The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	0	71859	4830815	transposase,portal,terminase,tRNA,capsid,holin,plate,lysis,head,tail	Escherichia_phage(45.95%)	62	NA	NA
WP_001016257.1|2579_3326_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_001298859.1|3340_4882_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_021533447.1|5484_6570_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_064055588.1|7180_8215_-|portal	phage portal protein	portal	Q858W8	Yersinia_virus	99.1	1.2e-200
WP_064055587.1|8214_9987_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.3	0.0e+00
WP_001085972.1|10160_11015_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MI4	Enterobacteria_phage	100.0	1.3e-139
WP_064055586.1|11073_12147_+|capsid	phage major capsid protein, P2 family	capsid	Q94MH9	Enterobacteria_phage	98.6	1.3e-200
WP_052923178.1|12150_12894_+|terminase	terminase endonuclease subunit	terminase	Q858W5	Yersinia_virus	98.0	7.8e-125
WP_064055585.1|12993_13503_+|head	head completion/stabilization protein	head	A0A0F7L9Y3	Escherichia_phage	99.4	4.3e-90
WP_000846399.1|13502_13706_+|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000123124.1|13709_13991_+|holin	holin	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_001144101.1|13990_14488_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_064055584.1|14502_14928_+	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	94.3	1.8e-57
WP_064055583.1|14915_15341_+|lysis	LysB family phage lysis regulatory protein	lysis	Q7Y4E2	Escherichia_virus	94.3	1.4e-65
WP_000917182.1|15448_15916_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	99.4	1.9e-81
WP_001001780.1|15908_16361_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	100.0	6.3e-77
WP_001093731.1|16427_17063_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	2.5e-111
WP_000127164.1|17059_17407_+|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
WP_001121474.1|17411_18320_+|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	100.0	1.2e-162
WP_001285337.1|18312_18924_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	4.9e-117
WP_001340317.1|20185_20419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087526003.1|20399_20810_-|tail	phage tail protein	tail	B6SCW7	Bacteriophage	42.5	5.4e-19
WP_044077513.1|20812_21319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000905100.1|21349_21943_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	98.0	1.2e-104
WP_001286716.1|22002_23193_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	100.0	1.6e-225
WP_064055542.1|23205_23724_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	98.8	1.6e-92
WP_001031303.1|23780_24056_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|24088_24208_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_064055543.1|24200_26648_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	95.3	0.0e+00
WP_000978897.1|26662_27142_+|tail	phage tail protein	tail	O64315	Escherichia_phage	100.0	5.1e-85
WP_021560400.1|27141_28305_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.2	3.1e-205
WP_000468308.1|28386_28605_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001292814.1|28924_31207_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.4	1.0e-162
WP_000642546.1|31261_32119_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_001297197.1|32524_34285_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_000642849.1|34414_35107_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_000057149.1|35305_36394_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
WP_000445231.1|36464_37748_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_001295345.1|37916_38681_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_000125016.1|38853_39537_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_000140327.1|39647_41321_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000167336.1|41480_41765_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000705765.1|41971_44236_+	ComEC family protein	NA	NA	NA	NA	NA
WP_000551270.1|44272_46021_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
WP_000570540.1|46017_47004_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000056498.1|47040_48273_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000350058.1|48324_48507_+	protein YcaR	NA	NA	NA	NA	NA
WP_000011590.1|48503_49250_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000436922.1|49403_50297_+	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000899599.1|50273_51053_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_001298300.1|51188_51974_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288850.1|51970_53293_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001295347.1|53273_53978_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572634.1|53977_58438_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_000925993.1|58698_60546_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001295932.1|60726_61275_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_001109487.1|61301_61949_+	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_000462687.1|62170_63361_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_000117881.1|65235_66636_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_001297200.1|66804_68007_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000193844.1|68272_70885_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	7.0e-19
WP_001090508.1|71091_71859_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	5.7e-30
>prophage 2
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	87780	89688	4830815		Tupanvirus(100.0%)	1	NA	NA
WP_000053089.1|87780_89688_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	1.4e-53
>prophage 3
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	102287	104342	4830815		Bacillus_phage(100.0%)	1	NA	NA
WP_000420536.1|102287_104342_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	1.0e-20
>prophage 4
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	108575	109235	4830815	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000375136.1|108575_109235_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
>prophage 5
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	128500	140755	4830815		Morganella_phage(20.0%)	13	NA	NA
WP_000066490.1|128500_128713_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071524879.1|128723_128912_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001331090.1|128886_129117_+	protein YmcE	NA	NA	NA	NA	NA
WP_001019197.1|129106_129280_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000829669.1|129327_130401_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_015695619.1|130472_133217_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.9	1.0e-36
WP_001264919.1|133299_134328_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001120112.1|134300_134993_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001230242.1|135122_136295_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001063132.1|136294_138841_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	30.7	2.2e-70
WP_000209869.1|138837_139437_+	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_000024560.1|139529_139835_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000420617.1|139834_140755_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
>prophage 6
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	145059	147159	4830815		Enterobacteria_phage(100.0%)	3	NA	NA
WP_001273658.1|145059_145233_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_001297178.1|145315_146644_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.6	6.9e-233
WP_001028096.1|146664_147159_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	96.9	1.1e-50
>prophage 7
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	162059	162983	4830815		Cronobacter_phage(100.0%)	1	NA	NA
WP_001307105.1|162059_162983_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	9.2e-91
>prophage 8
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	169802	172068	4830815	transposase	Bacillus_phage(50.0%)	2	NA	NA
WP_000409849.1|169802_171161_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.0	1.1e-20
WP_000878196.1|171201_172068_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
>prophage 9
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	177419	178253	4830815		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001189321.1|177419_178253_-	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 10
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	182387	182921	4830815		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000857399.1|182387_182921_+	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	7.8e-26
>prophage 11
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	192229	193150	4830815		Morganella_phage(100.0%)	1	NA	NA
WP_001331276.1|192229_193150_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	41.1	4.3e-56
>prophage 12
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	197812	198058	4830815		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|197812_198058_-	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 13
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	213904	214846	4830815		Brevibacillus_phage(100.0%)	1	NA	NA
WP_001295441.1|213904_214846_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 14
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	227204	228386	4830815		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_001008535.1|227204_227939_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
WP_000103754.1|228149_228386_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 15
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	231658	233301	4830815		Pseudomonas_phage(50.0%)	2	NA	NA
WP_001257000.1|231658_232300_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
WP_001267931.1|232296_233301_+	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	30.9	8.4e-05
>prophage 16
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	245615	245873	4830815		Erwinia_phage(100.0%)	1	NA	NA
WP_000800153.1|245615_245873_+	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 17
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	253162	256885	4830815		Planktothrix_phage(50.0%)	4	NA	NA
WP_001033694.1|253162_253864_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.1e-35
WP_001251348.1|253863_255108_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_064055540.1|255136_256048_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_000952736.1|256063_256885_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
>prophage 18
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	260157	262135	4830815		Mycoplasma_phage(100.0%)	2	NA	NA
WP_000799401.1|260157_261015_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|260998_262135_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
>prophage 19
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	267255	268626	4830815		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_000423750.1|267255_268626_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	5.5e-108
>prophage 20
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	271762	275491	4830815		Enterobacteria_phage(66.67%)	5	NA	NA
WP_000444487.1|271762_273013_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001307134.1|273115_273439_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	8.0e-42
WP_032141808.1|273971_274082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373101.1|274134_274539_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332319.1|274759_275491_-	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	3.5e-53
>prophage 21
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	281357	283679	4830815		Escherichia_phage(100.0%)	1	NA	NA
WP_001307136.1|281357_283679_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	42.8	1.5e-89
>prophage 22
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	292213	293901	4830815		Morganella_phage(50.0%)	2	NA	NA
WP_000897378.1|292213_292633_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_000457616.1|292632_293901_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	83.4	7.9e-210
>prophage 23
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	320661	323413	4830815		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_074182045.1|320661_322341_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_001298109.1|322465_323413_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
>prophage 24
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	326549	330557	4830815		Pseudomonas_phage(50.0%)	5	NA	NA
WP_000804726.1|326549_327632_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
WP_000456469.1|327631_328465_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000200378.1|328461_328854_+	SirB family protein	NA	NA	NA	NA	NA
WP_001257044.1|328857_329667_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000811065.1|329702_330557_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
>prophage 25
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	333659	333890	4830815		Spodoptera_litura_granulovirus(100.0%)	1	NA	NA
WP_001146442.1|333659_333890_+	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	6.5e-06
>prophage 26
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	345143	355154	4830815		Escherichia_phage(25.0%)	10	NA	NA
WP_000702660.1|345143_346682_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
WP_000571699.1|346678_347389_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_001160110.1|347388_348066_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000555849.1|348791_349634_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001307143.1|349683_350142_-	YchJ family protein	NA	NA	NA	NA	NA
WP_001226476.1|350254_351160_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_000193437.1|351251_352265_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_000718995.1|352466_353375_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_001287378.1|353518_353932_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000068079.1|354536_355154_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.3e-53
>prophage 27
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	363564	365579	4830815		Planktothrix_phage(50.0%)	2	NA	NA
WP_000110945.1|363564_364578_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
WP_000994905.1|364574_365579_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
>prophage 28
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	377236	380194	4830815		Acinetobacter_phage(100.0%)	2	NA	NA
WP_001344826.1|377236_378595_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
WP_000763511.1|378598_380194_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
>prophage 29
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	385127	390419	4830815	protease	Chrysochromulina_ericina_virus(33.33%)	4	NA	NA
WP_000559280.1|385127_385886_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	25.0	1.5e-06
WP_000422045.1|386105_387155_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_001031530.1|387190_387442_-	YciN family protein	NA	NA	NA	NA	NA
WP_001297122.1|387821_390419_+	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.7	1.7e-86
>prophage 30
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	395342	395933	4830815		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176295.1|395342_395933_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 31
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	403748	409405	4830815		Lactococcus_phage(50.0%)	5	NA	NA
WP_000484984.1|403748_405683_-	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.9	3.1e-32
WP_001610022.1|405750_406878_-	CMD domain-containing protein	NA	NA	NA	NA	NA
WP_000506490.1|407021_407810_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_000968844.1|408177_408531_-	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_000573407.1|408598_409405_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
>prophage 32
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	422210	423476	4830815		Klosneuvirus(100.0%)	1	NA	NA
WP_000069229.1|422210_423476_+	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.0	2.0e-24
>prophage 33
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	437480	438563	4830815		Planktothrix_phage(100.0%)	1	NA	NA
WP_000057978.1|437480_438563_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	5.6e-23
>prophage 34
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	456744	457260	4830815		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945005.1|456744_457260_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	2.4e-24
>prophage 35
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	463586	470856	4830815	tRNA	Bacillus_phage(20.0%)	6	NA	NA
WP_000628065.1|463586_464819_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|465073_466057_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123738.1|466534_467908_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000081418.1|468036_468972_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.7	1.1e-144
WP_001082294.1|469147_469582_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.0e-28
WP_000837924.1|469722_470856_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
>prophage 36
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	475816	476806	4830815		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762229.1|475816_476806_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
>prophage 37
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	508092	511995	4830815		Klosneuvirus(100.0%)	1	NA	NA
WP_000139551.1|508092_511995_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
>prophage 38
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	515934	516883	4830815		Escherichia_phage(50.0%)	2	NA	NA
WP_001307188.1|515934_516465_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000731856.1|516709_516883_+	hypothetical protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	5.8e-07
>prophage 39
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	528685	538859	4830815	transposase	Escherichia_phage(20.0%)	10	NA	NA
WP_160372023.1|528685_529894_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	92.5	5.0e-206
WP_001326689.1|529933_531148_-	BenE family transporter YdcO	NA	NA	NA	NA	NA
WP_000429153.1|531200_531737_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001307191.1|531809_533771_+	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.9	7.1e-24
WP_000494244.1|533862_534093_-	YncJ family protein	NA	NA	NA	NA	NA
WP_000813794.1|534314_534491_+	type II toxin-antitoxin system mRNA interferase toxin HicA	NA	A0A0M3LQ86	Mannheimia_phage	57.9	3.6e-12
WP_001270285.1|534536_534953_+	type II toxin-antitoxin system antitoxin HicB	NA	F1C593	Cronobacter_phage	58.5	1.6e-31
WP_000760590.1|535031_536438_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_000034363.1|536682_537828_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000220411.1|537845_538859_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	2.1e-27
>prophage 40
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	542240	543050	4830815		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000867987.1|542240_543050_+	CatB-related O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	41.0	7.7e-17
>prophage 41
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	547315	549418	4830815		Salmonella_phage(100.0%)	1	NA	NA
WP_000689356.1|547315_549418_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.6	8.1e-135
>prophage 42
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	554327	560712	4830815		Ralstonia_phage(50.0%)	2	NA	NA
WP_121540880.1|554327_556436_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.3	9.6e-27
WP_053264705.1|556503_560712_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.3	4.1e-21
>prophage 43
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	564605	573875	4830815	transposase	Staphylococcus_phage(66.67%)	6	NA	NA
WP_087526055.1|564605_565580_+|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.8	1.2e-51
WP_049589868.1|565775_567401_+	phosphoethanolamine--lipid A transferase MCR-1.1	NA	NA	NA	NA	NA
WP_039003037.1|567472_568195_+	PAP2 family protein	NA	NA	NA	NA	NA
WP_087526055.1|568284_569259_+|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.8	1.2e-51
WP_071524591.1|569286_569529_+	DUF3969 family protein	NA	NA	NA	NA	NA
WP_000015432.1|569609_573875_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	44.2	3.2e-21
>prophage 44
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	579678	581223	4830815		Escherichia_phage(100.0%)	1	NA	NA
WP_000702560.1|579678_581223_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 45
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	588107	588398	4830815		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000768402.1|588107_588398_-	hypothetical protein	NA	Q1MVN1	Enterobacteria_phage	64.0	6.1e-25
>prophage 46
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	594410	595852	4830815		Escherichia_phage(50.0%)	2	NA	NA
WP_000781370.1|594410_594695_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
WP_000642407.1|594841_595852_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.3	9.6e-25
>prophage 47
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	599126	601032	4830815		Planktothrix_phage(100.0%)	2	NA	NA
WP_000072429.1|599126_600053_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	1.2e-13
WP_000193575.1|600045_601032_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	1.2e-16
>prophage 48
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	605348	609155	4830815		Klosneuvirus(50.0%)	2	NA	NA
WP_001307211.1|605348_607748_-	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.6e-09
WP_000426265.1|607772_609155_-	diguanylate cyclase DosC	NA	G3MA91	Bacillus_virus	31.5	2.0e-17
>prophage 49
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	614429	621365	4830815		Powai_lake_megavirus(50.0%)	3	NA	NA
WP_001330901.1|614429_617225_-	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	24.0	3.4e-19
WP_000832442.1|617269_619642_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_000628531.1|619679_621365_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	24.1	1.3e-10
>prophage 50
