The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041435	Escherichia coli strain STEC309 chromosome, complete genome	4917238	781241	852955	4917238	protease,integrase,transposase	Pseudomonas_phage(25.0%)	56	809548:809564	816847:816863
WP_001034504.1|781241_785810_+|protease	lipoprotein metalloprotease SslE	protease	NA	NA	NA	NA
WP_001317326.1|785949_786759_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_001349452.1|786824_787235_+	GspS/AspS pilotin family protein	NA	NA	NA	NA	NA
WP_001317325.1|787252_788212_+	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_000498824.1|788241_790302_+	type II secretion system secretin GspD	NA	NA	NA	NA	NA
WP_000249368.1|790301_791795_+	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_001173448.1|791794_793018_+	type II secretion system inner membrane protein GspF	NA	NA	NA	NA	NA
WP_001087296.1|793034_793490_+	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_001115139.1|793493_794057_+	type II secretion system minor pseudopilin GspH	NA	NA	NA	NA	NA
WP_000820125.1|794053_794425_+	type II secretion system minor pseudopilin GspI	NA	NA	NA	NA	NA
WP_001255030.1|794421_795027_+	type II secretion system minor pseudopilin GspJ	NA	NA	NA	NA	NA
WP_000633239.1|795023_796001_+	type II secretion system minor pseudopilin GspK	NA	NA	NA	NA	NA
WP_000094989.1|795997_797176_+	type II secretion system protein GspL	NA	NA	NA	NA	NA
WP_000942795.1|797177_797714_+	type II secretion system protein	NA	NA	NA	NA	NA
WP_096858932.1|798048_799584_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_001399388.1|800161_800503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072713926.1|800800_801289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072713924.1|801285_801663_-	toxin	NA	NA	NA	NA	NA
WP_072713922.1|801709_802084_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_096858933.1|802133_802778_-	antitoxin of toxin-antitoxin stability system	NA	A0A2I6PI07	Pseudomonas_phage	33.6	3.4e-28
WP_000692326.1|802796_803018_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_122996610.1|803080_803557_-	RadC family protein	NA	NA	NA	NA	NA
WP_000206671.1|803572_804058_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.7	6.9e-13
WP_021536653.1|804149_804968_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.0	8.0e-46
WP_096858934.1|805295_808142_-	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_161619022.1|808513_809386_-	GTPase family protein	NA	NA	NA	NA	NA
809548:809564	attL	CTGTGCCAGAAGCGGAC	NA	NA	NA	NA
WP_001700313.1|809826_811143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000170427.1|812366_814181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001375260.1|814719_815820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001305361.1|816218_816821_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E036	Clostridioides_phage	33.3	1.8e-07
WP_000998321.1|817125_819438_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
816847:816863	attR	CTGTGCCAGAAGCGGAC	NA	NA	NA	NA
WP_001493615.1|819434_820370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072714055.1|821180_822356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000804439.1|824321_824924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001347898.1|825017_825224_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001367564.1|825607_826399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072146520.1|827468_827618_+	hemolysin activation protein	NA	NA	NA	NA	NA
WP_000860849.1|827849_828449_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000270955.1|828820_829204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024241614.1|829200_829587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096858936.1|829595_830794_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	1.2e-98
WP_136769128.1|830814_831108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042054507.1|831858_834168_+	ATPase	NA	NA	NA	NA	NA
WP_000117528.1|834171_835488_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_072714023.1|835484_837683_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_032318120.1|838164_839181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000169496.1|839248_839548_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_000255944.1|839990_841013_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001323403.1|841012_841792_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
WP_032286680.1|843022_844033_-	sulfite reductase subunit C	NA	NA	NA	NA	NA
WP_032286679.1|844043_844862_-	anaerobic sulfite reductase subunit AsrB	NA	NA	NA	NA	NA
WP_072714029.1|844865_845909_-	anaerobic sulfite reductase subunit A	NA	NA	NA	NA	NA
WP_072714031.1|846503_846737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161619023.1|847902_849189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161619024.1|849385_849586_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_072714039.1|852001_852955_+|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
>prophage 2
NZ_CP041435	Escherichia coli strain STEC309 chromosome, complete genome	4917238	1115719	1122859	4917238		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|1115719_1116358_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|1116354_1117617_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|1117613_1118522_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001272549.1|1118687_1119485_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	5.9e-70
WP_001141330.1|1119535_1120192_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
WP_064577946.1|1120297_1122859_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
>prophage 3
NZ_CP041435	Escherichia coli strain STEC309 chromosome, complete genome	4917238	1714811	1724253	4917238		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569325.1|1714811_1715738_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
WP_000783120.1|1715742_1716474_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1716454_1716562_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1716621_1717353_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1717574_1719260_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1719256_1719976_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1720022_1720493_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1720533_1720995_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001543461.1|1721119_1723120_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_001292774.1|1723116_1724253_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
>prophage 4
NZ_CP041435	Escherichia coli strain STEC309 chromosome, complete genome	4917238	1736818	1802345	4917238	holin,terminase,capsid,head,lysis,plate,integrase,portal,tail,tRNA	Escherichia_phage(50.0%)	71	1764069:1764096	1797261:1797288
WP_001295427.1|1736818_1738852_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
WP_001005448.1|1738983_1740093_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001324851.1|1740355_1740637_+	YehE family protein	NA	NA	NA	NA	NA
WP_000830468.1|1740929_1741472_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677395.1|1741552_1742227_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000945406.1|1742242_1744723_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001026154.1|1744736_1745771_+	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000153067.1|1745852_1746191_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000134576.1|1746409_1747234_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019938.1|1747354_1747627_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_001195590.1|1747849_1748638_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822274.1|1748634_1749435_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001315719.1|1749499_1750318_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	2.3e-24
WP_000434038.1|1750369_1751116_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011973.1|1751089_1752055_-	sugar kinase	NA	NA	NA	NA	NA
WP_000846219.1|1752051_1753056_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	1.3e-13
WP_161619033.1|1753052_1754330_-	MFS transporter	NA	NA	NA	NA	NA
WP_000129551.1|1754586_1755639_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000289788.1|1755948_1756803_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000853892.1|1756831_1758094_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000182899.1|1758103_1758556_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823272.1|1758586_1758871_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000490714.1|1758874_1760230_+	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000844219.1|1760278_1761319_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178556.1|1761418_1762198_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807362.1|1762279_1763179_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_000716757.1|1763593_1763911_+	hypothetical protein	NA	NA	NA	NA	NA
