The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041433	Escherichia coli strain STEC313 chromosome, complete genome	5099527	821442	883327	5099527	plate,protease,tRNA,integrase	Cronobacter_phage(20.0%)	56	826239:826256	870291:870308
WP_032255449.1|821442_822780_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_160520330.1|822776_823430_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_160520329.1|823432_825163_+	OmpA family protein	NA	NA	NA	NA	NA
WP_001007315.1|825168_825660_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_160520328.1|825829_828487_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	32.7	8.8e-94
826239:826256	attL	GTCAGAGCCAGTTGCAGC	NA	NA	NA	NA
WP_001559822.1|828483_829050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097464634.1|829043_829586_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_160520327.1|829572_832098_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_097464632.1|832094_833777_+	T6SS effector phospholipase Tle1-EAEC	NA	NA	NA	NA	NA
WP_097464631.1|833796_834474_+	T6SS immunity phospholipase A1-binding lipoprotein Tli1-EAEC	NA	NA	NA	NA	NA
WP_016237387.1|834617_835295_+	T6SS immunity phospholipase A1-binding lipoprotein Tli1-EAEC	NA	NA	NA	NA	NA
WP_000033410.1|835326_835593_+	PAAR domain-containing protein	NA	E5E3Y0	Burkholderia_phage	39.0	6.9e-07
WP_097464629.1|835650_836745_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_161622531.1|836737_840127_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_160520325.1|840126_841725_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_160520324.1|841858_843622_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_160520323.1|843576_844677_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_032252205.1|844657_845194_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_160520322.1|845196_845628_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_089643444.1|845784_846186_+	hypothetical protein	NA	A0A0R6PI25	Moraxella_phage	49.2	1.5e-05
WP_160520321.1|846341_847586_+	GIY-YIG nuclease family protein	NA	Q9MC01	Enterobacteria_phage	64.0	1.4e-78
WP_161622632.1|847821_849567_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_089643441.1|849632_849938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160520320.1|849992_851381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061361451.1|851902_853780_+	NTPase KAP	NA	NA	NA	NA	NA
WP_160520319.1|853779_854589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160520318.1|854585_855851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061361446.1|855847_856606_+	hydrolase TatD	NA	NA	NA	NA	NA
WP_161622633.1|856837_857752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089643363.1|858137_859400_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	43.1	9.0e-81
WP_000234524.1|859778_860486_-	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_000839747.1|860883_863019_+	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_001049791.1|863068_864325_-	nucleoside permease	NA	NA	NA	NA	NA
WP_000760323.1|864526_865606_-	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_000091700.1|865670_865946_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_001298922.1|865973_867026_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000786911.1|867186_867906_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001107564.1|867905_868232_+	YggL family protein	NA	NA	NA	NA	NA
WP_000984796.1|868415_869135_+	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_000394125.1|869310_870357_+	L-asparaginase 2	NA	NA	NA	NA	NA
870291:870308	attR	GCTGCAACTGGCTCTGAC	NA	NA	NA	NA
WP_000745217.1|870473_871481_+	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000378945.1|871536_872838_-	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_047082076.1|872837_873341_-	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_000784004.1|873385_874372_-	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000239939.1|874686_875823_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_001174751.1|875815_876409_-	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_001277222.1|876416_876707_-	YggU family protein	NA	NA	NA	NA	NA
WP_001094831.1|876703_877270_-	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_000997795.1|877287_877992_-	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001055618.1|878009_878990_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000017111.1|879165_879582_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_000126441.1|879581_880217_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000593273.1|880253_881204_-	glutathione synthase	NA	NA	NA	NA	NA
WP_001222508.1|881216_881948_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000286500.1|882027_882735_-	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_000858396.1|882829_883327_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
>prophage 2
NZ_CP041433	Escherichia coli strain STEC313 chromosome, complete genome	5099527	1135011	1142151	5099527		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|1135011_1135650_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|1135646_1136909_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|1136905_1137814_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001272549.1|1137979_1138777_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	5.9e-70
WP_001141330.1|1138827_1139484_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
WP_161622538.1|1139589_1142151_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.4	1.7e-30
>prophage 3
NZ_CP041433	Escherichia coli strain STEC313 chromosome, complete genome	5099527	1213345	1301217	5099527	capsid,portal,tRNA,integrase,terminase,tail,head,holin,transposase	Enterobacteria_phage(37.04%)	94	1226346:1226361	1306625:1306640
WP_000169527.1|1213345_1213645_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000878218.1|1213641_1214508_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_000577254.1|1214659_1216378_+	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	99.8	3.2e-307
WP_000214990.1|1216379_1218128_+	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	99.8	0.0e+00
WP_000448925.1|1218199_1218616_-	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
WP_001341819.1|1218654_1219884_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	100.0	1.5e-234
WP_000162574.1|1220626_1221109_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000600190.1|1221240_1221717_+	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_001117838.1|1221706_1221997_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203437.1|1222058_1222400_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880910.1|1222548_1224210_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059169.1|1224295_1225174_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001300112.1|1225296_1225887_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001287917.1|1225921_1226527_-	hypothetical protein	NA	NA	NA	NA	NA
1226346:1226361	attL	TCGAGAACGTCCTGCA	NA	NA	NA	NA
WP_010723175.1|1226649_1227936_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001189257.1|1227956_1228823_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460035.1|1228914_1230276_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256450.1|1230412_1230661_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043335.1|1230679_1231228_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000264777.1|1231258_1232026_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065253.1|1232067_1232415_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000589828.1|1232491_1232974_-	OmpA family protein	NA	NA	NA	NA	NA
WP_000969032.1|1232989_1234216_-	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_001212391.1|1234205_1234724_-	YfiR family protein	NA	NA	NA	NA	NA
WP_000976004.1|1234873_1235239_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001168044.1|1235448_1236519_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_000225221.1|1236529_1237651_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000200116.1|1237693_1238854_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_001386991.1|1238952_1239000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001440068.1|1239167_1240190_-|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	53.5	2.7e-99
WP_001242988.1|1240223_1240526_-	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	52.0	2.3e-19
WP_001001391.1|1240621_1240948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161622539.1|1240966_1241308_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	92.2	1.5e-54
WP_000159006.1|1241318_1241606_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	75.8	3.9e-32
WP_000514277.1|1241617_1241860_+	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000021656.1|1241856_1241970_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	2.5e-11
WP_161622540.1|1242056_1242260_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	85.1	8.6e-26
WP_000153699.1|1242256_1242523_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	76.1	6.8e-31
WP_032082655.1|1242519_1242819_+	phage protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	5.8e-39
