The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041437	Escherichia coli strain STEC005 chromosome, complete genome	4937832	1121707	1128847	4937832		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|1121707_1122346_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|1122342_1123605_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|1123601_1124510_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001272549.1|1124675_1125473_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	5.9e-70
WP_001141333.1|1125523_1126180_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	2.8e-49
WP_001272898.1|1126285_1128847_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
>prophage 2
NZ_CP041437	Escherichia coli strain STEC005 chromosome, complete genome	4937832	1714972	1724414	4937832		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569361.1|1714972_1715899_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
WP_000783120.1|1715903_1716635_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216961.1|1716615_1716723_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1716782_1717514_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1717735_1719421_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1719417_1720137_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001365803.1|1720183_1720654_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	3.0e-82
WP_001295429.1|1720694_1721156_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001331478.1|1721280_1723281_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
WP_001292767.1|1723277_1724414_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	4.6e-161
>prophage 3
NZ_CP041437	Escherichia coli strain STEC005 chromosome, complete genome	4937832	2273526	2341003	4937832	protease,terminase,lysis,integrase,tail,portal	Enterobacteria_phage(48.0%)	78	2281102:2281117	2311061:2311076
WP_001260855.1|2273526_2274348_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2274447_2274531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743951.1|2274623_2274959_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091835.1|2275355_2276609_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2276715_2277609_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2277743_2278964_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2279088_2279784_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_001315626.1|2279736_2281029_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
2281102:2281117	attL	CTTTAAGAGATAAAAA	NA	NA	NA	NA
WP_000148710.1|2281188_2281803_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526474.1|2281845_2282700_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2282701_2283319_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001515050.1|2283329_2285753_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.5	8.3e-208
WP_000041554.1|2285813_2288240_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	2.0e-214
WP_001307224.1|2288438_2288744_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|2288851_2289562_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2289564_2290125_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|2290159_2290501_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|2290635_2290962_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|2291167_2292382_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836079.1|2292393_2293413_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
WP_074152898.1|2293470_2293599_+	transporter	NA	NA	NA	NA	NA
WP_161620881.1|2293600_2294881_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	1.7e-156
WP_001296941.1|2294915_2295152_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_161620882.1|2295239_2297711_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.5	8.5e-59
WP_134778596.1|2297804_2297996_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854559.1|2297992_2298181_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000344944.1|2298667_2299243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|2299244_2299400_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_000381212.1|2299568_2299976_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	51.9	7.2e-32
WP_000921594.1|2300056_2300284_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705349.1|2300267_2300789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032200041.1|2300769_2301735_+	phage O protein family	NA	U5P0A0	Shigella_phage	60.8	2.6e-56
WP_032200040.1|2301775_2302198_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	8.2e-63
WP_072132653.1|2303500_2303719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887491.1|2303919_2304132_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	97.1	1.7e-29
WP_000980999.1|2304348_2304600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023147795.1|2304666_2304945_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	7.4e-12
WP_032200038.1|2304946_2305996_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.9	3.3e-113
WP_001204787.1|2306013_2306391_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	82.5	1.8e-53
WP_000780584.1|2306546_2307071_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	52.9	1.0e-46
WP_000592549.1|2307263_2308223_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_000120340.1|2308629_2309343_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000839587.1|2309533_2309749_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	2.9e-32
WP_000189921.1|2309753_2310065_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	63.6	1.0e-25
WP_001092971.1|2310061_2310595_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_001071769.1|2310591_2311089_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
2311061:2311076	attR	CTTTAAGAGATAAAAA	NA	NA	NA	NA
WP_000066495.1|2311452_2311665_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_161620967.1|2311675_2311864_+	cold-shock protein	NA	NA	NA	NA	NA
WP_120795388.1|2311866_2311932_+	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_001309517.1|2312011_2312167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019139.1|2312339_2312513_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_148462276.1|2312664_2313075_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	90.4	4.2e-64
WP_000421825.1|2313568_2314108_+	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
WP_001774468.1|2314116_2316216_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	96.4	0.0e+00
WP_001072975.1|2316212_2316425_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_077875340.1|2316352_2317933_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.8	1.6e-289
WP_077628251.1|2317877_2319905_+|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	100.0	0.0e+00
WP_001097050.1|2319991_2320315_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283153.1|2320307_2320583_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677132.1|2320594_2321173_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	1.2e-101
WP_001079419.1|2321169_2321571_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	99.2	1.9e-72
