The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP048019	Pediococcus acidilactici strain CACC 537 chromosome, complete genome	2035984	1507513	1612801	2035984	integrase,terminase,head,portal,tRNA,tail,protease,capsid,holin	Lactobacillus_phage(56.0%)	114	1531682:1531702	1573387:1573407
WP_002831947.1|1507513_1508770_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.8	1.5e-139
WP_002830460.1|1508864_1509452_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_002830457.1|1509454_1509745_+	nucleoside triphosphate pyrophosphohydrolase family protein	NA	A0A1S7FYY8	Listeria_phage	47.9	7.7e-20
WP_004165963.1|1510105_1511593_+	ABC transporter substrate-binding protein/permease	NA	NA	NA	NA	NA
WP_004165962.1|1511592_1512336_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.9	6.6e-31
WP_002831942.1|1512500_1514285_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_002831941.1|1514324_1515620_+	GTPase ObgE	NA	NA	NA	NA	NA
WP_063504367.1|1515687_1515990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002830452.1|1516120_1517047_+	ribonuclease Z	NA	NA	NA	NA	NA
WP_008841319.1|1517105_1517891_+	SDR family NAD(P)-dependent oxidoreductase	NA	W8CYX9	Bacillus_phage	35.1	7.0e-07
WP_063504366.1|1517908_1520230_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	33.3	8.5e-85
WP_002830449.1|1520230_1520749_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	43.3	4.0e-27
WP_002831937.1|1521076_1521271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_119179090.1|1521272_1522169_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	36.3	5.5e-24
WP_063504365.1|1522165_1522942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063504364.1|1523125_1524586_+	catalase	NA	A0A2K9L572	Tupanvirus	49.5	1.4e-104
WP_002830444.1|1524843_1526019_+	ArgE/DapE family deacylase	NA	NA	NA	NA	NA
WP_002831933.1|1526424_1527750_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_002830442.1|1527899_1528496_-	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_002830441.1|1528719_1528968_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_002831931.1|1529163_1529547_+	YxeA family protein	NA	NA	NA	NA	NA
WP_063504363.1|1529779_1531228_-	hypothetical protein	NA	NA	NA	NA	NA
1531682:1531702	attL	TTCAAATCCTGTACTCTCCTT	NA	NA	NA	NA
WP_162013312.1|1531843_1532959_-|integrase	site-specific integrase	integrase	A0A0M9JJ77	Lactobacillus_phage	51.7	6.5e-99
WP_162013313.1|1533096_1534098_-	Abi family protein	NA	M1PS09	Streptococcus_phage	35.6	8.0e-48
WP_162013314.1|1534357_1534522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162013315.1|1534629_1535016_-	transporter	NA	A0A0P0I7G8	Lactobacillus_phage	62.9	3.1e-32
WP_162013316.1|1535084_1535495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162013317.1|1535501_1535840_-	helix-turn-helix domain-containing protein	NA	M1PKY8	Streptococcus_phage	37.8	1.2e-11
WP_162013318.1|1536112_1536328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162013319.1|1536346_1536517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162013320.1|1536513_1536717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162013321.1|1536774_1537497_+	phage regulatory protein	NA	D2IYT0	Enterococcus_phage	50.6	7.0e-54
WP_162013322.1|1537510_1537840_+	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_162013323.1|1537986_1538841_+	DUF1351 domain-containing protein	NA	A0A0P0IV40	Lactobacillus_phage	32.1	2.1e-25
WP_162013324.1|1538845_1539586_+	AAA family ATPase	NA	B4XYS4	Lactobacillus_phage	55.5	3.3e-67
WP_162013325.1|1539585_1540113_+	DUF669 domain-containing protein	NA	A0A1P8VVN0	Streptococcus_phage	47.9	8.8e-30
WP_162013326.1|1540125_1540656_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_162013327.1|1541492_1542725_+	DNA helicase	NA	A8YQM1	Lactobacillus_phage	36.6	3.8e-60
WP_162013328.1|1542724_1543141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162013329.1|1543137_1543608_+	hypothetical protein	NA	A0A0A7DMU0	Lactobacillus_phage	43.8	9.3e-23
WP_162013330.1|1543651_1543879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162013331.1|1543878_1544499_+	RNA polymerase subunit sigma-70	NA	NA	NA	NA	NA
WP_162013332.1|1544665_1545037_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_162013333.1|1545205_1545730_+	DUF1642 domain-containing protein	NA	A0A1S5SB02	Streptococcus_phage	38.3	5.0e-09