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	637953	643374	4830815		Escherichia_phage(100.0%)	1	NA	NA
WP_064055598.1|637953_643374_-	autotransporter barrel domain-containing lipoprotein	NA	A0A2L1IV18	Escherichia_phage	38.1	2.0e-140
>prophage 51
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	646777	648313	4830815		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001194889.1|646777_648313_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	23.6	2.1e-15
>prophage 52
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	656194	657613	4830815		Bacillus_phage(100.0%)	1	NA	NA
WP_000558044.1|656194_657613_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
>prophage 53
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	665358	667488	4830815		Streptococcus_phage(50.0%)	3	NA	NA
WP_000091199.1|665358_665742_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000803659.1|665773_665992_+	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000012618.1|666048_667488_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.9	1.1e-29
>prophage 54
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	674992	675883	4830815		Bacillus_phage(100.0%)	1	NA	NA
WP_000592814.1|674992_675883_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	8.2e-20
>prophage 55
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	681249	682949	4830815		Salmonella_phage(50.0%)	2	NA	NA
WP_000214712.1|681249_681453_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527797.1|681488_682949_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.8	1.1e-42
>prophage 56
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	686055	756382	4830815	portal,terminase,capsid,lysis,head,tail,integrase	Enterobacteria_phage(45.45%)	82	699861:699874	745537:745550
WP_001593356.1|686055_686637_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	2.5e-102
WP_072005420.1|686636_689708_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	81.4	1.6e-67
WP_001230353.1|689772_690372_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	95.5	3.5e-107
WP_047656194.1|690441_693855_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.8	0.0e+00
WP_071596891.1|693915_694548_-|tail	tail assembly protein	tail	C6ZCZ4	Enterobacteria_phage	87.1	7.4e-92
WP_001746230.1|694484_695228_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.3e-148
WP_001152538.1|695233_695932_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	1.1e-131
WP_000847345.1|695931_696261_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_000840326.1|696257_698819_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	90.7	0.0e+00
WP_000459488.1|698811_699246_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	1.5e-64
WP_000479169.1|699227_699650_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
WP_001609944.1|699665_700406_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	99.6	1.7e-132
699861:699874	attL	GGTCAGCGTGGTGC	NA	NA	NA	NA
WP_000683105.1|700413_700809_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975054.1|700805_701384_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	3.5e-80
WP_000753019.1|701395_701749_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.6e-62
WP_000158868.1|701760_702156_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
WP_000063218.1|702197_703223_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.7	1.4e-188
WP_001513196.1|703278_703611_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123295.1|703620_704940_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.5	3.4e-232
WP_064055599.1|706731_707016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000766229.1|707027_707570_-|terminase	phage terminase small subunit	terminase	O64316	Escherichia_phage	48.1	3.8e-36
WP_064055600.1|707771_708155_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000190773.1|708166_708508_-|head	head decoration protein	head	NA	NA	NA	NA
WP_000228103.1|708517_709558_-|capsid	phage capsid protein	capsid	C6ZCY2	Enterobacteria_phage	41.9	8.8e-66
WP_064055602.1|709775_710198_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000125507.1|710194_710440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064055603.1|710727_712545_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	50.7	1.5e-129
WP_001710148.1|712541_712841_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001113144.1|712847_713168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064055604.1|713160_713358_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_064055605.1|713557_713863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064055606.1|714827_715085_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000963723.1|715086_716328_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	42.9	9.1e-94
WP_032195596.1|716476_717358_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.2	8.0e-161
WP_000198150.1|717354_717561_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	4.9e-29
WP_001609942.1|717557_719483_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000453566.1|719457_720003_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_032195597.1|720391_720586_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	93.8	2.2e-26
WP_000738423.1|720948_721242_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001228695.1|721332_721515_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001135280.1|721731_722229_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.6	1.1e-90
WP_000839561.1|722228_722444_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	95.8	5.9e-33
WP_001348108.1|722695_723070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000506937.1|723241_723670_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_000562553.1|724036_724168_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
WP_000762868.1|725069_725891_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	2.1e-78
WP_000904112.1|725887_726262_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	8.4e-35
WP_001265040.1|726274_727324_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.1e-108
WP_064055607.1|727325_727604_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.3e-11
WP_001013637.1|727771_727984_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	98.5	3.1e-26
WP_122083109.1|728028_728136_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
WP_001117226.1|728647_729847_+	MFS transporter	NA	NA	NA	NA	NA
WP_000957771.1|729858_730551_+	calcium transporter ChaC	NA	NA	NA	NA	NA
WP_000019008.1|730547_731429_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000625668.1|731559_732837_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_001676522.1|732900_734898_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	26.2	3.3e-21
WP_001151151.1|735238_735661_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	4.8e-63
WP_001262352.1|735701_736772_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	64.6	4.7e-62
WP_000693836.1|736843_737269_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000391949.1|737252_737534_-	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
WP_000362155.1|737634_738054_+	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_000379589.1|738319_738475_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001171928.1|738634_738850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001331024.1|738836_738989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001331023.1|739389_739578_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083273.1|739574_739766_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000048286.1|739859_742331_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	1.5e-58
WP_001296941.1|742418_742655_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000876986.1|742689_743970_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.6	1.7e-156
WP_001389342.1|743971_744100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836079.1|744157_745177_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
WP_001370501.1|745188_746403_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
745537:745550	attR	GGTCAGCGTGGTGC	NA	NA	NA	NA
WP_000598292.1|746608_746935_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705211.1|747069_747411_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138584.1|747445_748006_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|748008_748719_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001295396.1|748826_749132_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041535.1|749330_751757_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	2.9e-213
WP_001340362.1|751817_754241_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
WP_000213028.1|754251_754869_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_000526492.1|754870_755725_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148710.1|755767_756382_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
>prophage 57
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	774143	775445	4830815		Bacillus_phage(100.0%)	1	NA	NA
WP_000732497.1|774143_775445_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.9	4.2e-17
>prophage 58
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	785520	787332	4830815		Vaccinia_virus(100.0%)	1	NA	NA
WP_000945878.1|785520_787332_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	100.0	0.0e+00
>prophage 59
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	807215	808490	4830815	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001295400.1|807215_808490_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 60
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	815401	816900	4830815		Salmonella_phage(50.0%)	2	NA	NA
WP_001296937.1|815401_815923_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	7.8e-47
WP_000250661.1|816003_816900_-	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	3.6e-07
>prophage 61
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	825702	834494	4830815		Streptomyces_phage(20.0%)	9	NA	NA
WP_000101193.1|825702_826518_+	C40 family peptidase	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
WP_000007283.1|826645_827227_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000701040.1|827372_828542_-	MFS transporter	NA	NA	NA	NA	NA
WP_000102278.1|828707_828797_-	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000190982.1|829095_830121_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
WP_000269501.1|830117_831050_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001182363.1|831162_832374_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000098911.1|832664_833813_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.7	4.2e-85
WP_000493947.1|833852_834494_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
>prophage 62
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	839998	842265	4830815		Edwardsiella_phage(50.0%)	3	NA	NA
WP_000587560.1|839998_840811_-	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
WP_001070029.1|840814_841600_-	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_001349911.1|841596_842265_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.2	1.0e-22
>prophage 63
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	850555	855639	4830815		environmental_halophage(33.33%)	5	NA	NA
WP_000144578.1|850555_851776_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.4	4.4e-93
WP_000908012.1|851772_853044_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000948855.1|853018_853765_-	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	24.0	5.1e-07
WP_000089364.1|853774_855262_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000367160.1|855270_855639_-	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	4.3e-15
>prophage 64
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	874231	893824	4830815	tRNA	Tupanvirus(22.22%)	19	NA	NA
WP_000553696.1|874231_875932_+	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.8	1.6e-32
WP_000069375.1|875988_878367_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	9.4e-172
WP_000368046.1|878699_879533_+	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_001082226.1|879689_880736_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
WP_001270809.1|880867_881059_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_000175617.1|881062_882499_-	YdiU family protein	NA	NA	NA	NA	NA
WP_001299130.1|882561_883275_-	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_001209780.1|883521_883986_-	lipoprotein	NA	S5MM68	Bacillus_phage	37.7	9.5e-12
WP_000029466.1|884063_884813_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001154187.1|884812_885364_-	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000956530.1|885426_886407_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001229265.1|886507_886807_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000672343.1|886811_889199_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018588.1|889213_890197_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_001386830.1|890479_890524_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|890646_891003_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|891055_891253_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|891349_891892_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144190.1|891895_893824_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	5.5e-130
>prophage 65
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	905123	907385	4830815		Tupanvirus(100.0%)	1	NA	NA
WP_000077825.1|905123_907385_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	2.3e-143
>prophage 66
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	913512	914340	4830815		Bacillus_virus(100.0%)	1	NA	NA
WP_000175009.1|913512_914340_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.6	5.9e-73
>prophage 67
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	921816	923037	4830815		Klosneuvirus(100.0%)	1	NA	NA
WP_000081983.1|921816_923037_-	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	5.5e-27
>prophage 68
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	929801	930455	4830815		Bacillus_phage(100.0%)	1	NA	NA
WP_001299207.1|929801_930455_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.1	9.6e-10
>prophage 69
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	936055	938017	4830815		Streptococcus_phage(100.0%)	1	NA	NA
WP_001235796.1|936055_938017_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	4.1e-40
>prophage 70
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	942943	947028	4830815		Tupanvirus(50.0%)	4	NA	NA
WP_001120535.1|942943_943585_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	34.9	2.2e-19
WP_000438813.1|943677_945036_-	MFS transporter	NA	NA	NA	NA	NA
WP_000719088.1|945152_945911_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000723710.1|946047_947028_-	NADH-dependent methylglyoxal reductase	NA	A0A2H4PQR8	Staphylococcus_phage	21.5	2.3e-07
>prophage 71
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	955841	956696	4830815		Indivirus(100.0%)	1	NA	NA
WP_001186332.1|955841_956696_-	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.6	1.1e-10
>prophage 72
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	960013	964590	4830815		Bacillus_phage(100.0%)	3	NA	NA
WP_000219686.1|960013_961297_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
WP_000616433.1|961443_962919_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000766132.1|963099_964590_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	6.4e-09
>prophage 73
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	970540	971749	4830815	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_000826413.1|970540_971749_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	92.5	8.6e-206
>prophage 74
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	981087	989194	4830815	tRNA	Staphylococcus_phage(33.33%)	8	NA	NA
WP_000758422.1|981087_982773_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
WP_000268230.1|982977_983559_-	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_001220979.1|983598_984294_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000128847.1|984351_986262_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_001295493.1|986393_986738_+	RidA family protein	NA	NA	NA	NA	NA
WP_001331208.1|987100_987460_+	DUF1889 family protein	NA	NA	NA	NA	NA
WP_000457334.1|987579_987759_-	YoaH family protein	NA	NA	NA	NA	NA
WP_000854972.1|987832_989194_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	3.4e-41
>prophage 75
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	993056	994613	4830815		Moraxella_phage(100.0%)	1	NA	NA
WP_000394983.1|993056_994613_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 76
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1000253	1000463	4830815		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|1000253_1000463_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 77
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1005793	1007842	4830815		Moraxella_phage(100.0%)	1	NA	NA
WP_001315679.1|1005793_1007842_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
>prophage 78
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1015338	1019808	4830815		Escherichia_phage(33.33%)	7	NA	NA
WP_000812735.1|1015338_1015995_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.7	8.0e-57
WP_000976472.1|1016390_1016732_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879282.1|1016744_1017617_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000204699.1|1017620_1017995_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|1018133_1018364_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011658.1|1018465_1019122_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944256.1|1019145_1019808_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
>prophage 79
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1027864	1029340	4830815		Cyanophage(100.0%)	1	NA	NA
WP_000301720.1|1027864_1029340_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.3	9.9e-79
>prophage 80
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1033339	1040403	4830815		Bacillus_virus(50.0%)	9	NA	NA
WP_001184045.1|1033339_1034662_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_001342995.1|1034677_1035610_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202996.1|1035688_1036444_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_000571479.1|1036440_1037226_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568519.1|1037372_1038383_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|1038391_1039003_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_001386853.1|1039141_1039207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024930.1|1039277_1039880_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|1039881_1040403_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
>prophage 81
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1044452	1046461	4830815		Escherichia_coli_phage(50.0%)	3	NA	NA
WP_001336487.1|1044452_1045229_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.1e-72
WP_000252980.1|1045281_1045677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019588.1|1045717_1046461_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
>prophage 82
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1053077	1054811	4830815	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001025326.1|1053077_1054811_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
>prophage 83
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1060063	1065707	4830815		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_000763867.1|1060063_1060453_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036378.1|1060467_1061517_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204335.1|1061519_1062380_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483202.1|1062398_1064000_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.7	4.9e-15
WP_001297437.1|1064045_1065707_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
>prophage 84
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1075794	1077309	4830815		Cedratvirus(100.0%)	1	NA	NA
WP_001187810.1|1075794_1077309_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.7	1.3e-12
>prophage 85
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1095399	1101538	4830815		Liberibacter_phage(50.0%)	3	NA	NA
WP_032172471.1|1095399_1098684_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.4	4.7e-65
WP_050485724.1|1098705_1100025_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_032172473.1|1100014_1101538_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	39.5	2.2e-89
>prophage 86
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1118610	1119363	4830815		Bacillus_virus(100.0%)	1	NA	NA
WP_001272994.1|1118610_1119363_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
>prophage 87
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1131181	1131850	4830815		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000334587.1|1131181_1131850_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.7	1.5e-82
>prophage 88
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1145866	1159612	4830815	transposase	Bacillus_phage(28.57%)	13	NA	NA
WP_077248946.1|1145866_1147561_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
WP_063078592.1|1147798_1147981_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_063078593.1|1148059_1148977_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001507517.1|1149149_1150070_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000786004.1|1150058_1150529_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	1.5e-33
WP_063078594.1|1150509_1151928_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.4	1.1e-100
WP_000365561.1|1151994_1152690_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.8e-07
WP_001375929.1|1152729_1152975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088491938.1|1153031_1154244_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.3	1.6e-167
WP_000824370.1|1154974_1156033_+	outer membrane protein F	NA	Q1MVN1	Enterobacteria_phage	49.3	1.1e-92
WP_032294196.1|1156624_1157476_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_021547009.1|1157582_1158941_-	two-component system sensor histidine kinase HprS	NA	NA	NA	NA	NA