WP_089626894.1|2321581_2322325_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	97.6	3.6e-130
WP_089626897.1|2322385_2322772_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	95.3	3.7e-62
WP_001161009.1|2322780_2323110_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001774463.1|2323081_2326147_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.7	0.0e+00
WP_000447253.1|2326146_2326476_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_161620883.1|2326485_2327184_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	1.5e-133
WP_064765169.1|2327189_2327933_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.7	4.3e-147
WP_001399694.1|2327830_2328478_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.7	1.2e-110
WP_161620884.1|2328538_2331937_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	89.7	0.0e+00
WP_161620885.1|2332003_2332603_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	95.5	7.7e-107
WP_161620886.1|2332667_2335973_+|tail	phage tail protein	tail	K7PGT9	Enterobacteria_phage	68.0	4.1e-274
WP_072144121.1|2336027_2336147_+	hypothetical protein	NA	K7PMH7	Enterobacteria_phage	84.6	3.1e-12
WP_057687895.1|2336244_2336835_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.3	8.1e-24
WP_000836768.1|2337151_2337385_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|2337453_2337567_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000347483.1|2338170_2339454_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527797.1|2339542_2341003_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.8	1.1e-42
>prophage 4
NZ_CP041437	Escherichia coli strain STEC005 chromosome, complete genome	4937832	2552930	2624014	4937832	terminase,holin,integrase,tail,plate,tRNA	Escherichia_phage(76.39%)	92	2577407:2577423	2616157:2616173
WP_000837924.1|2552930_2554064_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
WP_001082294.1|2554204_2554639_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.0e-28
WP_032221042.1|2555178_2555742_-	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	95.2	5.6e-99
WP_161620328.1|2555741_2558114_-|tail	phage tail protein	tail	A0A0U2SH60	Escherichia_phage	65.6	8.7e-295
WP_097452375.1|2558137_2558668_-|tail	phage tail protein	tail	A0A0U2QV64	Escherichia_phage	99.4	2.4e-96
WP_097452376.1|2558682_2560065_-|tail	phage tail protein	tail	A0A0U2SAV1	Escherichia_phage	100.0	2.6e-267
WP_001199731.1|2560061_2560688_-	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	100.0	2.0e-121
WP_136769124.1|2560671_2561898_-	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	99.0	2.6e-226
WP_001774840.1|2561940_2562687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161620891.1|2563024_2563585_+	phage antirepressor Ant	NA	A0A0U2QL80	Escherichia_phage	84.9	8.6e-84
WP_001261330.1|2563560_2563908_-	hypothetical protein	NA	A0A0U2I1S2	Escherichia_phage	99.1	4.4e-62
WP_063100420.1|2563957_2564512_-	Rha family transcriptional regulator	NA	A0A088CBJ5	Shigella_phage	87.6	1.2e-85
WP_097446552.1|2565009_2565723_-|plate	phage baseplate protein	plate	A0A0U2JTX5	Escherichia_phage	95.8	2.8e-124
WP_001271169.1|2565722_2566730_-	hypothetical protein	NA	A0A0U2QL72	Escherichia_phage	91.3	3.6e-181
WP_063100417.1|2566729_2566996_-	hypothetical protein	NA	A0A0U2JGJ3	Escherichia_phage	96.6	2.4e-44
WP_161620892.1|2566992_2567661_-	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	98.6	9.5e-122
WP_096934524.1|2567664_2569740_-	hypothetical protein	NA	A0A0U2QV45	Escherichia_phage	43.2	4.3e-128
WP_136769122.1|2569804_2570422_-	hypothetical protein	NA	A0A0U2S634	Escherichia_phage	78.0	3.3e-84
WP_000613368.1|2570418_2570850_-	hypothetical protein	NA	A0A0U2S616	Escherichia_phage	100.0	3.3e-75
WP_096934526.1|2570873_2572211_-	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	97.1	5.5e-246
WP_063102153.1|2572210_2573155_-	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	99.0	8.3e-172
WP_053272720.1|2573141_2573582_-	hypothetical protein	NA	A0A0U2RTA8	Escherichia_phage	84.9	1.4e-68
WP_000175376.1|2573578_2574019_-	hypothetical protein	NA	A0A0U2S646	Escherichia_phage	99.3	1.2e-77
WP_000780861.1|2574018_2574489_-	hypothetical protein	NA	A0A0U2SAX6	Escherichia_phage	100.0	2.5e-84
WP_001272367.1|2574546_2575575_-	hypothetical protein	NA	A0A0U2QQI2	Escherichia_phage	99.7	1.9e-190
WP_096934527.1|2575589_2576207_-	hypothetical protein	NA	A0A0U2S600	Escherichia_phage	99.0	1.3e-117
WP_000059661.1|2576199_2577492_-	DUF2213 domain-containing protein	NA	A0A0U2QW61	Escherichia_phage	100.0	4.6e-197
2577407:2577423	attL	ACCAGCCACATGTTGGA	NA	NA	NA	NA
WP_161620968.1|2577472_2578192_-	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	97.9	1.1e-134
WP_161620893.1|2578250_2579687_-	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	96.7	1.2e-267
WP_021572593.1|2579705_2581034_-	hypothetical protein	NA	A0A0U2JTW9	Escherichia_phage	99.1	3.8e-263
WP_161620894.1|2581023_2582115_-|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	91.2	5.1e-141
WP_000126790.1|2582118_2582328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096934529.1|2582305_2583238_-	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	55.2	3.2e-83
WP_062873741.1|2583230_2584022_-	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.7	5.7e-49
WP_001421067.1|2584140_2584320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071702711.1|2584295_2584508_+	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_000014554.1|2584831_2585209_-	M15 family metallopeptidase	NA	Q9MBZ3	Enterobacteria_phage	98.4	7.8e-65
WP_096934530.1|2585211_2585487_-|holin	phage holin family protein	holin	Q9MBZ4	Enterobacteria_phage	97.8	2.5e-44
WP_001294583.1|2585476_2585869_-|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	89.2	5.7e-50
WP_161620969.1|2585926_2586352_-	subtilase cytotoxin subunit B-like protein	NA	NA	NA	NA	NA
WP_001774831.1|2586419_2587145_-	hypothetical protein	NA	A0A0U2KD26	Escherichia_phage	66.0	7.5e-80
WP_000640111.1|2587532_2588075_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	74.6	1.6e-74
WP_000228027.1|2588071_2588362_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	88.5	5.7e-47
WP_062873745.1|2588361_2588961_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	94.5	8.2e-109
WP_062873747.1|2589521_2589734_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	97.1	3.3e-28
WP_000058712.1|2589937_2590834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000673135.1|2590871_2591165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097450141.1|2591362_2591758_-	hypothetical protein	NA	A0A193GYM6	Enterobacter_phage	60.5	7.2e-37
WP_077881748.1|2591757_2592009_-	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	39.3	1.7e-07
WP_114499960.1|2592589_2592901_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	82.5	1.5e-50
WP_097446829.1|2592893_2593148_-	hypothetical protein	NA	A0A0U2RK51	Escherichia_phage	88.1	2.9e-39
WP_136768705.1|2593144_2593567_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	95.7	4.2e-67
WP_161620895.1|2593583_2594354_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	76.6	2.9e-98
