The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041431	Escherichia coli strain STEC316 chromosome, complete genome	5246433	584288	647466	5246433	transposase,head,terminase,tail,holin,integrase,plate	Haemophilus_phage(14.63%)	81	588063:588078	614714:614729
WP_000399648.1|584288_585269_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000130380.1|585426_586434_-	luciferase-like monooxygenase	NA	NA	NA	NA	NA
WP_001307410.1|586639_587518_-	U32 family peptidase	NA	NA	NA	NA	NA
WP_001298771.1|587526_588522_-	U32 family peptidase	NA	NA	NA	NA	NA
588063:588078	attL	GTGCCAGTTGTTTCAC	NA	NA	NA	NA
WP_001295552.1|588730_589255_+	SCP2 domain-containing protein	NA	NA	NA	NA	NA
WP_000908554.1|589248_589752_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_000189314.1|589738_590041_-	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	3.9e-14
WP_000449030.1|590091_590535_+	YhbP family protein	NA	NA	NA	NA	NA
WP_000037608.1|590514_591033_-	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	4.4e-10
WP_001298741.1|591160_591796_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_000147622.1|591868_592909_+	permease	NA	NA	NA	NA	NA
WP_000646043.1|593022_593598_-	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_001158034.1|593607_594198_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000246855.1|594217_594613_-	YraN family protein	NA	NA	NA	NA	NA
WP_000249160.1|594570_596607_-	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_000809253.1|596670_597531_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.3	2.1e-49
WP_000817007.1|597573_598665_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001136464.1|598675_601192_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000044768.1|601221_601917_-	molecular chaperone	NA	NA	NA	NA	NA
WP_001045442.1|601996_602581_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001307409.1|602980_603736_-	galactosamine-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000534351.1|603736_604528_-	PTS N-acetylgalactosamine transporter subunit IID	NA	NA	NA	NA	NA
WP_000544489.1|604517_605321_-	PTS N-acetylgalactosamine transporter subunit IIC	NA	NA	NA	NA	NA
WP_000098017.1|605359_605836_-	PTS N-acetylgalactosamine transporter subunit IIB	NA	NA	NA	NA	NA
WP_000022766.1|606002_606863_-	tagatose-bisphosphate aldolase subunit KbaY	NA	NA	NA	NA	NA
WP_001114873.1|606875_608030_-	AgaS family sugar isomerase	NA	NA	NA	NA	NA
WP_001326138.1|608380_609514_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_001395891.1|609510_609900_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_077170503.1|610255_610906_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_000989761.1|611074_611311_+	DNA-binding protein	NA	M1PVU4	Vibrio_phage	57.4	1.8e-14
WP_161620612.1|611310_613353_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	49.4	5.0e-174
WP_100616698.1|613370_614264_+	AAA family ATPase	NA	A0A2D1GNS0	Pseudomonas_phage	56.6	4.4e-90
WP_042966146.1|614278_614503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149857189.1|614518_614770_+	hypothetical protein	NA	NA	NA	NA	NA
614714:614729	attR	GTGAAACAACTGGCAC	NA	NA	NA	NA
WP_161620613.1|614780_614972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161620614.1|614961_615177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129049206.1|615206_615851_+	DUF3164 family protein	NA	Q6QIE4	Burkholderia_phage	69.3	1.7e-75
WP_021564513.1|615852_616086_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021564514.1|616066_616258_+	hypothetical protein	NA	A0A2D1GNV5	Pseudomonas_phage	53.3	3.6e-10
WP_000117574.1|616338_616725_+	hypothetical protein	NA	U5PRY6	Bacillus_phage	47.9	1.1e-21
WP_096123983.1|616789_617335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000564495.1|617473_617692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089640437.1|617780_618491_+	DUF2786 domain-containing protein	NA	NA	NA	NA	NA
WP_001019229.1|618717_618948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032082858.1|618937_619228_+	DUF4752 family protein	NA	A0A088CD82	Shigella_phage	71.3	5.9e-28
WP_072015457.1|619385_619646_+	hypothetical protein	NA	A0A0U2RK51	Escherichia_phage	87.5	1.1e-36
WP_096123984.1|619638_620229_+	ead/Ea22-like family protein	NA	A0A0F6R7P8	Escherichia_coli_O157_typing_phage	58.7	8.3e-53
WP_096123986.1|621003_621318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032082856.1|621289_621703_+	regulatory protein GemA	NA	A0A2D1GNN4	Pseudomonas_phage	62.8	2.4e-38
WP_001192995.1|621798_622266_+	hypothetical protein	NA	A0A2D1GNW5	Pseudomonas_phage	39.6	2.3e-18
WP_086589633.1|622293_622581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001372993.1|622768_623161_+|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	55.7	1.6e-28
WP_000445984.1|623150_623429_+|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	51.1	2.6e-17
WP_032082853.1|623431_623809_+	M15 family metallopeptidase	NA	Q9MBZ3	Enterobacteria_phage	91.1	2.6e-60
WP_032082852.1|623822_624005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000312575.1|624230_624731_+	DUF1804 family protein	NA	A0A0M3VI86	Ralstonia_phage	47.8	4.4e-39
