Resistance family protein	NA	NA	NA	NA	NA
WP_027243117.1|2529094_2530810_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_026063546.1|2530909_2531584_+|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_017376619.1|2531612_2532017_+	RidA family protein	NA	NA	NA	NA	NA
WP_027243116.1|2532041_2533001_-	response regulator	NA	NA	NA	NA	NA
WP_017376616.1|2533133_2533916_-	MFS transporter	NA	NA	NA	NA	NA
WP_075275357.1|2534017_2534977_+|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	34.3	1.2e-13
WP_017376613.1|2535121_2535469_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 29
NZ_CP048052	Piscirickettsia salmonis strain Ps-11091B chromosome, complete genome	3194020	2539470	2603249	3194020	transposase	Planktothrix_phage(10.0%)	53	NA	NA
WP_144420814.1|2539470_2540388_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875883.1|2540532_2541069_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_051929685.1|2541328_2542231_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_017376607.1|2543220_2544210_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G9BWD6	Planktothrix_phage	32.4	4.5e-19
WP_017376606.1|2544378_2544717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376605.1|2544713_2545289_+	ribonuclease HI	NA	M4QMN0	Micromonas_pusilla_virus	55.1	1.1e-33
WP_017376604.1|2545337_2545553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376603.1|2545739_2546579_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	1.4e-45
WP_017376601.1|2550275_2551184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375685.1|2551314_2551779_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_053856764.1|2552079_2553006_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036772137.1|2553324_2553885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377036.1|2554354_2555674_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_017377037.1|2555741_2556608_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	6.3e-25
WP_036772169.1|2556600_2557476_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377039.1|2557534_2557753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377041.1|2559153_2559483_-	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_026063593.1|2559717_2560422_+	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_017377043.1|2560402_2562631_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.8	1.7e-82
WP_017377044.1|2562902_2563916_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_017377045.1|2564024_2564246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377046.1|2564250_2565888_-	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	37.8	3.4e-88
WP_017377047.1|2566026_2566560_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_017377048.1|2566680_2567799_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_162038676.1|2567857_2569114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772661.1|2569100_2570237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377052.1|2570467_2570893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242609.1|2574222_2574576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|2574610_2575486_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_051929903.1|2575642_2576047_-	heavy metal-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_051929897.1|2576194_2577370_-	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_027242610.1|2577629_2578133_-	peptide deformylase	NA	A0A1D8KUY1	Synechococcus_phage	33.1	2.1e-09
WP_047927710.1|2578172_2579675_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.0	8.6e-46
WP_017377060.1|2579880_2580834_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	27.9	2.9e-31
WP_027242611.1|2580814_2581906_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_027242612.1|2582208_2582451_-	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_155046568.1|2583351_2583510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377064.1|2583518_2584094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420722.1|2584210_2584393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377065.1|2584968_2585241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377066.1|2585393_2585648_-	DUF493 domain-containing protein	NA	NA	NA	NA	NA
WP_027242613.1|2585762_2587166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377069.1|2587250_2587757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377070.1|2588320_2590141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242614.1|2590207_2590738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774569.1|2592284_2593001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774567.1|2593043_2593481_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017377073.1|2593518_2594898_-	MFS transporter	NA	NA	NA	NA	NA
WP_017377074.1|2595292_2597287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377075.1|2597749_2598562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420815.1|2598745_2600209_-	nuclease	NA	NA	NA	NA	NA
WP_017377077.1|2600568_2601948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772726.1|2602700_2603249_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.3	1.1e-06
>prophage 30
NZ_CP048052	Piscirickettsia salmonis strain Ps-11091B chromosome, complete genome	3194020	2635037	2678382	3194020	transposase	Staphylococcus_phage(22.22%)	42	NA	NA
WP_036773116.1|2635037_2636012_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_069971661.1|2636008_2636446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875878.1|2636620_2638024_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377105.1|2638034_2638310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377106.1|2638587_2639058_-	Hsp20 family protein	NA	A0A1B1IW69	uncultured_Mediterranean_phage	36.6	6.0e-22
WP_017377107.1|2639360_2640731_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.1	1.5e-110
WP_075275363.1|2641060_2641528_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_017377110.1|2641540_2642551_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_053856766.1|2642752_2644156_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242632.1|2644582_2645371_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_047927448.1|2645357_2646386_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.0	1.4e-15
WP_017377113.1|2646363_2646768_-	glycine-rich domain-containing protein-like	NA	NA	NA	NA	NA
WP_017377115.1|2646995_2648963_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_017377116.1|2649158_2649650_+	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_026063598.1|2649684_2650527_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_017377118.1|2650572_2651025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377119.1|2651314_2651947_+	LysE family translocator	NA	NA	NA	NA	NA
WP_017377120.1|2651947_2653198_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.4	2.7e-93