WP_000788979.1|2594374_2595121_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	81.3	4.3e-115
WP_112035990.1|2595127_2595916_-	hypothetical protein	NA	G9L6A8	Escherichia_phage	57.1	6.1e-43
WP_109955692.1|2595994_2596417_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.7	2.4e-70
WP_001774821.1|2596400_2596676_-	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	98.8	5.7e-41
WP_001774820.1|2596783_2597245_+	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	99.3	4.4e-78
WP_062873819.1|2597495_2597801_+	hypothetical protein	NA	A0A0U2S618	Escherichia_phage	99.0	1.5e-45
WP_032221031.1|2597762_2597996_-	hypothetical protein	NA	A0A0U2S658	Escherichia_phage	98.7	1.5e-34
WP_001156287.1|2598393_2598666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000440741.1|2598684_2598894_+	host cell division inhibitory peptide Kil	NA	NA	NA	NA	NA
WP_001093898.1|2598814_2599051_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_074430109.1|2598980_2599181_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	88.7	7.4e-22
WP_000632298.1|2599255_2599531_+	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	100.0	5.0e-45
WP_062873821.1|2599632_2602305_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	80.5	0.0e+00
WP_000166313.1|2602297_2603107_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
WP_001317028.1|2603163_2603358_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_001383994.1|2603350_2603539_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	100.0	1.9e-27
WP_000079604.1|2603638_2603854_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040837.1|2603855_2605091_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	99.8	2.9e-241
WP_001157407.1|2605142_2606078_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000123738.1|2606206_2607580_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387395.1|2608057_2609041_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628065.1|2609295_2610528_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_001046821.1|2610548_2611112_-	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_001421979.1|2611779_2611959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161620896.1|2612265_2612790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161620897.1|2612841_2614881_-	lytic transglycosylase domain-containing protein	NA	A0A0U2QV45	Escherichia_phage	52.1	1.1e-107
WP_161620898.1|2614945_2615563_-	hypothetical protein	NA	A0A0U2S634	Escherichia_phage	80.0	3.7e-88
WP_161620899.1|2615570_2616242_-	DUF2213 domain-containing protein	NA	A0A0U2QW61	Escherichia_phage	53.9	4.1e-64
2616157:2616173	attR	ACCAGCCACATGTTGGA	NA	NA	NA	NA
WP_032082823.1|2616306_2616885_-	hypothetical protein	NA	A0A0U2QW61	Escherichia_phage	63.2	6.4e-34
WP_069722811.1|2617298_2617586_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_161620900.1|2617582_2618113_-	proQ/FINO family protein	NA	Q2A0A1	Sodalis_phage	34.0	6.2e-07
WP_047085456.1|2618105_2618456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161620901.1|2618859_2620998_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	50.5	1.5e-157
WP_021534226.1|2620994_2621285_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001421990.1|2621289_2621490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089539772.1|2621482_2621848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089539794.1|2621840_2622206_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_052326232.1|2622981_2623713_-	Rha family transcriptional regulator	NA	A0A2D1GLJ3	Escherichia_phage	51.0	4.2e-22
WP_000953275.1|2623825_2624014_-	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.7	4.1e-14
>prophage 5
NZ_CP041437	Escherichia coli strain STEC005 chromosome, complete genome	4937832	2701579	2762613	4937832	protease,terminase,holin,integrase,tail,capsid,portal,plate,head	Escherichia_phage(36.36%)	81	2715358:2715392	2762750:2762784
WP_000422045.1|2701579_2702629_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559278.1|2702848_2703607_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	24.5	4.4e-06
WP_001278906.1|2703603_2704194_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|2704233_2705106_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001295575.1|2705206_2705827_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285661.1|2705823_2706705_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2706842_2706887_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194590.1|2706978_2708541_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763511.1|2708540_2710136_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001297118.1|2710139_2711498_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
WP_000209520.1|2711509_2712703_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443056.1|2712702_2713509_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|2713889_2714069_+	general stress protein	NA	NA	NA	NA	NA
WP_001056490.1|2714154_2714655_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_161620903.1|2714700_2715207_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
2715358:2715392	attL	GTGGTATCGATATCCATGTACCACACTGACATGTT	NA	NA	NA	NA
WP_096836018.1|2715577_2715853_+	hypothetical protein	NA	S5MQL6	Escherichia_phage	50.7	4.7e-11
WP_096836020.1|2715849_2716407_+	Rha family transcriptional regulator	NA	Q8H9L9	Vibrio_phage	62.9	3.5e-29
WP_136769085.1|2716443_2717022_-	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	91.2	2.0e-91
WP_161620904.1|2717021_2719304_-|tail	phage tail protein	tail	A0A0U2SH60	Escherichia_phage	86.1	3.1e-249
WP_161620905.1|2719328_2720405_-	late control protein	NA	R9TNM7	Vibrio_phage	29.8	1.7e-32
WP_001107807.1|2720395_2720614_-|tail	phage tail protein	tail	R9TR63	Vibrio_phage	52.1	4.9e-11
WP_000228000.1|2720588_2721077_-|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	34.1	4.0e-13
WP_161620906.1|2721079_2722732_-	hypothetical protein	NA	R9TRP8	Vibrio_phage	33.6	6.5e-47
WP_033813285.1|2722849_2723152_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_033813286.1|2723213_2723732_-|tail	tail protein	tail	NA	NA	NA	NA
WP_096095865.1|2723728_2725204_-|tail	phage tail protein	tail	R9TMQ0	Vibrio_phage	38.3	3.3e-74
WP_096095866.1|2725259_2725790_-|tail	tail assembly chaperone	tail	A0A1S6KZY8	Salmonella_phage	44.2	5.7e-37
WP_096095867.1|2725807_2726338_-|tail	phage tail protein	tail	A0A0U2QV64	Escherichia_phage	76.3	4.0e-75
WP_161620907.1|2726352_2727609_-|tail	phage tail protein	tail	A0A0U2SAV1	Escherichia_phage	96.5	1.1e-126
WP_096836038.1|2727605_2728196_-|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	39.9	2.8e-24
WP_000235847.1|2728188_2729103_-|plate	baseplate assembly protein	plate	D5LGZ3	Escherichia_phage	43.6	7.5e-61
WP_000579232.1|2729077_2729434_-	hypothetical protein	NA	V5YTB2	Pseudomonas_phage	46.8	1.6e-19
WP_000049992.1|2729467_2730091_-|plate	phage baseplate assembly protein V	plate	F1BUP5	Erwinia_phage	29.8	2.4e-10