WP_032301402.1|1242830_1243034_+	hypothetical protein	NA	A0A0A7NQ74	Enterobacteria_phage	97.0	3.1e-28
WP_000713740.1|1243030_1243861_+	hypothetical protein	NA	A0A0A7NPW9	Enterobacteria_phage	99.3	7.4e-132
WP_106777538.1|1243914_1244535_+	hypothetical protein	NA	S5MQL6	Escherichia_phage	40.4	1.2e-09
WP_161622541.1|1244531_1244897_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	94.2	1.8e-58
WP_161622542.1|1244903_1247726_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.2	0.0e+00
WP_161622543.1|1247802_1248762_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.4	6.4e-180
WP_000211287.1|1248766_1249081_+	peptide transporter	NA	A0A0A7NPT5	Enterobacteria_phage	51.4	2.3e-17
WP_000104418.1|1249095_1249383_+	hypothetical protein	NA	A5LH60	Enterobacteria_phage	69.5	1.8e-16
WP_000974052.1|1249394_1249754_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_001300959.1|1249822_1250137_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	45.1	7.3e-16
WP_161622544.1|1250145_1251180_-|portal	phage portal protein	portal	Q94MZ7	Haemophilus_virus	54.1	1.0e-90
WP_161622545.1|1251172_1252960_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	55.5	5.2e-191
WP_000166126.1|1253154_1254051_+|capsid	phage capsid protein	capsid	U3PDG3	Vibrio_phage	41.3	1.5e-37
WP_097339202.1|1254065_1255079_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	59.1	4.2e-105
WP_001142998.1|1255096_1255807_+|terminase	terminase endonuclease subunit	terminase	F1BUM0	Cronobacter_phage	47.0	5.6e-56
WP_161622546.1|1255905_1256400_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	42.5	5.9e-28
WP_161622547.1|1256409_1256883_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_161622548.1|1256879_1257593_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	40.8	1.1e-30
WP_161622549.1|1257612_1258761_+	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	55.8	7.6e-111
WP_000213187.1|1258757_1259213_+	DUF2597 family protein	NA	A5X9I1	Aeromonas_virus	54.3	9.5e-41
WP_001155241.1|1259216_1259513_+|holin	holin	holin	C7BGD7	Burkholderia_phage	44.7	2.6e-15
WP_000777017.1|1259622_1259964_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	78.2	1.9e-41
WP_000998379.1|1260034_1260322_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	47.6	7.4e-15
WP_000082775.1|1260509_1262606_+|tail	phage tail tape measure protein	tail	A0A2I7RNI7	Vibrio_phage	37.7	5.5e-107
WP_097486554.1|1262595_1262946_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	68.4	4.6e-27
WP_161620290.1|1262938_1264123_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	61.3	5.8e-138
WP_000775221.1|1264119_1264755_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	54.8	1.1e-50
WP_161620289.1|1264751_1266407_+|tail	phage tail protein	tail	Q8W613	Enterobacteria_phage	84.7	1.3e-116
WP_161620288.1|1266409_1266964_+|tail	tail fiber assembly protein	tail	Q8W612	Enterobacteria_phage	89.4	3.9e-89
WP_161620410.1|1268265_1268838_+	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	76.1	2.7e-77
WP_161620651.1|1268983_1269259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000192894.1|1269519_1270095_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	44.0	8.7e-31
WP_074500808.1|1270091_1271789_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	40.8	1.6e-109
WP_032218680.1|1272618_1272759_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	95.7	1.0e-17
WP_074523817.1|1273406_1273643_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_074523819.1|1273587_1274394_+	site-specific DNA-methyltransferase	NA	Q775B4	Bordetella_phage	53.7	8.9e-66
WP_000178456.1|1274545_1274887_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197686.1|1275157_1275895_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079107.1|1276029_1277010_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000040115.1|1277006_1277738_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235102.1|1277867_1280441_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000841103.1|1286219_1287518_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_000464877.1|1287514_1287859_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949265.1|1287883_1289239_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000082949.1|1289352_1292013_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_001307345.1|1292044_1292743_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_001098726.1|1292811_1293231_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997403.1|1293437_1294475_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001262723.1|1294522_1295212_-	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	2.1e-55
WP_000627807.1|1295516_1295900_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_000189206.1|1295954_1296542_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001307344.1|1296644_1297526_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000399648.1|1297762_1298743_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000219193.1|1299013_1300348_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001297411.1|1300479_1301217_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
1306625:1306640	attR	TGCAGGACGTTCTCGA	NA	NA	NA	NA
>prophage 4
NZ_CP041433	Escherichia coli strain STEC313 chromosome, complete genome	5099527	1776719	1786161	5099527		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569329.1|1776719_1777646_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
WP_000783120.1|1777650_1778382_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216961.1|1778362_1778470_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1778529_1779261_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1779482_1781168_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1781164_1781884_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1781930_1782401_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001296231.1|1782441_1782903_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001300967.1|1783027_1785028_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.6	0.0e+00
WP_001300968.1|1785024_1786161_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
>prophage 5
NZ_CP041433	Escherichia coli strain STEC313 chromosome, complete genome	5099527	1876934	1883611	5099527		Enterobacteria_phage(57.14%)	7	NA	NA
WP_161622559.1|1876934_1878326_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.8	4.8e-19
WP_001376208.1|1878501_1879398_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	41.5	4.5e-42
WP_001376207.1|1879737_1880820_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.1	3.7e-99
WP_001376206.1|1880822_1881722_+	dTDP-4-dehydrorhamnose reductase	NA	A0A140G5S3	Enterobacteria_phage	36.2	6.1e-31
WP_001376204.1|1881774_1882653_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	6.6e-107
WP_001471760.1|1882656_1883205_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	54.7	5.1e-49
WP_021558693.1|1883218_1883611_+	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SGE7	Hokovirus	50.0	6.5e-30
>prophage 6
NZ_CP041433	Escherichia coli strain STEC313 chromosome, complete genome	5099527	1889499	1897664	5099527	transposase	Ostreococcus_lucimarinus_virus(16.67%)	7	NA	NA
WP_001376067.1|1889499_1890906_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.0	1.2e-36
WP_001471753.1|1891129_1892296_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.0	7.7e-111
WP_032083663.1|1892347_1893352_-	NAD-dependent epimerase	NA	A0A2K9L4U8	Tupanvirus	30.4	8.6e-34
WP_032212789.1|1893436_1894291_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.4	1.2e-68
WP_001254940.1|1894339_1895491_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.9	1.5e-42
WP_001679039.1|1896033_1897014_+	LPS O-antigen chain length determinant protein WzzB	NA	NA	NA	NA	NA
WP_001374037.1|1897052_1897664_-	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A2H4UVM0	Bodo_saltans_virus	29.3	7.8e-14
>prophage 7
NZ_CP041433	Escherichia coli strain STEC313 chromosome, complete genome	5099527	2048844	2108475	5099527	capsid,portal,tRNA,integrase,tail,terminase,plate,head,holin	Enterobacteria_phage(52.73%)	75	2056181:2056212	2109633:2109664
WP_001025326.1|2048844_2050578_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
WP_001300190.1|2050793_2051360_+	VOC family protein	NA	NA	NA	NA	NA
WP_001185741.1|2051373_2052120_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001214304.1|2052507_2053608_+	cytochrome c	NA	NA	NA	NA	NA
WP_000176841.1|2053632_2056062_+	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
2056181:2056212	attL	GGCCGGATAAGGCATTCACGCCGCATCCGGCA	NA	NA	NA	NA
WP_000564742.1|2056226_2057198_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000019588.1|2057194_2057938_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000252980.1|2057978_2058374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044151905.1|2058426_2059197_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.1e-72
WP_161620741.1|2059178_2060492_-|integrase	site-specific integrase	integrase	Q8W658	Enterobacteria_phage	99.5	3.7e-255
WP_000528717.1|2060547_2060784_-	excisionase family protein	NA	Q8W657	Enterobacteria_phage	100.0	9.9e-42