WP_047088853.1|624783_626424_+|terminase	phage terminase large subunit	terminase	B7SDN0	Haemophilus_phage	63.5	1.3e-193
WP_161620615.1|626427_628023_+	DUF935 domain-containing protein	NA	A0A0U5KSI0	unidentified_phage	46.4	4.1e-123
WP_161620616.1|628009_629176_+|head	phage head morphogenesis protein	head	A0A0M4UTA3	Ralstonia_phage	45.7	5.4e-56
WP_059273813.1|629172_629724_+	phage virion morphogenesis protein	NA	A0A0M3LSP9	Mannheimia_phage	30.1	3.1e-09
WP_161620617.1|629933_631049_+	hypothetical protein	NA	A0A0M5N0Q6	Ralstonia_phage	37.9	1.9e-50
WP_161620618.1|631049_631445_+	hypothetical protein	NA	A0A2H4IZH5	uncultured_Caudovirales_phage	38.6	4.9e-17
WP_161620619.1|631455_632364_+|head	head protein	head	A0A2H4J778	uncultured_Caudovirales_phage	59.3	1.3e-100
WP_054577481.1|632367_632700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129049187.1|632703_633132_+	DUF1320 domain-containing protein	NA	A0A1X9SGZ3	Bradyrhizobium_phage	27.8	1.5e-08
WP_072015455.1|633128_633767_+	DUF1834 family protein	NA	NA	NA	NA	NA
WP_032082869.1|633756_633990_+	DUF2635 domain-containing protein	NA	A0A0M3LQM9	Mannheimia_phage	54.2	7.8e-07
WP_032082847.1|633982_635404_+|tail	tail sheath protein	tail	B7SDP8	Haemophilus_phage	44.3	6.5e-96
WP_000023097.1|635416_635791_+	hypothetical protein	NA	F6MIK8	Haemophilus_phage	58.5	1.1e-31
WP_001402716.1|635787_636171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161620620.1|636333_638574_+|tail	tail length tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	37.4	1.8e-84
WP_096100935.1|638573_639923_+	multidrug DMT transporter permease	NA	F6MIL2	Haemophilus_phage	26.7	1.2e-38
WP_161620621.1|639906_641118_+|tail	phage tail protein	tail	A0A2H4J9E6	uncultured_Caudovirales_phage	37.8	2.4e-70
WP_161620622.1|641114_641771_+|plate	phage baseplate assembly protein V	plate	F6MIL4	Haemophilus_phage	47.6	1.6e-41
WP_057698374.1|641824_642175_+	hypothetical protein	NA	A0A2H4JDR8	uncultured_Caudovirales_phage	63.8	2.8e-32
WP_127766870.1|642174_643254_+|plate	baseplate J/gp47 family protein	plate	A0A0M3LQN4	Mannheimia_phage	44.9	1.1e-74
WP_047675597.1|643257_643830_+	DUF2313 domain-containing protein	NA	F6MIL7	Haemophilus_phage	38.6	1.6e-29
WP_161620623.1|643829_644864_+|tail	tail fiber protein	tail	A0A193H2R1	Shigella_phage	58.6	6.5e-37
WP_161620624.1|644863_645439_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	56.1	2.7e-56
WP_161620625.1|645484_646888_+|tail	phage tail protein	tail	A0A0U2JTZ4	Escherichia_phage	85.1	4.9e-120
WP_161620626.1|646887_647466_+	DUF4376 domain-containing protein	NA	A0A0U2RK60	Escherichia_phage	93.2	5.4e-97
>prophage 2
NZ_CP041431	Escherichia coli strain STEC316 chromosome, complete genome	5246433	820922	882130	5246433	transposase,protease,integrase	Pseudomonas_phage(25.0%)	49	849412:849428	856711:856727
WP_001034498.1|820922_825488_+|protease	lipoprotein metalloprotease SslE	protease	NA	NA	NA	NA
WP_000895884.1|825814_826624_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_001298744.1|826689_827100_+	GspS/AspS pilotin family protein	NA	NA	NA	NA	NA
WP_001307390.1|827117_828077_+	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_000498836.1|828106_830167_+	type II secretion system secretin GspD	NA	NA	NA	NA	NA
WP_000249355.1|830166_831660_+	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_001173430.1|831659_832883_+	type II secretion system inner membrane protein GspF	NA	NA	NA	NA	NA
WP_001087289.1|832899_833355_+	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_001115138.1|833358_833922_+	type II secretion system minor pseudopilin GspH	NA	NA	NA	NA	NA
WP_000820125.1|833918_834290_+	type II secretion system minor pseudopilin GspI	NA	NA	NA	NA	NA
WP_001255039.1|834286_834886_+	type II secretion system minor pseudopilin GspJ	NA	NA	NA	NA	NA
WP_000633238.1|834888_835866_+	type II secretion system minor pseudopilin GspK	NA	NA	NA	NA	NA
WP_000094974.1|835862_837041_+	type II secretion system protein GspL	NA	NA	NA	NA	NA
WP_000942798.1|837042_837579_+	type II secretion system protein	NA	NA	NA	NA	NA
WP_001399388.1|840025_840367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000839243.1|840455_840653_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_072713926.1|840664_841153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072713924.1|841149_841527_-	toxin	NA	NA	NA	NA	NA
WP_072713922.1|841573_841948_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_096858933.1|841997_842642_-	antitoxin of toxin-antitoxin stability system	NA	A0A2I6PI07	Pseudomonas_phage	33.6	3.4e-28
WP_000692326.1|842660_842882_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_122996610.1|842944_843421_-	RadC family protein	NA	NA	NA	NA	NA
WP_000206671.1|843436_843922_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.7	6.9e-13
WP_021536653.1|844013_844832_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.0	8.0e-46
WP_096858934.1|845159_848006_-	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_001069764.1|848377_849250_-	GTPase family protein	NA	NA	NA	NA	NA
849412:849428	attL	CTGTGCCAGAAGCGGAC	NA	NA	NA	NA