WP_097450120.1|2730074_2730626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096095872.1|2730637_2731360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032083604.1|2731340_2731742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001372342.1|2731744_2732110_-	DNA breaking-rejoining protein	NA	NA	NA	NA	NA
WP_096934545.1|2732160_2733189_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	58.9	1.3e-109
WP_032083606.1|2733257_2733593_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	54.2	3.3e-22
WP_161620836.1|2733632_2735357_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	53.6	6.9e-100
WP_097450122.1|2735376_2736900_-|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	63.4	5.8e-183
WP_000263126.1|2736944_2737154_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	49.2	1.4e-10
WP_136769138.1|2737157_2739074_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.4	4.3e-252
WP_136769139.1|2739045_2739594_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	87.1	1.1e-59
WP_136769141.1|2740178_2740475_-	hypothetical protein	NA	Q8W634	Enterobacteria_phage	98.0	4.3e-50
WP_064484544.1|2740563_2740746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014554.1|2741112_2741490_-	M15 family metallopeptidase	NA	Q9MBZ3	Enterobacteria_phage	98.4	7.8e-65
WP_161620908.1|2741492_2741768_-|holin	phage holin family protein	holin	Q9MBZ4	Enterobacteria_phage	95.6	4.2e-44
WP_001294582.1|2741757_2742150_-|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	90.0	1.5e-50
WP_097450101.1|2742238_2742391_-	DUF3927 domain-containing protein	NA	A0A0A0YRI9	Escherichia_phage	57.8	1.9e-06
WP_097450102.1|2742387_2742813_-	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	85.8	4.2e-59
WP_097450103.1|2743699_2744743_-	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	92.1	4.1e-188
WP_000917767.1|2744893_2745091_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_161620909.1|2745260_2745974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097450105.1|2746228_2746795_-	ORF6N domain-containing protein	NA	A0A2R2Z302	Escherichia_phage	78.4	1.7e-47
WP_161620970.1|2747073_2747457_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	1.3e-59
WP_097450106.1|2747449_2747821_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.2e-36
WP_161620910.1|2747833_2748883_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	9.4e-108
WP_097450153.1|2748884_2749163_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	4.8e-11
WP_096095931.1|2749229_2749481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|2749698_2749854_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_097450141.1|2750144_2750540_-	hypothetical protein	NA	A0A193GYM6	Enterobacter_phage	60.5	7.2e-37
WP_096095942.1|2750539_2750791_-	DUF551 domain-containing protein	NA	Q76H45	Enterobacteria_phage	43.2	7.6e-08
WP_097446831.1|2751339_2751975_-	ead/Ea22-like family protein	NA	A0A2R2Z315	Escherichia_phage	99.5	2.8e-115
WP_001224672.1|2752140_2752323_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	96.7	2.0e-26
WP_033812990.1|2752451_2752763_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	82.5	9.0e-51
WP_033812989.1|2752755_2753010_-	hypothetical protein	NA	A0A0U2RK51	Escherichia_phage	89.3	7.7e-40
WP_087907238.1|2753006_2753429_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	95.0	2.1e-66
WP_087907239.1|2753445_2754216_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	77.0	5.8e-99
WP_159105019.1|2754250_2754793_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.0	2.6e-85
WP_123007303.1|2754704_2755745_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	88.3	1.9e-92
WP_097450109.1|2755716_2756268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000476986.1|2756251_2756479_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001003379.1|2756556_2756964_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	7.2e-24
WP_000379577.1|2757155_2757311_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_157839737.1|2757452_2757611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112015954.1|2758251_2758434_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090192.1|2758436_2758640_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_112015955.1|2758720_2761192_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.8	3.8e-59
WP_000113182.1|2761256_2761505_+	excisionase	NA	NA	NA	NA	NA
WP_033813123.1|2761482_2762613_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.1	5.7e-103
2762750:2762784	attR	GTGGTATCGATATCCATGTACCACACTGACATGTT	NA	NA	NA	NA
>prophage 6
NZ_CP041437	Escherichia coli strain STEC005 chromosome, complete genome	4937832	3011441	3064760	4937832	protease,terminase,holin,integrase,tail,capsid,portal,head	Escherichia_phage(39.22%)	69	3016115:3016174	3063835:3063899
WP_001651815.1|3011441_3012029_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|3012025_3012733_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107384.1|3012751_3014545_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001295940.1|3014541_3015660_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
3016115:3016174	attL	CGGTCTTGAAAACCGGCGACCCGAAAGGGTTCCAGAGTTCGAATCTCTGCGCTTCCGCCA	NA	NA	NA	NA
WP_161620914.1|3016440_3018270_-|tail	phage tail protein	tail	A0A2D1UII2	Escherichia_phage	76.2	1.9e-47
WP_161620915.1|3018334_3018934_-	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	88.9	1.3e-98
WP_161620916.1|3019001_3022397_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	89.7	0.0e+00
WP_122999551.1|3022457_3023090_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	89.5	7.2e-95
WP_000194783.1|3023026_3023770_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	1.2e-146
WP_074487959.1|3023775_3024474_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	1.6e-132
WP_000847332.1|3024473_3024803_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	99.1	5.6e-59
WP_061307684.1|3024799_3027373_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	84.2	0.0e+00
WP_000533393.1|3027353_3027767_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	80.8	2.5e-40
WP_001299690.1|3027793_3028225_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.4	2.4e-41
WP_000235050.1|3028243_3028990_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.4	3.3e-123
WP_000683079.1|3028997_3029393_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000975011.1|3029389_3029965_-|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	56.8	2.1e-48
WP_001204198.1|3029979_3030333_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	3.0e-42
WP_000201509.1|3030325_3030694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522625.1|3030745_3031774_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	60.1	6.1e-112
WP_000256823.1|3031831_3032179_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
WP_001253952.1|3032215_3033721_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	3.6e-100
WP_001353246.1|3033710_3035303_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	1.7e-185
WP_000259002.1|3035299_3035506_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_074500470.1|3035489_3037418_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	1.4e-258