WP_033813160.1|2060792_2060939_-	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	93.8	2.0e-21
WP_021558719.1|2060942_2061185_-	DUF4222 domain-containing protein	NA	Q8W656	Enterobacteria_phage	100.0	6.8e-38
WP_097449985.1|2061215_2061587_-	hypothetical protein	NA	Q8W655	Enterobacteria_phage	97.6	1.1e-63
WP_000720012.1|2061627_2062455_-	hypothetical protein	NA	Q8W654	Enterobacteria_phage	100.0	4.3e-132
WP_161622563.1|2062816_2063398_-	hypothetical protein	NA	Q8W653	Enterobacteria_phage	93.8	7.5e-107
WP_097449984.1|2063394_2063583_-	hypothetical protein	NA	Q8W652	Enterobacteria_phage	98.4	1.0e-28
WP_000141090.1|2063779_2063986_-	hypothetical protein	NA	Q8W651	Enterobacteria_phage	100.0	1.1e-31
WP_097449983.1|2064141_2064552_-	helix-turn-helix domain-containing protein	NA	Q8W649	Enterobacteria_phage	88.3	2.1e-31
WP_097449982.1|2064697_2065390_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	47.2	1.0e-49
WP_097449981.1|2065509_2065755_+	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	54.3	1.5e-13
WP_000072550.1|2065836_2066082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161622564.1|2066253_2066961_+	DNA-binding protein	NA	Q8W645	Enterobacteria_phage	91.1	3.9e-118
WP_161622565.1|2067833_2068496_+	hypothetical protein	NA	Q8W643	Enterobacteria_phage	87.0	3.4e-103
WP_021558728.1|2068488_2068722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021558729.1|2068718_2068943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161622566.1|2068939_2069932_+	replication protein	NA	Q8W642	Enterobacteria_phage	98.2	3.8e-58
WP_097449978.1|2069942_2070821_+	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	97.2	1.4e-141
WP_161622567.1|2070817_2072209_+	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	98.1	7.5e-262
WP_001064805.1|2072205_2072463_+	hypothetical protein	NA	Q8W639	Enterobacteria_phage	98.8	1.3e-34
WP_015967628.1|2072462_2072843_+	antitermination protein Q	NA	Q8W638	Enterobacteria_phage	100.0	3.4e-68
WP_015967629.1|2072937_2074167_+	GIY-YIG nuclease family protein	NA	Q9MC01	Enterobacteria_phage	100.0	7.2e-200
WP_000917767.1|2074382_2074580_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_161620734.1|2074730_2075777_+	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	93.4	2.5e-193
WP_097450102.1|2076668_2077094_+	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	85.8	4.2e-59
WP_000833644.1|2077090_2077243_+	DUF3927 domain-containing protein	NA	A0A0A0YRI9	Escherichia_phage	55.6	2.5e-06
WP_001294582.1|2077330_2077723_+|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	90.0	1.5e-50
WP_000950567.1|2077712_2077988_+|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	93.4	9.8e-41
WP_161619109.1|2077990_2078368_+	M15 family metallopeptidase	NA	Q9MBZ3	Enterobacteria_phage	96.0	3.3e-63
WP_161622568.1|2078438_2078720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001233884.1|2078792_2078975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042099690.1|2079489_2079765_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	90.1	2.0e-41
WP_136769139.1|2080234_2080783_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	87.1	1.1e-59
WP_136769138.1|2080754_2082671_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.4	4.3e-252
WP_161622569.1|2082674_2082884_+|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	50.8	2.8e-11
WP_097450122.1|2082928_2084452_+|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	63.4	5.8e-183
WP_161620836.1|2084471_2086196_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	53.6	6.9e-100
WP_032083606.1|2086235_2086571_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	54.2	3.3e-22
WP_096934545.1|2086639_2087668_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	58.9	1.3e-109
WP_001372342.1|2087718_2088084_+	DNA breaking-rejoining protein	NA	NA	NA	NA	NA
WP_032083604.1|2088086_2088488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096095872.1|2088468_2089191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097450120.1|2089202_2089754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000049992.1|2089737_2090361_+|plate	phage baseplate assembly protein V	plate	F1BUP5	Erwinia_phage	29.8	2.4e-10
WP_000579232.1|2090394_2090751_+	hypothetical protein	NA	V5YTB2	Pseudomonas_phage	46.8	1.6e-19
WP_000235847.1|2090725_2091640_+|plate	baseplate assembly protein	plate	D5LGZ3	Escherichia_phage	43.6	7.5e-61
WP_042099704.1|2091632_2092223_+|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	39.0	2.1e-24
WP_161620812.1|2092219_2093476_+|tail	phage tail protein	tail	A0A0U2SAV1	Escherichia_phage	89.6	2.4e-118
WP_033813289.1|2093490_2094018_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	76.3	9.9e-74
WP_033813288.1|2094045_2094579_+|tail	tail assembly chaperone	tail	A0A1S6KZY8	Salmonella_phage	47.3	7.0e-35
WP_096095865.1|2094635_2096111_+|tail	phage tail protein	tail	R9TMQ0	Vibrio_phage	38.3	3.3e-74
WP_033813286.1|2096107_2096626_+|tail	tail protein	tail	NA	NA	NA	NA
WP_033813285.1|2096687_2096990_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_146313824.1|2097107_2098769_+	hypothetical protein	NA	R9TRP8	Vibrio_phage	33.9	7.8e-48
WP_097450115.1|2098771_2099260_+|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	35.0	2.1e-14
WP_001107807.1|2099234_2099453_+|tail	phage tail protein	tail	R9TR63	Vibrio_phage	52.1	4.9e-11
WP_161619105.1|2099443_2100520_+	late control protein	NA	R9TNM7	Vibrio_phage	29.2	6.6e-32
WP_161620810.1|2100544_2102248_+|tail	phage tail protein	tail	A0A0U2SH60	Escherichia_phage	44.6	1.1e-54
WP_001774846.1|2102247_2102811_+	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	94.1	8.9e-97
WP_001217553.1|2102918_2103167_-	DinI family protein	NA	K7PLW4	Enterobacteria_phage	100.0	1.8e-38
WP_000332269.1|2103228_2104326_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_000543841.1|2104414_2105452_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000891404.1|2105585_2105828_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000235522.1|2105993_2106977_-	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000918363.1|2107059_2108475_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
2109633:2109664	attR	TGCCGGATGCGGCGTGAATGCCTTATCCGGCC	NA	NA	NA	NA
>prophage 8
NZ_CP041433	Escherichia coli strain STEC313 chromosome, complete genome	5099527	2227631	2277603	5099527	plate,protease	Cronobacter_phage(11.11%)	42	NA	NA
WP_000586633.1|2227631_2228045_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001554638.1|2228416_2228875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021558529.1|2229333_2229882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161622377.1|2230550_2230778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047628059.1|2231283_2231907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000124181.1|2232003_2232237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001287791.1|2232289_2232481_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_047628062.1|2232988_2233486_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001380969.1|2233507_2235052_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_061356632.1|2235067_2236405_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001380972.1|2236401_2237055_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_061356631.1|2237057_2238788_+	OmpA family protein	NA	NA	NA	NA	NA
WP_001007315.1|2238793_2239285_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_069914763.1|2239453_2242141_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	32.8	5.2e-94
WP_061356731.1|2242127_2242769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032175927.1|2243071_2245594_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.7	3.0e-03
WP_047628114.1|2245668_2247501_+	lipase family protein	NA	A0A2R8FER2	Brazilian_cedratvirus	28.6	2.1e-09
WP_032175926.1|2247484_2248246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047628076.1|2248849_2249116_+	PAAR domain-containing protein	NA	E5E3Y0	Burkholderia_phage	39.0	1.5e-06
WP_139127355.1|2249173_2250268_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_061356729.1|2250260_2253650_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_061356728.1|2253649_2255248_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_061356727.1|2255204_2255942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032252203.1|2255949_2257713_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_047628086.1|2257667_2258768_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_047628088.1|2258748_2259285_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_047628090.1|2259287_2259749_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_047628115.1|2259871_2260273_+	hypothetical protein	NA	A0A0R6PKW9	Moraxella_phage	71.9	2.6e-05
WP_047628092.1|2260428_2261673_+	chromosome partitioning protein ParA	NA	Q9MC01	Enterobacteria_phage	64.6	2.2e-79
WP_047628094.1|2261907_2263653_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_047628096.1|2263718_2264024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047628098.1|2264078_2265443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047628102.1|2266428_2268081_+	membrane protein	NA	NA	NA	NA	NA