WP_162013334.1|1545890_1546307_+	RNA polymerase subunit sigma-70	NA	NA	NA	NA	NA
WP_159206393.1|1546595_1546916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162013335.1|1547000_1547204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162013336.1|1547208_1547487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162013337.1|1547609_1548122_+	HNH endonuclease	NA	E9LUP7	Lactobacillus_phage	88.5	2.9e-78
WP_159209329.1|1548127_1548397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162013338.1|1548468_1548801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159209327.1|1548964_1549423_+|terminase	phage terminase small subunit P27 family	terminase	E9LUP8	Lactobacillus_phage	96.7	8.0e-80
WP_162013339.1|1549425_1551324_+|terminase	terminase large subunit	terminase	E9LUP9	Lactobacillus_phage	96.2	0.0e+00
WP_162013340.1|1551313_1551508_+	DUF1056 family protein	NA	E9LUQ0	Lactobacillus_phage	92.2	3.7e-26
WP_162013341.1|1551510_1552674_+|portal	phage portal protein	portal	E9LUQ1	Lactobacillus_phage	93.2	1.0e-208
WP_159215944.1|1552651_1553395_+|protease	Clp protease ClpP	protease	E9LUQ2	Lactobacillus_phage	95.5	5.4e-126
WP_002831808.1|1553394_1554627_+|capsid	phage major capsid protein	capsid	E9LUQ3	Lactobacillus_phage	92.9	4.1e-211
WP_002831807.1|1554699_1555032_+|head,tail	phage gp6-like head-tail connector protein	head,tail	E9LUQ4	Lactobacillus_phage	85.2	1.0e-44
WP_002831805.1|1555021_1555369_+|head	phage head closure protein	head	A0A2P0ZLF0	Lactobacillus_phage	67.0	1.8e-39
WP_002831803.1|1555371_1555779_+	hypothetical protein	NA	A0A2P0ZLE6	Lactobacillus_phage	87.9	3.9e-62
WP_162013342.1|1555778_1556159_+	DUF806 family protein	NA	A0A2P0ZLF4	Lactobacillus_phage	92.9	5.3e-61
WP_162013343.1|1556172_1556862_+|tail	phage tail protein	tail	A0A2P0ZLH1	Lactobacillus_phage	93.2	4.0e-107
WP_002831799.1|1556938_1557313_+	hypothetical protein	NA	A0A2P0ZLH4	Lactobacillus_phage	96.0	3.2e-58
WP_159207769.1|1557357_1557543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162013344.1|1557573_1562028_+	transglycosylase SLT domain-containing protein	NA	A0A2P0ZLG0	Lactobacillus_phage	66.8	0.0e+00
WP_162013345.1|1562104_1563874_+|tail	phage tail protein	tail	E9LUR2	Lactobacillus_phage	90.1	0.0e+00
WP_162013346.1|1563937_1566322_+	hypothetical protein	NA	E9LUR3	Lactobacillus_phage	91.1	0.0e+00
WP_162013347.1|1566308_1568690_+|tail	phage tail protein	tail	A0A1I9KK49	Lactobacillus_phage	80.9	2.2e-11
WP_086131892.1|1568682_1568922_+	hypothetical protein	NA	A0A2K9VDF6	Lactobacillus_phage	85.7	5.7e-29
WP_002831790.1|1569070_1569430_+	hypothetical protein	NA	E9LUR7	Lactobacillus_phage	79.0	6.6e-45
WP_162013348.1|1569441_1570626_+	LysM peptidoglycan-binding domain-containing protein	NA	E9LUR8	Lactobacillus_phage	82.5	2.9e-182
WP_002831786.1|1570625_1570889_+|holin	holin	holin	E9LUR9	Lactobacillus_phage	82.8	3.0e-31
WP_162013377.1|1570904_1571270_+|holin	holin	holin	A0A2K9VCG4	Lactobacillus_phage	63.8	1.4e-15
WP_002830702.1|1571730_1572513_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_002830382.1|1573762_1574872_+	L-lactate oxidase	NA	NA	NA	NA	NA
1573387:1573407	attR	TTCAAATCCTGTACTCTCCTT	NA	NA	NA	NA
WP_002830380.1|1575275_1575914_+	carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_053906569.1|1576596_1577019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002830379.1|1577478_1577745_-	membrane protein	NA	NA	NA	NA	NA
WP_002830378.1|1577867_1578377_-	membrane protein	NA	NA	NA	NA	NA
WP_002830377.1|1578969_1579347_+	general stress protein	NA	NA	NA	NA	NA
WP_002830376.1|1579558_1580296_+	NADPH-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002830375.1|1580523_1580973_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002830373.1|1581074_1581533_+	flavodoxin	NA	NA	NA	NA	NA
WP_002830371.1|1581707_1583291_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_002830370.1|1583313_1584309_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	43.8	7.1e-73
WP_002830368.1|1584539_1585724_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_002830367.1|1586260_1586461_+	helix-turn-helix transcriptional regulator	NA	A0A1V0E021	Clostridioides_phage	54.8	1.3e-10