1764069:1764096	attL	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_000985261.1|1764175_1765189_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.1	4.1e-193
WP_000020919.1|1765304_1765604_-	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_001081582.1|1765725_1766001_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
WP_000217670.1|1766178_1766679_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_074522358.1|1766742_1766967_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	97.3	1.5e-31
WP_001277904.1|1766966_1767269_+	hypothetical protein	NA	A0A0F7LCL4	Escherichia_phage	99.0	5.9e-47
WP_001113269.1|1767268_1767493_+	TraR/DksA family transcriptional regulator	NA	A0A0F7LDG9	Escherichia_phage	98.6	5.0e-35
WP_000027670.1|1767489_1767765_+	hypothetical protein	NA	M1TAP2	Escherichia_phage	98.9	6.6e-45
WP_161619034.1|1767754_1770007_+	replication endonuclease	NA	M1SV59	Escherichia_phage	92.1	0.0e+00
WP_000038188.1|1771937_1772972_-|portal	phage portal protein	portal	Q858W8	Yersinia_virus	99.4	4.2e-201
WP_000156861.1|1772971_1774744_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_104725533.1|1774917_1775772_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MD6	Enterobacteria_phage	99.3	1.1e-135
WP_001248558.1|1775830_1776904_+|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	100.0	6.7e-202
WP_000203462.1|1776907_1777651_+|terminase	terminase endonuclease subunit	terminase	Q94MK1	Enterobacteria_phage	100.0	2.1e-122
WP_000988636.1|1777750_1778260_+|head	head completion/stabilization protein	head	A0A0F7LDJ1	Escherichia_phage	100.0	8.6e-91
WP_000846399.1|1778259_1778463_+|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000123124.1|1778466_1778748_+|holin	holin	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_001144101.1|1778747_1779245_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_028985813.1|1779259_1779685_+	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	92.9	7.5e-56
WP_001355820.1|1779672_1780116_+|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	96.5	6.4e-66
WP_000917139.1|1780205_1780673_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	97.4	1.6e-80
WP_028985812.1|1780665_1781118_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	99.3	1.4e-76
WP_028985811.1|1781184_1781820_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	97.2	1.6e-110
WP_000127163.1|1781816_1782164_+|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001121474.1|1782168_1783077_+|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	100.0	1.2e-162
WP_028985810.1|1783069_1783600_+|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	99.4	3.9e-102
WP_104725536.1|1783610_1785821_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	93.3	0.0e+00
WP_074522352.1|1785824_1786349_+|tail	tail fiber assembly protein	tail	U5N0T1	Enterobacteria_phage	94.3	1.7e-89
WP_000166330.1|1786628_1787984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001026768.1|1788458_1789973_-	hypothetical protein	NA	Q38324	Lactococcus_phage	26.7	9.0e-27
WP_104725538.1|1790557_1791748_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.2	5.3e-224
WP_001554312.1|1791760_1792279_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	99.4	3.2e-93
WP_001031303.1|1792335_1792611_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|1792643_1792763_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_104725539.1|1792755_1795203_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	98.9	0.0e+00
WP_047645233.1|1795217_1795697_+|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	98.7	2.5e-84
WP_161619035.1|1795696_1796860_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	98.7	1.7e-203
WP_000468308.1|1796941_1797160_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000476011.1|1797432_1798794_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	100.0	1.1e-217
1797261:1797288	attR	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_001220181.1|1798896_1799193_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001307279.1|1799194_1799491_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_000929408.1|1799699_1800032_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137873.1|1800222_1800945_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	1.9e-30
WP_000675150.1|1800941_1802345_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
>prophage 5
NZ_CP041435	Escherichia coli strain STEC309 chromosome, complete genome	4917238	1848842	1855905	4917238		Enterobacteria_phage(42.86%)	7	NA	NA
WP_001116113.1|1848842_1850237_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.8	3.7e-19
WP_000183060.1|1850411_1851305_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_000699435.1|1851677_1852763_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.5	4.2e-103
WP_001023631.1|1852762_1853662_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.5	8.2e-28
WP_000857526.1|1853719_1854598_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	1.1e-106
WP_001100785.1|1854602_1855142_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.1	9.8e-53
WP_053265431.1|1855158_1855905_+	DUF616 domain-containing protein	NA	A0A2P0VMU2	Tetraselmis_virus	32.0	7.8e-24
>prophage 6
NZ_CP041435	Escherichia coli strain STEC309 chromosome, complete genome	4917238	2005485	2060394	4917238	holin,terminase,capsid,protease,head,plate,integrase,portal,tail,tRNA	Enterobacteria_phage(68.52%)	69	2000648:2000666	2047142:2047160
2000648:2000666	attL	CATGATGGCGCAGGATTTT	NA	NA	NA	NA
WP_001025326.1|2005485_2007219_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
WP_001326063.1|2007434_2008001_+	VOC family protein	NA	NA	NA	NA	NA
WP_001185742.1|2008014_2008761_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001214298.1|2009148_2010249_+	cytochrome c	NA	NA	NA	NA	NA
WP_097419182.1|2010273_2012703_+	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_000564745.1|2012867_2013839_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000019588.1|2013835_2014579_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000252979.1|2014619_2015015_-	membrane protein	NA	NA	NA	NA	NA
WP_097449987.1|2015067_2015838_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.1e-72
WP_161619042.1|2015819_2017133_-|integrase	site-specific integrase	integrase	Q8W658	Enterobacteria_phage	99.5	2.2e-255
WP_000528717.1|2017188_2017425_-	excisionase family protein	NA	Q8W657	Enterobacteria_phage	100.0	9.9e-42
WP_001030139.1|2017433_2017580_-	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	95.8	3.1e-22
WP_021558719.1|2017583_2017826_-	DUF4222 domain-containing protein	NA	Q8W656	Enterobacteria_phage	100.0	6.8e-38
WP_064578864.1|2017856_2018228_-	hypothetical protein	NA	Q8W655	Enterobacteria_phage	96.7	4.2e-63
WP_161619043.1|2018268_2019096_-	SPFH/Band 7/PHB domain protein	NA	Q8W654	Enterobacteria_phage	98.5	1.2e-129
WP_161619044.1|2019457_2020039_-	hypothetical protein	NA	Q8W653	Enterobacteria_phage	86.5	1.1e-97
WP_000391589.1|2020035_2020224_-	hypothetical protein	NA	Q8W652	Enterobacteria_phage	100.0	4.5e-29
WP_161619118.1|2020420_2020627_-	hypothetical protein	NA	Q8W651	Enterobacteria_phage	94.1	2.4e-28
WP_161619045.1|2020782_2021244_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPB8	Escherichia_phage	71.9	7.4e-41
WP_161619046.1|2021389_2022079_-	LexA family transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	87.8	4.0e-115
WP_064732963.1|2022212_2022512_+	Cro/Cl family transcriptional regulator	NA	A0A1B5FPK9	Escherichia_phage	90.9	2.3e-35
WP_077883870.1|2022588_2023443_+	ORF6N domain-containing protein	NA	Q8W644	Enterobacteria_phage	55.6	9.2e-45
WP_001193680.1|2023442_2023652_+	restriction alleviation protein, Lar family	NA	NA	NA	NA	NA
WP_161619047.1|2023669_2024332_+	hypothetical protein	NA	Q8W643	Enterobacteria_phage	89.0	3.6e-105
WP_064578859.1|2024324_2024558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001422782.1|2024554_2024779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064578858.1|2024775_2025600_+	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	75.6	3.0e-85
WP_000988195.1|2025610_2026489_+	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	96.8	5.4e-141
WP_161619048.1|2026485_2027877_+	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	99.1	5.5e-265
WP_001520742.1|2027873_2028131_+	hypothetical protein	NA	Q8W639	Enterobacteria_phage	100.0	4.4e-35
WP_015967628.1|2028130_2028511_+	antitermination protein Q	NA	Q8W638	Enterobacteria_phage	100.0	3.4e-68
WP_000917767.1|2030048_2030246_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_146314191.1|2030382_2031096_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_161619049.1|2032004_2032430_+	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	84.4	7.2e-59
WP_000833644.1|2032426_2032579_+	DUF3927 domain-containing protein	NA	A0A0A0YRI9	Escherichia_phage	55.6	2.5e-06
WP_001294586.1|2032670_2033063_+|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	88.5	5.7e-50
WP_161619050.1|2033052_2033328_+|holin	phage holin family protein	holin	Q9MBZ4	Enterobacteria_phage	93.4	8.9e-42