WP_047628104.1|2268087_2268795_+	OmpA family protein	NA	NA	NA	NA	NA
WP_047628105.1|2268798_2269896_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_047628108.1|2270286_2271519_+	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	32.7	7.7e-61
WP_061356723.1|2271503_2272142_+	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.0	3.9e-56
WP_047628619.1|2272220_2272490_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001176768.1|2273863_2274331_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_047628139.1|2274348_2275557_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_061356722.1|2275567_2276524_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_047628136.1|2276523_2277603_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.4	2.8e-38
>prophage 9
NZ_CP041433	Escherichia coli strain STEC313 chromosome, complete genome	5099527	2287041	2394674	5099527	protease,tRNA,integrase,terminase,tail,plate,head,holin,transposase	Pseudomonas_phage(13.73%)	121	2281281:2281296	2364866:2364880
2281281:2281296	attL	AACGCTTTCTGCCGCG	NA	NA	NA	NA
WP_000878219.1|2287041_2287908_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
2281281:2281296	attL	AACGCTTTCTGCCGCG	NA	NA	NA	NA
WP_000169527.1|2287904_2288204_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_161622570.1|2288279_2288381_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_061356664.1|2288939_2289290_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	62.9	5.8e-38
WP_047628124.1|2289590_2289854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047628164.1|2290668_2291406_+	porin family protein	NA	NA	NA	NA	NA
WP_047661865.1|2291825_2292722_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_047628120.1|2292770_2293850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061356665.1|2293896_2295468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000766272.1|2295464_2295731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061356666.1|2296133_2297795_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_029490416.1|2298255_2299548_-	MFS transporter	NA	NA	NA	NA	NA
WP_149016331.1|2300020_2301300_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	93.4	2.4e-166
WP_061356668.1|2301330_2302044_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_047627248.1|2302929_2304111_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	53.1	1.3e-121
WP_001188520.1|2304469_2305045_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000068978.1|2305081_2306779_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_000883400.1|2306754_2307093_-	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_000961957.1|2307208_2308510_-	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_000069437.1|2308627_2310064_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_001267448.1|2310400_2310877_+	membrane protein FxsA	NA	NA	NA	NA	NA
WP_000015837.1|2310892_2312149_-	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_001026276.1|2312424_2312718_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|2312761_2314408_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_000558209.1|2314545_2314899_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_000399589.1|2315151_2316132_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_001008073.1|2316380_2317250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000940530.1|2317639_2318668_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_000257278.1|2318709_2319276_+	elongation factor P	NA	NA	NA	NA	NA
WP_000977757.1|2319327_2319453_+	lipoprotein antitoxin entericidin A	NA	NA	NA	NA	NA
WP_000239596.1|2319563_2319710_+	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_000118482.1|2319891_2320209_+	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_001238378.1|2320205_2320739_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
WP_001352591.1|2320827_2321961_-	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
WP_001299198.1|2322023_2322383_-	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_000208757.1|2322393_2322789_-	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_000829498.1|2322799_2323534_-	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_001192973.1|2323526_2325335_-	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_000004771.1|2325659_2326637_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
WP_001355771.1|2326855_2328358_+	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_001236804.1|2328508_2331832_-	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_000934920.1|2331853_2332822_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_000041966.1|2332918_2333971_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_001295188.1|2334065_2334611_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
WP_010723271.1|2335353_2335407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001294219.1|2335389_2336529_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_001307537.1|2336527_2338075_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_000981977.1|2338046_2338508_+|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_000990312.1|2338526_2339864_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_001122487.1|2339873_2341721_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.4e-60
WP_001280345.1|2341713_2342664_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|2342749_2343058_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460360.1|2343133_2344414_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312488.1|2344499_2345759_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|2345761_2346766_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|2346847_2347045_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|2347148_2348447_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177644.1|2348651_2349077_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076316.1|2349115_2351557_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
WP_001293282.1|2351736_2352468_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
2352168:2352183	attR	CGCGGCAGAAAGCGTT	NA	NA	NA	NA
WP_000220137.1|2352594_2352996_+	DUF2170 family protein	NA	NA	NA	NA	NA
2352168:2352183	attR	CGCGGCAGAAAGCGTT	NA	NA	NA	NA
WP_000511955.1|2353014_2353713_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_103722894.1|2354048_2354675_-	helix-turn-helix transcriptional regulator	NA	L7P7S1	Pseudomonas_phage	36.9	2.8e-06
WP_077781711.1|2354857_2355127_+	transcriptional regulator	NA	A0A2D1GNH1	Pseudomonas_phage	35.8	1.3e-08
WP_161622571.1|2355136_2357179_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	48.7	6.8e-171
WP_100616698.1|2357196_2358090_+	AAA family ATPase	NA	A0A2D1GNS0	Pseudomonas_phage	56.6	4.4e-90
WP_042966146.1|2358104_2358329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042970505.1|2358344_2358596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000051130.1|2358606_2358798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000279302.1|2358787_2359003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161620694.1|2359032_2359677_+	DUF3164 family protein	NA	A4JWM8	Burkholderia_virus	65.4	4.9e-75
WP_047675512.1|2359678_2359912_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_161620695.1|2359892_2360084_+	hypothetical protein	NA	A0A2D1GNV5	Pseudomonas_phage	55.0	9.5e-11
WP_161620696.1|2360164_2360551_+	hypothetical protein	NA	U5PRY6	Bacillus_phage	47.9	2.4e-21
WP_161620697.1|2360615_2361161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161622572.1|2361437_2362148_+	DUF2786 domain-containing protein	NA	NA	NA	NA	NA
WP_161620699.1|2362374_2362599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089653615.1|2362595_2362784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053896997.1|2363150_2363561_+	hypothetical protein	NA	A0A076G6X8	Escherichia_phage	72.8	1.8e-30
WP_000849710.1|2363602_2363788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063101261.1|2363792_2364044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149857209.1|2364088_2364403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000914512.1|2364374_2364770_+	regulatory protein GemA	NA	A0A2D1GNN4	Pseudomonas_phage	63.8	7.0e-40
WP_000734972.1|2364766_2365105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161622573.1|2365205_2365673_+	mor transcription activator family protein	NA	A0A2D1GNW5	Pseudomonas_phage	38.8	8.9e-18
WP_000186479.1|2365699_2365978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001372993.1|2366160_2366553_+|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	55.7	1.6e-28
WP_000445984.1|2366542_2366821_+|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	51.1	2.6e-17
WP_000014543.1|2366823_2367201_+	M15 family metallopeptidase	NA	Q9MBZ3	Enterobacteria_phage	91.9	2.4e-61
WP_001082043.1|2367214_2367397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000312574.1|2367623_2368124_+	DUF1804 family protein	NA	A0A0M3VI86	Ralstonia_phage	47.2	4.9e-38
WP_161622574.1|2368170_2368911_+	site-specific DNA-methyltransferase	NA	Q775B4	Bordetella_phage	52.4	4.1e-65
WP_161622575.1|2368912_2370553_+|terminase	phage terminase large subunit	terminase	B7SDN0	Haemophilus_phage	63.3	3.9e-193