WP_058120782.1|1586457_1586922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002831915.1|1587276_1587507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002830365.1|1587730_1589029_+	uracil transporter	NA	Q9KX94	Enterobacteria_phage	36.9	1.1e-62
WP_002831912.1|1589354_1590302_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_002831910.1|1590311_1591049_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_002830362.1|1591063_1591393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002830361.1|1591500_1593732_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	S4TRQ0	Salmonella_phage	38.5	7.6e-06
WP_002830354.1|1593741_1594191_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_002830353.1|1594281_1594905_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_002830352.1|1594889_1595759_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4JCM7	uncultured_Caudovirales_phage	38.2	2.9e-22
WP_002830351.1|1596172_1597447_+|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L0H9	Tupanvirus	25.7	7.8e-24
WP_002830349.1|1597462_1599244_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002830347.1|1599525_1600404_+	YitT family protein	NA	NA	NA	NA	NA
WP_004165945.1|1600416_1601574_+	CDP-glycerol--glycerophosphate glycerophosphotransferase	NA	NA	NA	NA	NA
WP_002831904.1|1601566_1602772_+	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_002831903.1|1602774_1603665_+	deoxyribonuclease IV	NA	A0A2L2DJK8	Acanthamoeba_polyphaga_mimivirus	32.3	2.8e-28
WP_063504360.1|1603922_1604300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002830341.1|1604322_1605132_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_002830340.1|1605331_1605517_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_002830339.1|1605575_1606019_+	GatB/YqeY domain-containing protein	NA	A0A0K2FLI9	Brevibacillus_phage	35.9	1.5e-14
WP_063504359.1|1606030_1606999_+	phosphate starvation-inducible protein PhoH	NA	L7TP00	Rhizobium_phage	47.6	3.1e-49
WP_063504362.1|1607003_1607474_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_004165942.1|1607457_1607841_+	diacylglycerol kinase family protein	NA	NA	NA	NA	NA
WP_002830335.1|1607865_1608780_+	GTPase Era	NA	NA	NA	NA	NA
WP_063504358.1|1608782_1609544_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_063504357.1|1609829_1610729_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_063504356.1|1610728_1612801_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP048019	Pediococcus acidilactici strain CACC 537 chromosome, complete genome	2035984	1640803	1648125	2035984	tRNA	Staphylococcus_phage(28.57%)	7	NA	NA
WP_002830304.1|1640803_1641274_+	nucleoside deoxyribosyltransferase	NA	K4I206	Lactobacillus_phage	34.6	2.7e-14
WP_004165925.1|1641337_1642207_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	37.8	1.5e-55
WP_063504752.1|1642322_1643531_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	35.1	3.8e-44
WP_063504346.1|1643533_1645429_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.5	8.6e-51
WP_002831862.1|1645433_1646384_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	59.9	5.1e-113
WP_004165921.1|1646401_1646884_+	dihydrofolate reductase	NA	A0A076GDN3	Bacillus_phage	39.1	3.6e-22
WP_002830297.1|1647279_1648125_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	35.6	2.1e-17
>prophage 3
NZ_CP048019	Pediococcus acidilactici strain CACC 537 chromosome, complete genome	2035984	1673956	1682519	2035984		Synechococcus_phage(33.33%)	9	NA	NA
WP_002831743.1|1673956_1674439_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	39.7	2.4e-18
WP_063504749.1|1674422_1675583_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_063504336.1|1675560_1676295_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SLB8	Cyanophage	42.1	1.4e-41
WP_063504748.1|1676281_1676542_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_004165894.1|1676538_1677213_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_063504747.1|1677230_1679435_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.6	1.3e-146
WP_063504335.1|1679419_1680889_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.1	4.7e-57
WP_063504334.1|1680891_1681938_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3FC27	Synechococcus_phage	37.0	1.0e-53
WP_053906056.1|1681937_1682519_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.2	1.5e-22