WP_001700313.1|849690_851007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000170427.1|852230_854045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001375260.1|854583_855684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001305361.1|856082_856685_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E036	Clostridioides_phage	33.3	1.8e-07
WP_000998321.1|856989_859302_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
856711:856727	attR	CTGTGCCAGAAGCGGAC	NA	NA	NA	NA
WP_001493615.1|859298_860234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072714055.1|861044_862220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000804439.1|864186_864789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001347898.1|864882_865089_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001367564.1|865472_866264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072146520.1|867331_867481_+	hemolysin activation protein	NA	NA	NA	NA	NA
WP_000860849.1|867712_868312_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000270955.1|868683_869067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024241614.1|869063_869450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161620631.1|869458_870657_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	56.8	1.7e-97
WP_136769128.1|870677_870971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161620632.1|871721_874031_+	ATPase	NA	NA	NA	NA	NA
WP_000117528.1|874034_875351_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_072714023.1|875347_877546_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_032318120.1|878027_879044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000169527.1|879111_879411_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000878219.1|879407_880274_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_001254932.1|880978_882130_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
>prophage 3
NZ_CP041431	Escherichia coli strain STEC316 chromosome, complete genome	5246433	1172046	1179186	5246433		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|1172046_1172685_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|1172681_1173944_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|1173940_1174849_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001272549.1|1175014_1175812_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	5.9e-70
WP_001141330.1|1175862_1176519_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
WP_001272881.1|1176624_1179186_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.4	3.0e-30
>prophage 4
NZ_CP041431	Escherichia coli strain STEC316 chromosome, complete genome	5246433	1250676	1258144	5246433	transposase,integrase	Escherichia_phage(66.67%)	6	1241560:1241573	1258454:1258467
1241560:1241573	attL	TACCGCCGCAGTCA	NA	NA	NA	NA
WP_161620640.1|1250676_1251543_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_000577254.1|1251694_1253413_+	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	99.8	3.2e-307
WP_000214990.1|1253414_1255163_+	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	99.8	0.0e+00
WP_000448925.1|1255234_1255651_-	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
WP_001341819.1|1255689_1256919_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	100.0	1.5e-234
WP_000162574.1|1257661_1258144_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
1258454:1258467	attR	TGACTGCGGCGGTA	NA	NA	NA	NA
>prophage 5
NZ_CP041431	Escherichia coli strain STEC316 chromosome, complete genome	5246433	1529413	1637759	5246433	head,terminase,tail,tRNA,capsid,holin,integrase	Enterobacteria_phage(35.42%)	107	1548091:1548106	1612329:1612344
WP_001308252.1|1529413_1530418_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	52.6	1.3e-93
WP_161620644.1|1530420_1533090_-	toprim domain-containing protein	NA	A0A077K8T2	Ralstonia_phage	44.9	2.3e-219
WP_161620645.1|1533145_1533439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032082669.1|1533506_1533725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161620646.1|1533721_1533913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161620647.1|1533915_1534104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161620648.1|1534096_1534624_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_161620649.1|1534706_1535759_-|capsid	P2 family phage major capsid protein	capsid	F1BUM2	Cronobacter_phage	43.6	7.8e-54
WP_161620650.1|1535769_1536645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088130912.1|1536719_1536935_-	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	43.1	8.5e-08
WP_088130908.1|1537559_1538822_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.2	1.4e-73
WP_000368131.1|1539150_1540083_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_000776768.1|1540376_1541132_+	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000937840.1|1541313_1542372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001296861.1|1542737_1544078_-	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000030901.1|1544449_1544734_+	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_000531953.1|1544913_1546224_+	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_000426155.1|1546223_1548365_+	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
1548091:1548106	attL	TGATGTTGATGCTGAA	NA	NA	NA	NA