WP_027242633.1|2653231_2654329_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	34.9	3.5e-49
WP_144420723.1|2654658_2656044_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036774495.1|2656083_2656341_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_053856767.1|2658756_2660160_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375801.1|2660156_2661197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927106.1|2661589_2661985_+	YchJ family protein	NA	NA	NA	NA	NA
WP_144420816.1|2661981_2662770_-	DUF45 domain-containing protein	NA	NA	NA	NA	NA
WP_017375804.1|2662955_2663681_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_017375805.1|2663925_2665113_+	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_017375806.1|2665405_2665948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375807.1|2665944_2666631_-	acireductone synthase	NA	NA	NA	NA	NA
WP_017375808.1|2666634_2667246_-	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_017375809.1|2667292_2668312_-	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_017375810.1|2668414_2669209_-	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	69.0	1.1e-103
WP_017375811.1|2669222_2670023_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_017375812.1|2670101_2671151_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_026063478.1|2671326_2672607_+	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	34.7	4.6e-24
WP_027242634.1|2672652_2673330_+	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_017375815.1|2673415_2673697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275366.1|2673788_2674643_-	MFS transporter	NA	NA	NA	NA	NA
WP_157894745.1|2674582_2674948_-	MFS transporter	NA	S4TR35	Salmonella_phage	33.3	3.8e-08
WP_027242636.1|2675508_2676450_+	DMT family transporter	NA	NA	NA	NA	NA
WP_017375821.1|2677168_2677390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875923.1|2677386_2678382_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 31
NZ_CP048052	Piscirickettsia salmonis strain Ps-11091B chromosome, complete genome	3194020	2686725	2742662	3194020	transposase	Staphylococcus_phage(100.0%)	49	NA	NA
WP_048875873.1|2686725_2688129_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375570.1|2688125_2688263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875872.1|2688435_2689719_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875871.1|2689923_2690127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376862.1|2690301_2691306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376863.1|2691663_2692899_-	MFS transporter	NA	NA	NA	NA	NA
WP_017376864.1|2693065_2694016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875857.1|2694523_2695498_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
WP_087910670.1|2697313_2697499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910671.1|2697592_2698057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|2698444_2699419_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_032126138.1|2699846_2700110_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_036771639.1|2700551_2701526_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_048876253.1|2701522_2702179_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	3.3e-10
WP_036772347.1|2702340_2702757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242641.1|2702759_2703101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420817.1|2703131_2703665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772352.1|2703846_2704074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242642.1|2704116_2704593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420818.1|2704604_2704793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242644.1|2704994_2708321_-	DotA/TraY family protein	NA	NA	NA	NA	NA
WP_017376870.1|2708323_2709220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376871.1|2709496_2711800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772357.1|2711841_2713461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242646.1|2713912_2715415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242647.1|2715476_2718476_-	ATPase AAA	NA	NA	NA	NA	NA
WP_048875870.1|2718512_2718938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376878.1|2718944_2719598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242649.1|2719590_2720667_-	type IVB secretion system coupling complex protein DotM/IcmP	NA	NA	NA	NA	NA
WP_027242650.1|2720669_2721158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420726.1|2723647_2723887_-	type IV secretion protein IcmT	NA	NA	NA	NA	NA
WP_017376886.1|2723891_2725022_-	Flp pilus assembly complex ATPase component	NA	NA	NA	NA	NA
WP_017376887.1|2725024_2725771_-	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_017376888.1|2725763_2726267_-	DotD/TraH family lipoprotein	NA	NA	NA	NA	NA
WP_027242651.1|2726319_2726730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242652.1|2726844_2727885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242653.1|2727900_2728827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242654.1|2728844_2730068_-	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_017376891.1|2730064_2730967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420727.1|2731136_2731907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242655.1|2732211_2733108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376894.1|2733331_2733565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046566.1|2733781_2734375_+	DedA family protein	NA	NA	NA	NA	NA
WP_027242656.1|2734392_2735211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856768.1|2735502_2736297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242658.1|2736372_2737836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856766.1|2739178_2740582_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420729.1|2740701_2741340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774259.1|2741687_2742662_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 32
NZ_CP048052	Piscirickettsia salmonis strain Ps-11091B chromosome, complete genome	3194020	2768733	2803822	3194020	transposase	Escherichia_phage(16.67%)	39	NA	NA
WP_048875864.1|2768733_2769759_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_027242662.1|2770172_2771000_+	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_017377694.1|2771169_2771898_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_048876012.1|2772098_2773502_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376920.1|2773647_2774145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875863.1|2774214_2775117_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_162038680.1|2775449_2775707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772950.1|2775768_2776305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376923.1|2776403_2777570_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.7	1.3e-25
