The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP048021	Virgibacillus sp. MSP4-1 chromosome, complete genome	3332438	480093	487430	3332438	transposase	Staphylococcus_phage(33.33%)	7	NA	NA
WP_044160488.1|480093_481803_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	71.4	3.7e-13
WP_044160486.1|481884_482622_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_162038758.1|482794_484024_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	23.7	1.6e-21
WP_044160485.1|484167_484512_+	winged helix-turn-helix transcriptional regulator	NA	A0A218MNF3	uncultured_virus	38.6	1.8e-12
WP_044160483.1|484527_485826_+	arsenic transporter	NA	A0A2H4PQU3	Staphylococcus_phage	66.4	2.5e-158
WP_044160481.1|485901_486321_+	arsenate reductase (thioredoxin)	NA	A0A2H4PQT9	Staphylococcus_phage	60.4	6.1e-42
WP_044160480.1|486458_487430_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	44.2	9.2e-17
>prophage 2
NZ_CP048021	Virgibacillus sp. MSP4-1 chromosome, complete genome	3332438	1170029	1176575	3332438		Bacillus_virus(14.29%)	9	NA	NA
WP_044157747.1|1170029_1170518_-	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	51.2	3.5e-41
WP_044157748.1|1170585_1171530_-	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	67.1	3.8e-124
WP_052330347.1|1171649_1172648_+	hypothetical protein	NA	A0A1V0DZX6	Clostridioides_phage	44.8	1.0e-18
WP_162038969.1|1172668_1173310_-	HD domain-containing protein	NA	S4W232	Pandoravirus	32.7	4.5e-12
WP_044157750.1|1173306_1174164_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_044157751.1|1174210_1174432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044157752.1|1174749_1174950_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	67.7	4.5e-19
WP_044157753.1|1175101_1175722_+	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	63.0	7.9e-38
WP_044157754.1|1175903_1176575_+	queuosine precursor transporter	NA	A0A2H4J2N7	uncultured_Caudovirales_phage	27.6	1.4e-11
>prophage 3
NZ_CP048021	Virgibacillus sp. MSP4-1 chromosome, complete genome	3332438	3007238	3050127	3332438	integrase,holin,tRNA,protease,transposase	uncultured_virus(18.18%)	38	3024240:3024254	3042370:3042384
WP_044164392.1|3007238_3007850_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_044164393.1|3007982_3008345_+	holo-[acyl-carrier-protein] synthase	NA	NA	NA	NA	NA
WP_044164394.1|3008623_3009646_+	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
WP_044164395.1|3010275_3011457_+	alanine racemase	NA	NA	NA	NA	NA
WP_044164455.1|3011622_3011916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044164397.1|3011922_3012273_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A2P0ZKX3	Lactobacillus_phage	37.7	1.7e-13
WP_044164399.1|3012535_3013402_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_044164401.1|3013406_3013763_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_044164457.1|3013767_3014175_+	anti-sigma regulatory factor	NA	NA	NA	NA	NA
WP_044164403.1|3014185_3015178_+	PP2C family protein-serine/threonine phosphatase	NA	NA	NA	NA	NA
WP_044164406.1|3015261_3015591_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_044164408.1|3015590_3016070_+	anti-sigma B factor RsbW	NA	NA	NA	NA	NA
WP_044164409.1|3016041_3016833_+	RNA polymerase sigma factor SigB	NA	A0A0Y0AU18	Bacillus_phage	32.4	1.8e-23
WP_052330502.1|3016829_3017432_+	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_044164461.1|3017625_3019773_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_044164410.1|3019786_3019918_-	cortex morphogenetic protein CmpA	NA	NA	NA	NA	NA
WP_044164413.1|3020340_3020784_+	SprT family protein	NA	NA	NA	NA	NA
3024240:3024254	attL	TTTGTTTAGTTTTGA	NA	NA	NA	NA
WP_162038833.1|3028250_3029444_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_044164112.1|3029788_3030757_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_044164110.1|3030771_3031227_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_044164108.1|3031223_3031931_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_044164106.1|3031923_3032370_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_044164104.1|3032354_3033416_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	45.3	4.9e-72
WP_044164103.1|3033773_3035705_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	32.1	3.4e-55
WP_044164101.1|3035847_3036513_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_044164099.1|3036658_3036868_-	YdiK family protein	NA	NA	NA	NA	NA
WP_044164097.1|3036874_3037582_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_044164095.1|3037955_3038240_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	53.8	1.7e-19
WP_044164094.1|3038301_3039936_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	56.6	1.3e-159
WP_162039009.1|3040017_3040806_-|integrase	site-specific integrase	integrase	A0A0C5AN64	Paenibacillus_phage	60.5	5.8e-78