WP_001195819.1|1548570_1549056_+	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000033328.1|1549739_1550303_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001352731.1|1550384_1553030_+	fimbrial usher protein YfcU	NA	NA	NA	NA	NA
WP_000482748.1|1553049_1553802_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000018471.1|1553817_1554327_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000714140.1|1554323_1554812_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000844745.1|1554808_1555348_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000698675.1|1555349_1556204_+	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_047627722.1|1556276_1556828_-	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001298774.1|1556993_1557926_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000918470.1|1557960_1559046_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
WP_001043812.1|1559049_1559874_+	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_000447361.1|1559873_1560683_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_001089235.1|1560682_1561231_+	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000559764.1|1561264_1561543_+	YfcL family protein	NA	NA	NA	NA	NA
WP_000683799.1|1561663_1563670_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000817178.1|1563828_1565049_+	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000127756.1|1565341_1566520_+	MFS transporter	NA	NA	NA	NA	NA
WP_000615813.1|1566516_1567512_-	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_161620286.1|1567831_1568572_+	DUF4875 domain-containing protein	NA	NA	NA	NA	NA
WP_000078916.1|1568764_1568905_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_074500808.1|1569734_1571432_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	40.8	1.6e-109
WP_000192894.1|1571428_1572004_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	44.0	8.7e-31
WP_161620651.1|1572264_1572540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161620410.1|1572685_1573258_-	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	76.1	2.7e-77
WP_161620288.1|1574559_1575114_-|tail	tail fiber assembly protein	tail	Q8W612	Enterobacteria_phage	89.4	3.9e-89
WP_161620289.1|1575116_1576772_-|tail	phage tail protein	tail	Q8W613	Enterobacteria_phage	84.7	1.3e-116
WP_000775221.1|1576768_1577404_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	54.8	1.1e-50
WP_161620652.1|1577400_1578459_-	hypothetical protein	NA	F1BUK6	Cronobacter_phage	53.4	6.8e-114
WP_074500815.1|1578451_1578802_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	66.3	1.5e-25
WP_074500817.1|1578791_1580888_-|tail	phage tail tape measure protein	tail	A0A2I7RNI7	Vibrio_phage	37.8	7.1e-107
WP_000998379.1|1581075_1581363_-	hypothetical protein	NA	A5X9I7	Aeromonas_virus	47.6	7.4e-15
WP_000777017.1|1581433_1581775_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	78.2	1.9e-41
WP_001155241.1|1581884_1582181_-|holin	holin	holin	C7BGD7	Burkholderia_phage	44.7	2.6e-15
WP_074500818.1|1582184_1582640_-	DUF2597 family protein	NA	A5X9I1	Aeromonas_virus	53.6	2.8e-40
WP_161620653.1|1582636_1583785_-	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	56.3	6.9e-112
WP_074500820.1|1583804_1584518_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	40.5	1.1e-30
WP_161620654.1|1584514_1584988_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_161620655.1|1584997_1585492_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	41.2	2.5e-26
WP_161620656.1|1585591_1586302_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	46.5	1.8e-54
WP_161620657.1|1586319_1587333_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	58.5	6.1e-104
WP_074500855.1|1591308_1591623_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	46.1	2.5e-16
WP_074500828.1|1591691_1592051_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_000104418.1|1592062_1592350_-	hypothetical protein	NA	A5LH60	Enterobacteria_phage	69.5	1.8e-16
WP_161620658.1|1592364_1592679_-	peptide transporter	NA	A0A0A7NPT5	Enterobacteria_phage	53.8	1.4e-19
WP_161620659.1|1592683_1593643_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.7	3.4e-181
WP_161620660.1|1593719_1596542_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.0	0.0e+00
WP_073849656.1|1596548_1596914_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	5.1e-61
WP_023140813.1|1597585_1598416_-	SPFH/Band 7/PHB domain protein	NA	A0A0A7NPW9	Enterobacteria_phage	99.6	3.3e-132
WP_074500837.1|1598922_1599168_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	91.4	4.5e-37
WP_074500839.1|1599164_1599368_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	92.5	3.7e-29
WP_074500840.1|1599391_1599802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074500842.1|1599895_1600009_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	94.6	1.6e-10
WP_074500844.1|1600005_1600248_-	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	82.5	2.4e-30
WP_074500845.1|1600259_1600547_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	74.7	3.9e-32
WP_161620661.1|1600557_1600908_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	80.2	1.5e-46