WP_161619051.1|2033330_2033708_+	M15 family metallopeptidase	NA	Q9MBZ3	Enterobacteria_phage	95.2	1.6e-62
WP_097450134.1|2033778_2034060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089570301.1|2034948_2035245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161619052.1|2035265_2035616_+	HNH endonuclease	NA	Q8W633	Enterobacteria_phage	98.3	1.8e-63
WP_161619053.1|2035763_2036246_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	98.1	6.7e-85
WP_161619054.1|2036245_2038003_+|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.5	0.0e+00
WP_032083405.1|2038014_2038197_+	hypothetical protein	NA	Q8W630	Enterobacteria_phage	93.3	2.5e-24
WP_096098848.1|2038196_2039438_+|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	99.3	6.5e-241
WP_001193625.1|2039415_2040066_+|head,protease	HK97 family phage prohead protease	head,protease	Q8W628	Enterobacteria_phage	100.0	6.0e-121
WP_161619119.1|2040077_2041304_+|capsid	phage major capsid protein	capsid	Q8W627	Enterobacteria_phage	92.4	1.4e-208
WP_000924705.1|2041351_2041675_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8W626	Enterobacteria_phage	99.1	9.7e-56
WP_000702447.1|2041671_2042088_+|head	phage head closure protein	head	Q8HAC9	Salmonella_phage	68.4	7.6e-45
WP_001076770.1|2042053_2042578_+	hypothetical protein	NA	Q8W625	Enterobacteria_phage	99.4	1.6e-95
WP_161619055.1|2042574_2043138_+	hypothetical protein	NA	Q8W624	Enterobacteria_phage	98.4	1.0e-105
WP_161619056.1|2043147_2043321_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	71.4	1.5e-15
WP_021558831.1|2043304_2044801_+|tail	phage tail sheath protein	tail	Q8W623	Enterobacteria_phage	98.8	3.0e-277
WP_001062340.1|2044800_2045157_+	hypothetical protein	NA	Q8W622	Enterobacteria_phage	99.2	5.3e-63
WP_000117144.1|2045156_2045486_+|tail	phage tail assembly protein	tail	Q8W621	Enterobacteria_phage	100.0	7.8e-53
WP_161619057.1|2045570_2047520_+|tail	phage tail tape measure protein	tail	Q8W620	Enterobacteria_phage	97.7	0.0e+00
2047142:2047160	attR	CATGATGGCGCAGGATTTT	NA	NA	NA	NA
WP_032083313.1|2047587_2048070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161619058.1|2048116_2049508_+	DNA circularization protein	NA	Q8W619	Enterobacteria_phage	96.5	3.2e-249
WP_063123875.1|2049504_2050560_+|plate	baseplate protein	plate	Q8W618	Enterobacteria_phage	99.1	1.0e-199
WP_001013088.1|2050559_2051093_+|plate	phage baseplate assembly protein	plate	Q8W617	Enterobacteria_phage	99.4	2.4e-96
WP_057697897.1|2051098_2051512_+	hypothetical protein	NA	Q8W616	Enterobacteria_phage	97.8	8.6e-73
WP_000785587.1|2051504_2052587_+|plate	baseplate J/gp47 family protein	plate	Q8W615	Enterobacteria_phage	100.0	2.6e-209
WP_000380342.1|2052586_2053177_+	DUF2313 domain-containing protein	NA	Q8W614	Enterobacteria_phage	99.5	4.4e-115
WP_161619059.1|2053163_2054201_+|tail	phage tail protein	tail	Q8W613	Enterobacteria_phage	83.4	1.4e-156
WP_097452375.1|2054215_2054746_+|tail	phage tail protein	tail	A0A0U2QV64	Escherichia_phage	99.4	2.4e-96
WP_161619060.1|2054769_2056770_+|tail	phage tail protein	tail	A0A0U2SH60	Escherichia_phage	56.8	2.4e-221
WP_161619120.1|2056769_2057333_+	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	96.3	5.0e-100
WP_000891610.1|2057745_2058312_-	hydrolase	NA	NA	NA	NA	NA
WP_001258662.1|2058621_2060394_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 7
NZ_CP041435	Escherichia coli strain STEC309 chromosome, complete genome	4917238	2495550	2607552	4917238	holin,terminase,capsid,head,plate,transposase,integrase,portal,tail,tRNA	Escherichia_phage(56.14%)	111	2521986:2522002	2606685:2606701
WP_001373192.1|2495550_2496759_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.8	2.9e-209
WP_001261013.1|2497289_2497958_-	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
WP_000586733.1|2498260_2498854_-	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
WP_001296725.1|2498850_2499843_-	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
WP_001234054.1|2499966_2500947_+	LbetaH domain-containing protein	NA	NA	NA	NA	NA
WP_000140877.1|2500941_2501478_-	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
WP_001296778.1|2501540_2501765_-	YdcH family protein	NA	NA	NA	NA	NA
WP_000375956.1|2501904_2503560_-	glucan biosynthesis protein	NA	NA	NA	NA	NA
WP_000013786.1|2503784_2505128_-	VOC family protein	NA	NA	NA	NA	NA
WP_000414564.1|2505344_2506268_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001098551.1|2506305_2507946_-	methyl-accepting chemotaxis protein Trg	NA	NA	NA	NA	NA
WP_001320773.1|2508344_2508494_+	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_000731833.1|2508565_2508739_-	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_001307188.1|2508983_2509514_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000048667.1|2509702_2510704_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_000115957.1|2510745_2512185_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001027931.1|2512381_2513182_-	YdcF family protein	NA	NA	NA	NA	NA
WP_000139614.1|2513453_2517356_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
WP_000048948.1|2517556_2518162_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_000627376.1|2518212_2519529_-	phosphatase PAP2/dual specificity phosphatase family protein	NA	NA	NA	NA	NA
WP_000890935.1|2521290_2522187_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
2521986:2522002	attL	TTATCAGCGCAAAAAAC	NA	NA	NA	NA
WP_000177536.1|2522186_2522792_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_000097801.1|2525331_2526192_-	pyridoxine 4-dehydrogenase	NA	NA	NA	NA	NA
WP_001123454.1|2526422_2527013_-	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
WP_000039886.1|2526994_2527945_-	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_000632286.1|2528045_2529359_-	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_001206190.1|2529385_2530591_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_000018413.1|2530590_2531013_-	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_000973371.1|2531002_2532430_-	3-hydroxyacyl-CoA dehydrogenase PaaC	NA	NA	NA	NA	NA
WP_000969780.1|2532431_2533220_-	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_001292341.1|2533219_2533987_-	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_000206364.1|2533983_2535054_-	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
WP_001189197.1|2535061_2535559_-	phenylacetate degradation protein PaaD	NA	NA	NA	NA	NA
WP_001072837.1|2535573_2536320_-	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_000073393.1|2536328_2536616_-	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_000191073.1|2536627_2537557_-	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_001186504.1|2537841_2539887_+	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_000535440.1|2540134_2542408_+	primary-amine oxidase	NA	NA	NA	NA	NA
WP_000138608.1|2542465_2543965_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_001067519.1|2544200_2545106_+	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_001325798.1|2545277_2545607_-	YdbL family protein	NA	NA	NA	NA	NA
WP_000698141.1|2545611_2545797_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_000900909.1|2545793_2548433_-	YdbH family protein	NA	NA	NA	NA	NA
WP_000762229.1|2548640_2549630_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
WP_001299385.1|2549740_2550163_+	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_001295715.1|2550159_2550426_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_000628159.1|2550699_2554224_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_000837924.1|2554589_2555723_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
WP_001082294.1|2555863_2556298_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.0e-28
WP_032221042.1|2556837_2557401_-	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	95.2	5.6e-99
WP_161619066.1|2557400_2559773_-|tail	phage tail protein	tail	A0A0U2SH60	Escherichia_phage	63.7	3.0e-279
WP_161619067.1|2559797_2560886_-	late control protein	NA	R9TNM7	Vibrio_phage	29.2	2.5e-31
WP_001107807.1|2560876_2561095_-|tail	phage tail protein	tail	R9TR63	Vibrio_phage	52.1	4.9e-11
WP_000228000.1|2561069_2561558_-|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	34.1	4.0e-13
WP_161619068.1|2561560_2563213_-	hypothetical protein	NA	R9TRP8	Vibrio_phage	33.6	3.2e-46
WP_096836030.1|2563330_2563633_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_033813286.1|2563694_2564213_-|tail	tail protein	tail	NA	NA	NA	NA
WP_112015624.1|2564209_2565685_-|tail	phage tail protein	tail	R9TMQ0	Vibrio_phage	38.3	1.9e-74
WP_096836034.1|2565740_2566283_-|tail	phage tail protein	tail	Q8W612	Enterobacteria_phage	73.2	1.9e-72
WP_161619069.1|2566285_2567542_-|tail	phage tail protein	tail	Q8W613	Enterobacteria_phage	80.8	3.9e-108
WP_112015622.1|2567538_2568129_-|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	38.5	3.6e-24
WP_097450119.1|2568121_2569036_-|plate	baseplate assembly protein	plate	D5LGZ3	Escherichia_phage	44.6	1.6e-63
WP_040091455.1|2569010_2569367_-|plate	baseplate assembly protein	plate	V5YTB2	Pseudomonas_phage	46.8	2.8e-19