WP_017376924.1|2777874_2780673_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	45.1	1.1e-179
WP_017376925.1|2780731_2781952_+	ribonucleotide-diphosphate reductase subunit beta	NA	A0A1V0EEL7	Caulobacter_phage	28.7	4.2e-35
WP_017376926.1|2782201_2782468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376927.1|2782457_2782595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376929.1|2783021_2783309_+	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_017376930.1|2783465_2783795_+	integration host factor subunit beta	NA	NA	NA	NA	NA
WP_017376931.1|2783829_2785467_-	response regulator	NA	NA	NA	NA	NA
WP_017376932.1|2785568_2786618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376933.1|2786690_2787335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063581.1|2787331_2788585_-	UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase	NA	NA	NA	NA	NA
WP_017376935.1|2788602_2789874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376936.1|2789898_2790489_-	UPF0149 family protein	NA	NA	NA	NA	NA
WP_017376937.1|2790633_2790858_+	TIGR02449 family protein	NA	NA	NA	NA	NA
WP_016209991.1|2790838_2791168_+	cell division protein ZapA	NA	NA	NA	NA	NA
WP_026063582.1|2791394_2791958_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_017376939.1|2791994_2792456_+	EVE domain-containing protein	NA	NA	NA	NA	NA
WP_017376940.1|2792533_2794219_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.6	2.9e-26
WP_026063583.1|2794268_2795096_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_016210000.1|2795095_2795644_-	ADP compounds hydrolase NudE	NA	NA	NA	NA	NA
WP_017376942.1|2795773_2796166_+	ribosome-associated heat shock protein Hsp15	NA	NA	NA	NA	NA
WP_017376943.1|2796416_2796674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046564.1|2796670_2797282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910653.1|2797486_2797702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046563.1|2797718_2797856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971662.1|2798325_2799300_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	9.5e-30
WP_027242664.1|2799583_2800786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162038681.1|2801297_2801525_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_053856769.1|2801842_2802409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875862.1|2802553_2802808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875861.1|2802952_2803822_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 33
NZ_CP048052	Piscirickettsia salmonis strain Ps-11091B chromosome, complete genome	3194020	2815933	2842284	3194020	tRNA,protease,transposase	Staphylococcus_phage(40.0%)	29	NA	NA
WP_017376964.1|2815933_2818414_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	43.8	3.8e-192
WP_036772765.1|2818476_2818908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376966.1|2819108_2819399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242666.1|2819458_2821057_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.1	7.1e-06
WP_017376969.1|2821221_2821557_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_017376970.1|2821585_2823250_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5ERK4	Ostreococcus_lucimarinus_virus	28.8	6.4e-34
WP_027242667.1|2823249_2823891_-	lipoprotein	NA	NA	NA	NA	NA
WP_017376972.1|2823890_2824634_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_017376973.1|2824692_2824929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376974.1|2825079_2826447_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	29.9	1.6e-43
WP_017376975.1|2826457_2827009_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_065653729.1|2827089_2828193_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_017376977.1|2828194_2829952_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_062312189.1|2830174_2830798_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_016210574.1|2830852_2831272_-	prokaryotic dksA/traR C4-type zinc finger family protein	NA	NA	NA	NA	NA
WP_047927116.1|2831412_2832027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242668.1|2832084_2832870_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376980.1|2833501_2834518_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_144420820.1|2834520_2835033_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_017376982.1|2835074_2835548_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_162038682.1|2835603_2836353_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_036771653.1|2836432_2837173_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	1.9e-09
WP_017376985.1|2837262_2837511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910654.1|2837886_2838540_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_144420733.1|2838508_2838688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856770.1|2839085_2840300_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875859.1|2840608_2841403_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375625.1|2841535_2841763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772490.1|2842005_2842284_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 34
NZ_CP048052	Piscirickettsia salmonis strain Ps-11091B chromosome, complete genome	3194020	2925945	3037079	3194020	tRNA,protease,transposase	Staphylococcus_phage(13.33%)	102	NA	NA
WP_017378106.1|2925945_2926890_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_017378107.1|2926889_2927243_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_162038683.1|2927291_2929967_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	23.9	3.9e-25
WP_017378109.1|2929983_2931501_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_016209273.1|2931577_2932030_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_017378110.1|2932248_2933688_-	NADH-quinone oxidoreductase subunit NuoN	NA	NA	NA	NA	NA
WP_017378111.1|2933687_2935226_-	NADH-quinone oxidoreductase subunit M	NA	NA	NA	NA	NA
WP_017378112.1|2935240_2937211_-	NADH-quinone oxidoreductase subunit L	NA	NA	NA	NA	NA
WP_016209309.1|2937214_2937520_-	NADH-quinone oxidoreductase subunit NuoK	NA	NA	NA	NA	NA
WP_017378113.1|2937543_2938167_-	NADH-quinone oxidoreductase subunit J	NA	NA	NA	NA	NA
WP_017378114.1|2938186_2938675_-	NADH-quinone oxidoreductase subunit NuoI	NA	NA	NA	NA	NA
WP_027242679.1|2938688_2939714_-	NADH-quinone oxidoreductase subunit NuoH	NA	NA	NA	NA	NA
WP_017378117.1|2939718_2942112_-	NADH-quinone oxidoreductase subunit G	NA	NA	NA	NA	NA
WP_016209307.1|2942161_2943451_-	NADH-quinone oxidoreductase subunit NuoF	NA	NA	NA	NA	NA
WP_017378118.1|2943457_2943958_-	NAD(P)H-dependent oxidoreductase subunit E	NA	NA	NA	NA	NA
WP_017378119.1|2943957_2945211_-	NADH-quinone oxidoreductase subunit D	NA	NA	NA	NA	NA
WP_017378120.1|2945212_2945890_-	NADH-quinone oxidoreductase subunit C	NA	NA	NA	NA	NA
WP_016209262.1|2945907_2946393_-	NADH-quinone oxidoreductase subunit B	NA	NA	NA	NA	NA
WP_016209283.1|2946383_2946752_-	NAD(P)H-quinone oxidoreductase subunit 3	NA	NA	NA	NA	NA