WP_001405844.1|3037389_3037896_-	DNA-packaging protein	NA	O64316	Escherichia_phage	48.5	1.6e-33
WP_001305859.1|3038709_3038823_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	89.2	2.5e-11
WP_161620342.1|3038954_3039236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089606971.1|3039306_3039684_-	M15 family metallopeptidase	NA	Q9MBZ3	Enterobacteria_phage	93.5	1.1e-61
WP_161619110.1|3039686_3039962_-|holin	phage holin family protein	holin	Q9MBZ4	Enterobacteria_phage	94.5	2.8e-43
WP_161620917.1|3039951_3040344_-|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	86.9	1.6e-52
WP_161620918.1|3040522_3040795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097449973.1|3040760_3041105_-	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	83.0	2.0e-46
WP_097449974.1|3041109_3041325_-|holin	holin	holin	G9L6J5	Escherichia_phage	97.2	2.2e-32
WP_096129430.1|3041590_3041914_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	99.1	1.7e-60
WP_000738076.1|3042101_3042371_-	Shiga toxin Stx2d subunit B	NA	Q5TJL5	Enterobacteria_phage	97.8	3.0e-42
WP_097449975.1|3042382_3043342_-	Shiga toxin Stx2 subunit A	NA	Q6DWN9	Enterobacteria_phage	96.6	1.8e-169
WP_097449976.1|3043711_3044425_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917767.1|3044561_3044759_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_057108854.1|3044932_3045646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047662436.1|3045900_3046566_-	antiterminator	NA	I6PDF8	Cronobacter_phage	52.4	9.3e-61
WP_000510632.1|3046562_3046922_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	2.4e-39
WP_001265268.1|3046934_3047984_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.0e-109
WP_024187670.1|3047985_3048258_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	7.2e-12
WP_024187671.1|3048681_3049119_-	toxin	NA	NA	NA	NA	NA
WP_021534150.1|3049167_3049527_-	helix-turn-helix transcriptional regulator	NA	L7TKV7	Pseudomonas_virus	46.6	3.6e-19
WP_071999547.1|3049753_3049876_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	85.0	1.6e-11
WP_044806668.1|3049898_3050924_-	hypothetical protein	NA	A0A0M4S6X1	Salmonella_phage	88.3	1.8e-172
WP_097446546.1|3051076_3051475_-	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	51.5	1.7e-17
WP_097446545.1|3051951_3052263_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	81.6	4.5e-50
WP_161620919.1|3052506_3053211_-	ead/Ea22-like family protein	NA	A0A0U2QW67	Escherichia_phage	98.7	1.9e-120
WP_161620920.1|3053170_3053476_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	98.0	1.4e-51
WP_001594978.1|3053472_3053895_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	93.6	1.1e-67
WP_106121408.1|3053935_3054901_-	hypothetical protein	NA	U5P0A0	Shigella_phage	64.4	2.8e-58
WP_089550520.1|3054881_3055403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019965.1|3055386_3055653_-	DNA-binding protein	NA	A0A2I6PIE5	Escherichia_phage	60.6	1.5e-17
WP_000233318.1|3055732_3056152_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	58.7	2.1e-18
WP_000379575.1|3056447_3056603_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001171930.1|3056762_3056981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394534.1|3057003_3057324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001351093.1|3057301_3057739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001353256.1|3058098_3058362_-	DUF1883 domain-containing protein	NA	NA	NA	NA	NA
WP_161620921.1|3058582_3059437_+	transcriptional regulator	NA	A0A0P0ZE80	Stx2-converting_phage	62.7	1.0e-64
WP_000450218.1|3059447_3059636_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_001093951.1|3059632_3059836_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_161620922.1|3059915_3062387_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_000273158.1|3062453_3062705_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_161620353.1|3062673_3063693_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	50.0	4.4e-86
WP_000375136.1|3064100_3064760_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
3063835:3063899	attR	CGGTCTTGAAAACCGGCGACCCGAAAGGGTTCCAGAGTTCGAATCTCTGCGCTTCCGCCAAATAA	NA	NA	NA	NA
>prophage 7
NZ_CP041437	Escherichia coli strain STEC005 chromosome, complete genome	4937832	3154975	3241010	4937832	protease,terminase,lysis,integrase,tail,capsid,portal,plate,head,tRNA	Salmonella_phage(60.71%)	89	3147936:3147951	3243581:3243596
3147936:3147951	attL	GTTACCGCCATCGCCA	NA	NA	NA	NA
WP_000886683.1|3154975_3156268_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067767.1|3156358_3157702_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|3157712_3158324_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077018.1|3158478_3162624_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|3162758_3163253_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|3163797_3164763_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_001043587.1|3164885_3166652_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_001202185.1|3166652_3168374_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	2.4e-20
WP_001241694.1|3168415_3169120_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3169404_3169623_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|3170366_3172643_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|3172673_3172994_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|3173316_3173541_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188193.1|3173613_3175560_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	5.0e-38
WP_000746460.1|3175556_3176672_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_001355621.1|3176822_3177779_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000599812.1|3177775_3179434_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_000488716.1|3179859_3180555_+	aquaporin Z	NA	NA	NA	NA	NA
WP_000491142.1|3181011_3181911_+	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_000458817.1|3182054_3183707_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000178677.1|3183718_3184687_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000815350.1|3184819_3186538_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	4.0e-31
WP_000566372.1|3186574_3187576_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_001136554.1|3187586_3189017_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001338420.1|3189115_3190129_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001255144.1|3190125_3190956_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001160737.1|3190952_3191276_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001270740.1|3191401_3191917_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027205.1|3192134_3192863_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_000756569.1|3192880_3193612_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001001691.1|3193618_3194335_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000464491.1|3194334_3195003_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001295905.1|3195294_3196026_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001149732.1|3196200_3197328_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	3.5e-28