WP_096934541.1|2569400_2570024_-|plate	phage baseplate assembly protein V	plate	F1BUP5	Erwinia_phage	30.2	1.1e-10
WP_096934551.1|2570007_2570559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097446582.1|2570570_2571293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112015621.1|2571273_2571675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096934544.1|2571677_2572043_-	DNA breaking-rejoining protein	NA	NA	NA	NA	NA
WP_096934545.1|2572093_2573122_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	58.9	1.3e-109
WP_000598339.1|2573191_2573527_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	55.1	1.9e-22
WP_096934546.1|2573565_2575182_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	54.5	2.8e-103
WP_089553007.1|2575171_2576695_-|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	63.4	4.4e-183
WP_000263126.1|2576739_2576949_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	49.2	1.4e-10
WP_097446584.1|2578839_2579388_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	97.1	2.9e-68
WP_097450134.1|2580982_2581264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089606971.1|2581334_2581712_-	M15 family metallopeptidase	NA	Q9MBZ3	Enterobacteria_phage	93.5	1.1e-61
WP_096934530.1|2581714_2581990_-|holin	phage holin family protein	holin	Q9MBZ4	Enterobacteria_phage	97.8	2.5e-44
WP_001294583.1|2581979_2582372_-|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	89.2	5.7e-50
WP_000823297.1|2582429_2582855_-	subtilase	NA	NA	NA	NA	NA
WP_112015687.1|2582922_2583648_-	pertussis toxin-like subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	66.4	3.3e-80
WP_000640111.1|2584035_2584578_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	74.6	1.6e-74
WP_000228027.1|2584574_2584865_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	88.5	5.7e-47
WP_062873745.1|2584864_2585464_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	94.5	8.2e-109
WP_087907235.1|2586024_2586198_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	77.8	2.4e-13
WP_087907236.1|2586339_2587224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136769118.1|2587211_2587673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001289353.1|2587846_2588482_-	ead/Ea22-like family protein	NA	A0A2R2Z315	Escherichia_phage	100.0	1.3e-115
WP_001224672.1|2588647_2588830_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	96.7	2.0e-26
WP_033812990.1|2588958_2589270_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	82.5	9.0e-51
WP_033812989.1|2589262_2589517_-	hypothetical protein	NA	A0A0U2RK51	Escherichia_phage	89.3	7.7e-40
WP_087907238.1|2589513_2589936_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	95.0	2.1e-66
WP_087907239.1|2589952_2590723_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	77.0	5.8e-99
WP_159105019.1|2590757_2591300_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.0	2.6e-85
WP_161619070.1|2591211_2592282_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	97.5	1.4e-199
WP_062873816.1|2592294_2592717_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	99.3	6.7e-73
WP_161619071.1|2592727_2592976_-	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	64.6	4.9e-23
WP_001253182.1|2593081_2593546_+	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	69.5	1.2e-54
WP_096925985.1|2593927_2594083_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	4.7e-08
WP_161619072.1|2594084_2594717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000560220.1|2595032_2595254_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	100.0	6.2e-38
WP_023568504.1|2595247_2595424_+	bacteriophage protein	NA	A0A0U2SHB5	Escherichia_phage	100.0	3.9e-27
WP_161619073.1|2595874_2599021_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	99.8	0.0e+00
WP_021529594.1|2599035_2600124_+	hypothetical protein	NA	A0A0U2S5Y9	Escherichia_phage	100.0	7.7e-206
WP_021500490.1|2600187_2600382_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	100.0	9.0e-33
WP_001383994.1|2600374_2600563_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	100.0	1.9e-27
WP_000079604.1|2600662_2600878_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_072017917.1|2600879_2602115_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	100.0	1.5e-242
WP_001157377.1|2602166_2603102_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	100.0	2.8e-148
WP_000123745.1|2603230_2604604_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|2605081_2606065_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001307164.1|2606319_2607552_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
2606685:2606701	attR	TTATCAGCGCAAAAAAC	NA	NA	NA	NA
>prophage 8
NZ_CP041435	Escherichia coli strain STEC309 chromosome, complete genome	4917238	3041677	3129479	4917238	terminase,capsid,protease,head,lysis,plate,integrase,portal,tail,tRNA	Salmonella_phage(56.9%)	91	3077530:3077544	3130816:3130830
WP_000886683.1|3041677_3042970_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067755.1|3043060_3044404_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|3044414_3045026_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077063.1|3045180_3049287_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|3049421_3049916_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|3050460_3051426_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_001043587.1|3051548_3053315_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_001202188.1|3053315_3055037_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	1.9e-20
WP_001241678.1|3055078_3055783_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3056067_3056286_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|3056970_3059247_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|3059277_3059598_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|3059920_3060145_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188176.1|3060217_3062164_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000746460.1|3062160_3063276_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_001355621.1|3063426_3064383_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000599806.1|3064379_3066038_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001297311.1|3066463_3067159_+	aquaporin Z	NA	NA	NA	NA	NA
WP_000491142.1|3067653_3068553_+	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_000458817.1|3068696_3070349_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000178677.1|3070360_3071329_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_161619079.1|3071461_3073180_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	4.0e-31
WP_000566372.1|3073216_3074218_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_001136554.1|3074228_3075659_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001338420.1|3075757_3076771_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_097419204.1|3076767_3077598_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	4.3e-07
3077530:3077544	attL	AATGCCTTTTTCGCC	NA	NA	NA	NA
WP_001160737.1|3077594_3077918_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001270740.1|3078043_3078559_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027205.1|3078776_3079505_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_000756569.1|3079522_3080254_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001001691.1|3080260_3080977_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000464491.1|3080976_3081645_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001295905.1|3081936_3082668_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001149733.1|3082842_3083970_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	3.5e-28
WP_000389260.1|3084010_3084499_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061657.1|3084558_3085404_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000105430.1|3085400_3086354_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000996025.1|3086363_3087497_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.4	5.0e-30
WP_097419205.1|3087591_3088704_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|3089055_3089532_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684311.1|3089619_3090522_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000189159.1|3090582_3091305_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201554.1|3091288_3091576_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195240.1|3091735_3091993_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
WP_000681108.1|3092022_3092400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024867.1|3092669_3094355_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000972391.1|3094590_3094809_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_001011790.1|3094899_3096000_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.0	3.8e-176
WP_000980383.1|3095996_3096482_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	4.8e-67
WP_161619080.1|3096478_3099556_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.1	0.0e+00