WP_017378122.1|2947430_2947793_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_017378123.1|2947806_2948568_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_017378124.1|2948869_2950216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771461.1|2950312_2950855_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	NA	NA	NA	NA
WP_017378126.1|2950970_2951804_+	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_027242680.1|2951825_2952419_+	thymidine kinase	NA	A0A0B7MRR0	Enterobacteria_phage	53.6	6.4e-53
WP_048875856.1|2952594_2953614_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375571.1|2953884_2954286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378129.1|2954296_2954620_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_065653735.1|2954643_2955654_-	lipase	NA	NA	NA	NA	NA
WP_017378132.1|2955720_2956569_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_026063707.1|2956685_2957597_-	Nudix family hydrolase	NA	NA	NA	NA	NA
WP_036772169.1|2958363_2959239_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_026063708.1|2959297_2959678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063709.1|2959824_2960061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378135.1|2960357_2960828_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_017378136.1|2960882_2961737_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_017378137.1|2962208_2962427_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_027242681.1|2964123_2964606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420735.1|2964842_2965250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|2965606_2966581_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017378141.1|2966639_2967692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378142.1|2968010_2968976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378143.1|2969278_2970103_-	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_017378144.1|2970304_2971381_+	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_017378145.1|2971465_2972452_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_017378146.1|2972470_2973115_+	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_027242684.1|2973126_2974236_+	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	23.5	1.6e-17
WP_027242685.1|2974302_2974965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242686.1|2975224_2977108_-	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_017378149.1|2977421_2978921_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_017378150.1|2979011_2979794_+	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	33.0	1.8e-31
WP_017378151.1|2979921_2980842_+	SPFH/Band 7/PHB domain protein	NA	J3IZE5	Acanthamoeba_polyphaga_lentillevirus	27.5	2.2e-20
WP_017378152.1|2980865_2981324_+	NfeD family protein	NA	NA	NA	NA	NA
WP_048875854.1|2981445_2982321_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378154.1|2982354_2983620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|2983807_2984683_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048875853.1|2984880_2985072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875852.1|2985276_2986572_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275379.1|2986891_2987110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375941.1|2987146_2988526_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	30.9	3.0e-53
WP_017375942.1|2988553_2989012_-	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	68.0	3.5e-51
WP_036773720.1|2988989_2990207_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.3	6.3e-39
WP_017375944.1|2990399_2990636_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_016210730.1|2990649_2990805_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_017375945.1|2990885_2991848_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017375947.1|2992007_2993324_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_017375948.1|2993333_2994002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375949.1|2994412_2996227_+	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	45.1	3.8e-24
WP_144420736.1|2996942_2997128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375951.1|2997309_2997768_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772169.1|2998486_2999362_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420737.1|2999593_2999992_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081000012.1|2999995_3000238_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375794.1|3001127_3002879_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_017375795.1|3002889_3003690_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.1	3.4e-33
WP_017375796.1|3003792_3004281_-	dihydrofolate reductase	NA	A0A1B2IDT7	Erwinia_phage	43.1	4.5e-28
WP_047927156.1|3004780_3005704_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017375799.1|3005800_3006145_+	DMT family protein	NA	NA	NA	NA	NA
WP_162034387.1|3007057_3007216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377528.1|3011839_3012802_-	hypothetical protein	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	28.1	7.0e-17
WP_036772663.1|3012840_3013716_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_026063646.1|3013975_3015235_-	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_016210045.1|3015457_3015784_-	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	46.2	1.5e-16
WP_048875850.1|3015978_3016929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242725.1|3016986_3019053_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_017377534.1|3019058_3020054_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_027242724.1|3020811_3022392_+	APC family permease	NA	NA	NA	NA	NA
WP_016210041.1|3022539_3023949_-	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_017377536.1|3024008_3025142_-	cation transporter	NA	NA	NA	NA	NA
WP_017377537.1|3025280_3026105_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_027242723.1|3026332_3026632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377539.1|3026628_3026841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046561.1|3026854_3026992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377540.1|3027129_3027363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210044.1|3028414_3028786_-	isochorismatase	NA	NA	NA	NA	NA
WP_017377542.1|3029096_3029384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377543.1|3029535_3030384_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_048875849.1|3030506_3031478_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377545.1|3031580_3032621_+	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_017377550.1|3035159_3035450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377551.1|3035717_3035978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|3036104_3037079_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 35