WP_001339045.1|1158940_1159612_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
>prophage 89
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1163156	1166838	4830815	integrase	Escherichia_phage(33.33%)	4	1165334:1165393	1180015:1180094
WP_001079074.1|1163156_1163687_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
WP_001442913.1|1164439_1165237_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
1165334:1165393	attL	CGATTCCTCTGTAGTTCAGTCGGTAGAACGGCGGACTGTTAATCCGTATGTCACTGGTTC	NA	NA	NA	NA
WP_072808028.1|1165575_1166106_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	42.1	2.0e-29
WP_077248793.1|1166199_1166838_+|integrase	site-specific integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	42.3	1.1e-29
1180015:1180094	attR	CGATTCCTCTGTAGTTCAGTCGGTAGAACGGCGGACTGTTAATCCGTATGTCACTGGTTCGAGTCCAGTCAGAGGAGCCA	NA	NA	NA	NA
>prophage 90
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1200941	1202743	4830815	transposase	Escherichia_phage(100.0%)	2	NA	NA
WP_023278068.1|1200941_1201721_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.2	2.2e-138
WP_032178008.1|1201720_1202743_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.3e-199
>prophage 91
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1212520	1214679	4830815		Yersinia_phage(33.33%)	4	NA	NA
WP_001234530.1|1212520_1213342_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.5	3.6e-46
WP_000860076.1|1213423_1213903_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	8.9e-13
WP_001186773.1|1213918_1214395_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692323.1|1214457_1214679_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
>prophage 92
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1219020	1220187	4830815		Stx2-converting_phage(100.0%)	1	NA	NA
WP_001320295.1|1219020_1220187_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	98.7	5.5e-226
>prophage 93
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1227831	1228731	4830815		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131782.1|1227831_1228731_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 94
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1236085	1238905	4830815		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_063078856.1|1236085_1237252_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.2	4.4e-114
WP_061351668.1|1237498_1238905_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	6.2e-38
>prophage 95
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1244170	1251699	4830815		Escherichia_phage(28.57%)	7	NA	NA
WP_061351663.1|1244170_1244719_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	56.1	8.5e-52
WP_061351662.1|1244723_1245602_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	6.6e-107
WP_063078854.1|1245659_1246559_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.2	5.7e-29
WP_000699422.1|1246558_1247644_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.5	1.0e-101
WP_000183060.1|1248015_1248909_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_000999466.1|1249151_1250147_-	SDR family oxidoreductase	NA	A0A1V0QG29	Shearwaterpox_virus	26.3	1.9e-09
WP_001570045.1|1250304_1251699_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	3.7e-19
>prophage 96
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1257315	1264285	4830815		Bacillus_phage(25.0%)	6	NA	NA
WP_001504404.1|1257315_1258686_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.5	1.7e-32
WP_000079243.1|1259054_1260491_-	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.2	5.7e-47
WP_000699704.1|1260493_1261717_-	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_000479836.1|1261713_1262193_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000043595.1|1262195_1263161_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.8	2.9e-87
WP_000048188.1|1263163_1264285_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	65.2	9.0e-133
>prophage 97
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1268529	1279024	4830815		uncultured_marine_virus(20.0%)	8	NA	NA
WP_000654503.1|1268529_1269369_-	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	9.7e-07
WP_000137118.1|1269546_1271709_-	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	2.4e-17
WP_000482901.1|1271711_1272155_-	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_000978094.1|1272160_1273300_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_001300971.1|1273958_1275542_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_063078850.1|1275834_1277688_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001234767.1|1277709_1278291_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.3e-31
WP_001295424.1|1278382_1279024_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
>prophage 98
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1283758	1285111	4830815		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_000469697.1|1283758_1285111_+	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	21.1	7.1e-07
>prophage 99
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1298960	1305067	4830815	tRNA	Bacillus_phage(50.0%)	6	NA	NA
WP_000675150.1|1298960_1300364_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
WP_000137877.1|1300360_1301083_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000929408.1|1301273_1301606_+	YegP family protein	NA	NA	NA	NA	NA
WP_000476014.1|1301752_1303114_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
WP_001318299.1|1303444_1303762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807356.1|1304167_1305067_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.7e-12
>prophage 100
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1314287	1317844	4830815		Serratia_phage(50.0%)	4	NA	NA
WP_000846219.1|1314287_1315292_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	1.3e-13
WP_000011976.1|1315288_1316254_+	sugar kinase	NA	NA	NA	NA	NA
WP_000434038.1|1316227_1316974_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001297420.1|1317025_1317844_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	2.3e-24
>prophage 101
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1328493	1330527	4830815	tRNA	Indivirus(100.0%)	1	NA	NA
WP_001295427.1|1328493_1330527_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
>prophage 102
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1343038	1352480	4830815		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292767.1|1343038_1344175_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	4.6e-161
WP_001331478.1|1344171_1346172_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
WP_001295429.1|1346296_1346758_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|1346798_1347269_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|1347315_1348035_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|1348031_1349717_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240398.1|1349938_1350670_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001216963.1|1350729_1350837_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|1350817_1351549_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569361.1|1351553_1352480_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
>prophage 103
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1372795	1374316	4830815		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000255042.1|1372795_1374316_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 104
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1378010	1381796	4830815		Cellulophaga_phage(50.0%)	3	NA	NA
WP_001139613.1|1378010_1378679_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
WP_000425438.1|1378936_1379773_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000489247.1|1379804_1381796_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	2.0e-13
>prophage 105
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1385865	1386723	4830815		Catovirus(100.0%)	1	NA	NA
WP_000873890.1|1385865_1386723_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	34.0	1.4e-24
>prophage 106
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1401218	1405519	4830815		Ostreococcus_tauri_virus(50.0%)	4	NA	NA
WP_000848232.1|1401218_1402685_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.3	2.3e-43
WP_000198822.1|1402802_1403789_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_001296828.1|1403827_1404541_+	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000241011.1|1404952_1405519_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
>prophage 107
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1411273	1418921	4830815		Vibrio_phage(50.0%)	7	NA	NA
WP_000194939.1|1411273_1412863_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	33.6	3.2e-19
WP_000202798.1|1412866_1413211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213382.1|1413543_1414734_-	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	2.9e-20
WP_001234850.1|1414761_1415457_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578076.1|1415605_1417366_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	3.2e-100
WP_000494183.1|1417490_1417775_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000050789.1|1417913_1418921_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	1.5e-83
>prophage 108
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1430620	1431238	4830815		Bacillus_virus(100.0%)	1	NA	NA
WP_000888560.1|1430620_1431238_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
>prophage 109
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1440005	1445783	4830815		Bacillus_phage(25.0%)	5	NA	NA
WP_000422187.1|1440005_1441649_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	9.5e-14
WP_000884922.1|1441724_1442375_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_000786386.1|1442374_1443439_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
WP_000406102.1|1443512_1444568_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000865572.1|1444679_1445783_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	59.4	6.2e-118
>prophage 110
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1450059	1452909	4830815		Hokovirus(100.0%)	1	NA	NA
WP_000876014.1|1450059_1452909_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
>prophage 111
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1462609	1476665	4830815		Pseudomonas_phage(33.33%)	8	NA	NA
WP_001281229.1|1462609_1465237_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	3.1e-91
WP_000990754.1|1465383_1466106_+	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_001610493.1|1466233_1469968_-	AIDA-I family autotransporter adhesin YfaL/EhaC	NA	A0A2L1IV18	Escherichia_phage	27.3	1.1e-20
WP_001075177.1|1470663_1472949_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.1e-283
WP_000332036.1|1473037_1474168_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	2.5e-175
WP_000135040.1|1474167_1474422_+	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000301050.1|1474475_1475126_-	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
WP_000779084.1|1475588_1476665_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
>prophage 112
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1482558	1483461	4830815	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000140553.1|1482558_1483461_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.4	9.6e-69
>prophage 113
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1486613	1491617	4830815		Tupanvirus(50.0%)	4	NA	NA
WP_001297077.1|1486613_1487216_-	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	3.4e-09
WP_001388277.1|1487523_1488663_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	29.8	1.1e-29
WP_000461657.1|1488666_1489635_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.5	8.8e-36
WP_000860259.1|1489634_1491617_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	1.8e-19
>prophage 114
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1526033	1529261	4830815		Salmonella_phage(50.0%)	3	NA	NA
WP_000813860.1|1526033_1526633_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
WP_001012899.1|1526691_1528524_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_001203389.1|1528610_1529261_-	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	34.3	5.2e-08
>prophage 115
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1539820	1541693	4830815		Sodalis_phage(50.0%)	2	NA	NA
WP_000156113.1|1539820_1540723_-	recombination-promoting nuclease RpnB	NA	Q2A0A7	Sodalis_phage	44.5	8.2e-68
WP_001293612.1|1540919_1541693_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
>prophage 116
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1545904	1547422	4830815		Mollivirus(100.0%)	1	NA	NA
WP_000334218.1|1545904_1547422_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	1.0e-86
>prophage 117
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1553898	1555035	4830815		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000699121.1|1553898_1555035_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	5.9e-23
>prophage 118
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1563608	1564694	4830815		Pandoravirus(100.0%)	1	NA	NA
WP_000918470.1|1563608_1564694_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
>prophage 119
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1582576	1583509	4830815		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000368131.1|1582576_1583509_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
>prophage 120
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1586548	1587982	4830815		Bacillus_phage(100.0%)	1	NA	NA
WP_000194515.1|1586548_1587982_+	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
>prophage 121
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1594634	1602211	4830815		Hokovirus(50.0%)	4	NA	NA
WP_001325644.1|1594634_1598228_+	acid-sensing system histidine kinase EvgS	NA	A0A1V0SGX0	Hokovirus	32.1	1.7e-36
WP_001296867.1|1598283_1599429_-	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_000955028.1|1599502_1600447_-	transporter YfdV	NA	NA	NA	NA	NA
WP_001283499.1|1600516_1602211_-	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.0e-23
>prophage 122
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1605902	1606823	4830815		Morganella_phage(100.0%)	1	NA	NA
WP_000484404.1|1605902_1606823_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	4.9e-76
>prophage 123
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1610641	1611376	4830815		Clostridioides_phage(100.0%)	1	NA	NA
WP_001295458.1|1610641_1611376_+	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
>prophage 124
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1637069	1652439	4830815		Streptococcus_phage(33.33%)	15	NA	NA
WP_000443665.1|1637069_1639085_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.4	6.5e-150
WP_001297862.1|1639155_1640142_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000254843.1|1640371_1641133_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_000034402.1|1641317_1642289_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000487600.1|1642672_1642930_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000623136.1|1642974_1644702_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
WP_000522247.1|1644742_1645252_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000096660.1|1645293_1646145_-	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000719943.1|1646249_1646618_+	YfeK family protein	NA	NA	NA	NA	NA
WP_162014431.1|1646620_1647532_-	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.6	5.9e-58
WP_000021040.1|1647665_1648763_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
WP_000852686.1|1648752_1649628_-	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_000458405.1|1649627_1650461_-	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_000290223.1|1650460_1651477_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000517431.1|1651647_1652439_-	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	8.9e-18
>prophage 125
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1655917	1660855	4830815		Mycobacterium_phage(33.33%)	6	NA	NA
WP_001315775.1|1655917_1657222_+	penicillin binding protein PBP4B	NA	A0A0B5A438	Mycobacterium_phage	26.2	1.6e-08
WP_000084590.1|1657279_1658179_-	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_000838945.1|1658274_1658850_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_000842944.1|1658910_1659360_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000406000.1|1659346_1659772_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_000102891.1|1659985_1660855_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	4.2e-13
>prophage 126
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1679409	1680360	4830815		Cyanophage(100.0%)	1	NA	NA
WP_001003709.1|1679409_1680360_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 127
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1698388	1699102	4830815		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|1698388_1699102_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 128
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1720394	1724396	4830815		Enterobacteria_phage(33.33%)	4	NA	NA
WP_000198328.1|1720394_1721684_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
WP_001295473.1|1721769_1722396_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001295474.1|1722720_1723758_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.1e-71
WP_001028614.1|1723757_1724396_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
>prophage 129
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1730642	1737902	4830815		Escherichia_phage(66.67%)	7	NA	NA
WP_000017552.1|1730642_1730795_-	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
WP_000076001.1|1730812_1731004_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_072645677.1|1732091_1732610_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	8.5e-62
WP_000755174.1|1732625_1733165_+	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	99.4	9.9e-45
WP_000138282.1|1733257_1734835_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_001299507.1|1734903_1736370_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_064055575.1|1736531_1737902_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	36.0	1.4e-42
>prophage 130
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1746731	1747163	4830815		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963837.1|1746731_1747163_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
>prophage 131
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1757045	1763502	4830815		Mycoplasma_phage(20.0%)	8	NA	NA
WP_000133582.1|1757045_1758329_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	2.2e-34
WP_000523616.1|1758506_1758707_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_001124469.1|1758718_1759054_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_001196613.1|1759055_1760906_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
WP_000384411.1|1760922_1761438_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_000028953.1|1761533_1761857_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000331707.1|1761873_1762260_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_001295373.1|1762287_1763502_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
>prophage 132
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1778666	1780178	4830815		Staphylococcus_phage(100.0%)	1	NA	NA
WP_032186603.1|1778666_1780178_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.0	1.8e-11
>prophage 133
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1785936	1797226	4830815		Bacillus_phage(50.0%)	7	NA	NA
WP_000919159.1|1785936_1787190_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
WP_000883122.1|1787517_1788708_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000717694.1|1788752_1789091_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_001298983.1|1789151_1790486_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_001345753.1|1790475_1791189_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001297612.1|1791353_1792781_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	3.0e-16
WP_064055576.1|1793338_1797226_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.4	7.0e-132
>prophage 134
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1801345	1801606	4830815		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196283.1|1801345_1801606_+	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.1e-17
>prophage 135
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1805064	1808807	4830815		Tetraselmis_virus(50.0%)	3	NA	NA
WP_001068343.1|1805064_1805745_-	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
WP_000002542.1|1806017_1806992_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790168.1|1807007_1808807_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
>prophage 136
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1814578	1820837	4830815	tRNA	Cafeteria_roenbergensis_virus(25.0%)	7	NA	NA
WP_000219193.1|1814578_1815913_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_000365855.1|1816121_1817003_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189207.1|1817105_1817693_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627807.1|1817748_1818132_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001262716.1|1818436_1819126_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_064055577.1|1819173_1820211_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|1820417_1820837_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
>prophage 137
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1826130	1827429	4830815		Burkholderia_virus(100.0%)	1	NA	NA
WP_000230378.1|1826130_1827429_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.4	4.3e-46
>prophage 138
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1833293	1835867	4830815		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001235102.1|1833293_1835867_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
>prophage 139
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1841773	1842844	4830815		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001168054.1|1841773_1842844_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	5.3e-90