WP_000763311.1|3099548_3099668_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001281008.1|3099682_3099985_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	88.0	1.6e-39
WP_001207660.1|3100039_3100555_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_000046134.1|3100564_3101737_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.0	7.8e-204
WP_000905033.1|3101879_3102446_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.8	3.8e-87
WP_071779871.1|3102476_3102857_+	hypothetical protein	NA	I3PGW0	Xanthomonas_phage	31.8	3.0e-08
WP_000282064.1|3103009_3103615_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	84.4	1.4e-92
WP_115285318.1|3103614_3105201_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	73.1	1.6e-207
WP_001086845.1|3105197_3105803_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	2.0e-110
WP_000268306.1|3105795_3106704_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.4	3.5e-143
WP_059331288.1|3106690_3107050_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.9	1.0e-50
WP_001440572.1|3107046_3107625_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	85.4	3.0e-92
WP_000870373.1|3107699_3108914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001183830.1|3108888_3109272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000829112.1|3109289_3109739_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	76.4	1.1e-52
WP_001039948.1|3109731_3110163_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.7	2.6e-72
WP_000196201.1|3110258_3110687_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	88.7	2.8e-58
WP_001069904.1|3110683_3111199_-	lysozyme	NA	E5G6N1	Salmonella_phage	93.0	7.4e-90
WP_000171568.1|3111179_3111395_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_000868175.1|3111398_3111602_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000673522.1|3111601_3112066_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	2.4e-76
WP_000059183.1|3112161_3112812_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	6.6e-112
WP_040082407.1|3112815_3113874_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	2.2e-181
WP_000216242.1|3113890_3114724_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	6.3e-123
WP_001098431.1|3114866_3116633_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.7	0.0e+00
WP_161619081.1|3116632_3117664_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	87.3	5.0e-170
WP_000553634.1|3117689_3118652_-	DNA-processing protein DprA	NA	S6BFL3	Thermus_phage	30.2	5.2e-20
WP_016245841.1|3118656_3119226_-	phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001217568.1|3120299_3120533_-	DinI family protein	NA	E5G6M1	Salmonella_phage	98.7	2.3e-35
WP_001154434.1|3120543_3120732_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_000017528.1|3120884_3123299_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	98.0	0.0e+00
WP_000104182.1|3123295_3124153_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	96.8	1.7e-160
WP_000752619.1|3124149_3124377_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	3.5e-36
WP_001244224.1|3124376_3124610_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	1.9e-32
WP_000963473.1|3124677_3125019_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_000956181.1|3124982_3125183_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
WP_000460893.1|3125190_3125700_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000188448.1|3125732_3125954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000107902.1|3126049_3126646_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	42.4	1.1e-39
WP_001084068.1|3126666_3128343_+	DUF4041 domain-containing protein	NA	A0A142LP25	Marinitoga_camini_virus	67.0	5.7e-83
WP_000290937.1|3128426_3129479_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
3130816:3130830	attR	GGCGAAAAAGGCATT	NA	NA	NA	NA
>prophage 9
NZ_CP041435	Escherichia coli strain STEC309 chromosome, complete genome	4917238	3160109	3255205	4917238	terminase,capsid,head,transposase,integrase,portal,tail,lysis	Enterobacteria_phage(43.75%)	106	3186388:3186423	3256639:3256674
WP_000399648.1|3160109_3161090_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000961458.1|3161368_3162961_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
WP_001056384.1|3163179_3164100_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000056415.1|3164158_3165277_-	anion transporter	NA	NA	NA	NA	NA
WP_000091016.1|3165273_3165741_-	manganese-binding transcriptional regulator MntR	NA	NA	NA	NA	NA
WP_001001761.1|3165926_3166055_+	manganase accumulation protein MntS	NA	NA	NA	NA	NA
WP_001054662.1|3166326_3167910_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_001295296.1|3167958_3168474_-	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
WP_120795379.1|3168526_3168592_-	protein YliM	NA	NA	NA	NA	NA
WP_001315365.1|3168826_3169714_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_000100800.1|3170012_3170516_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_000843866.1|3170919_3171666_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_001159065.1|3171804_3172464_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000569080.1|3172460_3173183_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
WP_001267250.1|3173299_3175522_+	mechanosensitive channel protein	NA	NA	NA	NA	NA
WP_001275941.1|3175518_3176445_-	23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF	NA	NA	NA	NA	NA
WP_000710619.1|3176720_3176981_+	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
WP_000430045.1|3177244_3179527_+	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_000990177.1|3179568_3180246_+	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	1.2e-18
WP_000146369.1|3180319_3180586_+	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	6.9e-07
WP_000849301.1|3180850_3181111_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000443512.1|3181338_3182424_-	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000386551.1|3182564_3183527_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_001307069.1|3183554_3185705_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.3	5.7e-43
WP_001145128.1|3185824_3186307_+	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.7	1.5e-36
3186388:3186423	attL	TGCCGGATGCGGCGTAAACGCCTTATCCGGCCTACA	NA	NA	NA	NA
WP_000007102.1|3186538_3187903_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001315358.1|3188131_3188803_+	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000976400.1|3188802_3189801_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_000996092.1|3189793_3191530_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
WP_000070131.1|3191522_3192656_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000469031.1|3192666_3193773_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000871982.1|3193734_3194145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001113351.1|3194277_3195039_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000650337.1|3195035_3196277_+	cardiolipin synthase ClsB	NA	NA	NA	NA	NA
WP_000045448.1|3196276_3197233_+	UPF0104 family protein	NA	NA	NA	NA	NA
WP_001088641.1|3197268_3197982_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_001331162.1|3198051_3198699_-	membrane protein	NA	NA	NA	NA	NA
WP_000373624.1|3198900_3199605_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000852287.1|3199741_3200194_-	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
WP_000598619.1|3200195_3200441_-	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
WP_000080885.1|3200433_3200919_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_000084639.1|3200921_3201434_-	molybdenum cofactor biosynthesis protein B	NA	NA	NA	NA	NA
WP_001315357.1|3201455_3202445_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_001295302.1|3202841_3203750_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
WP_000042533.1|3203941_3205963_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_000044882.1|3206541_3207219_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000246805.1|3207211_3207967_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_000118822.1|3207953_3209108_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_000951213.1|3209104_3210145_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_001367048.1|3210231_3211521_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.0e-18
WP_000767389.1|3211579_3212056_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_001468417.1|3212801_3214133_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	2.5e-20
WP_001171282.1|3214637_3215600_+	hypothetical protein	NA	A0A0A7NV63	Enterobacteria_phage	91.1	4.0e-174
WP_001541481.1|3215603_3216131_+|tail	tail fiber assembly protein	tail	A0A077SK10	Escherichia_phage	97.7	1.2e-92
WP_000972143.1|3216159_3216693_-|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	99.4	6.4e-97
WP_077763067.1|3216695_3219533_-|tail	phage tail protein	tail	Q1MVL8	Enterobacteria_phage	60.5	8.5e-204
WP_001233093.1|3219597_3220197_-	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	98.0	2.2e-109