NZ_CP048052	Piscirickettsia salmonis strain Ps-11091B chromosome, complete genome	3194020	3070072	3130719	3194020	transposase,tRNA	Staphylococcus_phage(37.5%)	54	NA	NA
WP_075278722.1|3070072_3070948_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377392.1|3071472_3072069_+	biotin/lipoyl-binding protein	NA	NA	NA	NA	NA
WP_017377391.1|3072339_3072918_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017377386.1|3077440_3078946_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_016209709.1|3079402_3079744_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_017377384.1|3079864_3081769_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_047927397.1|3081901_3083473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927396.1|3083490_3084708_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_017377379.1|3084829_3085828_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_144420826.1|3085831_3086590_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_017377377.1|3086591_3087791_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_036771983.1|3087774_3088446_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_017377374.1|3089245_3090244_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	32.4	2.7e-40
WP_017377373.1|3090245_3090824_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	44.5	1.1e-44
WP_016209719.1|3092332_3092620_-	trp operon repressor	NA	NA	NA	NA	NA
WP_026063627.1|3092820_3093741_+	DMT family transporter	NA	NA	NA	NA	NA
WP_017377369.1|3093856_3094411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377368.1|3094526_3094952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771981.1|3095222_3095573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242711.1|3095766_3096306_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_017377365.1|3096390_3096927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242710.1|3097586_3097889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242709.1|3098337_3098907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771979.1|3098999_3099320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376171.1|3099498_3100473_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155046560.1|3100739_3100913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|3101018_3102422_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875844.1|3102426_3103446_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275373.1|3104062_3104392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378398.1|3104617_3105016_-	DUF3135 domain-containing protein	NA	NA	NA	NA	NA
WP_017378399.1|3105883_3106834_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_017378400.1|3106833_3108912_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_017378401.1|3109053_3109569_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_017378402.1|3109577_3110141_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_017378403.1|3110121_3110868_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_017378404.1|3111006_3111459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927132.1|3111594_3112431_+	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_027242707.1|3112427_3113324_+	DMT family transporter	NA	NA	NA	NA	NA
WP_017378407.1|3113356_3114424_+	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_016210352.1|3114442_3114811_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_080963575.1|3114836_3116288_-	potassium transporter	NA	NA	NA	NA	NA
WP_017378410.1|3116294_3117674_-	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_036773239.1|3117714_3119028_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_026063734.1|3119017_3119992_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	1.3e-10
WP_017378413.1|3120085_3120589_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	5.4e-13
WP_017378414.1|3120723_3121875_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_016210342.1|3121871_3122351_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_027242705.1|3122497_3124819_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	35.9	7.9e-99
WP_080963576.1|3124763_3125390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378416.1|3125394_3126294_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_036773242.1|3126474_3127029_+	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_036771330.1|3127068_3128043_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017378420.1|3128632_3129010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|3129744_3130719_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 1
NZ_CP048053	Piscirickettsia salmonis strain Ps-11091B plasmid Ps11091B-p1, complete sequence	203283	12001	56981	203283	portal,integrase,transposase,terminase	Streptococcus_phage(33.33%)	41	39204:39263	61490:62055
WP_027242929.1|12001_12385_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	45.5	9.5e-26
WP_075278733.1|12471_12954_+|terminase	P27 family phage terminase small subunit	terminase	Q9B019	Phage_GMSE-1	33.3	8.1e-14
WP_048876205.1|12956_14288_+|terminase	terminase large subunit	terminase	A0A1W6JP18	Morganella_phage	46.3	6.1e-112
WP_157894751.1|14570_14927_+	hypothetical protein	NA	A0A1X9I6B3	Streptococcus_phage	49.6	2.6e-25
WP_087910668.1|15013_15400_+|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	50.0	2.1e-25
WP_036771649.1|15437_16172_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.9e-38
WP_048876202.1|16218_16932_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.2	3.2e-11
WP_144420848.1|18310_18496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157894750.1|18559_21844_+	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_017377509.1|22024_22753_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_075275482.1|22846_23821_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.8e-28
WP_027242596.1|24134_24497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242595.1|24536_25046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420849.1|25277_26258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|26723_27701_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_036771347.1|28181_29159_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155046636.1|29173_29335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243211.1|29552_29807_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_027243212.1|29796_30084_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	50.5	9.6e-15
WP_036771347.1|30578_31556_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_053093683.1|32556_32769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|32926_33904_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_075317322.1|33890_35405_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_047927782.1|36200_36590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|36505_37483_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
39204:39263	attL	TTGGCTTTTCTCCTAGCACGATTAGCCGTGAGATTAAACGGCACACCCCAATCGATTTTA	NA	NA	NA	NA