WP_000389260.1|3197368_3197857_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061657.1|3197916_3198762_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000105438.1|3198758_3199712_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000996017.1|3199721_3200855_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000126097.1|3200949_3202062_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|3202412_3202889_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|3202976_3203879_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000189159.1|3203939_3204662_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201576.1|3204645_3204933_-	YbjC family protein	NA	NA	NA	NA	NA
WP_001195231.1|3205092_3205350_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	63.1	7.8e-24
WP_000681108.1|3205379_3205757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024876.1|3206026_3207712_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000972391.1|3207947_3208166_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_001011797.1|3208255_3209356_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.0	1.7e-176
WP_052921286.1|3209352_3209838_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	1.8e-66
WP_161620923.1|3209834_3212912_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.4	0.0e+00
WP_000763311.1|3212904_3213024_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001281016.1|3213038_3213341_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	90.0	8.2e-41
WP_097480616.1|3213395_3213911_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	94.7	1.1e-88
WP_161620924.1|3213920_3215093_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.0	3.9e-203
WP_001513107.1|3215199_3215613_-|tail	caudovirales tail fiber assembly family protein	tail	U5P0S4	Shigella_phage	73.0	3.4e-21
WP_161620925.1|3215612_3217532_-|tail	phage tail protein	tail	A0A0F7LDR4	Escherichia_phage	46.0	4.0e-80
WP_021534464.1|3217528_3218134_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	5.8e-110
WP_000268297.1|3218126_3219035_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.7	2.7e-143
WP_000177580.1|3219021_3219381_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	87.4	3.2e-52
WP_097421338.1|3219377_3219956_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	86.5	8.0e-93
WP_161620926.1|3220049_3220955_+	hypothetical protein	NA	E5G6N5	Salmonella_phage	35.0	3.0e-38
WP_111961581.1|3220943_3221390_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	81.0	8.1e-61
WP_001039937.1|3221382_3221814_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.7	1.3e-71
WP_000196201.1|3221909_3222338_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	88.7	2.8e-58
WP_001069904.1|3222334_3222850_-	lysozyme	NA	E5G6N1	Salmonella_phage	93.0	7.4e-90
WP_000171568.1|3222830_3223046_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_000868175.1|3223049_3223253_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000673523.1|3223252_3223717_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	6.4e-77
WP_161620927.1|3223812_3224463_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.4	1.9e-111
WP_000742510.1|3224466_3225525_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	3.8e-181
WP_001554837.1|3225541_3226375_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.7	5.3e-122
WP_089588519.1|3226517_3228284_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_161620928.1|3228283_3229312_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	88.2	6.5e-170
WP_097421331.1|3229343_3230027_-	RelA/SpoT domain-containing protein	NA	NA	NA	NA	NA
WP_089588522.1|3230023_3231127_-	AAA family ATPase	NA	Q7M293	Enterobacteria_phage	26.2	5.0e-19
WP_001217575.1|3231407_3231641_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|3231651_3231840_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_161620929.1|3231993_3234408_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.9	0.0e+00
WP_109538357.1|3234404_3235262_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	3.0e-160
WP_161620930.1|3235258_3235486_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	97.3	1.7e-35
WP_044071187.1|3235485_3235719_-	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	96.1	2.4e-32
WP_000963473.1|3235786_3236128_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_000956182.1|3236091_3236292_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
WP_000460894.1|3236299_3236809_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	9.8e-87
WP_000035244.1|3236841_3237063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001009714.1|3237188_3238070_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	45.3	6.4e-41
WP_161620931.1|3238150_3239353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000584504.1|3239354_3239876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000290942.1|3239957_3241010_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	6.1e-107
3243581:3243596	attR	TGGCGATGGCGGTAAC	NA	NA	NA	NA
>prophage 8
NZ_CP041437	Escherichia coli strain STEC005 chromosome, complete genome	4937832	3544585	3606936	4937832	protease,terminase,transposase,lysis,integrase,tail,capsid,portal,head,tRNA	Enterobacteria_phage(44.0%)	67	3553066:3553112	3596730:3596776
WP_000420795.1|3544585_3545722_+|transposase	ISAs1-like element ISEc1 family transposase	transposase	NA	NA	NA	NA
WP_000383951.1|3545990_3548228_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000662366.1|3548214_3551187_+	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_001224569.1|3551187_3552078_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177452.1|3552260_3553022_+	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
3553066:3553112	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_047671491.1|3553535_3554489_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_000386784.1|3554738_3555488_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000239881.1|3556350_3557019_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_161620938.1|3557073_3557658_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.3	2.8e-101
WP_161620939.1|3557657_3560573_-	hypothetical protein	NA	A0A2D1UII2	Escherichia_phage	97.5	3.8e-58
WP_001230378.1|3560637_3561237_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.0	4.4e-110
WP_161620940.1|3561303_3564702_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.1	0.0e+00
WP_071592395.1|3564762_3565395_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	98.1	7.2e-95
WP_097422276.1|3565331_3566075_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.0	2.4e-150
WP_001152502.1|3566080_3566779_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	8.9e-131
WP_000847345.1|3566778_3567108_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_097422274.1|3567104_3569666_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	90.2	0.0e+00
WP_000459457.1|3569658_3570093_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_001357868.1|3570074_3570497_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	8.2e-71