>prophage 140
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1856618	1864088	4830815	transposase,integrase	Escherichia_phage(60.0%)	5	1854406:1854419	1861521:1861534
1854406:1854419	attL	CGACTATTTGAACT	NA	NA	NA	NA
WP_000162574.1|1856618_1857101_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001341819.1|1857843_1859073_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	100.0	1.5e-234
WP_000448925.1|1859111_1859528_+	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
WP_000577254.1|1861351_1863070_-	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	99.8	3.2e-307
1861521:1861534	attR	AGTTCAAATAGTCG	NA	NA	NA	NA
WP_000878196.1|1863221_1864088_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
>prophage 141
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1869642	1873694	4830815		Klosneuvirus(50.0%)	4	NA	NA
WP_000097662.1|1869642_1870923_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	1.4e-33
WP_001295173.1|1871160_1872561_+	GABA permease	NA	NA	NA	NA	NA
WP_000156811.1|1872581_1873244_+	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_000522424.1|1873244_1873694_-	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
>prophage 142
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1877629	1882925	4830815		Oenococcus_phage(20.0%)	5	NA	NA
WP_001223227.1|1877629_1877875_+	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
WP_000080947.1|1877871_1878282_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
WP_000246540.1|1878254_1880399_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.0	2.1e-194
WP_000777969.1|1880408_1881368_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	3.5e-133
WP_000985494.1|1881722_1882925_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
>prophage 143
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1896109	1901669	4830815	tRNA	Vibrio_phage(25.0%)	5	NA	NA
WP_000906486.1|1896109_1896295_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000047176.1|1896529_1899160_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000140509.1|1899287_1899788_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000963143.1|1900030_1901092_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000132234.1|1901171_1901669_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	50.3	1.5e-31
>prophage 144
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1907135	1908101	4830815		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287410.1|1907135_1908101_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	2.3e-36
>prophage 145
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1915576	1916587	4830815		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001402444.1|1915576_1916587_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.3	1.0e-26
>prophage 146
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1934415	1941555	4830815		Escherichia_phage(83.33%)	6	NA	NA
WP_001272894.1|1934415_1936977_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	2.3e-30
WP_001141330.1|1937082_1937739_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
WP_001272549.1|1937789_1938587_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	5.9e-70
WP_000847985.1|1938752_1939661_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590388.1|1939657_1940920_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.7	5.7e-136
WP_001278994.1|1940916_1941555_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 147
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1946769	1950485	4830815		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000081550.1|1946769_1947762_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272590.1|1947824_1948964_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|1949103_1949730_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|1949723_1950485_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 148
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1953597	1955630	4830815		Tupanvirus(50.0%)	2	NA	NA
WP_001173673.1|1953597_1954203_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	4.2e-28
WP_001090379.1|1954202_1955630_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.4	3.7e-30
>prophage 149
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1980275	1981061	4830815		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_000021321.1|1980275_1981061_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	6.5e-21
>prophage 150
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1985717	1990637	4830815		Vibrio_phage(33.33%)	4	NA	NA
WP_001199970.1|1985717_1986389_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.7e-14
WP_001288227.1|1986527_1986668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000036723.1|1987613_1988912_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_000210878.1|1988999_1990637_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
>prophage 151
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	1994669	1998784	4830815		Erysipelothrix_phage(50.0%)	2	NA	NA
WP_000046785.1|1994669_1995971_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.7	2.0e-38
WP_000186450.1|1996027_1998784_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
>prophage 152
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	2006318	2007167	4830815		Vibrio_phage(100.0%)	1	NA	NA
WP_000100430.1|2006318_2007167_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	4.7e-41
>prophage 153
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	2011935	2012781	4830815		Bacillus_phage(100.0%)	1	NA	NA
WP_001214598.1|2011935_2012781_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	5.6e-10
>prophage 154
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	2024307	2039694	4830815	tRNA	Bacillus_phage(33.33%)	9	NA	NA
WP_001307370.1|2024307_2025513_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.8	2.3e-73
WP_000184251.1|2025512_2025956_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_000117728.1|2026006_2026813_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	2.2e-16
WP_000678646.1|2026889_2027987_-	murein transglycosylase A	NA	NA	NA	NA	NA
WP_000016907.1|2028566_2029820_-	N-acetylmuramoyl-L-alanine amidase	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_000237947.1|2030051_2031383_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000775955.1|2031444_2033271_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.7	3.5e-25
WP_001285997.1|2033270_2036813_-	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	20.9	1.5e-08
WP_001138163.1|2036805_2039694_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.6	1.2e-67
>prophage 155
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	2045171	2051944	4830815		Geobacillus_virus(33.33%)	6	NA	NA
WP_000816232.1|2045171_2045966_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
WP_000204658.1|2045972_2046848_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000957914.1|2046998_2049245_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000564489.1|2049257_2049788_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000082188.1|2050472_2051162_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000895624.1|2051230_2051944_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
>prophage 156
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	2061575	2064070	4830815		Aichi_virus(50.0%)	2	NA	NA
WP_000256438.1|2061575_2062994_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	26.9	1.8e-24
WP_000603508.1|2063308_2064070_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	4.5e-19
>prophage 157
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	2079140	2087306	4830815	transposase	Enterobacteria_phage(75.0%)	4	NA	NA
WP_000027057.1|2079140_2080001_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001235713.1|2080183_2080741_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_001143760.1|2080904_2083910_+|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
WP_001272558.1|2086550_2087306_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 158
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	2111585	2126977	4830815	tRNA	environmental_Halophage(14.29%)	14	NA	NA
WP_001280192.1|2111585_2112986_+	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
WP_001295158.1|2113003_2114320_+	guanine deaminase	NA	NA	NA	NA	NA
WP_000012163.1|2114355_2115723_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	73.1	2.1e-160
WP_000838428.1|2115758_2116247_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_001626722.1|2116246_2118166_-	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_001295374.1|2118601_2120050_+	purine permease	NA	Q9KX94	Enterobacteria_phage	26.8	7.3e-26
WP_001050745.1|2120051_2120177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795390.1|2120173_2120245_-	protein YqfH	NA	NA	NA	NA	NA
WP_001192790.1|2120299_2120848_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_064055641.1|2120890_2122408_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	4.5e-87
WP_001701073.1|2122417_2123516_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000813220.1|2123606_2125340_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.5	3.2e-60
WP_000715208.1|2125345_2126056_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000806637.1|2126080_2126977_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
>prophage 159
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	2130901	2136274	4830815		Pandoravirus(50.0%)	3	NA	NA
WP_001307385.1|2130901_2132335_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.9	5.7e-31
WP_000951941.1|2132391_2133135_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000195023.1|2133400_2136274_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.0	3.7e-263
>prophage 160
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	2144801	2146034	4830815		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|2144801_2146034_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 161
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	2164085	2164763	4830815		Bacillus_virus(100.0%)	1	NA	NA
WP_000956868.1|2164085_2164763_+	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.1	6.4e-09
>prophage 162
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	2178339	2179494	4830815		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001062128.1|2178339_2179494_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 163
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	2233065	2234238	4830815		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000524972.1|2233065_2234238_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	30.7	4.2e-40
>prophage 164
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	2256452	2257337	4830815		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000018760.1|2256452_2257337_+	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 165
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	2263413	2274237	4830815		Staphylococcus_phage(25.0%)	9	NA	NA
WP_000013149.1|2263413_2264241_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	7.2e-63
WP_000691598.1|2264440_2265367_+	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000848528.1|2265417_2265675_+	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_000095187.1|2265717_2267937_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_000059395.1|2268047_2269460_-	cell division protein FtsP	NA	NA	NA	NA	NA
WP_000965712.1|2269534_2270272_-	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_001281841.1|2270505_2272764_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	1.8e-84
WP_000183494.1|2273309_2273792_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000712658.1|2273844_2274237_-	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
>prophage 166
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	2278064	2289026	4830815		Bacillus_virus(20.0%)	12	NA	NA
WP_000195292.1|2278064_2279957_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	34.9	7.6e-92
WP_000105733.1|2279985_2280567_-	esterase YqiA	NA	NA	NA	NA	NA
WP_000444747.1|2280566_2281394_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000833393.1|2281418_2281841_-	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000917117.1|2281841_2282471_-	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
WP_000735278.1|2282675_2284157_+	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000831543.1|2284304_2284976_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000442860.1|2284981_2286142_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
WP_000188373.1|2286179_2286995_-	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_001295627.1|2287110_2287884_+	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_000469266.1|2287941_2288112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001076997.1|2288372_2289026_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
>prophage 167
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	2298541	2299975	4830815		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869178.1|2298541_2299975_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 168
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	2305112	2306351	4830815	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_000708504.1|2305112_2306351_+|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.6	1.0e-92
>prophage 169
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	2312733	2318091	4830815	tRNA	Moraxella_phage(33.33%)	4	NA	NA
WP_001264365.1|2312733_2313747_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	4.8e-109
WP_001144069.1|2313983_2314199_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918827.1|2314309_2316055_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
WP_000437371.1|2316249_2318091_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
>prophage 170
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	2321524	2323701	4830815		Klebsiella_phage(33.33%)	4	NA	NA
WP_000692350.1|2321524_2321746_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_072661507.1|2321814_2322291_-	RadC family protein	NA	NA	NA	NA	NA
WP_000214315.1|2322306_2322792_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.0	5.3e-13
WP_001234702.1|2322882_2323701_-	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	40.3	8.0e-46
>prophage 171
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	2328930	2338617	4830815	transposase	Liberibacter_phage(50.0%)	6	NA	NA
WP_086598320.1|2328930_2329245_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	90.3	1.7e-25
WP_016240669.1|2330105_2330456_-|transposase	transposase	transposase	Q716C1	Shigella_phage	97.7	4.0e-39
WP_064055656.1|2330668_2333686_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	25.2	2.3e-21
WP_063085660.1|2333700_2334864_-	DUF4268 domain-containing protein	NA	NA	NA	NA	NA
WP_112923079.1|2334873_2336187_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_001407279.1|2336193_2338617_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U4	Liberibacter_phage	28.1	6.0e-25
>prophage 172
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	2352119	2354542	4830815	transposase	Enterobacteria_phage(50.0%)	2	NA	NA
WP_000053329.1|2352119_2353130_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.3	5.1e-18
WP_001313178.1|2353510_2354542_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	94.9	1.5e-166
>prophage 173
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	2360622	2372912	4830815	tRNA,integrase	Salmonella_phage(40.0%)	8	2349492:2349507	2374128:2374143
2349492:2349507	attL	GCCGATAAAAATCCCG	NA	NA	NA	NA
WP_000268404.1|2360622_2361219_-	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	87.4	9.4e-97
WP_001696226.1|2361348_2362665_-|integrase	site-specific integrase	integrase	A0A248SL35	Klebsiella_phage	29.1	9.2e-36
WP_000018005.1|2364012_2364636_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000094692.1|2364742_2366263_-	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	52.2	1.4e-35
WP_000627213.1|2366569_2368060_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	4.8e-33
WP_000450589.1|2368101_2368434_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_000212470.1|2368652_2369636_+	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_001082869.1|2369819_2372912_+	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.2	2.6e-158
2374128:2374143	attR	CGGGATTTTTATCGGC	NA	NA	NA	NA
>prophage 174
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	2385433	2386399	4830815		Escherichia_phage(100.0%)	1	NA	NA
WP_001098805.1|2385433_2386399_+	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 175
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	2412632	2414927	4830815		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861734.1|2412632_2414927_-	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	7.4e-158
>prophage 176
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	2422914	2424060	4830815		Streptococcus_phage(100.0%)	1	NA	NA
WP_064055651.1|2422914_2424060_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	40.9	8.2e-49
>prophage 177
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	2447070	2454863	4830815		Streptococcus_phage(25.0%)	10	NA	NA
WP_000809253.1|2447070_2447931_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.3	2.1e-49
WP_000249160.1|2447994_2450031_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_000246855.1|2449988_2450384_+	YraN family protein	NA	NA	NA	NA	NA
WP_001158034.1|2450403_2450994_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000646043.1|2451003_2451579_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_000147622.1|2451692_2452733_-	permease	NA	NA	NA	NA	NA
WP_001298741.1|2452805_2453441_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_000037608.1|2453568_2454087_+	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	4.4e-10
WP_000449030.1|2454066_2454510_-	YhbP family protein	NA	NA	NA	NA	NA
WP_000189314.1|2454560_2454863_+	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	3.9e-14
>prophage 178
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	2460690	2462580	4830815		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001295553.1|2460690_2462580_-	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 179
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	2468061	2474700	4830815		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
WP_000133044.1|2468061_2470734_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	2.5e-24
WP_001031055.1|2470758_2472246_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_001300397.1|2472273_2472726_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_000207685.1|2473356_2474700_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
>prophage 180
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	2478782	2481655	4830815	protease	Pandoravirus(50.0%)	2	NA	NA
WP_000764731.1|2478782_2479631_-	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
WP_001107467.1|2479720_2481655_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
>prophage 181
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	2488283	2489761	4830815		Indivirus(50.0%)	2	NA	NA
WP_001047336.1|2488283_2489255_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
WP_000445418.1|2489482_2489761_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	3.4e-17
>prophage 182
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	2493829	2508624	4830815		Staphylococcus_phage(25.0%)	17	NA	NA
WP_000438245.1|2493829_2494639_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
WP_000922901.1|2494848_2495826_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_001295557.1|2495839_2496826_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000030016.1|2496846_2497413_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
WP_000030537.1|2497409_2497985_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000669785.1|2497953_2498511_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000224099.1|2498517_2499243_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000809051.1|2499290_2500724_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_001176599.1|2500746_2501034_+	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_001331180.1|2501151_2501643_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_000243741.1|2501688_2502543_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000216791.1|2502539_2502812_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000620405.1|2503025_2503658_+	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000047091.1|2503654_2504383_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_001299134.1|2504379_2505033_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000809785.1|2505262_2507599_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.3e-40
WP_001176896.1|2507694_2508624_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
>prophage 183
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	2515373	2520121	4830815		Salmonella_phage(50.0%)	5	NA	NA
WP_000445145.1|2515373_2516501_+	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	87.8	1.4e-72
WP_000979882.1|2516560_2517025_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000209003.1|2517021_2517897_-	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000054239.1|2517893_2518583_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_000108473.1|2518630_2520121_-	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.9	4.9e-09
>prophage 184
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	2523825	2524323	4830815	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_000366129.1|2523825_2524323_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	42.9	3.3e-26
>prophage 185
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	2528289	2530814	4830815	protease	uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001295271.1|2528289_2529657_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
WP_000497723.1|2529746_2530814_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
>prophage 186
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	2547590	2548634	4830815		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|2547590_2548634_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 187