WP_027243215.1|40474_41497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774350.1|41979_42708_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	6.4e-39
WP_048876194.1|43947_44481_+|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	33.3	1.1e-19
WP_080963665.1|44661_45003_+|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	54.3	4.3e-22
WP_080963664.1|45183_45450_+|portal	phage portal protein	portal	G0ZT36	Aeromonas_phage	46.7	2.5e-09
WP_027243206.1|45522_47388_-	UvrD-helicase domain-containing protein	NA	V5K3E8	Pseudomonas_phage	32.7	7.9e-57
WP_146619416.1|47693_47840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|48183_48912_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_155046637.1|48993_49485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162038693.1|50217_51374_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.5	2.2e-49
WP_048876191.1|51996_52425_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_048876190.1|52417_52747_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017377694.1|52776_53505_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_017375663.1|53516_53666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|53912_54641_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_036774388.1|56018_56981_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
61490:62055	attR	TTGGCTTTTCTCCTAGCACGATTAGCCGTGAGATTAAACGGCACACCCCAATCGATTTTAAAGGTCTTTATTGTCACCGGCTTACTTCTCGCTGCGCACAAGAAAAACGAGCTAACGCTAAGCAAGGACAAGCTTTTCAACAAATTTCAGAAGAGGAAAAAATGTTGATTCATCAGCGGTTAAGCACTCATACATCCCCCGATGTTATCAGTCAAGAACTTATACGTGAGCATAATATTCAGGTGAGTGAGAGCACGATTTACCGTTATATTTATGATGATAGAGAGCGGGGCGGAGAGCTTTACAAAAACCTGCCTCATTCAGGAAAACCTTATAAGAAGAAGGTGAGTCGTGGTGATCAAACAAAAATACCTAATCGCGTTGGTATTGAACAACGGCCTGCTATTGCTGATGAAAAGACAGAGTTTGGTCATTTTGAAATTGATACGGTTGTGGGTCGTGACCACCAATCTTATTTATTAACACTGGTCGATAAGGCGAATAAAATGTGTTGTATAAGGAAAATGCCTAACAAACAAGCCAAGACTGTTATCAATACATTCATG	NA	NA	NA	NA
>prophage 2
NZ_CP048053	Piscirickettsia salmonis strain Ps-11091B plasmid Ps11091B-p1, complete sequence	203283	60496	171823	203283	portal,transposase,integrase	Streptococcus_phage(50.0%)	102	80095:80154	148441:150176
WP_036774373.1|60496_61225_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_048876188.1|61398_62172_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.6	3.9e-10
WP_027243202.1|62885_63821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|64095_64824_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_155046639.1|64989_65193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929623.1|65292_68634_+	DEAD/DEAH box helicase	NA	C3VNU0	Bombyx_mandarina_nucleopolyhedrovirus	28.7	2.6e-50
WP_036772541.1|68791_69520_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_144420834.1|69813_70209_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	46.2	4.9e-09
WP_036815648.1|70261_70990_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_036772541.1|71473_72202_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_027243197.1|72372_72942_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.1	2.2e-26
WP_087910667.1|72946_73630_-	cell filamentation protein Fic	NA	NA	NA	NA	NA
WP_036772541.1|73781_74510_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_080963627.1|74528_74747_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_036774644.1|75726_76788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927488.1|77296_78043_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	29.9	4.9e-18
WP_027243200.1|78043_78448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|78754_79729_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
80095:80154	attL	GATGTATCTTAGCTAAATCTGTCAGCACCTTTTTAATTTTAGTATCAACAACCTGTTTTT	NA	NA	NA	NA
WP_036771293.1|80268_80535_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771296.1|80830_82726_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_036771296.1|83081_84977_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_017375632.1|85676_86012_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_017375836.1|86206_86410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243203.1|86503_87298_+	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	35.9	2.5e-36
WP_080999971.1|91348_92752_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_081000017.1|93016_93268_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_048875857.1|93668_94643_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.5	2.2e-26
WP_048876221.1|95630_96086_-|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	34.8	4.3e-17
WP_016212398.1|96180_96642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420836.1|96816_97017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157894758.1|98744_100775_+	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_017377509.1|100804_101533_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_144420837.1|101674_102607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377511.1|102636_103365_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_017377512.1|103367_103640_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017377511.1|104490_105219_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_144420838.1|105274_105895_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017375910.1|107043_107772_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_162038694.1|107991_108894_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377667.1|109563_109734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377666.1|109878_110136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036815609.1|112036_112492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036816769.1|112735_113134_-	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
WP_047927763.1|113130_113394_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027243210.1|113807_114542_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.9e-36
WP_017377526.1|114871_115732_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_157894756.1|115993_116134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377525.1|116133_116931_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_075275471.1|117471_118446_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	1.3e-26
WP_048876214.1|119217_119946_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.1e-38
WP_017377521.1|120454_120808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|121735_122464_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_157894750.1|123106_126391_+	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_048876213.1|126699_127590_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275473.1|128828_129005_+	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	46.0	1.7e-06
WP_027243191.1|129121_129829_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	40.0	1.2e-34