WP_161620615.1|2370556_2372152_+	DUF935 domain-containing protein	NA	A0A0U5KSI0	unidentified_phage	46.4	4.1e-123
WP_161620616.1|2372138_2373305_+|head	phage head morphogenesis protein	head	A0A0M4UTA3	Ralstonia_phage	45.7	5.4e-56
WP_059273813.1|2373301_2373853_+	phage virion morphogenesis protein	NA	A0A0M3LSP9	Mannheimia_phage	30.1	3.1e-09
WP_161622576.1|2374062_2375178_+	hypothetical protein	NA	A0A0M5N0Q6	Ralstonia_phage	39.7	7.3e-50
WP_032300900.1|2375178_2375574_+	hypothetical protein	NA	A0A2H4IZH5	uncultured_Caudovirales_phage	38.6	2.2e-17
WP_021564529.1|2375584_2376493_+	hypothetical protein	NA	A0A2H4J778	uncultured_Caudovirales_phage	59.7	5.6e-101
WP_021564530.1|2376495_2376837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021564531.1|2376840_2377272_+	DUF1320 domain-containing protein	NA	A0A1X9SGZ3	Bradyrhizobium_phage	28.1	4.1e-09
WP_149857199.1|2377268_2377922_+	DUF1834 family protein	NA	NA	NA	NA	NA
WP_149857210.1|2377935_2378145_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_149857200.1|2378137_2379559_+|tail	phage tail protein	tail	B7SDP8	Haemophilus_phage	44.5	3.5e-97
WP_073521083.1|2379571_2379946_+|tail	phage tail protein	tail	F6MIK8	Haemophilus_phage	59.3	8.7e-32
WP_105494270.1|2379942_2380326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161622577.1|2380488_2382759_+|tail	tail length tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	37.8	5.6e-89
WP_161622578.1|2382758_2384108_+	multidrug DMT transporter permease	NA	F6MIL2	Haemophilus_phage	25.7	6.5e-37
WP_161622579.1|2384091_2385303_+|tail	phage tail protein	tail	A0A2H4J9E6	uncultured_Caudovirales_phage	38.3	4.8e-71
WP_161622580.1|2385299_2385953_+|plate	phage baseplate assembly protein	plate	F6MIL4	Haemophilus_phage	48.2	1.4e-40
WP_023982056.1|2386006_2386357_+	hypothetical protein	NA	A0A2H4JDR8	uncultured_Caudovirales_phage	63.8	6.2e-32
WP_161622581.1|2386356_2387436_+|plate	baseplate J/gp47 family protein	plate	A0A0M3LQN4	Mannheimia_phage	44.9	9.1e-74
WP_112039567.1|2387440_2388013_+	DUF2313 domain-containing protein	NA	A0A2H4J9D6	uncultured_Caudovirales_phage	32.6	1.7e-18
WP_161622582.1|2388012_2388816_+|tail	phage tail protein	tail	A0A0U2SAV1	Escherichia_phage	84.9	1.2e-30
WP_161622583.1|2388830_2389355_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	66.7	1.9e-64
WP_161622584.1|2389402_2391106_+|tail	phage tail protein	tail	A0A0U2SH60	Escherichia_phage	42.6	6.7e-47
WP_161622585.1|2391105_2391672_+	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	89.2	1.5e-91
WP_000012553.1|2391784_2392444_+	YjfK family protein	NA	NA	NA	NA	NA
WP_000547760.1|2392461_2392860_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000101649.1|2392869_2393508_+	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_047627504.1|2393510_2394674_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.5	1.7e-81
>prophage 10
NZ_CP041433	Escherichia coli strain STEC313 chromosome, complete genome	5099527	2445000	2501813	5099527	protease,tRNA,integrase,plate,transposase	Enterobacteria_phage(16.67%)	47	2470194:2470209	2499561:2499576
WP_001162164.1|2445000_2446353_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_161620804.1|2446408_2446795_+	cytochrome b562	NA	NA	NA	NA	NA
WP_161620803.1|2446839_2447304_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	58.3	1.9e-52
WP_000187798.1|2447461_2449600_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
WP_016246824.1|2449993_2451649_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_016246825.1|2451698_2453120_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001181324.1|2453238_2454186_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
WP_001387276.1|2454370_2454424_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_016246826.1|2454564_2457261_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	6.9e-46
WP_001130089.1|2457305_2457761_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000047539.1|2457827_2458214_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|2458286_2458748_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013046.1|2458760_2459696_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_001296693.1|2459699_2459834_-	pyr operon leader peptide	NA	NA	NA	NA	NA
WP_000230272.1|2460114_2460510_-	RidA family protein	NA	NA	NA	NA	NA
WP_000500694.1|2460641_2461355_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000256673.1|2461425_2462019_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001315168.1|2462163_2462616_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000036417.1|2462738_2464391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000012907.1|2464462_2465467_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000002953.1|2465628_2466045_+	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_001059394.1|2466090_2466594_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000079656.1|2466786_2467983_+	DUF898 domain-containing protein	NA	NA	NA	NA	NA
WP_000416390.1|2468038_2470894_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.8	2.1e-141
2470194:2470209	attL	GCCACGCCGGTATCGC	NA	NA	NA	NA
WP_000786399.1|2470893_2471337_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_161622587.1|2471470_2472982_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	37.7	2.3e-46
WP_000584114.1|2473248_2474349_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001295681.1|2474348_2475431_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_001376011.1|2475591_2477094_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	2.1e-84
WP_001575402.1|2477223_2478243_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.1	4.2e-44
WP_001218930.1|2478709_2479975_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.0	2.2e-79
WP_097377504.1|2480298_2481798_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_096998512.1|2481949_2482690_-	porin family protein	NA	NA	NA	NA	NA
WP_085429796.1|2483481_2485638_+	ATPase	NA	NA	NA	NA	NA
WP_000117526.1|2485641_2486958_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_161622588.1|2486954_2489153_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_097377507.1|2489589_2490234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097377514.1|2490254_2490524_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000502848.1|2490602_2491241_-	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.5	1.5e-55
WP_097377508.1|2491225_2492458_-	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	33.3	7.7e-61
WP_097377515.1|2492958_2495127_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_021552177.1|2496234_2497599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032157452.1|2497653_2497959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021552179.1|2498025_2498475_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_021552180.1|2498477_2499014_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_097377509.1|2498994_2500095_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
2499561:2499576	attR	GCGATACCGGCGTGGC	NA	NA	NA	NA
WP_021552182.1|2500049_2501813_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 11
NZ_CP041433	Escherichia coli strain STEC313 chromosome, complete genome	5099527	2772667	2781443	5099527	integrase	Escherichia_phage(33.33%)	8	2773403:2773415	2777230:2777242
WP_161622604.1|2772667_2775337_+	toprim domain-containing protein	NA	A0A077K8T2	Ralstonia_phage	44.8	3.6e-220
2773403:2773415	attL	GGCTGGAGAACGG	NA	NA	NA	NA
WP_161622635.1|2775339_2776341_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	55.4	4.6e-104
WP_161622605.1|2777060_2777315_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	46.4	9.4e-14
2777230:2777242	attR	GGCTGGAGAACGG	NA	NA	NA	NA
WP_096936207.1|2777449_2777596_-	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	68.9	6.2e-10
WP_161622606.1|2778411_2778921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000683851.1|2779168_2779705_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_000651599.1|2779745_2780408_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000150637.1|2780516_2781443_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
>prophage 12
NZ_CP041433	Escherichia coli strain STEC313 chromosome, complete genome	5099527	2834774	2896964	5099527	plate,protease,tRNA,transposase	Emiliania_huxleyi_virus(12.5%)	52	NA	NA
WP_001295561.1|2834774_2836127_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|2836156_2838589_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|2838710_2839196_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139279.1|2839199_2840225_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|2840329_2840785_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|2840788_2841577_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139659.1|2841576_2842725_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569430.1|2842721_2843318_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_001294757.1|2843354_2846837_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000055741.1|2846849_2847809_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001021030.1|2847907_2850049_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|2850105_2850495_+	VOC family protein	NA	NA	NA	NA	NA