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	2559199	2560084	4830815		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001258900.1|2559199_2560084_+	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.2	1.1e-24
>prophage 188
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	2566588	2570742	4830815		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000738579.1|2566588_2567614_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	2.4e-71
WP_000019674.1|2567681_2568863_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_001299298.1|2568872_2569976_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000078338.1|2569983_2570742_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.2e-19
>prophage 189
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	2581075	2582547	4830815	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
WP_000114984.1|2581075_2581585_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
WP_000004479.1|2581599_2582547_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
>prophage 190
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	2602424	2607998	4830815		Tupanvirus(33.33%)	7	NA	NA
WP_000031783.1|2602424_2603609_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000124700.1|2603679_2605794_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_001138043.1|2605890_2606361_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000246815.1|2606457_2606832_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000903377.1|2606957_2607245_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000820720.1|2607252_2607612_-	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_001209710.1|2607611_2607998_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	38.3	5.6e-18
>prophage 191
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	2613568	2623109	4830815		Tupanvirus(25.0%)	9	NA	NA
WP_000634798.1|2613568_2615482_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	4.3e-74
WP_000057405.1|2615481_2616504_+	hydrolase	NA	NA	NA	NA	NA
WP_000907085.1|2616497_2616716_+	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_001275838.1|2616769_2617639_+	phosphoribulokinase	NA	NA	NA	NA	NA
WP_001148908.1|2617693_2618098_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000242750.1|2618399_2619032_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001295162.1|2619082_2621173_+	membrane protein	NA	H9YQA8	environmental_Halophage	100.0	1.7e-76
WP_000963785.1|2621239_2622460_-	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_000601847.1|2622545_2623109_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	55.8	1.2e-61
>prophage 192
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	2647336	2648173	4830815		Vibrio_phage(100.0%)	1	NA	NA
WP_000742143.1|2647336_2648173_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	4.9e-67
>prophage 193
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	2665148	2669659	4830815		Bacillus_phage(66.67%)	5	NA	NA
WP_001298201.1|2665148_2666771_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	5.3e-142
WP_000493758.1|2666887_2667205_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000650976.1|2667263_2667560_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001253696.1|2667590_2668943_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
WP_001157751.1|2668939_2669659_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 194
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	2683070	2685464	4830815		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_000081909.1|2683070_2685464_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 195
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	2689843	2691070	4830815		Ralstonia_phage(100.0%)	1	NA	NA
WP_001105504.1|2689843_2691070_-	RtcB family protein	NA	A0A1L7N133	Ralstonia_phage	60.0	4.0e-134
>prophage 196
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	2700299	2702747	4830815		Dickeya_phage(100.0%)	1	NA	NA
WP_000993449.1|2700299_2702747_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 197
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	2722755	2724566	4830815		Enterococcus_phage(50.0%)	2	NA	NA
WP_000073590.1|2722755_2723499_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.0	6.4e-10
WP_000907790.1|2723495_2724566_-	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
>prophage 198
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	2728106	2729589	4830815		Planktothrix_phage(50.0%)	2	NA	NA
WP_000416895.1|2728106_2728820_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	9.1e-14
WP_000082101.1|2728821_2729589_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
>prophage 199
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	2735323	2738142	4830815		Salicola_phage(50.0%)	3	NA	NA
WP_000130217.1|2735323_2736178_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
WP_060618110.1|2736422_2737481_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000617723.1|2737473_2738142_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
>prophage 200
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	2741148	2745280	4830815		Dickeya_phage(50.0%)	4	NA	NA
WP_000964718.1|2741148_2741775_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
WP_000106527.1|2741848_2744047_+	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.3	5.0e-119
WP_000130621.1|2744148_2744394_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_001100467.1|2744614_2745280_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.6	5.6e-58
>prophage 201
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	2753173	2759070	4830815		Bacillus_virus(33.33%)	6	NA	NA
WP_000173666.1|2753173_2753980_+	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	4.5e-17
WP_001190064.1|2753985_2754387_+	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_000593555.1|2754506_2754866_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_001259388.1|2754862_2755138_-	type II toxin-antitoxin system HicA family toxin	NA	R4JMD3	Burkholderia_phage	48.8	3.2e-15
WP_001615305.1|2755210_2756335_-	ABC-2 transporter permease	NA	NA	NA	NA	NA
WP_000149132.1|2756334_2759070_-	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	4.1e-22
>prophage 202
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	2772482	2774525	4830815		Indivirus(100.0%)	1	NA	NA
WP_001298719.1|2772482_2774525_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.1	6.8e-46
>prophage 203
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	2777639	2779774	4830815		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
WP_000008957.1|2777639_2777993_+	arsenical resistance operon transcriptional regulator ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	9.7e-25
WP_000922639.1|2778046_2779336_+	arsenite/antimonite:H(+) antiporter ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	4.6e-173
WP_000065786.1|2779348_2779774_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	2.5e-51
>prophage 204
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	2784651	2785299	4830815		Bacillus_virus(100.0%)	1	NA	NA
WP_001296814.1|2784651_2785299_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.5	6.1e-17
>prophage 205
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	2832279	2834264	4830815		Bacillus_virus(50.0%)	2	NA	NA
WP_000107024.1|2832279_2833284_-	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	1.1e-17
WP_001196486.1|2833280_2834264_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	3.9e-15
>prophage 206
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	2844321	2846655	4830815		Escherichia_phage(100.0%)	1	NA	NA
WP_000013916.1|2844321_2846655_-	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.4	1.1e-71
>prophage 207
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	2850309	2852333	4830815	transposase	Morganella_phage(50.0%)	3	NA	NA
WP_000014594.1|2850309_2850522_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
WP_001135746.1|2850709_2850862_-	type I toxin-antitoxin system toxin HokA	NA	NA	NA	NA	NA
WP_087522250.1|2850963_2852333_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	99.5	6.3e-112
>prophage 208
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	2856192	2857188	4830815		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182653.1|2856192_2857188_+	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.7	9.1e-12
>prophage 209
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	2862506	2864048	4830815		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001146479.1|2862506_2864048_+	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	2.5e-16
>prophage 210
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	2888235	2898926	4830815	tRNA	uncultured_Caudovirales_phage(66.67%)	7	NA	NA
WP_000582487.1|2888235_2890080_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.6	1.3e-16
WP_000206275.1|2890076_2891468_-|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_000779792.1|2891565_2892174_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_001746441.1|2892402_2896638_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.3	9.6e-26
WP_001271686.1|2896609_2896993_+	protein YhhH	NA	NA	NA	NA	NA
WP_000072855.1|2897097_2897940_+	lyase	NA	NA	NA	NA	NA
WP_001346013.1|2898092_2898926_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	47.0	3.3e-23
>prophage 211
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	2921056	2931784	4830815		Rhizobium_phage(16.67%)	10	NA	NA
WP_000024392.1|2921056_2921308_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
WP_001315904.1|2921448_2921880_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_001352773.1|2922124_2923669_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001214147.1|2923678_2924962_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_000483856.1|2924965_2925925_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000982091.1|2925911_2926946_-	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	5.8e-09
WP_000646014.1|2927184_2928210_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_001213834.1|2928219_2929416_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	4.9e-36
WP_000842823.1|2929690_2930548_-	protein YibB	NA	NA	NA	NA	NA
WP_000587764.1|2930851_2931784_+	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	1.1e-35
>prophage 212
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	2943715	2948278	4830815		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_001171866.1|2943715_2944195_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.0	4.8e-27
WP_001114533.1|2944233_2945043_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
WP_001051798.1|2945140_2945308_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000091955.1|2945328_2945565_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001352775.1|2945781_2946450_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_000050152.1|2946621_2947842_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.7	1.1e-43
WP_000976070.1|2947819_2948278_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	9.6e-49
>prophage 213
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	2951651	2958402	4830815		Morganella_phage(33.33%)	5	NA	NA
WP_001299758.1|2951651_2952476_+	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	76.6	6.9e-90
WP_000924289.1|2952767_2953385_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_001295237.1|2955321_2955945_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_000135058.1|2955999_2956275_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000280488.1|2956293_2958402_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
>prophage 214
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	2963523	2964915	4830815		environmental_Halophage(100.0%)	1	NA	NA
WP_001330986.1|2963523_2964915_+	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 215
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	2971194	2975163	4830815	transposase,integrase	Enterobacteria_phage(50.0%)	2	2970008:2970022	2973434:2973448
2970008:2970022	attL	CATCATCAGAACCGT	NA	NA	NA	NA
WP_001218908.1|2971194_2972379_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	69.9	3.4e-162
WP_087526051.1|2974359_2975163_+|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	38.9	6.4e-32
2973434:2973448	attR	ACGGTTCTGATGATG	NA	NA	NA	NA
>prophage 216
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	2985168	2989228	4830815	transposase	Escherichia_phage(100.0%)	3	NA	NA
WP_001322394.1|2985168_2986185_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	1.1e-185
WP_032178008.1|2987426_2988449_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.3e-199
WP_023278068.1|2988448_2989228_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.2	2.2e-138
>prophage 217
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3001647	3004057	4830815		Yersinia_phage(33.33%)	4	NA	NA
WP_072645737.1|3001647_3002466_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.3	6.1e-46
WP_000855064.1|3002807_3003281_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	29.6	3.3e-12
WP_001186775.1|3003296_3003773_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692345.1|3003835_3004057_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
>prophage 218
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3012947	3014282	4830815		Moraxella_phage(100.0%)	1	NA	NA
WP_001349999.1|3012947_3014282_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.2	6.6e-66
>prophage 219
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3021586	3030747	4830815		Micromonas_sp._RCC1109_virus(25.0%)	10	NA	NA
WP_000168432.1|3021586_3023275_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.7	5.4e-57
WP_001315912.1|3023380_3023479_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_000060506.1|3024042_3024132_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_000828746.1|3024550_3025735_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	8.9e-14
WP_000148063.1|3025742_3026240_-	radical SAM protein	NA	NA	NA	NA	NA
WP_001113432.1|3026236_3026599_-	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000703959.1|3026588_3026936_-	YidH family protein	NA	NA	NA	NA	NA
WP_000511287.1|3027045_3027495_+	membrane protein	NA	NA	NA	NA	NA
WP_064055591.1|3027541_3029035_-	sulfatase-like hydrolase/transferase	NA	A0A2K9L1A5	Tupanvirus	25.3	5.5e-29
WP_001087147.1|3029031_3030747_-	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.6	5.6e-41
>prophage 220
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3037100	3038054	4830815		Synechococcus_phage(50.0%)	2	NA	NA
WP_001243431.1|3037100_3037529_-	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
WP_001243437.1|3037640_3038054_-	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
>prophage 221
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3042481	3043630	4830815		Oenococcus_phage(100.0%)	1	NA	NA
WP_000705001.1|3042481_3043630_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	3.6e-52
>prophage 222
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3048336	3055705	4830815		Bacillus_virus(33.33%)	8	NA	NA
WP_000072067.1|3048336_3050751_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
WP_000060118.1|3050779_3051853_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000673464.1|3051852_3052953_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000059111.1|3052957_3054361_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_120795392.1|3054657_3054738_+	protein YsdD	NA	NA	NA	NA	NA
WP_000831330.1|3054967_3055108_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_000239730.1|3055124_3055484_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_001307474.1|3055447_3055705_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
>prophage 223
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3065904	3067242	4830815		Moraxella_phage(100.0%)	1	NA	NA
WP_001299598.1|3065904_3067242_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
>prophage 224
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3078233	3082074	4830815		Bacillus_phage(50.0%)	4	NA	NA
WP_000063125.1|3078233_3079007_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
WP_001251991.1|3079097_3079988_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000741620.1|3079987_3080947_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_000867146.1|3081033_3082074_-	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
>prophage 225
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3087606	3090968	4830815		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_000334099.1|3087606_3089436_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.4	1.9e-132
WP_000933736.1|3089597_3090968_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	3.1e-34
>prophage 226
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3102920	3103913	4830815		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845133.1|3102920_3103913_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.3	6.5e-50
>prophage 227
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3107081	3112934	4830815		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_000102319.1|3107081_3108950_+	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	6.0e-65
WP_001297694.1|3109116_3109536_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_064055594.1|3109543_3111049_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	4.6e-15
WP_000211858.1|3111053_3112019_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_001056273.1|3112043_3112934_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
>prophage 228
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3126325	3127972	4830815		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001012602.1|3126325_3127972_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.6	1.4e-65
>prophage 229
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3136387	3141799	4830815		Bacillus_phage(33.33%)	4	NA	NA
WP_001238869.1|3136387_3138409_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	2.9e-113
WP_001299253.1|3138455_3139940_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000047499.1|3140073_3141339_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
WP_001280776.1|3141469_3141799_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
>prophage 230
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3145841	3151985	4830815		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000866672.1|3145841_3146972_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	31.3	3.9e-27
WP_000006618.1|3146968_3148231_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	5.9e-24
WP_001226604.1|3148230_3149298_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.7	3.5e-102
WP_000676056.1|3149316_3150198_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
WP_001145196.1|3150175_3150850_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000612036.1|3150854_3151985_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.6e-18
>prophage 231
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3168270	3173869	4830815		Salmonella_phage(100.0%)	4	NA	NA
WP_000678268.1|3168270_3169584_-	hypothetical protein	NA	A0A0U2C3T4	Salmonella_phage	33.6	4.7e-08
WP_001584059.1|3169580_3171059_-	hypothetical protein	NA	A0A0U2C3T4	Salmonella_phage	54.7	1.8e-43
WP_000864455.1|3171119_3172430_-	hypothetical protein	NA	A0A0U2C3T4	Salmonella_phage	46.4	1.5e-09
WP_001584061.1|3172426_3173869_-	hypothetical protein	NA	A0A0U2C3T4	Salmonella_phage	52.7	1.5e-34
>prophage 232
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3176909	3180768	4830815		Bacillus_phage(100.0%)	3	NA	NA
WP_000130691.1|3176909_3177806_+	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
WP_001213584.1|3177805_3178522_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000383424.1|3178605_3180768_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
>prophage 233
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3188254	3190084	4830815		Catovirus(100.0%)	1	NA	NA
WP_001617666.1|3188254_3190084_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	7.4e-84
>prophage 234
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3202496	3205783	4830815		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_000187530.1|3202496_3204137_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	8.2e-42
WP_001295260.1|3204215_3204485_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000459592.1|3204488_3205004_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_000109943.1|3205006_3205783_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
>prophage 235
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3214573	3215188	4830815		Streptococcus_phage(100.0%)	1	NA	NA
WP_001296979.1|3214573_3215188_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	1.6e-19
>prophage 236
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3228877	3231664	4830815		uncultured_virus(100.0%)	1	NA	NA
WP_064055626.1|3228877_3231664_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	4.9e-71
>prophage 237
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3235742	3238213	4830815		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
WP_001188776.1|3235742_3237152_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
WP_000190577.1|3237163_3238213_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
>prophage 238
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3254436	3257216	4830815		Staphylococcus_phage(50.0%)	3	NA	NA
WP_000718896.1|3254436_3255333_-	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	90.7	9.6e-61
WP_000621656.1|3255500_3256397_+	sulfofructose kinase	NA	NA	NA	NA	NA
WP_000059678.1|3256430_3257216_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	8.2e-24
>prophage 239
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3266070	3269121	4830815		Escherichia_phage(100.0%)	1	NA	NA
WP_011310337.1|3266070_3269121_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
>prophage 240
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3284661	3289522	4830815		Bacillus_thuringiensis_phage(33.33%)	5	NA	NA
WP_001297064.1|3284661_3285282_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
WP_001166062.1|3285541_3286525_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001270272.1|3286673_3287348_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580417.1|3287453_3288827_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033722.1|3288823_3289522_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