WP_001357869.1|3570512_3571253_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.4	1.6e-130
WP_001357870.1|3571260_3571656_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	98.5	2.9e-70
WP_000985116.1|3571652_3572231_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	7.8e-80
WP_000785282.1|3572242_3572596_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
WP_000158875.1|3572607_3573003_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	1.1e-58
WP_001357871.1|3573044_3574070_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.4	3.1e-188
WP_001338090.1|3574125_3574458_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	6.5e-55
WP_000123225.1|3574467_3575787_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.9	6.2e-234
WP_063100970.1|3575767_3577369_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	4.2e-309
WP_000198149.1|3577365_3577572_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027269.1|3577568_3579494_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000453611.1|3579468_3580014_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
WP_001421937.1|3580402_3580597_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_001031427.1|3580761_3580968_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_000079503.1|3581253_3581664_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
WP_000738500.1|3581954_3582248_+	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_001228697.1|3582338_3582521_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_001135281.1|3582737_3583235_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_000670959.1|3583234_3583450_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	3.4e-33
WP_000737283.1|3584038_3585136_+	porin	NA	Q1MVN1	Enterobacteria_phage	76.3	4.8e-155
WP_161620941.1|3585357_3585708_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.6	4.4e-54
WP_161620942.1|3586270_3586711_-	hypothetical protein	NA	A0A291AWV9	Escherichia_phage	99.3	1.1e-78
WP_001061408.1|3586718_3587516_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.6	7.5e-150
WP_000767127.1|3587535_3587925_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	1.6e-68
WP_000210176.1|3587921_3588248_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	97.2	2.3e-52
WP_001573323.1|3588247_3588742_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	97.5	6.2e-86
WP_000104957.1|3588738_3589680_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.3	1.7e-140
WP_001250269.1|3589669_3589849_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515870.1|3590024_3590576_-	hypothetical protein	NA	U5P4K1	Shigella_phage	98.9	1.7e-100
WP_000205494.1|3590613_3590814_-	cell division protein	NA	NA	NA	NA	NA
WP_000450738.1|3590911_3591538_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	2.5e-47
WP_000559922.1|3591765_3592281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000135682.1|3592751_3593114_+	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_000081287.1|3593179_3594004_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000008165.1|3594131_3594668_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	4.8e-100
WP_001242707.1|3594658_3595021_+	phage protein	NA	K7PH61	Enterobacteria_phage	98.3	4.4e-65
WP_000206813.1|3595020_3595326_+	hypothetical protein	NA	U5P0J0	Shigella_phage	95.0	1.4e-48
WP_000433949.1|3595325_3595697_+	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.8e-46
WP_000051902.1|3595552_3596716_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
WP_000805432.1|3597050_3597683_+	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
3596730:3596776	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001323731.1|3597685_3598201_-	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000691050.1|3598211_3599219_-	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_000988366.1|3601870_3602563_-	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_000776555.1|3602782_3603325_-	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000729160.1|3603805_3604672_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000190288.1|3604673_3604886_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001143552.1|3604993_3605515_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000912345.1|3605550_3606936_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
>prophage 9
NZ_CP041437	Escherichia coli strain STEC005 chromosome, complete genome	4937832	3837218	3919522	4937832	protease,terminase,holin,integrase,tail,capsid,portal,plate,head	Shigella_phage(56.14%)	90	3856139:3856155	3916968:3916984
WP_000131034.1|3837218_3839252_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	4.4e-21
WP_001351501.1|3839380_3839968_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089066.1|3839981_3841454_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159102.1|3841467_3843138_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_001209088.1|3843349_3844015_+	membrane protein	NA	NA	NA	NA	NA
WP_001358288.1|3844260_3844956_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023906.1|3844948_3846376_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102119.1|3846386_3847106_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339593.1|3847632_3848487_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001046329.1|3848712_3850038_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	48.1	1.0e-114
WP_000474077.1|3850146_3850383_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001365941.1|3850394_3850985_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_001315271.1|3851580_3852438_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000092603.1|3852559_3856813_-	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
3856139:3856155	attL	CGGCGATTTTTTCCAGC	NA	NA	NA	NA
WP_000662258.1|3857928_3858030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803999.1|3858392_3858656_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|3858655_3858796_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147277.1|3858830_3859058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001296902.1|3859880_3860423_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730974.1|3860497_3861085_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716398.1|3861142_3861811_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131079.1|3861836_3864362_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001315269.1|3864351_3865995_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001305432.1|3865963_3866674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303809.1|3866986_3867316_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|3867563_3868178_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070694.1|3868595_3869285_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643333.1|3869281_3870238_+	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
WP_000667026.1|3870234_3872433_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