WP_161620662.1|1601047_1601515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161620663.1|1601506_1601860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161620664.1|1602059_1602587_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_161620665.1|1602691_1603033_+	helix-turn-helix transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	51.2	1.0e-15
WP_161620666.1|1603102_1604095_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	56.2	1.3e-103
WP_000850305.1|1604394_1606839_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	5.0e-221
WP_000213098.1|1606849_1607467_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000534645.1|1607468_1608332_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000165876.1|1608367_1608994_-	hydrolase	NA	NA	NA	NA	NA
WP_000109289.1|1609308_1610457_+	MFS transporter	NA	NA	NA	NA	NA
WP_000918506.1|1610666_1612097_+	amino acid permease	NA	NA	NA	NA	NA
WP_047627629.1|1612097_1613006_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
1612329:1612344	attR	TTCAGCATCAACATCA	NA	NA	NA	NA
WP_161620667.1|1613105_1613696_+	NAD(P)H oxidoreductase	NA	NA	NA	NA	NA
WP_000111043.1|1613777_1614518_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_001292822.1|1614709_1616992_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_000642546.1|1617046_1617904_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_001307086.1|1618309_1620070_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_000642849.1|1620199_1620892_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_000057149.1|1621090_1622179_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
WP_000445231.1|1622249_1623533_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_001295345.1|1623701_1624466_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_000125016.1|1624638_1625322_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_000140327.1|1625432_1627106_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000167336.1|1627265_1627550_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_161620668.1|1627756_1630021_+	ComEC family protein	NA	NA	NA	NA	NA
WP_000551270.1|1630057_1631806_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
WP_000570540.1|1631802_1632789_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000056503.1|1632825_1634058_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000350058.1|1634109_1634292_+	protein YcaR	NA	NA	NA	NA	NA
WP_000011590.1|1634288_1635035_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000436922.1|1635188_1636082_+	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000899590.1|1636058_1636838_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_001297198.1|1636973_1637759_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP041431	Escherichia coli strain STEC316 chromosome, complete genome	5246433	1847642	1899925	5246433	head,terminase,portal,tail,tRNA,protease,capsid,holin,integrase,plate	Enterobacteria_phage(44.64%)	71	1846254:1846269	1866786:1866801
1846254:1846269	attL	ATCCACCGCATCACCG	NA	NA	NA	NA
WP_032083071.1|1847642_1848761_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.4	3.5e-84
WP_000003742.1|1848729_1848999_-	excisionase	NA	NA	NA	NA	NA
WP_161620671.1|1849060_1851535_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.0	5.7e-55
WP_001090252.1|1851615_1851819_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_047088393.1|1851815_1852004_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001542791.1|1852687_1852885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001542792.1|1852907_1853126_-	phage protein	NA	NA	NA	NA	NA
WP_077170458.1|1853286_1853442_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	8.8e-07
WP_000103683.1|1853710_1854427_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.4	3.4e-53
WP_000471548.1|1854476_1854689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161620672.1|1854688_1855114_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_097333595.1|1855185_1856256_+	phage replisome organizer	NA	A0A088CD36	Shigella_phage	66.2	2.2e-64
WP_161620673.1|1856298_1856700_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	45.7	6.0e-23
WP_161620674.1|1856696_1856996_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	98.0	4.3e-50
WP_044152396.1|1857042_1857453_+	hypothetical protein	NA	A0A0H4ISY5	Shigella_phage	93.7	1.4e-70
WP_072652764.1|1857388_1857787_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.5e-58
WP_032083143.1|1857837_1858050_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	91.4	2.0e-33
WP_161620675.1|1858082_1858301_+	DUF4014 domain-containing protein	NA	A0A2R2Z311	Escherichia_phage	87.5	1.3e-27
WP_001229296.1|1858302_1858668_+	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	100.0	5.1e-69
WP_161620676.1|1858664_1859522_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	49.0	2.5e-58
WP_161620677.1|1859509_1859773_+	eaa protein	NA	A0A1B0V7L4	Salmonella_phage	94.2	1.4e-39
WP_161620678.1|1860007_1860220_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	98.5	1.5e-25
WP_161620825.1|1860386_1860659_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.8	2.1e-11