WP_052330490.1|3040992_3042006_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	27.9	4.3e-25
WP_044164093.1|3042814_3043942_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	43.6	1.2e-71
3042370:3042384	attR	TTTGTTTAGTTTTGA	NA	NA	NA	NA
WP_162039010.1|3043961_3045206_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	49.5	1.5e-96
WP_044164091.1|3045685_3046012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044164089.1|3046182_3046800_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044164087.1|3046829_3047240_+	Spx/MgsR family RNA polymerase-binding regulatory protein	NA	NA	NA	NA	NA
WP_162039011.1|3047394_3047970_-	GbsR/MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044164084.1|3048441_3050127_+|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	33.0	5.4e-65
>prophage 4
NZ_CP048021	Virgibacillus sp. MSP4-1 chromosome, complete genome	3332438	3238213	3288226	3332438	integrase,transposase	Acinetobacter_phage(42.86%)	44	3269976:3269997	3287146:3287167
WP_162038833.1|3238213_3239407_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_044163823.1|3239534_3240071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044163821.1|3240717_3241413_+	DUF2711 family protein	NA	NA	NA	NA	NA
WP_044163818.1|3241543_3242836_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_044163816.1|3243057_3243588_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_044163814.1|3243580_3244609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044163811.1|3245448_3246870_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_044163809.1|3246866_3247490_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	47.4	1.8e-45
WP_044163807.1|3247473_3248493_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	32.0	2.5e-49
WP_044163806.1|3248500_3249289_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	44.9	8.8e-34
WP_044163804.1|3249285_3249900_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_044163802.1|3249896_3251102_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_044163800.1|3251094_3251883_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_044163798.1|3251924_3253766_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_044163796.1|3254068_3254470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044163795.1|3254531_3254999_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_162038927.1|3255075_3256041_-	AEC family transporter	NA	NA	NA	NA	NA
WP_044163793.1|3256501_3256996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044163792.1|3257007_3258294_-	MFS transporter	NA	NA	NA	NA	NA
WP_044163791.1|3258375_3259011_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_044163790.1|3259231_3260182_+	D-2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_044163789.1|3260184_3260739_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_044163788.1|3260881_3261328_+	peroxide-responsive transcriptional repressor PerR	NA	NA	NA	NA	NA
WP_044163787.1|3261569_3261953_-	YgzB family protein	NA	NA	NA	NA	NA
WP_044163786.1|3262079_3262940_+	hypothetical protein	NA	NA	NA	NA	NA
3269976:3269997	attL	TTCGACCCCGACCACCGGTATC	NA	NA	NA	NA
WP_044161443.1|3270144_3271257_-|integrase	site-specific integrase	integrase	Q5YAA6	Bacillus_phage	58.4	2.8e-118
WP_044161442.1|3271419_3271743_-	DUF771 domain-containing protein	NA	Q9MBW7	Lactococcus_phage	41.7	9.2e-14
WP_044161441.1|3272203_3272515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044161440.1|3273218_3274202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044161438.1|3274504_3274993_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_044161436.1|3275027_3275993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044161434.1|3276126_3276708_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_044161432.1|3276719_3278249_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	39.2	4.6e-95
WP_052330419.1|3278258_3279449_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_044161430.1|3279486_3282585_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	26.3	2.5e-71
WP_044161428.1|3282596_3283322_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_044161426.1|3283405_3283909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044161425.1|3284014_3284599_+	SLATT domain-containing protein	NA	NA	NA	NA	NA
WP_044161424.1|3284608_3285961_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_044161423.1|3286066_3286906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162038928.1|3287383_3287647_+|transposase	transposase	transposase	NA	NA	NA	NA
3287146:3287167	attR	TTCGACCCCGACCACCGGTATC	NA	NA	NA	NA
WP_162038929.1|3287660_3287957_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_162038930.1|3287956_3288073_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_162039020.1|3288091_3288226_+|transposase	transposase	transposase	NA	NA	NA	NA