WP_000121330.1|3872442_3873399_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_161620949.1|3873377_3873788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000343528.1|3874309_3877486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161620950.1|3878205_3880095_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_000905004.1|3880128_3880320_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	72.1	1.5e-16
WP_032276223.1|3880349_3880754_+	hypothetical protein	NA	M1FN94	Enterobacteria_phage	42.3	3.6e-15
WP_000639074.1|3880762_3881158_+|tail	tail fiber assembly protein	tail	A0A0M4S6V4	Salmonella_phage	43.5	3.5e-15
WP_000782984.1|3881129_3881549_-|tail	tail assembly chaperone	tail	M1SNQ2	Escherichia_phage	64.7	3.8e-36
WP_000383548.1|3882211_3882796_-	YmfQ family protein	NA	O22003	Shigella_phage	100.0	1.1e-113
WP_161620951.1|3882786_3883845_-|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	99.4	5.0e-202
WP_032252893.1|3883831_3884257_-|tail	phage tail protein	tail	U5P0R9	Shigella_phage	98.6	7.4e-80
WP_001259084.1|3884256_3884805_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	98.9	5.1e-97
WP_000999510.1|3884804_3885884_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	100.0	5.3e-207
WP_032252894.1|3885880_3887209_-	DNA circularization protein	NA	Q8SBG8	Shigella_phage	99.1	3.2e-246
WP_000734912.1|3887319_3887766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161620952.1|3887798_3889631_-|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	98.4	2.6e-302
WP_000661054.1|3889772_3890042_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
WP_000090998.1|3890041_3890398_-	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_000155733.1|3890397_3891894_-|tail	tail sheath protein	tail	S5FKL0	Shigella_phage	98.8	7.5e-276
WP_000497751.1|3891877_3892048_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000779276.1|3892056_3892617_-	hypothetical protein	NA	Q8SBH4	Shigella_phage	97.8	2.6e-104
WP_000213502.1|3892613_3893120_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	100.0	1.7e-91
WP_000702402.1|3893094_3893505_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	98.5	9.1e-75
WP_000927719.1|3893501_3893825_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_000601360.1|3893827_3894028_-	hypothetical protein	NA	S5FNU1	Shigella_phage	97.0	3.8e-26
WP_000257501.1|3894077_3895283_-|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	99.0	2.9e-222
WP_001193631.1|3895297_3895948_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_001560816.1|3895925_3897167_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.5	5.9e-242
WP_000605606.1|3897166_3897349_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_072011717.1|3897360_3898857_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.8	7.4e-300
WP_000929190.1|3899090_3899585_-|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	98.8	8.6e-88
WP_021570659.1|3899710_3900061_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	92.2	2.4e-60
WP_161620953.1|3900188_3900563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021570657.1|3900774_3901167_-	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	82.3	5.1e-51
WP_021570656.1|3901150_3901627_-	glycoside hydrolase family protein	NA	Q8SBE0	Shigella_phage	98.1	1.4e-87
WP_021570655.1|3901630_3901957_-|holin	phage holin, lambda family	holin	U5P0K7	Shigella_phage	97.2	1.7e-55
WP_047658045.1|3902046_3902832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047658043.1|3903034_3903787_-	antitermination protein	NA	Q8SBE4	Shigella_phage	99.2	1.2e-136
WP_021530631.1|3903800_3904790_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	2.5e-195
WP_001061445.1|3904797_3905607_-	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	99.6	4.0e-151
WP_000767105.1|3905626_3906016_-	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	99.2	2.1e-68
WP_000210170.1|3906012_3906339_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_032200251.1|3906335_3906989_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	4.3e-127
WP_072132639.1|3906988_3907483_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.8	5.6e-87
WP_087651143.1|3907479_3908421_-	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.4	9.5e-144
WP_023148278.1|3908410_3908590_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	66.7	3.9e-14
WP_000515830.1|3908765_3909317_-	protein YmfL	NA	S5FXP0	Shigella_phage	98.4	2.2e-100
WP_000649477.1|3909360_3909561_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000848748.1|3909651_3910326_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000549626.1|3910560_3910767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016389.1|3910738_3911173_-	hypothetical protein	NA	U5P096	Shigella_phage	100.0	8.4e-79
WP_000135682.1|3911641_3912004_+	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_000081287.1|3912069_3912894_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000008200.1|3913021_3913558_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	100.0	4.3e-101
WP_001242749.1|3913548_3913911_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_161620954.1|3913910_3914216_+	hypothetical protein	NA	U5P0J0	Shigella_phage	99.0	2.0e-50
WP_000433939.1|3914215_3914566_+	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	100.0	4.9e-61
WP_000051887.1|3914442_3915606_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_000893255.1|3915810_3917064_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
3916968:3916984	attR	CGGCGATTTTTTCCAGC	NA	NA	NA	NA
WP_001285288.1|3917075_3918179_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|3918466_3919522_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
>prophage 1
NZ_CP041438	Escherichia coli strain STEC005 plasmid pSTEC005, complete sequence	89435	20692	31935	89435	integrase	Escherichia_phage(22.22%)	14	18817:18831	29969:29983
18817:18831	attL	GTTCACCAGAAAAAT	NA	NA	NA	NA
WP_096934566.1|20692_21358_-	PIG-L family deacetylase	NA	A0A1L6BYV0	Mycobacterium_phage	28.6	2.4e-08
WP_000813634.1|23606_23825_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159871.1|23826_24132_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_161619134.1|24132_24942_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	94.6	3.0e-53
WP_000239529.1|25079_25355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000633911.1|25348_25993_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	43.5	8.8e-40
WP_001103694.1|26221_27193_+	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	42.9	9.7e-67
WP_000340833.1|27197_27590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000643588.1|27594_27843_-	DUF4113 domain-containing protein	NA	F1C5A5	Cronobacter_phage	60.3	5.0e-20
WP_072001427.1|27872_28865_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	58.9	2.6e-99
WP_032219119.1|28864_29302_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	46.8	2.4e-25
WP_019842136.1|29298_29547_-	DinI-like family protein	NA	Q2A098	Sodalis_phage	48.0	5.4e-14
WP_077877494.1|29895_30867_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
29969:29983	attR	ATTTTTCTGGTGAAC	NA	NA	NA	NA
WP_032219114.1|31251_31935_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	6.7e-30