WP_161620679.1|1860660_1861707_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	57.9	2.1e-115
WP_161620680.1|1861719_1862079_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	1.1e-39
WP_161620681.1|1862075_1862765_+	antiterminator	NA	I6PDF8	Cronobacter_phage	50.4	2.9e-57
WP_000917767.1|1862976_1863174_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_161620682.1|1863324_1864371_+	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	93.4	1.1e-193
WP_097450102.1|1865263_1865689_+	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	85.8	4.2e-59
WP_000833644.1|1865685_1865838_+	DUF3927 domain-containing protein	NA	A0A0A0YRI9	Escherichia_phage	55.6	2.5e-06
WP_052953717.1|1865925_1866318_+|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	89.2	1.3e-49
WP_032084004.1|1866307_1866583_+|holin	phage holin family protein	holin	Q9MBZ4	Enterobacteria_phage	97.8	9.5e-44
WP_161620683.1|1866585_1866963_+	M15 family metallopeptidase	NA	Q9MBZ3	Enterobacteria_phage	98.4	1.3e-64
1866786:1866801	attR	CGGTGATGCGGTGGAT	NA	NA	NA	NA
WP_100224468.1|1866905_1867115_+	hypothetical protein	NA	Q9MBZ2	Enterobacteria_phage	60.3	4.7e-11
WP_000159741.1|1867095_1867365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000004120.1|1867689_1867986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001140106.1|1868006_1868357_+	HNH endonuclease	NA	Q8W633	Enterobacteria_phage	100.0	1.2e-64
WP_021558836.1|1868505_1868988_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	99.4	3.5e-86
WP_069905840.1|1868987_1870745_+|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.7	0.0e+00
WP_032083405.1|1870756_1870939_+	hypothetical protein	NA	Q8W630	Enterobacteria_phage	93.3	2.5e-24
WP_161620684.1|1870938_1872180_+|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	99.0	1.1e-240
WP_001193625.1|1872157_1872808_+|head,protease	HK97 family phage prohead protease	head,protease	Q8W628	Enterobacteria_phage	100.0	6.0e-121
WP_161620685.1|1872821_1874048_+|capsid	phage major capsid protein	capsid	Q8W627	Enterobacteria_phage	92.8	1.9e-208
WP_000924706.1|1874093_1874417_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8W626	Enterobacteria_phage	100.0	3.3e-56
WP_000702447.1|1874413_1874830_+|head	phage head closure protein	head	Q8HAC9	Salmonella_phage	68.4	7.6e-45
WP_001076770.1|1874795_1875320_+	hypothetical protein	NA	Q8W625	Enterobacteria_phage	99.4	1.6e-95
WP_000779452.1|1875316_1875880_+	hypothetical protein	NA	Q8W624	Enterobacteria_phage	98.4	3.0e-105
WP_021558832.1|1875889_1876063_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	73.2	1.4e-16
WP_021558831.1|1876046_1877543_+|tail	phage tail sheath protein	tail	Q8W623	Enterobacteria_phage	98.8	3.0e-277
WP_001062340.1|1877542_1877899_+	hypothetical protein	NA	Q8W622	Enterobacteria_phage	99.2	5.3e-63
WP_000117144.1|1877898_1878228_+|tail	phage tail assembly protein	tail	Q8W621	Enterobacteria_phage	100.0	7.8e-53
WP_161620686.1|1878312_1880226_+|tail	phage tail tape measure protein	tail	U5P420	Shigella_phage	76.4	1.0e-269
WP_161620687.1|1880241_1881633_+	DNA circularization protein	NA	Q8W619	Enterobacteria_phage	98.1	3.1e-252
WP_001066647.1|1881629_1882685_+|plate	baseplate protein	plate	Q8W618	Enterobacteria_phage	99.4	3.6e-200
WP_001013088.1|1882684_1883218_+|plate	phage baseplate assembly protein	plate	Q8W617	Enterobacteria_phage	99.4	2.4e-96
WP_001542822.1|1883223_1883637_+	hypothetical protein	NA	Q8W616	Enterobacteria_phage	100.0	2.7e-74
WP_000785587.1|1883629_1884712_+|plate	baseplate J/gp47 family protein	plate	Q8W615	Enterobacteria_phage	100.0	2.6e-209
WP_161620688.1|1884711_1885302_+	DUF2313 domain-containing protein	NA	Q8W614	Enterobacteria_phage	98.5	4.9e-114
WP_161620689.1|1885288_1886287_+|tail	phage tail protein	tail	Q8W613	Enterobacteria_phage	97.3	3.1e-185
WP_161620690.1|1886289_1886838_+|tail	tail fiber assembly protein	tail	Q8W612	Enterobacteria_phage	95.1	1.1e-96
WP_161620691.1|1886861_1888865_+|tail	phage tail protein	tail	A0A0U2SH60	Escherichia_phage	60.8	3.4e-247
WP_161620826.1|1888864_1889428_+	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	90.2	2.0e-93
WP_000799406.1|1889663_1890527_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531601.1|1890510_1891647_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
WP_000359463.1|1891896_1893126_+	peptidase T	NA	NA	NA	NA	NA
WP_001295435.1|1893271_1894393_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000735412.1|1894468_1895929_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|1895928_1896600_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|1896767_1898138_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001297479.1|1898141_1898783_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001297484.1|1898818_1899925_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 7
NZ_CP041431	Escherichia coli strain STEC316 chromosome, complete genome	5246433	2004625	2087135	5246433	transposase,head,terminase,portal,tail,capsid,integrase,holin,plate	Enterobacteria_phage(25.3%)	116	2003034:2003073	2087319:2087358
2003034:2003073	attL	AACATGTCAGTGTGGTACATGGATATCGATACCACCGCCA	NA	NA	NA	NA
WP_161620504.1|2004625_2007097_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.0	4.2e-58