WP_000176573.1|2850559_2851858_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|2851906_2852167_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|2852153_2852354_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185293.1|2852519_2853065_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635545.1|2853061_2853484_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239192.1|2853497_2854208_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000399648.1|2854457_2855438_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_001346133.1|2855640_2856465_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_047628473.1|2856517_2858236_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094011.1|2858346_2859054_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|2859050_2859455_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874224.1|2859572_2860388_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|2860427_2861081_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|2861073_2862105_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140175.1|2862292_2862868_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997049.1|2868627_2869431_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.1	1.2e-38
WP_000648576.1|2869427_2870342_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|2870582_2871383_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211726.1|2871460_2872231_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|2872278_2873637_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052707.1|2873708_2874464_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001295200.1|2874497_2875220_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|2875216_2875684_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297205.1|2875748_2876480_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_001086142.1|2877015_2877801_+	aminopeptidase	NA	NA	NA	NA	NA
WP_001236649.1|2877937_2878417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908057.1|2878426_2879341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284199.1|2879384_2879867_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000377959.1|2879890_2881243_-	membrane protein	NA	NA	NA	NA	NA
WP_122985795.1|2881253_2884688_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240543.1|2884796_2886212_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088873.1|2886216_2886960_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614335.1|2886956_2889716_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	31.0	2.7e-82
WP_000343293.1|2889724_2890486_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246416.1|2890490_2891822_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080144.1|2891824_2892349_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113722.1|2892345_2893626_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348793.1|2893650_2894733_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393844.1|2894696_2896547_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000611742.1|2896550_2896964_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 13
NZ_CP041433	Escherichia coli strain STEC313 chromosome, complete genome	5099527	3437231	3493158	5099527	lysis,capsid,portal,integrase,tail,terminase,head	Enterobacteria_phage(52.38%)	79	3453118:3453133	3466986:3467001
WP_000533642.1|3437231_3438302_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	100.0	5.1e-202
WP_001303849.1|3438279_3438498_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_001336413.1|3438923_3439076_-	hypothetical protein	NA	Q71T70	Escherichia_phage	73.7	5.1e-07
WP_001336414.1|3439053_3439338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208012.1|3439422_3439998_-	hypothetical protein	NA	K7P7E3	Enterobacteria_phage	96.5	8.3e-58
WP_000582228.1|3440008_3440764_-	hypothetical protein	NA	A0A1R3Y5Q7	Salmonella_virus	92.8	2.5e-142
WP_001289863.1|3440765_3441173_-	ead/Ea22-like family protein	NA	A0A125RPT9	Escherichia_phage	97.0	1.4e-67
WP_000763365.1|3441169_3441391_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	97.3	1.4e-34
WP_001395510.1|3441489_3441771_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	100.0	2.5e-47
WP_000548537.1|3441781_3441973_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_000682313.1|3441945_3442128_-	DUF1317 family protein	NA	A0A0P0ZAS9	Stx2-converting_phage	91.7	2.2e-25
WP_000186804.1|3442124_3442805_-	YqaJ viral recombinase family protein	NA	A0A0N6WET1	Escherichia_phage	98.7	1.3e-131
WP_063074664.1|3442801_3443587_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	2.4e-148
WP_000995420.1|3443592_3443889_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	1.8e-48
WP_000233576.1|3443965_3444172_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000581650.1|3444650_3445163_-	DUF4411 family protein	NA	NA	NA	NA	NA
WP_000741702.1|3445159_3446299_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_001295669.1|3446428_3447121_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	1.5e-109
WP_000184665.1|3447231_3447459_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
WP_001182887.1|3447489_3448029_+	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	67.0	2.6e-61
WP_001361484.1|3448115_3449045_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.8	4.0e-110
WP_001361480.1|3449041_3449743_+	replication P family protein	NA	M1FJ72	Enterobacteria_phage	98.7	1.4e-128
WP_000145946.1|3449739_3450033_+	winged helix-turn-helix transcriptional regulator	NA	A0A0P0ZCJ0	Stx2-converting_phage	84.9	3.7e-38
WP_000371307.1|3450321_3451074_+	DUF4145 domain-containing protein	NA	A0A1S6L018	Salmonella_phage	36.5	3.9e-31
WP_063074663.1|3451330_3451813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072106870.1|3451904_3452006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001050829.1|3452002_3452458_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	5.4e-60
WP_000224916.1|3452457_3452628_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	1.5e-12
WP_000774490.1|3452620_3452911_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	2.5e-47
WP_001099516.1|3452907_3453270_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	94.0	2.3e-58
3453118:3453133	attL	CTGGATAATCTGCAAA	NA	NA	NA	NA
WP_001586249.1|3453266_3453407_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	5.5e-08
WP_001204791.1|3453492_3453876_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000737266.1|3454065_3455163_-	porin	NA	Q1MVN1	Enterobacteria_phage	76.5	2.2e-155
WP_000839596.1|3455751_3455967_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135297.1|3455966_3456464_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.6	3.2e-90
WP_000092234.1|3456460_3456898_+|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	94.5	3.0e-68
WP_001028465.1|3457103_3457625_+	DNA-binding protein	NA	K7P7K9	Enterobacteria_phage	100.0	1.5e-93
WP_000079508.1|3457974_3458385_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_000105084.1|3458441_3458675_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	94.4	7.3e-21
WP_000453580.1|3459063_3459609_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	100.0	2.8e-95
WP_161620775.1|3459583_3461509_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_000198149.1|3461505_3461712_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_063074607.1|3461708_3462590_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	97.8	4.0e-160
WP_000963723.1|3462738_3463980_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	42.9	9.1e-94
WP_029488835.1|3463981_3464239_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_063074606.1|3464295_3464874_+	antirepressor protein	NA	A0A1W6JPH8	Morganella_phage	62.3	7.8e-56
WP_000179580.1|3465207_3465513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001390072.1|3465703_3465901_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000920679.1|3465893_3466079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001156310.1|3466078_3466270_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	59.3	1.1e-11
WP_001091146.1|3466270_3466492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000425299.1|3466509_3466809_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000761841.1|3466805_3468560_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	40.1	7.8e-91
3466986:3467001	attR	CTGGATAATCTGCAAA	NA	NA	NA	NA
WP_000161636.1|3468907_3469159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126640.1|3469155_3469578_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_063074605.1|3469795_3470836_+|capsid	capsid protein	capsid	C6ZCY2	Enterobacteria_phage	41.9	8.8e-66
WP_000190771.1|3470845_3471187_+|head	head decoration protein	head	NA	NA	NA	NA
WP_001179424.1|3471198_3471582_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000835282.1|3471783_3472326_+|terminase	terminase	terminase	O64316	Escherichia_phage	48.8	3.4e-37
WP_000140265.1|3472337_3472619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024222987.1|3474188_3475508_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	2.0e-232
WP_001299443.1|3475517_3475850_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_000063238.1|3475905_3476931_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.9	4.7e-189