>prophage 241
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3301096	3305599	4830815		Paramecium_bursaria_Chlorella_virus(50.0%)	5	NA	NA
WP_000084268.1|3301096_3301942_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|3302366_3302612_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|3302696_3303182_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000139496.1|3303274_3304201_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293343.1|3304267_3305599_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
>prophage 242
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3311236	3315421	4830815		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_131454242.1|3311236_3315421_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.0	1.8e-24
>prophage 243
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3328289	3335536	4830815		Synechococcus_phage(33.33%)	5	NA	NA
WP_000424845.1|3328289_3328952_-	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
WP_001174093.1|3328963_3331465_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_001004454.1|3331773_3332853_+	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000161265.1|3332867_3333188_+	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_000184824.1|3333238_3335536_+	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
>prophage 244
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3347652	3348867	4830815		Oenococcus_phage(100.0%)	1	NA	NA
WP_000690934.1|3347652_3348867_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	28.6	5.9e-45
>prophage 245
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3355616	3357461	4830815		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000591359.1|3355616_3357461_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.0	7.1e-10
>prophage 246
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3366053	3369106	4830815		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000023081.1|3366053_3367004_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
WP_000031784.1|3367921_3369106_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 247
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3373222	3381551	4830815		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_000263098.1|3373222_3377251_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
WP_000653944.1|3377327_3381551_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	2.5e-66
>prophage 248
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3390767	3392531	4830815		Klosneuvirus(50.0%)	3	NA	NA
WP_000362392.1|3390767_3391439_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
WP_000940106.1|3391481_3392072_+	YjaG family protein	NA	NA	NA	NA	NA
WP_001044513.1|3392258_3392531_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
>prophage 249
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3397899	3399489	4830815		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187566.1|3397899_3399489_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	1.3e-68
>prophage 250
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3414854	3418538	4830815		Dickeya_phage(100.0%)	1	NA	NA
WP_000096055.1|3414854_3418538_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 251
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3424188	3424980	4830815		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001130534.1|3424188_3424980_+	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	45.5	1.4e-47
>prophage 252
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3440842	3441958	4830815		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|3440842_3441958_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 253
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3451173	3451782	4830815		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|3451173_3451782_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 254
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3458403	3460951	4830815		Escherichia_phage(50.0%)	2	NA	NA
WP_000918363.1|3458403_3459819_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
WP_001147328.1|3459871_3460951_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
>prophage 255
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3465139	3468752	4830815		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000357740.1|3465139_3467962_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
WP_000168305.1|3468215_3468752_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
>prophage 256
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3480781	3482740	4830815		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078239.1|3480781_3482740_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.4	1.9e-90
>prophage 257
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3492022	3494170	4830815		Escherichia_phage(100.0%)	1	NA	NA
WP_001300547.1|3492022_3494170_-	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.9	7.0e-33
>prophage 258
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3499415	3506984	4830815	transposase	Tetraselmis_virus(33.33%)	5	NA	NA
WP_001307516.1|3499415_3501401_-	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.5	5.5e-149
WP_064055537.1|3501755_3502736_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	8.9e-185
WP_001311314.1|3503786_3504482_-	D-allulose-6-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_000507106.1|3504492_3505473_-	D-allose ABC transporter permease	NA	NA	NA	NA	NA
WP_000235252.1|3505451_3506984_-	D-allose ABC transporter ATP-binding protein AlsA	NA	G3M9Y6	Bacillus_virus	27.0	2.8e-12
>prophage 259
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3513219	3514769	4830815		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_000611404.1|3513219_3513900_-	phosphonate C-P lyase system protein PhnL	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.5	7.1e-08
WP_001075526.1|3514010_3514769_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	27.8	1.0e-15
>prophage 260
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3520373	3521162	4830815		Cedratvirus(100.0%)	1	NA	NA
WP_001193391.1|3520373_3521162_-	phosphonate ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	30.1	8.5e-13
>prophage 261
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3526001	3527504	4830815		Burkholderia_virus(100.0%)	1	NA	NA
WP_064055532.1|3526001_3527504_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.2	3.1e-56
>prophage 262
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3548700	3551912	4830815	tRNA	Catovirus(50.0%)	2	NA	NA
WP_001295074.1|3548700_3550218_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
WP_000856832.1|3550454_3551912_-	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.4	4.0e-48
>prophage 263
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3566188	3568172	4830815		Cronobacter_phage(50.0%)	2	NA	NA
WP_001026276.1|3566188_3566482_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|3566525_3568172_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
>prophage 264
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3573957	3574491	4830815		Morganella_phage(100.0%)	1	NA	NA
WP_001238369.1|3573957_3574491_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
>prophage 265
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3579411	3580389	4830815		Tupanvirus(100.0%)	1	NA	NA
WP_000004771.1|3579411_3580389_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
>prophage 266
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3587817	3588363	4830815		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001295188.1|3587817_3588363_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
>prophage 267
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3592278	3605309	4830815	protease,tRNA	Vibrio_phage(20.0%)	11	NA	NA
WP_000990312.1|3592278_3593616_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_001122507.1|3593625_3595473_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.4e-60
WP_001280345.1|3595465_3596416_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|3596501_3596810_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460360.1|3596885_3598166_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312488.1|3598251_3599511_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|3599513_3600518_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|3600599_3600797_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|3600900_3602199_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_064055546.1|3602403_3602829_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076316.1|3602867_3605309_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
>prophage 268
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3609240	3610404	4830815		Ralstonia_phage(100.0%)	1	NA	NA
WP_000943984.1|3609240_3610404_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.5	1.3e-81
>prophage 269
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3651973	3658461	4830815		uncultured_Caudovirales_phage(33.33%)	6	NA	NA
WP_000055075.1|3651973_3652504_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000265933.1|3652813_3653770_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000210554.1|3653909_3655412_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.1e-11
WP_001368084.1|3655425_3656448_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000595979.1|3656434_3657430_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853753.1|3657462_3658461_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
>prophage 270
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3662776	3665538	4830815		Cronobacter_phage(50.0%)	2	NA	NA
WP_001106238.1|3662776_3663241_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.1	1.1e-52
WP_000187778.1|3663399_3665538_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
>prophage 271
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3669176	3675633	4830815	transposase	Paramecium_bursaria_Chlorella_virus(66.67%)	7	NA	NA
WP_001181324.1|3669176_3670124_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
WP_001387276.1|3670308_3670362_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000471866.1|3670502_3673199_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_001118337.1|3673243_3673699_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000047539.1|3673764_3674151_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|3674223_3674685_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013046.1|3674697_3675633_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
>prophage 272
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3683911	3694988	4830815	tRNA,integrase	Klosneuvirus(25.0%)	8	3677101:3677115	3705201:3705215
3677101:3677115	attL	TCTCTGTCAGCACTA	NA	NA	NA	NA
WP_000416392.1|3683911_3686767_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.8e-140
WP_000786399.1|3686766_3687210_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|3687343_3688855_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584114.1|3689121_3690222_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001295681.1|3690221_3691304_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_001294545.1|3691422_3692925_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	6.1e-84
WP_001514390.1|3693007_3693217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001218930.1|3693722_3694988_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.0	2.2e-79
3705201:3705215	attR	TAGTGCTGACAGAGA	NA	NA	NA	NA
>prophage 273
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3710238	3711951	4830815		Moraxella_phage(100.0%)	1	NA	NA
WP_064055550.1|3710238_3711951_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	25.5	3.4e-22
>prophage 274
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3715984	3720094	4830815	transposase	Sodalis_phage(50.0%)	6	NA	NA
WP_001566978.1|3715984_3716329_+	ProQ/FinO family protein	NA	Q2A0A1	Sodalis_phage	39.7	1.0e-07
WP_001566979.1|3716347_3716896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000958149.1|3717138_3717375_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_021559485.1|3717443_3718019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162014428.1|3718033_3718183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001352368.1|3718885_3720094_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
>prophage 275
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3729783	3739464	4830815		Mycobacterium_phage(25.0%)	7	NA	NA
WP_000109895.1|3729783_3731238_-	restriction endonuclease	NA	A0A142K7G3	Mycobacterium_phage	24.5	2.1e-09
WP_001040176.1|3731237_3733385_-	N-6 DNA methylase	NA	B3GAM1	uncultured_virus	43.8	2.6e-19
WP_000148644.1|3733435_3733822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000504877.1|3733818_3735162_-	McrC family protein	NA	NA	NA	NA	NA
WP_000177023.1|3735154_3737230_-	AAA domain-containing protein	NA	K4I1H4	Acidithiobacillus_phage	33.8	4.5e-37
WP_000168592.1|3737399_3738272_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_000991444.1|3738483_3739464_-	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	Q08JA2	Stx2-converting_phage	55.9	2.5e-102
>prophage 276
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3742827	3744504	4830815		Escherichia_phage(100.0%)	2	NA	NA
WP_000790583.1|3742827_3743430_+	type 1 fimbria regulatory protein FimB	NA	A0A2L1IV36	Escherichia_phage	52.3	3.1e-55
WP_000044711.1|3743907_3744504_+	type 1 fimbria regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
>prophage 277
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3755547	3757008	4830815		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208180.1|3755547_3757008_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	1.6e-49
>prophage 278
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3771631	3772576	4830815	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000181170.1|3771631_3772576_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.7	5.9e-61
>prophage 279
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3792599	3797955	4830815		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
WP_000919572.1|3792599_3794255_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
WP_000410144.1|3794303_3795665_-	MFS transporter	NA	NA	NA	NA	NA
WP_000091572.1|3795879_3796794_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000106033.1|3796932_3797955_+	zinc-binding alcohol dehydrogenase family protein	NA	A0A2K9L7I1	Tupanvirus	26.3	2.7e-11
>prophage 280
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3801181	3802461	4830815		Shigella_phage(50.0%)	2	NA	NA
WP_000799911.1|3801181_3801919_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
WP_064055630.1|3801921_3802461_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	61.7	4.9e-28
>prophage 281
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3810391	3813267	4830815		Streptococcus_phage(50.0%)	3	NA	NA
WP_000175943.1|3810391_3811981_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
WP_001295748.1|3812373_3812979_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|3813105_3813267_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
>prophage 282
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3818902	3820225	4830815		Geobacillus_virus(100.0%)	1	NA	NA
WP_000477793.1|3818902_3820225_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	1.0e-79
>prophage 283
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3826968	3832323	4830815		Enterococcus_phage(33.33%)	3	NA	NA
WP_000093810.1|3826968_3828201_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.6e-82
WP_000046742.1|3828507_3830175_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.2	1.4e-41
WP_000409451.1|3830385_3832323_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
>prophage 284
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3835606	3837720	4830815		Bacillus_phage(50.0%)	2	NA	NA
WP_001188666.1|3835606_3836296_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	2.0e-29
WP_001219605.1|3836295_3837720_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	22.1	7.2e-10
>prophage 285
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3849488	3858557	4830815		Cyanophage(20.0%)	9	NA	NA
WP_000130185.1|3849488_3850442_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.5	1.7e-10
WP_001295414.1|3850556_3851144_+	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000528538.1|3851178_3851745_-	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001102385.1|3851893_3852607_-	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000843558.1|3852632_3853037_-	DUF2541 family protein	NA	NA	NA	NA	NA
WP_000516135.1|3853413_3855330_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_001118464.1|3855418_3856549_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_001331242.1|3856652_3856862_-	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	72.5	2.3e-18
WP_000681359.1|3857390_3858557_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.3	4.4e-90
>prophage 286
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3865591	3868408	4830815	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001286857.1|3865591_3868408_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	2.7e-77
>prophage 287
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3872814	3873963	4830815		Halovirus(100.0%)	1	NA	NA
WP_000597260.1|3872814_3873963_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.7e-49
>prophage 288
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3879433	3885094	4830815		Hepacivirus(50.0%)	4	NA	NA
WP_001297614.1|3879433_3880987_-	crotonobetaine/carnitine-CoA ligase	NA	Q75ZG1	Hepacivirus	25.4	4.7e-31
WP_000349938.1|3881060_3882278_-	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_000347117.1|3882406_3883549_-	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000787111.1|3883579_3885094_-	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
>prophage 289
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3892988	3894388	4830815		Bacillus_phage(50.0%)	2	NA	NA
WP_000624375.1|3892988_3893468_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
WP_000257186.1|3893545_3894388_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.0e-08
>prophage 290
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3902132	3907555	4830815		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001117011.1|3902132_3905039_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
WP_000035654.1|3905203_3907555_-	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.5	1.3e-37
>prophage 291
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3913887	3914586	4830815		Planktothrix_phage(100.0%)	1	NA	NA
WP_000916310.1|3913887_3914586_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	36.7	2.3e-22
>prophage 292
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3927288	3929013	4830815		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_000425658.1|3927288_3929013_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	8.3e-37
>prophage 293
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3954986	3956030	4830815		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217338.1|3954986_3956030_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 294
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3960275	3960827	4830815		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923721.1|3960275_3960827_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	32.3	3.0e-12
>prophage 295
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3969454	3970879	4830815		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102485.1|3969454_3970879_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 296
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3978528	3984996	4830815		Mamastrovirus(33.33%)	5	NA	NA
WP_001189664.1|3978528_3980079_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	7.8e-18
WP_001331234.1|3980125_3982516_-	pyrroloquinoline quinone-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_001609215.1|3982721_3983258_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_000651599.1|3983298_3983961_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000150637.1|3984069_3984996_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
>prophage 297
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3988258	3989161	4830815		Sodalis_phage(100.0%)	1	NA	NA
WP_000339946.1|3988258_3989161_+	recombination-promoting nuclease RpnC	NA	Q2A0A7	Sodalis_phage	49.2	5.7e-61
>prophage 298
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	3999067	4005873	4830815	tRNA	unidentified_phage(50.0%)	6	NA	NA
WP_000174643.1|3999067_4000486_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
WP_000937434.1|4000524_4001451_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_001155227.1|4001487_4001943_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_000396024.1|4002120_4002825_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001294697.1|4002839_4003370_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_001542630.1|4003443_4005873_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.3	3.9e-40
>prophage 299
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	4011116	4011914	4830815		Planktothrix_phage(100.0%)	1	NA	NA
WP_001158929.1|4011116_4011914_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	6.0e-14
>prophage 300
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	4017825	4018170	4830815		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|4017825_4018170_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 301
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	4022099	4023524	4830815	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000753945.1|4022099_4023524_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
>prophage 302
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	4035405	4100095	4830815	protease,transposase,tRNA,plate	Flavobacterium_phage(11.11%)	53	NA	NA
WP_001295562.1|4035405_4036164_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