WP_032083069.1|2007190_2007382_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_032083068.1|2007378_2007567_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_033813301.1|2008141_2008351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033813300.1|2008351_2008990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001171935.1|2009014_2009221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161620505.1|2009380_2009536_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_064578994.1|2009732_2010221_-	helix-turn-helix domain-containing protein	NA	Q7Y5W5	Haemophilus_phage	47.5	2.4e-13
WP_053289472.1|2010291_2010576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161620506.1|2010559_2010985_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_161620507.1|2011056_2012097_+	phage replisome organizer	NA	A0A0U2RT81	Escherichia_phage	87.6	9.6e-105
WP_161620508.1|2012008_2012551_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	3.4e-85
WP_161620509.1|2012585_2013341_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	84.6	2.3e-108
WP_000034249.1|2013327_2013828_+	ead/Ea22-like family protein	NA	G9L663	Escherichia_phage	65.9	1.2e-36
WP_033558349.1|2013922_2014141_+	DUF4014 domain-containing protein	NA	A0A1I9LJM2	Stx_converting_phage	93.1	2.3e-29
WP_062873881.1|2014142_2014592_+	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	79.4	2.6e-38
WP_096111919.1|2014593_2015223_+	dTDP-6-deoxy-L-hexose 3-O-methyltransferase	NA	A0A1U9AJ59	Stx1_converting_phage	53.4	1.7e-48
WP_000673136.1|2015422_2015713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000018425.1|2016853_2017066_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	2.0e-17
WP_042099681.1|2017698_2017977_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	4.8e-11
WP_064578987.1|2017978_2019028_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.4e-108
WP_062873948.1|2019040_2019415_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	65.5	1.1e-37
WP_077170456.1|2019411_2020233_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.2e-78
WP_000917767.1|2020460_2020658_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_161620692.1|2020808_2021867_+	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	99.1	3.1e-207
WP_161620510.1|2022251_2023211_+	Shiga toxin Stx2 subunit A	NA	Q9MBZ8	Enterobacteria_phage	99.1	2.9e-172
WP_000738063.1|2023223_2023487_+	Shiga toxin Stx2e subunit B	NA	Q9MBZ7	Enterobacteria_phage	100.0	2.9e-42
WP_032083190.1|2023905_2024298_+|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	100.0	7.4e-58
WP_103722894.1|2024675_2025302_-	helix-turn-helix transcriptional regulator	NA	L7P7S1	Pseudomonas_phage	36.9	2.8e-06
WP_077781711.1|2025484_2025754_+	transcriptional regulator	NA	A0A2D1GNH1	Pseudomonas_phage	35.8	1.3e-08
WP_161620693.1|2025763_2027806_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	48.8	3.1e-171
WP_100616698.1|2027823_2028717_+	AAA family ATPase	NA	A0A2D1GNS0	Pseudomonas_phage	56.6	4.4e-90
WP_042966146.1|2028731_2028956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042970505.1|2028971_2029223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000051130.1|2029233_2029425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000279302.1|2029414_2029630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161620694.1|2029659_2030304_+	DUF3164 family protein	NA	A4JWM8	Burkholderia_virus	65.4	4.9e-75
WP_047675512.1|2030305_2030539_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_161620695.1|2030519_2030711_+	hypothetical protein	NA	A0A2D1GNV5	Pseudomonas_phage	55.0	9.5e-11
WP_161620696.1|2030791_2031178_+	hypothetical protein	NA	U5PRY6	Bacillus_phage	47.9	2.4e-21
WP_161620697.1|2031242_2031788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161620698.1|2032064_2032775_+	DUF2786 domain-containing protein	NA	NA	NA	NA	NA
WP_161620699.1|2033001_2033226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089653615.1|2033222_2033411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053896997.1|2033777_2034188_+	hypothetical protein	NA	A0A076G6X8	Escherichia_phage	72.8	1.8e-30
WP_000849710.1|2034229_2034415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063101261.1|2034419_2034671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149857209.1|2034715_2035030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000914512.1|2035001_2035397_+	regulatory protein GemA	NA	A0A2D1GNN4	Pseudomonas_phage	63.8	7.0e-40
WP_000734972.1|2035393_2035732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001192995.1|2035832_2036300_+	hypothetical protein	NA	A0A2D1GNW5	Pseudomonas_phage	39.6	2.3e-18
WP_000186479.1|2036326_2036605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001372993.1|2036787_2037180_+|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	55.7	1.6e-28
WP_000445984.1|2037169_2037448_+|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	51.1	2.6e-17
WP_000014543.1|2037450_2037828_+	M15 family metallopeptidase	NA	Q9MBZ3	Enterobacteria_phage	91.9	2.4e-61
WP_001082043.1|2037841_2038024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000312575.1|2038250_2038751_+	DUF1804 family protein	NA	A0A0M3VI86	Ralstonia_phage	47.8	4.4e-39