WP_161619082.1|3220267_3223765_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	97.7	0.0e+00
WP_000090873.1|3223825_3224458_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	6.5e-96
WP_004009102.1|3224394_3225138_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	4.5e-149
WP_001152639.1|3225143_3225842_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_000847379.1|3225841_3226171_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_134240115.1|3226167_3228729_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	92.6	0.0e+00
WP_000459457.1|3228721_3229156_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_161619083.1|3229137_3229560_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.7	2.4e-70
WP_161619084.1|3229575_3230316_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.6	1.4e-129
WP_000683111.1|3230323_3230719_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	5.0e-70
WP_048943351.1|3230715_3231294_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	5.9e-80
WP_000752996.1|3231305_3231659_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	1.5e-62
WP_048943350.1|3231670_3232066_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.2	2.4e-56
WP_161619085.1|3232107_3233133_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.4	1.5e-187
WP_001358225.1|3233188_3233521_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	2.5e-54
WP_001710055.1|3233530_3234850_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	4.0e-233
WP_001329116.1|3234830_3236432_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.4	2.2e-310
WP_000198149.1|3236428_3236635_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_161619086.1|3236631_3238392_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000255944.1|3238450_3239473_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001323403.1|3239472_3240252_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
WP_161619087.1|3240261_3240516_-|terminase	terminase	terminase	A0A0K2FJ14	Enterobacteria_phage	100.0	1.0e-31
WP_000453611.1|3240490_3241036_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
WP_001663509.1|3241424_3241658_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	2.5e-21
WP_032217515.1|3241714_3242125_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	75.6	8.3e-52
WP_001139678.1|3242476_3242629_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
WP_001228702.1|3242657_3242864_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	98.5	5.3e-31
WP_001135261.1|3243080_3243578_-	lysozyme	NA	A0A1B5FP97	Escherichia_phage	97.6	4.2e-90
WP_000839582.1|3243577_3243793_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	1.2e-33
WP_001146308.1|3243980_3244712_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000592546.1|3245063_3246023_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_000780581.1|3246215_3246740_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	1.1e-48
WP_001204777.1|3246895_3247273_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.2	7.3e-55
WP_000971055.1|3247358_3247499_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001540841.1|3247495_3247858_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	9.5e-60
WP_000950954.1|3247877_3248072_-	protein ninF	NA	NA	NA	NA	NA
WP_000386643.1|3248064_3248406_-	DUF2591 domain-containing protein	NA	Q76H72	Enterobacteria_phage	96.5	1.6e-61
WP_001254223.1|3248408_3248585_-	NinE family protein	NA	K7PHE6	Enterobacteria_phage	98.3	1.4e-27
WP_161619088.1|3248581_3249109_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	99.4	4.7e-100
WP_000736903.1|3249105_3249546_-	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.0e-81
WP_000145931.1|3249619_3249910_-	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
WP_000788869.1|3249906_3250608_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_161619089.1|3250604_3251504_-	replication protein	NA	M1FN81	Enterobacteria_phage	99.3	1.4e-173
WP_001177650.1|3251538_3251817_-	transcriptional regulator	NA	K7P7A2	Enterobacteria_phage	100.0	1.6e-43
WP_094283415.1|3252013_3253160_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	98.9	4.9e-158
WP_000762731.1|3253219_3253648_+	DUF2513 domain-containing protein	NA	NA	NA	NA	NA
WP_000545741.1|3253731_3253899_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	4.9e-27
WP_001303849.1|3253938_3254157_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_001540845.1|3254134_3255205_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	99.4	9.6e-201
3256639:3256674	attR	TGCCGGATGCGGCGTAAACGCCTTATCCGGCCTACA	NA	NA	NA	NA
>prophage 10
NZ_CP041435	Escherichia coli strain STEC309 chromosome, complete genome	4917238	3480064	3526616	4917238	terminase,capsid,protease,head,integrase,portal,tail,lysis	Enterobacteria_phage(58.49%)	61	3479595:3479641	3526630:3526676
3479595:3479641	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001201810.1|3480064_3481018_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_000386784.1|3481267_3482017_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000239881.1|3482879_3483548_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_134254079.1|3483602_3484187_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	1.0e-103
WP_161619090.1|3484186_3487258_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	82.1	1.9e-68
WP_001230279.1|3487322_3487922_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	98.0	1.3e-109
WP_161619091.1|3487992_3491406_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.4	0.0e+00
WP_000090873.1|3491466_3492099_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	6.5e-96
WP_004009102.1|3492035_3492779_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	4.5e-149
WP_001152639.1|3492784_3493483_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_000847379.1|3493482_3493812_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_134240115.1|3493808_3496370_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	92.6	0.0e+00
WP_000459457.1|3496362_3496797_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_161619083.1|3496778_3497201_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.7	2.4e-70
WP_048943399.1|3497216_3497957_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	6.1e-130
WP_000683111.1|3497964_3498360_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	5.0e-70
WP_048943351.1|3498356_3498935_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	5.9e-80
WP_000752996.1|3498946_3499300_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	1.5e-62
WP_048943350.1|3499311_3499707_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.2	2.4e-56
WP_048943349.1|3499748_3500774_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.4	9.0e-188
WP_001338090.1|3500829_3501162_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	6.5e-55
WP_048943348.1|3501171_3502491_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.9	3.8e-231
WP_032358757.1|3502471_3504073_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	1.1e-309
WP_000198149.1|3504069_3504276_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_161619092.1|3504272_3506198_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_000453611.1|3506172_3506718_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
WP_001663509.1|3507106_3507340_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	2.5e-21
WP_000079508.1|3507396_3507807_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_001139678.1|3508158_3508311_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
WP_001228702.1|3508339_3508546_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	98.5	5.3e-31
WP_032267560.1|3508762_3509260_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.0	1.2e-89
WP_000839596.1|3509259_3509475_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737266.1|3510048_3511146_+	porin	NA	Q1MVN1	Enterobacteria_phage	76.5	2.2e-155
WP_001204780.1|3511335_3511719_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
WP_044687701.1|3511837_3512200_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000774486.1|3512196_3512487_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
WP_000224914.1|3512479_3512650_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001356995.1|3512649_3513105_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	3.7e-61
WP_001303586.1|3513101_3513203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000881075.1|3513319_3514117_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001445652.1|3514126_3514678_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_001356996.1|3515142_3516669_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	28.0	7.9e-31
WP_001299444.1|3516726_3516876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070442.1|3516923_3517256_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|3517323_3517626_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788815.1|3517622_3518324_-	hypothetical protein	NA	M1FJ72	Enterobacteria_phage	98.7	2.4e-128