WP_000158875.1|3476972_3477368_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	1.1e-58
WP_000785282.1|3477379_3477733_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
WP_000975081.1|3477744_3478323_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000683129.1|3478319_3478715_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	8.5e-70
WP_001317730.1|3478722_3479463_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	5.2e-129
WP_000479200.1|3479478_3479901_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	85.0	1.4e-59
WP_000459457.1|3479882_3480317_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840291.1|3480309_3482871_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	97.9	0.0e+00
WP_000847379.1|3482867_3483197_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_032218334.1|3483196_3483895_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	4.0e-131
WP_000140717.1|3483900_3484644_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.1e-146
WP_000090917.1|3484580_3485213_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_000515639.1|3485273_3488771_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	97.6	0.0e+00
WP_001233090.1|3488841_3489441_+	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	97.5	8.2e-109
WP_161620774.1|3489505_3492577_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	82.1	2.5e-68
WP_063074595.1|3492576_3493158_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	91.7	8.9e-100
>prophage 14
NZ_CP041433	Escherichia coli strain STEC313 chromosome, complete genome	5099527	3613866	3627402	5099527	protease,capsid,integrase,terminase,head	Enterobacteria_phage(42.86%)	16	3611449:3611463	3616266:3616280
3611449:3611463	attL	CGATGCGCTGGCGCA	NA	NA	NA	NA
WP_097449680.1|3613866_3615105_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	52.2	1.5e-125
WP_001206972.1|3615523_3615733_+	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	67.9	3.7e-16
WP_161620768.1|3615913_3616108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001113144.1|3616863_3617184_+	hypothetical protein	NA	NA	NA	NA	NA
3616266:3616280	attR	TGCGCCAGCGCATCG	NA	NA	NA	NA
WP_001710148.1|3617190_3617490_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_048230479.1|3617486_3619304_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	48.1	1.7e-128
WP_000125504.1|3619591_3619837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126642.1|3619833_3620256_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_089565838.1|3620514_3620721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161622617.1|3620720_3621776_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	45.1	2.2e-72
WP_064986826.1|3621786_3622116_+|head	head decoration protein	head	NA	NA	NA	NA
WP_089636739.1|3622130_3622556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075842411.1|3622853_3623438_+|terminase	terminase small subunit	terminase	K7PJS9	Enterobacteria_phage	53.8	1.6e-48
WP_063118912.1|3623703_3623988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000520781.1|3624774_3625095_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|3625125_3627402_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
>prophage 15
NZ_CP041433	Escherichia coli strain STEC313 chromosome, complete genome	5099527	4305748	4357949	5099527	protease,lysis,portal,tail,terminase,transposase	Enterobacteria_phage(42.86%)	60	NA	NA
WP_047628296.1|4305748_4306330_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	8.6e-103
WP_161620716.1|4306329_4309353_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	80.7	4.7e-67
WP_047628564.1|4309417_4310017_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	95.5	5.0e-106
WP_161620717.1|4310084_4313564_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.4	0.0e+00
WP_000090847.1|4313624_4314227_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	1.8e-87
WP_024170790.1|4314163_4314907_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	4.7e-146
WP_001724602.1|4314912_4315611_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	98.7	5.6e-133
WP_000447248.1|4315620_4315950_-|tail	phage tail protein	tail	A0A291AWW9	Escherichia_phage	100.0	1.7e-60
WP_059330973.1|4315949_4319015_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.2	0.0e+00
WP_001161009.1|4318986_4319316_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001297778.1|4319324_4319711_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	99.2	3.6e-65
WP_161622625.1|4319771_4320515_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	99.6	1.1e-131
WP_001079398.1|4320526_4320928_-|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_001711248.1|4320924_4321503_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001283153.1|4321514_4321790_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|4321782_4322106_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001136586.1|4322192_4324220_-|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.4	0.0e+00
WP_000985957.1|4324164_4325673_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.6	2.9e-288
WP_001072975.1|4325672_4325885_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_059330972.1|4325881_4327981_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	99.3	0.0e+00
WP_077871916.1|4327989_4328529_-	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	99.4	5.2e-94
WP_000548593.1|4329078_4329285_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
WP_001443523.1|4329925_4330081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071526745.1|4330228_4330417_-	cold-shock protein	NA	NA	NA	NA	NA
WP_001356335.1|4330427_4330640_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.6e-22
WP_001071776.1|4331003_4331501_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_001092966.1|4331497_4332031_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	8.4e-97
WP_000189918.1|4332027_4332339_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	62.6	5.0e-25
WP_000839562.1|4332343_4332559_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.3e-32
WP_001348108.1|4332810_4333185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000506936.1|4333356_4333785_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_029380182.1|4334151_4334280_-	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	96.4	4.7e-06
WP_000762866.1|4335001_4335823_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.0	1.2e-78
WP_047627813.1|4335819_4336194_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.8	3.2e-34
WP_001695976.1|4336206_4337256_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	2.7e-107
WP_032149942.1|4337257_4337536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980999.1|4337602_4337854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000887491.1|4338070_4338283_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	97.1	1.7e-29
WP_000878218.1|4339444_4340311_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_000169527.1|4340307_4340607_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001151126.1|4341564_4341987_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.0	7.7e-61
WP_001613119.1|4342027_4342993_-	phage replication protein O	NA	U5P0A0	Shigella_phage	61.2	4.5e-56
WP_000705349.1|4342973_4343495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000909905.1|4343478_4343706_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000381212.1|4343786_4344194_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	51.9	7.2e-32
WP_000379589.1|4344362_4344518_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001613120.1|4344519_4345095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|4345581_4345770_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083280.1|4345766_4345958_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_059330971.1|4346051_4348523_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_001296941.1|4348610_4348847_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_001360138.1|4350181_4350292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836057.1|4350349_4351369_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	7.4e-17
WP_001295394.1|4351380_4352595_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|4352800_4353127_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705211.1|4353261_4353603_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|4353637_4354198_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_161620719.1|4354200_4354911_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001307224.1|4355018_4355324_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_059330969.1|4355522_4357949_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	5.9e-214
>prophage 16
NZ_CP041433	Escherichia coli strain STEC313 chromosome, complete genome	5099527	4612122	4704426	5099527	protease,capsid,portal,tRNA,tail,terminase,plate,head,holin	Enterobacteria_phage(33.33%)	104	NA	NA
WP_000984517.1|4612122_4613004_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001315679.1|4613195_4615244_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