WP_048876212.1|129782_130661_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_144420840.1|130691_131123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876211.1|131505_132210_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.7	7.9e-10
WP_162038695.1|132229_132949_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_051929563.1|132978_133368_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	40.0	1.1e-10
WP_017375910.1|133390_134119_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_036815979.1|134121_134730_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.6	8.9e-10
WP_155046641.1|134910_135075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157894755.1|135188_135326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243184.1|135318_135657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052133264.1|135670_136075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375840.1|136119_136338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157894754.1|137324_138419_+	RepB family plasmid replication initiator protein	NA	A0A218MNI2	uncultured_virus	29.8	3.6e-25
WP_017377655.1|138760_139006_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_017377656.1|139002_139389_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_036772434.1|139476_140205_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	9.3e-38
WP_080963659.1|140183_140804_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017377658.1|141149_141836_+	Fic family protein	NA	NA	NA	NA	NA
WP_155082177.1|142785_143004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212146.1|143150_144890_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_155046629.1|145291_145444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162038696.1|145471_146002_-|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	36.8	3.6e-15
WP_036771347.1|146076_147054_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_081000019.1|147129_147300_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876210.1|147340_148069_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	4.6e-37
WP_036771293.1|148614_148881_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046692.1|149176_151075_-	DUF1561 family protein	NA	NA	NA	NA	NA
148441:150176	attR	GATGTATCTTAGCTAAATCTGTCAGCACCTTTTTAATTTTAGTATCAACAACCTGTTTTTTAGGTTGATACCGATAAACTGATCGGCCAATACGGCACATCTTGCATGCTTTATTCCCGCTCAATGCATGAGCTTTGACAGCATAATCAACTAAGTCACGCCGACTCGCTGCGGTTATAGCTTTTTTTCAACAATATCCTTGAGCACTTTGTGCTCTAGGCTAATGTCTGCGTACATCTGTTTCAAACGACGGTTTTCGTCTTCAAACTCTTTTAAACGCTGTAGATCTGAAACGCCCATGCCTTGATATTTGGATCTGAGTTTGTAGTAGCTGCTTTTAGCAATACCATACTGGCGACAAATATCTTCAACTTTAACACCCGCTTGGCCTTCATTAAGCATGGCTACAATTTGTGATTCTGTTAGTTTTGATCGTTTCATCTTCTCTCTCCTGGCTAAGTTAATTTAACAGAAGATTCCACTTATCACTTGTACTATTTTAAGGGAGGGTTACCGAGTTATGTGAGAGCACAGTAGTGGAGTGTGCCGATTCAAGGCACGTAACGCTGTGTGACGCGGACAGCCGAGGGTTTATAGTCGTCGCGTTTTGCTCGGCGATTTTGCATCATTGGATGTGCAAAATACCTACCGAGGTAGCGACGCTTACGTTGCGACAGAACCCTCCTTGGTTCGCAGCGCCAACATCATATCATTAAATCAAATTGCGACAGAACCATTATAGCTCATCATCTTCATATCTTGTATGTTTAGGATCATTACAAACATACCATCCACTAGAACTAGAATTTGTACATACCCCATACCTTTTAGATAAATCAAAGTACATAGTTGTGCTAGAAGGAGATTGTGATGATTTAGCATCAAAAAGTGAGCCAAAATGATTGTAAGTCGTGACATATAAATTACTTTTATCTGAATTTTTAATATATATTGCGCTGACAGGATCATTTACTCTACTTTCTAAAAACCATTTTAAATTATTAGGTACGTTATCCATAAATGGATCACACTGTTTGAAATAAACCCAATCCCAATCCGTCGTTTTTCCAGCAATATTAGAAGTTAAACAGCTTAAAAACCAACCATCAGATGAAAATGCACGGCCATATAGTGAAAGCATCAATATTCTAGAATTTTTCATATCATAGTATGTTCTATTCAAATAATTTGAATTATACGAACCTGAATACATAGGATAGTAATTATTATCAGATTTATCATAAAACCTCATACCAATTTCATACCAAAATGTATTTACTTTTGATGGTGTTTTAAAAAAGTATTTAGACATTTTATTTGCATCTAAAACAATATTAGTTCCACTTGATTTTGAAATAATTCCATAGTTGCCATACCATTGAATAGATAGATCTTTATTTAAACGAGGTTTTAATTTTCCATCTCTTACATCCCATTTTTGATAAGGGTTATAAATATCACAAGGCCAAAACTCTACATAATCCCATTTATCATCACCTTTGATGACATTTTCTGGTGCAGTCATACATAGAGGGATTCCAAATTGAGATTTAGAGAAAGCAACTCTGCCAAGAGTATCATAAATAGCTTTTTGACTTTCTACATTAGAACATGTTTGAGCGTATAAATAAGATCGAGACGTTTTCATAGAAGAGTCTCTTGATTGAGTTGGAGCTAAACAGTAACCTCCCTGAGTTGTAATTAACTGGCTTGGTATTGTAGGTAAATCTTTAAAT	NA	NA	NA	NA
WP_017377694.1|151496_152225_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_082884401.1|152322_152445_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155046630.1|152861_153026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771359.1|154514_155243_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	41.7	3.5e-37
WP_036771347.1|155370_156348_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155046631.1|156422_157073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126795.1|159704_159965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772441.1|159968_160241_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_017375910.1|160316_161045_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_048876229.1|161613_162585_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_157894752.1|162857_163037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876208.1|163449_164277_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.1	1.2e-17
WP_036771289.1|165130_165601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046633.1|166494_166638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275480.1|167844_168381_-	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_017375850.1|168797_169574_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_036771279.1|169934_170663_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_155046634.1|170732_170933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876229.1|170851_171823_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP048053	Piscirickettsia salmonis strain Ps-11091B plasmid Ps11091B-p1, complete sequence	203283	186969	191899	203283	portal,transposase,terminase	Streptococcus_phage(42.86%)	7	NA	NA
WP_027242929.1|186969_187353_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	45.5	9.5e-26
WP_075278733.1|187439_187922_+|terminase	P27 family phage terminase small subunit	terminase	Q9B019	Phage_GMSE-1	33.3	8.1e-14
WP_162038697.1|187924_188521_+	hypothetical protein	NA	A0A1J0GUY5	Halomonas_phage	51.8	4.7e-40
WP_157894751.1|189537_189894_+	hypothetical protein	NA	A0A1X9I6B3	Streptococcus_phage	49.6	2.6e-25
WP_087910668.1|189980_190367_+|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	50.0	2.1e-25
WP_036771649.1|190404_191139_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.9e-38
WP_048876202.1|191185_191899_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.2	3.2e-11
>prophage 1
NZ_CP048054	Piscirickettsia salmonis strain Ps-11091B plasmid Ps11091B-p2, complete sequence	66325	1811	57111	66325	tail,capsid,transposase,head	unidentified_phage(32.14%)	57	NA	NA
WP_036771639.1|1811_2786_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.9	4.9e-26
WP_087910670.1|3740_3926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910671.1|4019_4484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162038711.1|4871_5504_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	3.2e-10