WP_000922446.1|4036176_4037034_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_001295561.1|4037045_4038398_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|4038427_4040860_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|4040981_4041467_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139279.1|4041470_4042496_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|4042600_4043056_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|4043059_4043848_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139667.1|4043847_4044996_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569430.1|4044992_4045589_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_001294757.1|4045625_4049108_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000055741.1|4049120_4050080_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020973.1|4050178_4052320_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|4052376_4052766_+	VOC family protein	NA	NA	NA	NA	NA
WP_000176578.1|4052830_4054129_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|4054177_4054438_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|4054424_4054625_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185290.1|4054790_4055336_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635316.1|4055332_4055755_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239192.1|4055768_4056479_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000399647.1|4056728_4057709_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_001260712.1|4058789_4060508_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094011.1|4060619_4061327_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|4061323_4061728_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874224.1|4061845_4062661_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|4062700_4063354_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|4063346_4064378_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140174.1|4064565_4065138_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997010.1|4070896_4071700_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
WP_000648606.1|4071696_4072611_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|4072851_4073652_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211689.1|4073729_4074500_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|4074547_4075906_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052710.1|4075977_4076733_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001297210.1|4076766_4077489_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|4077485_4077953_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297205.1|4078017_4078749_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_001086142.1|4080065_4080851_+	aminopeptidase	NA	NA	NA	NA	NA
WP_001236649.1|4080987_4081467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908052.1|4081476_4082391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284199.1|4082434_4082917_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087745.1|4082940_4084293_-	membrane protein	NA	NA	NA	NA	NA
WP_122985538.1|4084303_4087738_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240530.1|4087846_4089259_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088859.1|4089263_4090007_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_001766987.1|4090003_4092847_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	27.6	1.0e-79
WP_000343302.1|4092855_4093617_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246437.1|4093621_4094953_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|4094955_4095480_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113725.1|4095476_4096757_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348806.1|4096781_4097864_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393845.1|4097827_4099678_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000611738.1|4099681_4100095_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 303
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	4103811	4110264	4830815		Ralstonia_phage(50.0%)	2	NA	NA
WP_000103361.1|4103811_4105953_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	8.2e-26
WP_000508710.1|4106028_4110264_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.3	1.5e-23
>prophage 304
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	4117441	4121360	4830815		Caulobacter_phage(50.0%)	6	NA	NA
WP_000284050.1|4117441_4118020_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000333380.1|4118225_4118993_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|4118963_4119704_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000615982.1|4119859_4120138_-	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_000729704.1|4120140_4120401_-	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000543899.1|4120586_4121360_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
>prophage 305
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	4126438	4127578	4830815		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000528870.1|4126438_4127578_+	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	32.0	5.3e-32
>prophage 306
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	4132255	4138087	4830815		Streptococcus_phage(50.0%)	4	NA	NA
WP_000749865.1|4132255_4133311_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	2.0e-118
WP_001285288.1|4133598_4134702_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893255.1|4134713_4135967_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
WP_087526018.1|4137535_4138087_+	hypothetical protein	NA	A0A1L5C2A2	Pseudoalteromonas_phage	60.0	1.2e-05
>prophage 307
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	4145285	4217564	4830815	holin,integrase	Enterobacteria_phage(52.94%)	60	4193470:4193485	4216392:4216407
WP_001609339.1|4145285_4147127_+	hypothetical protein	NA	A0A140G5Z0	Enterobacteria_phage	27.5	4.2e-18
WP_001240681.1|4147174_4147852_+	hypothetical protein	NA	A0A1D7XFF4	Escherichia_phage	51.8	1.7e-46
WP_064055618.1|4147932_4149267_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000068781.1|4149458_4151396_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000857772.1|4151476_4153318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067395.1|4154456_4155383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001609341.1|4155733_4156078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001273463.1|4156360_4157026_+	recombinase family protein	NA	A0A0F7L6S1	uncultured_marine_virus	41.1	1.5e-31
WP_032195564.1|4157293_4159000_+	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_001609345.1|4159136_4159634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001330891.1|4159873_4160335_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000908078.1|4160365_4161547_+	DUF4062 domain-containing protein	NA	NA	NA	NA	NA
WP_001130497.1|4162255_4163440_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.4	3.2e-144
WP_000064054.1|4163432_4165061_+	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_000622599.1|4165057_4165798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000446152.1|4166100_4166673_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.8	6.5e-95
WP_000638629.1|4166746_4167247_-	transactivation protein	NA	NA	NA	NA	NA
WP_001283027.1|4167243_4167978_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.4	1.4e-129
WP_001149160.1|4168529_4168796_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_000980231.1|4168792_4169392_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	80.3	1.9e-49
WP_001244665.1|4169384_4169672_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_000459302.1|4169664_4170120_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
WP_000856729.1|4170255_4170576_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000783650.1|4170590_4172924_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.6	0.0e+00
WP_001111349.1|4173542_4173953_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000121326.1|4173931_4174888_-	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000667026.1|4174897_4177096_-	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
WP_000643328.1|4177092_4178049_-	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
WP_000070693.1|4178045_4178735_-	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_001019920.1|4179152_4179767_+	YagU family protein	NA	NA	NA	NA	NA
WP_001303809.1|4180014_4180344_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001305432.1|4180656_4181367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001330883.1|4181335_4182979_-	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_064055617.1|4182968_4185494_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000716392.1|4185519_4186188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000730974.1|4186245_4186833_-	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_001296902.1|4186907_4187450_-	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_001147277.1|4188272_4188500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000866436.1|4188534_4188675_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_000803998.1|4188674_4188938_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000662258.1|4189300_4189402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000092556.1|4190517_4194771_+	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
4193470:4193485	attL	CTGGTGCTGAATGTTG	NA	NA	NA	NA
WP_064055616.1|4194891_4195749_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001299025.1|4195997_4196867_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.7	9.3e-53
WP_001299021.1|4197026_4197620_-	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000474074.1|4197631_4197868_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_064055615.1|4197976_4199302_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	7.2e-113
WP_000339587.1|4199527_4200382_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001102115.1|4200911_4201631_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000023910.1|4201641_4203069_+	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_000370308.1|4203061_4203757_+	lactate utilization protein C	NA	NA	NA	NA	NA
WP_071593451.1|4205628_4206822_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_001406334.1|4207967_4208729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001315275.1|4208882_4209677_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001295805.1|4210006_4210570_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	53.3	6.0e-53
WP_001616491.1|4210815_4210950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001159102.1|4211644_4213315_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_000089063.1|4213328_4214801_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001351501.1|4214814_4215402_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000131044.1|4215530_4217564_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
4216392:4216407	attR	CTGGTGCTGAATGTTG	NA	NA	NA	NA
>prophage 308
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	4230290	4234828	4830815		Bacillus_virus(50.0%)	4	NA	NA
WP_000447335.1|4230290_4231775_+	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.7	8.0e-12
WP_000818900.1|4231767_4232739_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000750340.1|4232735_4233692_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000692742.1|4233778_4234828_+	NADPH-dependent aldehyde reductase YahK	NA	A0A0G2YAX3	Acanthamoeba_polyphaga_mimivirus	42.3	1.1e-71
>prophage 309
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	4243205	4245092	4830815		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000010270.1|4243205_4245092_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	3.1e-53
>prophage 310
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	4249280	4250180	4830815		Lactobacillus_phage(100.0%)	1	NA	NA
WP_000952485.1|4249280_4250180_-	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	4.2e-16
>prophage 311
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	4254020	4258300	4830815		Herpes_simplex_virus(50.0%)	2	NA	NA
WP_001609427.1|4254020_4257095_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	99.5	0.0e+00
WP_000805902.1|4257217_4258300_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	100.0	7.5e-193
>prophage 312
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	4263710	4265671	4830815		Ostreococcus_lucimarinus_virus(50.0%)	2	NA	NA
WP_000044314.1|4263710_4264661_+	acetaldehyde dehydrogenase	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	8.7e-36
WP_001013499.1|4264657_4265671_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	1.2e-43
>prophage 313
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	4268849	4269959	4830815		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000842102.1|4268849_4269959_-	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	1.2e-31
>prophage 314
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	4275255	4276023	4830815		Planktothrix_phage(100.0%)	1	NA	NA
WP_000939395.1|4275255_4276023_+	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	40.9	3.8e-26
>prophage 315
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	4282916	4284074	4830815		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000830741.1|4282916_4284074_-	OXA-12 family class D beta-lactamase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	5.1e-06
>prophage 316
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	4291489	4292605	4830815		Bacillus_phage(100.0%)	1	NA	NA
WP_000484048.1|4291489_4292605_+	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.1e-18
>prophage 317
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	4296894	4306866	4830815		Bacillus_phage(60.0%)	7	NA	NA
WP_001298537.1|4296894_4297806_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
WP_001219320.1|4297930_4298839_+	fructokinase	NA	NA	NA	NA	NA
WP_001345723.1|4298981_4300166_-	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_000698907.1|4300291_4303435_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_001221319.1|4303431_4304634_-	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
WP_000113933.1|4304823_4305513_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_000893578.1|4305570_4306866_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	1.3e-26
>prophage 318
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	4313818	4322799	4830815	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_000667319.1|4313818_4314946_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
WP_000007629.1|4314968_4315301_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000934822.1|4315328_4317176_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000046637.1|4317186_4318158_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000974813.1|4318286_4318634_+	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_001295328.1|4318810_4319695_-	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_001295327.1|4319993_4320533_-	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_000543535.1|4320683_4321133_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001150472.1|4321136_4322240_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.5	5.3e-53
WP_001021161.1|4322328_4322799_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
>prophage 319
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	4346505	4351552	4830815	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_000122253.1|4346505_4347129_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
WP_000130305.1|4347254_4348529_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_001295325.1|4348716_4351071_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_001043542.1|4351279_4351552_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
>prophage 320
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	4354680	4355376	4830815		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817229.1|4354680_4355376_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.9e-88
>prophage 321
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	4358699	4362246	4830815		Bacillus_phage(100.0%)	2	NA	NA
WP_001235608.1|4358699_4360472_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	2.6e-49
WP_001256180.1|4360464_4362246_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	1.1e-42
>prophage 322
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	4371080	4374230	4830815		Leptospira_phage(100.0%)	1	NA	NA
WP_001132470.1|4371080_4374230_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	6.2e-54
>prophage 323
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	4381239	4389801	4830815		Klosneuvirus(25.0%)	8	NA	NA
WP_000127356.1|4381239_4381791_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
WP_000122013.1|4381919_4383851_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000467098.1|4383903_4384233_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_001195025.1|4384232_4384838_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_000678201.1|4384947_4386822_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
WP_001220233.1|4387002_4387647_+	adenylate kinase	NA	NA	NA	NA	NA
WP_001250088.1|4387882_4388845_+	ferrochelatase	NA	NA	NA	NA	NA
WP_000801832.1|4388841_4389801_-	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.3	1.1e-14
>prophage 324
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	4397995	4400955	4830815		Escherichia_phage(50.0%)	2	NA	NA
WP_001344274.1|4397995_4398337_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	74.5	1.8e-39
WP_000078268.1|4398450_4400955_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.2	3.8e-115
>prophage 325
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	4405494	4406172	4830815		Bacillus_virus(100.0%)	1	NA	NA
WP_001157535.1|4405494_4406172_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	2.4e-27
>prophage 326
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	4409308	4417125	4830815		Planktothrix_phage(50.0%)	3	NA	NA
WP_001110573.1|4409308_4409995_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561899.1|4409991_4412406_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000014664.1|4412835_4417125_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	41.5	2.1e-20
>prophage 327
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	4423500	4425282	4830815		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_001096878.1|4423500_4425282_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.1	2.1e-38
>prophage 328
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	4431473	4432619	4830815		Streptococcus_phage(100.0%)	1	NA	NA
WP_000706355.1|4431473_4432619_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	1.8e-48
>prophage 329
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	4444107	4447238	4830815	tRNA	Moumouvirus(50.0%)	4	NA	NA
WP_000912345.1|4444107_4445493_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143552.1|4445528_4446050_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|4446157_4446370_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729154.1|4446371_4447238_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
>prophage 330
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	4463572	4473703	4830815		uncultured_Caudovirales_phage(33.33%)	5	NA	NA
WP_064055664.1|4463572_4468435_-	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.0	4.0e-20
WP_001160804.1|4468454_4468916_-	DcrB-related protein	NA	NA	NA	NA	NA
WP_000103243.1|4468943_4470845_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.3	1.7e-27
WP_000253830.1|4471581_4473030_-	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	NA	NA	NA	NA
WP_000770953.1|4473019_4473703_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
>prophage 331
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	4476848	4479992	4830815		Leptospira_phage(100.0%)	1	NA	NA
WP_000573940.1|4476848_4479992_+	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.4	2.2e-59
>prophage 332
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	4491421	4497464	4830815		Tupanvirus(50.0%)	3	NA	NA
WP_000077713.1|4491421_4495303_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.2	7.6e-62
WP_000096723.1|4495518_4496652_+	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_000140647.1|4496648_4497464_-	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
>prophage 333
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	4511824	4513647	4830815		uncultured_marine_virus(50.0%)	2	NA	NA
WP_000502941.1|4511824_4512454_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.8	2.9e-56
WP_000029834.1|4512426_4513647_-	phosphoadenosine phosphosulfate reductase	NA	L0P6Z6	Lactobacillus_phage	32.5	2.3e-57
>prophage 334
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	4516714	4518829	4830815		Bacillus_virus(50.0%)	2	NA	NA
WP_000887629.1|4516714_4518280_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
WP_000278505.1|4518400_4518829_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.1e-19
>prophage 335
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	4534253	4534901	4830815		Morganella_phage(50.0%)	2	NA	NA
WP_000034825.1|4534253_4534463_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
WP_000939738.1|4534517_4534901_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
>prophage 336
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	4539716	4542156	4830815		Stx2-converting_phage(50.0%)	2	NA	NA
WP_001092082.1|4539716_4540928_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
WP_001231428.1|4541067_4542156_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
>prophage 337
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	4549166	4551749	4830815	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001297565.1|4549166_4551749_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.3	5.2e-184
>prophage 338
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	4561493	4562219	4830815		Planktothrix_phage(100.0%)	1	NA	NA
WP_000631384.1|4561493_4562219_-	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
>prophage 339
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	4570115	4571195	4830815		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000490838.1|4570115_4571195_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.3e-47