WP_000431370.1|4615263_4615962_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001043882.1|4616058_4616556_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_001207283.1|4616685_4617969_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_047082192.1|4617937_4620571_+	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_000057022.1|4620650_4622090_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001295499.1|4622207_4622444_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_000929532.1|4622464_4622740_+	YebW family protein	NA	NA	NA	NA	NA
WP_000976472.1|4623792_4624134_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879282.1|4624146_4625019_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000204699.1|4625022_4625397_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|4625535_4625766_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011658.1|4625867_4626524_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944256.1|4626547_4627210_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_000936951.1|4627206_4629267_-	oligopeptidase B	NA	NA	NA	NA	NA
WP_000024745.1|4629475_4630135_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001295500.1|4630461_4630818_-	protein YebF	NA	NA	NA	NA	NA
WP_000257738.1|4630884_4631175_-	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
WP_000173493.1|4631308_4632487_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_000800512.1|4632542_4633184_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_001687627.1|4633220_4635032_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_000301727.1|4635266_4636742_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
WP_001056694.1|4637079_4637949_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000091176.1|4638076_4639519_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_000448381.1|4639650_4640622_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_001184045.1|4640741_4642064_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_001342995.1|4642079_4643012_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202996.1|4643090_4643846_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_000571479.1|4643842_4644628_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568519.1|4644774_4645785_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|4645793_4646405_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_001386853.1|4646543_4646609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024930.1|4646679_4647282_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|4647283_4647805_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_000907248.1|4647839_4648580_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001443602.1|4648608_4649061_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001258662.1|4649178_4650951_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000891610.1|4651260_4651827_+	hydrolase	NA	NA	NA	NA	NA
WP_161620831.1|4652239_4652803_-	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	89.8	6.0e-93
WP_161622627.1|4652802_4654806_-|tail	phage tail protein	tail	A0A0U2SH60	Escherichia_phage	59.4	1.1e-229
WP_136769135.1|4654830_4655907_-	late control protein	NA	R9TNM7	Vibrio_phage	28.9	1.9e-31
WP_001107807.1|4655897_4656116_-|tail	phage tail protein	tail	R9TR63	Vibrio_phage	52.1	4.9e-11
WP_097450115.1|4656090_4656579_-|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	35.0	2.1e-14
WP_097450116.1|4656581_4658243_-	hypothetical protein	NA	R9TRP8	Vibrio_phage	34.2	2.7e-48
WP_097450117.1|4658360_4658663_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_033813286.1|4658724_4659243_-|tail	tail protein	tail	NA	NA	NA	NA
WP_096095865.1|4659239_4660715_-|tail	phage tail protein	tail	R9TMQ0	Vibrio_phage	38.3	3.3e-74
WP_033813288.1|4660771_4661305_-|tail	tail assembly chaperone	tail	A0A1S6KZY8	Salmonella_phage	47.3	7.0e-35
WP_161622628.1|4661332_4661860_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	77.5	3.4e-74
WP_161620907.1|4661874_4663131_-|tail	phage tail protein	tail	A0A0U2SAV1	Escherichia_phage	96.5	1.1e-126
WP_161622629.1|4663127_4663718_-|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	39.7	9.5e-25
WP_161622637.1|4667193_4668399_-|tail	phage tail protein	tail	A0A0U2SAV1	Escherichia_phage	89.6	2.3e-118
WP_000579232.1|4669912_4670269_-	hypothetical protein	NA	V5YTB2	Pseudomonas_phage	46.8	1.6e-19
WP_000049992.1|4670302_4670926_-|plate	phage baseplate assembly protein V	plate	F1BUP5	Erwinia_phage	29.8	2.4e-10
WP_097450120.1|4670909_4671461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096095872.1|4671472_4672195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032083604.1|4672175_4672577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001372342.1|4672579_4672945_-	DNA breaking-rejoining protein	NA	NA	NA	NA	NA
WP_096934545.1|4672995_4674024_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	58.9	1.3e-109
WP_032083606.1|4674092_4674428_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	54.2	3.3e-22
WP_161620836.1|4674467_4676192_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	53.6	6.9e-100
WP_097450122.1|4676211_4677735_-|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	63.4	5.8e-183
WP_000263126.1|4677779_4677989_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	49.2	1.4e-10
WP_161620813.1|4677992_4679909_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.4	3.3e-252
WP_032083611.1|4679880_4680429_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	98.6	2.6e-69
WP_097450134.1|4682024_4682306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161619109.1|4682376_4682754_-	M15 family metallopeptidase	NA	Q9MBZ3	Enterobacteria_phage	96.0	3.3e-63
WP_161619110.1|4682756_4683032_-|holin	phage holin family protein	holin	Q9MBZ4	Enterobacteria_phage	94.5	2.8e-43
WP_097449971.1|4683021_4683414_-|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	86.9	5.5e-53
WP_097449972.1|4683592_4683865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097449973.1|4683830_4684175_-	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	83.0	2.0e-46
WP_097449974.1|4684179_4684395_-|holin	holin	holin	G9L6J5	Escherichia_phage	97.2	2.2e-32
WP_096129430.1|4684660_4684984_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	99.1	1.7e-60
WP_000738076.1|4685171_4685441_-	Shiga toxin Stx2d subunit B	NA	Q5TJL5	Enterobacteria_phage	97.8	3.0e-42
WP_097449975.1|4685452_4686412_-	Shiga toxin Stx2 subunit A	NA	Q6DWN9	Enterobacteria_phage	96.6	1.8e-169
WP_097449976.1|4686781_4687495_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917767.1|4687631_4687829_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_161620815.1|4688002_4688716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161619112.1|4688970_4689636_-	antiterminator	NA	I6PDF8	Cronobacter_phage	52.9	1.1e-61
WP_136769107.1|4689632_4689992_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.7	1.8e-39
WP_136769108.1|4690004_4690994_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	95.7	4.6e-189
WP_001061438.1|4691001_4691811_-	KilA-N domain-containing protein	NA	A5LH75	Enterobacteria_phage	100.0	8.2e-152
WP_000767141.1|4691830_4692220_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A291AX14	Escherichia_phage	99.2	1.6e-68
WP_000210169.1|4692216_4692543_-	LexA family transcriptional regulator	NA	K7PLX6	Enterobacteria_phage	100.0	9.2e-54
WP_072127929.1|4693191_4693686_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	98.1	3.6e-86
WP_024211007.1|4693682_4694501_-	helix-turn-helix domain-containing protein	NA	A0A291AWW0	Escherichia_phage	99.3	1.8e-122
WP_000620696.1|4694497_4694722_-	hypothetical protein	NA	A5LH70	Enterobacteria_phage	100.0	5.7e-39
WP_136769109.1|4694718_4695870_-	peptidase	NA	K7PLX4	Enterobacteria_phage	96.1	6.9e-205
WP_000515862.1|4695866_4696418_-	hypothetical protein	NA	Q8SBF4	Shigella_phage	99.5	9.9e-101
WP_001191669.1|4696410_4696671_-	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
WP_001345148.1|4696768_4697461_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.1	8.3e-121
WP_000135680.1|4698184_4698547_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_161620816.1|4698612_4699437_+	YfdQ family protein	NA	Q8SBF9	Shigella_phage	99.3	1.7e-149
WP_000008178.1|4699565_4700102_+	5'-deoxynucleotidase	NA	A0A0P0ZCH9	Stx2-converting_phage	99.4	2.2e-100
WP_097455379.1|4700092_4700455_+	hypothetical protein	NA	K7PH61	Enterobacteria_phage	97.5	2.3e-66
WP_000111289.1|4700451_4700655_+	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	98.5	1.0e-31
WP_000476211.1|4700647_4700887_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	98.7	2.2e-36
WP_027661982.1|4700883_4701138_+	hypothetical protein	NA	A0A0U2RK51	Escherichia_phage	97.6	3.3e-43
WP_136769110.1|4701504_4702467_+	DUF551 domain-containing protein	NA	Q8VNQ2	Enterobacteria_phage	94.3	2.1e-69
WP_097455382.1|4702466_4703039_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	97.4	4.3e-107
WP_001093911.1|4703075_4703348_+	hypothetical protein	NA	S5MQM5	Escherichia_phage	100.0	7.2e-44
WP_053878051.1|4703381_4703930_-	hypothetical protein	NA	S5M7T3	Escherichia_phage	86.3	2.0e-77
WP_059242328.1|4703952_4704426_-	SocA family protein	NA	K4NZT7	Burkholderia_phage	31.8	2.4e-18