WP_162038712.1|5612_6134_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	38.1	8.7e-14
WP_032126138.1|6561_6825_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_036771639.1|7266_8241_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.9	4.9e-26
WP_048876253.1|8237_8894_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	3.3e-10
WP_048876254.1|9151_10402_-	MFS transporter	NA	NA	NA	NA	NA
WP_075275452.1|10489_11551_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036771347.1|12364_13342_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_048876255.1|13360_14362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275453.1|14604_15579_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.4	2.9e-26
WP_017377662.1|15666_15981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377663.1|15991_16321_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	44.9	6.1e-13
WP_162038713.1|16593_17385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876257.1|17529_18324_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_036817087.1|18705_19074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876258.1|19386_20181_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_080963666.1|22492_22732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876259.1|22602_23619_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155049772.1|24036_24990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162038714.1|25375_26329_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.1	1.1e-25
WP_017375692.1|26472_26706_+	hypothetical protein	NA	Q7Y5W4	Haemophilus_phage	42.6	1.3e-06
WP_017375691.1|26729_27431_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	37.6	9.6e-32
WP_036773107.1|27414_27732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|28019_28994_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_027242588.1|29332_29686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771953.1|29702_31982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|32444_33419_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.9	4.9e-26
WP_075275454.1|33468_34008_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	44.2	9.3e-35
WP_027242598.1|34021_34606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375778.1|34990_35302_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	30.8	5.6e-08
WP_017375779.1|35298_35724_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	37.9	3.9e-12
WP_017375780.1|35902_36298_+	HK97 gp10 family phage protein	NA	Q6UAX1	Klebsiella_phage	39.6	4.3e-05
WP_017375781.1|36294_36645_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_017375782.1|36644_37067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375783.1|37068_37392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375784.1|37448_37715_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_036771950.1|37718_39797_+|tail	phage tail tape measure protein	tail	A0A1J0GWA6	Alteromonas_phage	31.2	1.6e-50
WP_017375786.1|39789_40131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375787.1|40127_40799_+|tail	phage minor tail protein L	tail	W6EC15	Rhizobium_phage	33.6	1.4e-27
WP_144420832.1|40728_41514_+	hypothetical protein	NA	A0A0R6PHF9	Moraxella_phage	41.1	5.1e-42
WP_017375789.1|41503_42061_+|tail	tail assembly protein	tail	K7PM97	Enterobacterial_phage	35.6	2.7e-21
WP_027242568.1|42057_44748_+	host specificity protein J	NA	A0A0R6PIC9	Moraxella_phage	32.9	6.1e-111
WP_017375652.1|44806_45235_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771347.1|45262_46240_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_036771355.1|46711_48148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375933.1|48164_49157_-	ParA family protein	NA	A0A1X9I765	Streptococcus_phage	28.9	5.0e-10
WP_036771347.1|49556_50534_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_051929651.1|50695_51748_+	ParA family protein	NA	NA	NA	NA	NA
WP_036816420.1|51751_52384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|52787_53762_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.9	4.9e-26
WP_087910670.1|54717_54903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910671.1|54996_55461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162038711.1|55848_56481_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	3.2e-10
WP_162038712.1|56589_57111_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	38.1	8.7e-14
>prophage 1
NZ_CP048055	Piscirickettsia salmonis strain Ps-11091B plasmid Ps11091B-p3, complete sequence	52567	25559	41581	52567	capsid,integrase,tail,terminase,transposase,head	unidentified_phage(35.71%)	22	20055:20114	42192:42483
20055:20114	attL	AAACGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTT	NA	NA	NA	NA
WP_027242943.1|25559_25976_-	hypothetical protein	NA	A0A2R3UA88	Siphoviridae_environmental_samples	41.7	2.2e-20
WP_027242944.1|25972_26530_-|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	36.2	7.9e-21
WP_027242945.1|26875_27391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420855.1|28194_28410_-|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_036771330.1|28483_29458_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_027242946.1|29838_30420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275490.1|30455_30848_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	45.0	7.0e-24
WP_036771330.1|30944_31919_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_027242948.1|31938_32124_-	hypothetical protein	NA	A0A1J0GUY5	Halomonas_phage	47.3	9.0e-06
WP_027242949.1|32126_32609_-|terminase	P27 family phage terminase small subunit	terminase	Q9B019	Phage_GMSE-1	34.0	3.6e-14
WP_027242950.1|32695_33079_-	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	46.3	4.3e-26
WP_027242951.1|33291_34158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|34783_35758_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_027242952.1|35855_36203_-	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	36.4	1.6e-16
WP_027242953.1|36195_36450_-	addiction module toxin, HicA family	NA	NA	NA	NA	NA
WP_027242954.1|36594_36960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971681.1|37492_38467_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	1.7e-26
WP_016211078.1|38643_38997_-	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	34.8	6.5e-13
WP_027242955.1|38989_39250_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_016212329.1|39480_40071_+|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	35.3	3.2e-20
WP_075278739.1|40136_40493_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|40606_41581_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
42192:42483	attR	AACCCGAACCTACCTCGGCCTACTCACCCCGTGCTTAGCACTCCATGGCTCGCAGCGTTTGTTTACTTCTATGCTTATCTAAAACTGTATCATCAACGACAAGTAAGCAAGGCTCTTCTGTATTAATTAGATCTTTTACAATATGCCAGATGTCTCTAGGGCGGTACTGCTGTGACTGAAGCCATCTGCTCACACTGTCATGAGAAAGAGGTTTCGGAGAAACTTCTGATAGAGCCAGCCCTGAATAACGTACGCTACTTGCCTGGAGAAATGCTTTATAAATCTCTTTTGT	NA	NA	NA	NA