WP_001551200.1|3518320_3519250_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.1	8.0e-111
WP_001182903.1|3519336_3519876_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	1.2e-61
WP_001067458.1|3519944_3520175_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_000259990.1|3520213_3520969_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	1.4e-92
WP_000233576.1|3521564_3521771_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995433.1|3521846_3522143_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
WP_000100847.1|3522148_3522934_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186833.1|3522930_3523611_+	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	5.1e-131
WP_000682294.1|3523607_3523769_+	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	96.0	7.7e-22
WP_001356999.1|3523761_3524319_+	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	62.3	2.0e-61
WP_077248689.1|3524329_3524611_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	2.1e-46
WP_000763390.1|3524709_3524928_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	98.6	4.9e-35
WP_000488407.1|3524975_3525254_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000446905.1|3525225_3525597_+	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
WP_001299447.1|3525452_3526616_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.3	3.4e-199
3526630:3526676	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
>prophage 11
NZ_CP041435	Escherichia coli strain STEC309 chromosome, complete genome	4917238	3759920	3834655	4917238	holin,terminase,capsid,protease,head,plate,transposase,integrase,portal,tail	Shigella_phage(50.0%)	85	3790021:3790067	3830753:3830799
WP_000131044.1|3759920_3761954_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001295527.1|3762082_3762670_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089077.1|3762683_3764156_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159102.1|3764169_3765840_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_001295805.1|3766914_3767478_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	53.3	6.0e-53
WP_001315275.1|3767807_3768602_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001406334.1|3768755_3769517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071593451.1|3770662_3771856_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_001209088.1|3772039_3772705_+	membrane protein	NA	NA	NA	NA	NA
WP_001315273.1|3772950_3773646_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023914.1|3773638_3775066_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102101.1|3775076_3775796_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339593.1|3776324_3777179_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001046293.1|3777404_3778730_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	8.5e-114
WP_000474077.1|3778838_3779075_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001299021.1|3779086_3779680_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_001299025.1|3779839_3780709_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.7	9.3e-53
WP_001315271.1|3780957_3781815_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000092603.1|3781936_3786190_-	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
WP_000662258.1|3787305_3787407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803999.1|3787769_3788033_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|3788032_3788173_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147277.1|3788207_3788435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094283415.1|3788648_3789795_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	98.9	4.9e-158
3790021:3790067	attL	ATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_126677963.1|3790821_3791565_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000355484.1|3793743_3794517_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.5	2.4e-36
WP_000905124.1|3794577_3795132_-	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	87.8	2.8e-87
WP_161619121.1|3795161_3795548_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_021576032.1|3795549_3795987_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	69.2	5.4e-49
WP_001676479.1|3795958_3796561_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	88.0	1.9e-97
WP_000554706.1|3796560_3797331_-|tail	tail fiber protein	tail	U5P0I1	Shigella_phage	94.4	2.7e-51
WP_000383550.1|3797334_3797919_-	YmfQ family protein	NA	O22003	Shigella_phage	98.5	7.8e-112
WP_096934567.1|3797909_3798968_-|plate	baseplate J/gp47 family protein	plate	U5P424	Shigella_phage	98.0	1.5e-198
WP_000424732.1|3798954_3799380_-	hypothetical protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_001259088.1|3799379_3799928_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	98.4	3.3e-96
WP_126677961.1|3799927_3801007_-|plate	baseplate protein	plate	Q8SBG7	Shigella_phage	99.4	3.4e-206
WP_053901023.1|3801003_3802332_-	DNA circularization protein	NA	Q8SBG8	Shigella_phage	98.0	6.7e-244
WP_000679479.1|3802393_3802924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001557407.1|3803015_3804848_-|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	97.9	1.7e-301
WP_000661047.1|3804989_3805259_-|tail	phage tail assembly protein	tail	S5FNR3	Shigella_phage	100.0	3.5e-43
WP_000090998.1|3805258_3805615_-	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_126677959.1|3805614_3807111_-|tail	phage tail protein	tail	M1FN90	Enterobacteria_phage	99.6	2.4e-274
WP_000497751.1|3807094_3807265_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_126677957.1|3807273_3807834_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	98.9	4.0e-105
WP_000213502.1|3807830_3808337_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	100.0	1.7e-91
WP_000702402.1|3808311_3808722_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	98.5	9.1e-75
WP_000927711.1|3808718_3809042_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_057081021.1|3809044_3809245_-	hypothetical protein	NA	S5FNU1	Shigella_phage	98.5	2.2e-26
WP_126677955.1|3809295_3810501_-|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	99.5	2.0e-223
WP_001442257.1|3810515_3811166_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	99.5	1.6e-118
WP_000466250.1|3811143_3812385_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.5	2.6e-242
WP_000605605.1|3812384_3812567_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	98.3	3.8e-25
WP_122986317.1|3812578_3814075_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.6	9.7e-300
WP_000929184.1|3814308_3814803_-|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	100.0	2.3e-88
WP_001135203.1|3814928_3815279_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	97.4	1.4e-63
WP_000651450.1|3815371_3815692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001476996.1|3815938_3816331_-	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	91.4	7.4e-58
WP_001075798.1|3816327_3816942_-	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	99.0	1.4e-111
WP_000422366.1|3816941_3817223_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	45.2	9.7e-20
WP_001283169.1|3817209_3817596_-	membrane protein	NA	A0A192Y8P2	Salmonella_phage	100.0	7.0e-61
WP_000220228.1|3817686_3818283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000609696.1|3818389_3818968_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	53.9	1.6e-45
WP_001471961.1|3818982_3819972_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	2.8e-194
WP_001061444.1|3819979_3820789_-	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	100.0	1.8e-151
WP_000767113.1|3820808_3821198_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_000210171.1|3821194_3821521_-	LexA family transcriptional regulator	NA	Q8SBE8	Shigella_phage	99.1	9.2e-54
WP_072749291.1|3821517_3822171_-	phage N-6-adenine-methyltransferase	NA	A0A0P0ZCC0	Stx2-converting_phage	99.5	1.6e-126
WP_072184155.1|3822170_3822665_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	97.5	9.6e-87
WP_000104942.1|3822661_3823603_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.3	1.7e-140
WP_001250269.1|3823592_3823772_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515829.1|3823947_3824505_-	protein YmfL	NA	S5FXP0	Shigella_phage	96.2	1.1e-96
WP_126677953.1|3824548_3824749_-	transcriptional regulator	NA	U5P445	Shigella_phage	98.5	8.7e-31
WP_000848748.1|3824839_3825514_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_001369946.1|3825685_3825889_+	ClpX C4-type zinc finger	NA	A0A1C9IHZ4	Salmonella_phage	68.3	8.9e-15
WP_001514782.1|3825897_3826173_+	hypothetical protein	NA	Q8SBF7	Shigella_phage	97.8	7.0e-47
WP_000135682.1|3826773_3827136_+	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_126677951.1|3827201_3828026_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	1.3e-149
WP_126677949.1|3828154_3828691_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	2.4e-99