>prophage 340
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	4575291	4576956	4830815		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337066.1|4575291_4576956_-	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.3	6.1e-85
>prophage 341
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	4581582	4585396	4830815	tRNA	Vibrio_phage(50.0%)	2	NA	NA
WP_001023104.1|4581582_4583529_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.6e-07
WP_001287154.1|4583731_4585396_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	99.1	0.0e+00
>prophage 342
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	4589545	4590310	4830815		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000773279.1|4589545_4590310_-	esterase	NA	A0A1J0GNR5	Mycobacterium_phage	31.5	2.9e-05
>prophage 343
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	4596965	4609686	4830815		Bacillus_phage(25.0%)	8	NA	NA
WP_000186103.1|4596965_4597643_-	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	31.1	8.9e-27
WP_001331457.1|4597639_4600324_-	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.8	6.5e-12
WP_001297248.1|4600316_4600889_-	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_000087967.1|4600897_4602946_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	22.8	4.2e-27
WP_000741137.1|4602968_4604642_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_001272653.1|4604641_4604731_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_000424924.1|4605043_4605250_+	YbfA family protein	NA	NA	NA	NA	NA
WP_121540881.1|4605492_4609686_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.9	3.3e-26
>prophage 344
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	4614149	4617091	4830815		Hokovirus(50.0%)	2	NA	NA
WP_000207157.1|4614149_4615568_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.0	3.1e-61
WP_001032694.1|4615609_4617091_-	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	2.5e-45
>prophage 345
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	4620469	4621261	4830815		Kaumoebavirus(100.0%)	1	NA	NA
WP_001114025.1|4620469_4621261_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	28.8	3.7e-08
>prophage 346
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	4657298	4660818	4830815		Vibrio_phage(33.33%)	4	NA	NA
WP_000345401.1|4657298_4658018_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	33.2	3.2e-22
WP_000951292.1|4658014_4658956_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.2	2.2e-23
WP_000784351.1|4659069_4659450_-	periplasmic protein	NA	NA	NA	NA	NA
WP_001109196.1|4659765_4660818_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.4	3.4e-81
>prophage 347
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	4665174	4671747	4830815		Tupanvirus(33.33%)	7	NA	NA
WP_001265438.1|4665174_4666191_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	6.1e-80
WP_000096881.1|4666451_4667924_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.3	4.2e-13
WP_001147439.1|4667991_4668780_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000891515.1|4668908_4669058_+	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_000101997.1|4669223_4669997_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000604034.1|4669996_4670686_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000891685.1|4670688_4671747_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.7	2.6e-20
>prophage 348
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	4682102	4683392	4830815		Klosneuvirus(100.0%)	1	NA	NA
WP_001389241.1|4682102_4683392_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.9	3.8e-18
>prophage 349
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	4689873	4690782	4830815		Streptococcus_phage(100.0%)	1	NA	NA
WP_001295302.1|4689873_4690782_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
>prophage 350
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	4702093	4716904	4830815		Anomala_cuprea_entomopoxvirus(14.29%)	13	NA	NA
WP_000996091.1|4702093_4703830_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.3	1.3e-18
WP_000976401.1|4703822_4704821_-	secretion protein HlyD	NA	NA	NA	NA	NA
WP_001296991.1|4704820_4705492_-	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000007101.1|4705720_4707085_+	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001145126.1|4707316_4707799_-	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.0	9.8e-36
WP_057107196.1|4707918_4710069_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.0	5.7e-43
WP_000386551.1|4710096_4711059_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_000443530.1|4711199_4712285_+	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000849301.1|4712513_4712774_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000146343.1|4713038_4713305_-	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	6.9e-07
WP_001299027.1|4713378_4714092_-	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	9.4e-19
WP_000430036.1|4714097_4716380_-	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_000710619.1|4716643_4716904_-	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
>prophage 351
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	4720444	4725669	4830815		Planktothrix_phage(33.33%)	7	NA	NA
WP_000569080.1|4720444_4721167_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
WP_001159065.1|4721163_4721823_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000843866.1|4721961_4722708_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_000100800.1|4723111_4723615_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_001119538.1|4723913_4724801_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_120795379.1|4725035_4725101_+	protein YliM	NA	NA	NA	NA	NA
WP_001295296.1|4725153_4725669_+	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
>prophage 352
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	4730666	4732259	4830815		Tupanvirus(100.0%)	1	NA	NA
WP_000961458.1|4730666_4732259_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
>prophage 353
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	4736151	4740282	4830815		Citrobacter_phage(50.0%)	3	NA	NA
WP_000209359.1|4736151_4738584_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
WP_001295295.1|4738589_4739489_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_000424890.1|4739619_4740282_+	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	34.6	5.7e-26
>prophage 354
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	4743497	4745369	4830815		Planktothrix_phage(100.0%)	1	NA	NA
WP_001296993.1|4743497_4745369_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	4.0e-16
>prophage 355
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	4756704	4757907	4830815		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000195961.1|4756704_4757907_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
>prophage 356
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	4766473	4775624	4830815		Vibrio_phage(25.0%)	11	NA	NA
WP_001195240.1|4766473_4766731_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
WP_001201560.1|4766890_4767178_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_000189152.1|4767161_4767884_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_000684321.1|4767944_4768847_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|4768934_4769411_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126065.1|4769762_4770875_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000995994.1|4770969_4772103_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.9e-29
WP_001093858.1|4772112_4773066_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061657.1|4773062_4773908_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|4773967_4774456_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149734.1|4774496_4775624_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.3	4.6e-28
>prophage 357
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	4778961	4781699	4830815		Planktothrix_phage(50.0%)	4	NA	NA
WP_000027205.1|4778961_4779690_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_001270740.1|4779907_4780423_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160737.1|4780548_4780872_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001255144.1|4780868_4781699_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
>prophage 358
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	4785286	4787005	4830815		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000815362.1|4785286_4787005_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	5.2e-31
>prophage 359
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	4796302	4820061	4830815	protease,tRNA	uncultured_Mediterranean_phage(16.67%)	16	NA	NA
WP_000188194.1|4796302_4798249_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	5.0e-38
WP_000410785.1|4798321_4798546_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|4798868_4799189_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|4799219_4801496_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001040187.1|4802180_4802399_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241678.1|4802683_4803388_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202188.1|4803429_4805151_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	1.9e-20
WP_001043618.1|4805151_4806918_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	5.4e-23
WP_000537418.1|4807040_4808006_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_000228473.1|4808550_4809045_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000077012.1|4809179_4813247_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|4813401_4814013_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067755.1|4814023_4815367_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_000886683.1|4815457_4816750_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000850313.1|4816988_4819433_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.9	3.0e-221
WP_000213098.1|4819443_4820061_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
>prophage 360
NZ_CP048025	Escherichia coli strain GZEC065 chromosome, complete genome	4830815	4826371	4830554	4830815	integrase	Escherichia_phage(62.5%)	8	4818040:4818052	4830408:4830420
4818040:4818052	attL	AAACACCGCAATG	NA	NA	NA	NA
WP_000067977.1|4826371_4827169_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.3e-21
WP_000023391.1|4827200_4828196_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	99.7	7.1e-190
WP_000072552.1|4828289_4828601_-	helix-turn-helix transcriptional regulator	NA	Q1JS25	Enterobacteria_phage	100.0	4.3e-53
WP_000022051.1|4828705_4829062_+	hypothetical protein	NA	A0A0F7LDH4	Escherichia_phage	100.0	1.1e-63
WP_000217677.1|4829239_4829740_+	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	100.0	4.5e-92
WP_000557703.1|4829803_4830028_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001277957.1|4830027_4830330_+	DUF5405 family protein	NA	A0A0F7LDT6	Escherichia_phage	99.0	2.2e-46
WP_001113270.1|4830329_4830554_+	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	98.6	3.8e-35
4830408:4830420	attR	CATTGCGGTGTTT	NA	NA	NA	NA
>prophage 1
NZ_CP048026	Escherichia coli strain GZEC065 plasmid pTEM1-GZEC065, complete sequence	142236	1262	62037	142236	bacteriocin,protease,integrase,transposase	Escherichia_phage(60.0%)	52	NA	NA
WP_001066954.1|1262_2003_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.2e-24
WP_001312821.1|2123_2312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000175738.1|2685_3594_-	antimicrobial resistance protein Mig-14	NA	NA	NA	NA	NA
WP_000771475.1|3656_4766_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_000280980.1|5198_6152_-|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_001312823.1|7424_7583_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001067858.1|13974_14679_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000557454.1|14937_15798_+	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_000587837.1|15810_16353_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000951934.1|16834_17026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000248278.1|17049_17277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000080860.1|17327_18464_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_014342212.1|18430_18580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014342213.1|20091_20217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|21021_21726_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001389365.1|21854_22619_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001137892.1|23111_23696_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|23695_24934_-	MFS transporter	NA	NA	NA	NA	NA
WP_000219391.1|24930_25836_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067858.1|25957_26662_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000018329.1|26812_27628_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067858.1|27817_28522_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000935452.1|28568_29873_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001067858.1|29947_30652_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001206356.1|30956_31748_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_001336345.1|31753_32044_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001083725.1|32155_32653_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_000845039.1|32797_33811_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|34013_34364_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001067858.1|34822_35527_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000888203.1|35628_36108_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_000347934.1|36177_39330_-	multidrug efflux RND transporter permease subunit OqxB	NA	NA	NA	NA	NA
WP_002914189.1|39353_40529_-	multidrug efflux RND transporter periplasmic adaptor subunit OqxA	NA	NA	NA	NA	NA
WP_001067858.1|40848_41553_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_064055682.1|41887_42280_+	NimC/NimA family protein	NA	NA	NA	NA	NA
WP_063102497.1|42599_42986_-	bleomycin binding protein	NA	NA	NA	NA	NA
WP_001067858.1|43179_43884_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000844627.1|46057_46300_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_031606906.1|46331_46958_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000804064.1|47063_48263_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000058717.1|48294_49179_-	EamA family transporter	NA	NA	NA	NA	NA
WP_001351729.1|49316_49709_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_162014435.1|51570_51852_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_023154360.1|51897_52746_+	3'-5' exonuclease	NA	K7RFY5	Vibrio_phage	39.0	5.0e-27
WP_001311056.1|52862_53345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000142450.1|53646_53994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064055658.1|54416_58238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000493379.1|58769_59120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000796228.1|59163_59853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016493.1|59849_60641_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	90.2	2.7e-51
WP_000864812.1|60818_61172_+	colicin M immunity protein	NA	NA	NA	NA	NA
WP_001312845.1|61221_62037_-|bacteriocin	lipid II-degrading bacteriocin colicin M	bacteriocin	NA	NA	NA	NA
>prophage 1
NZ_CP048027	Escherichia coli strain GZEC065 plasmid pTET-GZEC065, complete sequence	88706	0	73315	88706	integrase,transposase	Escherichia_phage(58.49%)	73	15825:15841	72315:72331
WP_001076427.1|0_861_+	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	100.0	4.7e-158
WP_000817632.1|1260_2466_+	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	100.0	2.0e-226
WP_000725192.1|2462_3428_+	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	100.0	3.3e-168
WP_033550815.1|3692_5399_+	hypothetical protein	NA	Q71TM1	Escherichia_phage	99.5	0.0e+00
WP_033550816.1|5458_6964_+	hypothetical protein	NA	Q1MVJ6	Enterobacteria_phage	93.4	2.0e-281
WP_064055653.1|6973_7789_+	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	93.7	1.2e-107
WP_000035251.1|7824_8406_+	hypothetical protein	NA	Q71TM4	Escherichia_phage	99.5	3.8e-103
WP_121540878.1|8545_9759_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.3	1.6e-167
WP_074182058.1|9985_10240_+	hypothetical protein	NA	Q71TM5	Escherichia_phage	97.6	1.7e-39
WP_001313475.1|11704_11860_-	type I toxin-antitoxin system toxin HokD	NA	A0A1I9LJU7	Stx_converting_phage	92.2	1.0e-15
WP_033550825.1|12194_12464_-	hypothetical protein	NA	A0A077SK41	Escherichia_phage	96.6	1.6e-43
WP_033550820.1|13068_13869_-	protein kilA	NA	Q1MVK4	Enterobacteria_phage	99.6	7.1e-148
WP_033550821.1|14032_15067_-	antirepressor	NA	A0A077SLI1	Escherichia_phage	96.8	2.3e-183
WP_072019019.1|15063_15285_-	host cell division inhibitor Icd-like protein	NA	Q38414	Enterobacteria_phage	97.3	1.2e-36
15825:15841	attL	CATCAATAGGATTAATC	NA	NA	NA	NA
WP_033550822.1|15905_16418_+	membrane protein	NA	A0A077SK39	Escherichia_phage	82.9	1.6e-44
WP_033550823.1|16429_16969_+	DUF5384 family protein	NA	A0A077SL46	Escherichia_phage	87.7	3.8e-36
WP_077248989.1|17284_18544_+	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_023155386.1|18674_19241_+	hypothetical protein	NA	A0A077SK12	Escherichia_phage	98.9	1.5e-99
WP_000523980.1|19251_19863_+	hypothetical protein	NA	Q71TN8	Escherichia_phage	99.5	2.9e-109
WP_100250112.1|21284_21659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033551022.1|21865_23221_-	deoxyguanosinetriphosphate triphosphohydrolase family protein	NA	NA	NA	NA	NA
WP_033551020.1|23469_23958_-	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	77.8	8.6e-64
WP_077248987.1|24126_25800_+	hypothetical protein	NA	Q1MVN7	Enterobacteria_phage	96.6	5.8e-269
WP_000224045.1|25833_26274_+	hypothetical protein	NA	A0A077SLF0	Escherichia_phage	99.3	1.9e-78
WP_000747846.1|26270_26519_+	hypothetical protein	NA	Q71TG0	Escherichia_phage	100.0	1.8e-41
WP_033551018.1|26577_27087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033551017.1|27086_28124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033551016.1|28217_28859_-	hypothetical protein	NA	A0A1B0VAG4	Salmonella_phage	95.3	6.1e-110
WP_033551015.1|29139_29694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001637298.1|29740_30127_-	Ref family protein	NA	Q71TG3	Escherichia_phage	94.6	2.1e-57
WP_033551013.1|30345_31122_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000104482.1|31137_32127_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001541954.1|32135_32537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071595431.1|33332_33440_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.5	1.5e-05
WP_016246567.1|33632_33944_-	hypothetical protein	NA	Q71TG4	Escherichia_phage	96.1	8.8e-46
WP_033551011.1|33994_35026_-|integrase	tyrosine-type recombinase/integrase	integrase	Q71TG5	Escherichia_phage	99.1	4.2e-193
WP_001697576.1|35033_35255_-	hypothetical protein	NA	Q5XLQ6	Enterobacteria_phage	100.0	2.0e-36
WP_064055537.1|35891_36872_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	8.9e-185
WP_000874156.1|37059_37269_+	hypothetical protein	NA	A0A077SK26	Escherichia_phage	100.0	1.8e-31
WP_000611664.1|37379_38231_+	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	100.0	1.2e-158
WP_033551397.1|38263_39379_-	antirepressor	NA	A0A077SLR9	Escherichia_phage	92.7	3.6e-190
WP_033551394.1|40412_41456_-	DUF968 domain-containing protein	NA	A0A1B0VBU2	Salmonella_phage	98.0	1.8e-204
WP_000113018.1|41483_41663_-	hypothetical protein	NA	Q71TH5	Escherichia_phage	98.3	1.2e-23
WP_033551393.1|41667_42048_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	98.4	1.6e-62
WP_001190712.1|42047_42269_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_001044210.1|45405_45546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001366550.1|46031_46769_+	recombinase family protein	NA	NA	NA	NA	NA
WP_000743213.1|46765_46990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001120888.1|47200_48694_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_021598067.1|48724_49609_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_023300759.1|49825_51040_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	5.5e-19
WP_001255015.1|51067_51373_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_162014439.1|52983_53589_+	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000480968.1|54169_55006_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|55005_55809_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_001043260.1|55869_56685_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000954592.1|57014_57191_+	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_001067858.1|58180_58885_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_014839980.1|59270_59687_+	fosfomycin resistance glutathione transferase FosA3	NA	Q2LI91	Bacillus_phage	35.6	2.0e-08
WP_014839979.1|59691_60210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014839978.1|60209_60998_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_049824851.1|61017_61488_-	TetR family transcriptional regulator	NA	A0A0R6PIB6	Moraxella_phage	32.7	5.3e-10
WP_001067858.1|61497_62202_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_033550853.1|62915_64178_-	hypothetical protein	NA	A0A1B0V7L1	Salmonella_phage	99.5	1.0e-233
WP_033550850.1|64495_65182_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	98.7	4.6e-140
WP_001567998.1|65178_65856_-	hypothetical protein	NA	Q71TJ1	Escherichia_phage	97.8	4.6e-132
WP_000484116.1|65852_66479_-	norphogenetic protein	NA	Q1MVG8	Enterobacteria_phage	100.0	2.1e-123
WP_001567997.1|66980_67136_-	hypothetical protein	NA	Q1MVH0	Enterobacteria_phage	98.0	1.2e-19
WP_000654811.1|67547_68516_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.6	1.7e-172
WP_032306837.1|68666_69293_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.5	1.1e-79
WP_033550846.1|69295_70123_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	37.9	2.7e-17
WP_042004625.1|70161_72585_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	45.5	1.2e-198
72315:72331	attR	GATTAATCCTATTGATG	NA	NA	NA	NA
WP_042004624.1|72667_73315_+	hypothetical protein	NA	A0A077SLS7	Escherichia_phage	34.6	3.1e-13