WP_001242749.1|3828681_3829044_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000206732.1|3829043_3829349_+	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_000433939.1|3829348_3829699_+	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	100.0	4.9e-61
WP_000051887.1|3829575_3830739_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_000893255.1|3830943_3832197_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
3830753:3830799	attR	ATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285288.1|3832208_3833312_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749882.1|3833599_3834655_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.6	1.3e-117
>prophage 12
NZ_CP041435	Escherichia coli strain STEC309 chromosome, complete genome	4917238	4467902	4517644	4917238	holin,terminase,capsid,head,plate,integrase,portal,tail,tRNA	Enterobacteria_phage(38.6%)	68	4459620:4459635	4487112:4487127
4459620:4459635	attL	CACTGCCTGCTGATAA	NA	NA	NA	NA
WP_000543841.1|4467902_4468940_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332269.1|4469028_4470126_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_001217553.1|4470187_4470436_+	DinI family protein	NA	K7PLW4	Enterobacteria_phage	100.0	1.8e-38
WP_161619122.1|4470543_4471107_-	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	95.7	1.5e-99
WP_161619104.1|4471106_4473479_-|tail	phage tail protein	tail	A0A0U2SH60	Escherichia_phage	64.1	8.8e-279
WP_161619105.1|4473503_4474580_-	late control protein	NA	R9TNM7	Vibrio_phage	29.2	6.6e-32
WP_001107807.1|4474570_4474789_-|tail	phage tail protein	tail	R9TR63	Vibrio_phage	52.1	4.9e-11
WP_097450115.1|4474763_4475252_-|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	35.0	2.1e-14
WP_161619106.1|4475254_4476916_-	hypothetical protein	NA	R9TRP8	Vibrio_phage	33.6	8.6e-47
WP_097450117.1|4477033_4477336_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_033813286.1|4477397_4477916_-|tail	tail protein	tail	NA	NA	NA	NA
WP_096095865.1|4477912_4479388_-|tail	phage tail protein	tail	R9TMQ0	Vibrio_phage	38.3	3.3e-74
WP_033813288.1|4479444_4479978_-|tail	tail assembly chaperone	tail	A0A1S6KZY8	Salmonella_phage	47.3	7.0e-35
WP_033813289.1|4480005_4480533_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	76.3	9.9e-74
WP_161619107.1|4480547_4481801_-|tail	phage tail protein	tail	A0A0U2SAV1	Escherichia_phage	89.2	8.6e-116
WP_042099704.1|4481797_4482388_-|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	39.0	2.1e-24
WP_161619108.1|4482380_4483295_-|plate	baseplate assembly protein	plate	D5LGZ3	Escherichia_phage	44.2	8.0e-63
WP_000579232.1|4483269_4483626_-	hypothetical protein	NA	V5YTB2	Pseudomonas_phage	46.8	1.6e-19
WP_000049992.1|4483659_4484283_-|plate	phage baseplate assembly protein V	plate	F1BUP5	Erwinia_phage	29.8	2.4e-10
WP_097450120.1|4484266_4484818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096095872.1|4484829_4485552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032083604.1|4485532_4485934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001372342.1|4485936_4486302_-	DNA breaking-rejoining protein	NA	NA	NA	NA	NA
WP_096934545.1|4486352_4487381_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	58.9	1.3e-109
4487112:4487127	attR	CACTGCCTGCTGATAA	NA	NA	NA	NA
WP_032083606.1|4487449_4487785_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	54.2	3.3e-22
WP_096095873.1|4487824_4489441_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	53.9	3.7e-103
WP_096095880.1|4489430_4490954_-|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	63.2	9.9e-183
WP_000263126.1|4490998_4491208_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	49.2	1.4e-10
WP_000622385.1|4491211_4493128_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	1.0e-253
WP_032083611.1|4493099_4493648_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	98.6	2.6e-69
WP_097450134.1|4495243_4495525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161619109.1|4495595_4495973_-	M15 family metallopeptidase	NA	Q9MBZ3	Enterobacteria_phage	96.0	3.3e-63
WP_161619110.1|4495975_4496251_-|holin	phage holin family protein	holin	Q9MBZ4	Enterobacteria_phage	94.5	2.8e-43
WP_097449971.1|4496240_4496633_-|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	86.9	5.5e-53
WP_097449972.1|4496811_4497084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097449973.1|4497049_4497394_-	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	83.0	2.0e-46
WP_097449974.1|4497398_4497614_-|holin	holin	holin	G9L6J5	Escherichia_phage	97.2	2.2e-32
WP_161619111.1|4497879_4498203_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	98.1	6.5e-60
WP_000738076.1|4498390_4498660_-	Shiga toxin Stx2d subunit B	NA	Q5TJL5	Enterobacteria_phage	97.8	3.0e-42
WP_097449975.1|4498671_4499631_-	Shiga toxin Stx2 subunit A	NA	Q6DWN9	Enterobacteria_phage	96.6	1.8e-169
WP_097449976.1|4500000_4500714_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917767.1|4500850_4501048_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_057108854.1|4501221_4501935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161619112.1|4502188_4502854_-	antiterminator	NA	I6PDF8	Cronobacter_phage	52.9	1.1e-61
WP_136769107.1|4502850_4503210_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.7	1.8e-39
WP_136769108.1|4503222_4504212_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	95.7	4.6e-189
WP_001061438.1|4504219_4505029_-	KilA-N domain-containing protein	NA	A5LH75	Enterobacteria_phage	100.0	8.2e-152
WP_000767141.1|4505048_4505438_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A291AX14	Escherichia_phage	99.2	1.6e-68
WP_000210169.1|4505434_4505761_-	LexA family transcriptional regulator	NA	K7PLX6	Enterobacteria_phage	100.0	9.2e-54
WP_072127929.1|4506409_4506904_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	98.1	3.6e-86
WP_024211007.1|4506900_4507719_-	helix-turn-helix domain-containing protein	NA	A0A291AWW0	Escherichia_phage	99.3	1.8e-122
WP_000620696.1|4507715_4507940_-	hypothetical protein	NA	A5LH70	Enterobacteria_phage	100.0	5.7e-39
WP_136769109.1|4507936_4509088_-	peptidase	NA	K7PLX4	Enterobacteria_phage	96.1	6.9e-205
WP_000515862.1|4509084_4509636_-	hypothetical protein	NA	Q8SBF4	Shigella_phage	99.5	9.9e-101
WP_001191669.1|4509628_4509889_-	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
WP_001345148.1|4509986_4510679_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.1	8.3e-121
WP_000135680.1|4511402_4511765_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_161619113.1|4511830_4512655_+	YfdQ family protein	NA	Q8SBF9	Shigella_phage	98.5	6.6e-149
WP_000008178.1|4512783_4513320_+	5'-deoxynucleotidase	NA	A0A0P0ZCH9	Stx2-converting_phage	99.4	2.2e-100
WP_097455379.1|4513310_4513673_+	hypothetical protein	NA	K7PH61	Enterobacteria_phage	97.5	2.3e-66
WP_000111289.1|4513669_4513873_+	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	98.5	1.0e-31
WP_000476211.1|4513865_4514105_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	98.7	2.2e-36
WP_027661982.1|4514101_4514356_+	hypothetical protein	NA	A0A0U2RK51	Escherichia_phage	97.6	3.3e-43
WP_161619114.1|4514722_4515685_+	DUF551 domain-containing protein	NA	Q8VNQ2	Enterobacteria_phage	93.6	4.6e-69
WP_097455382.1|4515684_4516257_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	97.4	4.3e-107
WP_001093911.1|4516293_4516566_+	hypothetical protein	NA	S5MQM5	Escherichia_phage	100.0	7.2e-44
WP_053878051.1|4516599_4517148_-	hypothetical protein	NA	S5M7T3	Escherichia_phage	86.3	2.0e-77
WP_059242328.1|4517170_4517644_-	SocA family protein	NA	K4NZT7	Burkholderia_phage	31.8	2.4e-18
>prophage 1
NZ_CP041436	Escherichia coli strain STEC309 plasmid pSTEC309, complete sequence	88727	50635	61881	88727	integrase	Cronobacter_phage(22.22%)	14	52588:52602	63743:63757
WP_032219114.1|50635_51319_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	6.7e-30
WP_077877494.1|51703_52675_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
52588:52602	attL	GTTCACCAGAAAAAT	NA	NA	NA	NA
WP_019842136.1|53023_53272_+	DinI-like family protein	NA	Q2A098	Sodalis_phage	48.0	5.4e-14
WP_032219119.1|53268_53706_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	46.8	2.4e-25
WP_161619133.1|53705_54698_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	58.5	3.4e-99
WP_000643588.1|54727_54976_+	DUF4113 domain-containing protein	NA	F1C5A5	Cronobacter_phage	60.3	5.0e-20
WP_000340833.1|54980_55373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001103694.1|55377_56349_-	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	42.9	9.7e-67
WP_000633911.1|56577_57222_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	43.5	8.8e-40
WP_000239529.1|57215_57491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161619134.1|57628_58438_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	94.6	3.0e-53
WP_001159871.1|58438_58744_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000813634.1|58745_58964_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_096934566.1|61215_61881_+	PIG-L family deacetylase	NA	A0A1L6BYV0	Mycobacterium_phage	28.6	2.4e-08
63743:63757	attR	ATTTTTCTGGTGAAC	NA	NA	NA	NA