WP_001171801.1|2038797_2039538_+	DNA methylase N-4	NA	Q775B4	Bordetella_phage	53.2	4.3e-67
WP_001129150.1|2039539_2041180_+|terminase	phage terminase large subunit	terminase	B7SDN0	Haemophilus_phage	63.3	1.7e-193
WP_149857194.1|2041183_2042779_+	DUF935 family protein	NA	L7P7P3	Pseudomonas_phage	45.9	4.1e-123
WP_149857195.1|2042765_2043932_+|head	phage head morphogenesis protein	head	A0A0M4UTA3	Ralstonia_phage	46.1	1.4e-56
WP_000012999.1|2043928_2044480_+	phage virion morphogenesis protein	NA	A0A0M3LSP9	Mannheimia_phage	30.1	3.1e-09
WP_149857196.1|2044689_2045805_+	hypothetical protein	NA	A0A0M5N0Q6	Ralstonia_phage	40.0	1.9e-50
WP_032300900.1|2045805_2046201_+	hypothetical protein	NA	A0A2H4IZH5	uncultured_Caudovirales_phage	38.6	2.2e-17
WP_021564529.1|2046211_2047120_+	hypothetical protein	NA	A0A2H4J778	uncultured_Caudovirales_phage	59.7	5.6e-101
WP_021564530.1|2047122_2047464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021564531.1|2047467_2047899_+	DUF1320 domain-containing protein	NA	A0A1X9SGZ3	Bradyrhizobium_phage	28.1	4.1e-09
WP_071988111.1|2047895_2048534_+	DUF1834 family protein	NA	NA	NA	NA	NA
WP_032082869.1|2048523_2048757_+	DUF2635 domain-containing protein	NA	A0A0M3LQM9	Mannheimia_phage	54.2	7.8e-07
WP_161620700.1|2048749_2050171_+|tail	phage tail protein	tail	B7SDP8	Haemophilus_phage	44.5	1.2e-97
WP_000023097.1|2050183_2050558_+	hypothetical protein	NA	F6MIK8	Haemophilus_phage	58.5	1.1e-31
WP_089633905.1|2050554_2050938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161620701.1|2051100_2053338_+|tail	tail length tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	39.7	1.6e-93
WP_063848385.1|2053337_2054687_+	multidrug DMT transporter permease	NA	F6MIL2	Haemophilus_phage	26.7	9.1e-39
WP_059239154.1|2054670_2055882_+|tail	phage tail protein	tail	A0A2H4J9E6	uncultured_Caudovirales_phage	37.8	1.8e-70
WP_089616737.1|2055878_2056532_+|plate	phage baseplate assembly protein	plate	F6MIL4	Haemophilus_phage	48.2	3.6e-41
WP_000372931.1|2056585_2056936_+	hypothetical protein	NA	A0A2H4JDR8	uncultured_Caudovirales_phage	63.8	4.8e-32
WP_161620702.1|2056935_2058015_+|plate	baseplate J/gp47 family protein	plate	A0A0M3LQN4	Mannheimia_phage	44.9	1.3e-75
WP_089597594.1|2058018_2058591_+	DUF2313 domain-containing protein	NA	F6MIL7	Haemophilus_phage	38.1	2.3e-28
WP_161620623.1|2058590_2059625_+|tail	tail fiber protein	tail	A0A193H2R1	Shigella_phage	58.6	6.5e-37
WP_161620624.1|2059624_2060200_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	56.1	2.7e-56
WP_161620625.1|2060245_2061649_+|tail	phage tail protein	tail	A0A0U2JTZ4	Escherichia_phage	85.1	4.9e-120
WP_161620626.1|2061648_2062227_+	DUF4376 domain-containing protein	NA	A0A0U2RK60	Escherichia_phage	93.2	5.4e-97
WP_161620828.1|2062269_2062506_+|holin	phage holin family protein	holin	Q9MBZ4	Enterobacteria_phage	98.4	1.1e-29
WP_032084002.1|2062513_2062891_+	M15 family metallopeptidase	NA	Q9MBZ3	Enterobacteria_phage	97.6	1.3e-64
WP_032084003.1|2062961_2063243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001305859.1|2063374_2063488_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	89.2	2.5e-11
WP_161620553.1|2063760_2064057_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	95.9	3.6e-49
WP_158122754.1|2064640_2065189_+|terminase	terminase small subunit	terminase	K7PJS9	Enterobacteria_phage	60.6	3.2e-59
WP_161620703.1|2065139_2067077_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	64.4	1.7e-251
WP_161620512.1|2067080_2067290_+|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	49.2	1.4e-10
WP_161620415.1|2067334_2068858_+|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	63.2	7.6e-183
WP_161620704.1|2068847_2070464_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	54.2	9.7e-104
WP_032083606.1|2070503_2070839_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	54.2	3.3e-22
WP_032083605.1|2070908_2071937_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	59.2	5.8e-110
WP_001372342.1|2071987_2072353_+	DNA breaking-rejoining protein	NA	NA	NA	NA	NA
WP_032083604.1|2072355_2072757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032083603.1|2072737_2073460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001406275.1|2073471_2074023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000049992.1|2074006_2074630_+|plate	phage baseplate assembly protein V	plate	F1BUP5	Erwinia_phage	29.8	2.4e-10
WP_000579231.1|2074663_2075020_+|plate	baseplate assembly protein	plate	V5YTB2	Pseudomonas_phage	46.8	2.8e-19
WP_000235848.1|2074994_2075909_+|plate	baseplate assembly protein	plate	D5LGZ3	Escherichia_phage	44.6	1.4e-62
WP_032083602.1|2075901_2076492_+|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	39.2	1.4e-23
WP_032083601.1|2076488_2077706_+	hypothetical protein	NA	Q8W613	Enterobacteria_phage	99.6	1.5e-136
WP_032083600.1|2077708_2078254_+|tail	tail assembly protein	tail	Q8W612	Enterobacteria_phage	95.0	5.6e-96
WP_000015654.1|2078308_2079784_+|tail	tail protein	tail	R9TMQ0	Vibrio_phage	38.7	2.1e-76
WP_000988219.1|2079780_2080299_+|tail	tail protein	tail	NA	NA	NA	NA
WP_001291421.1|2080358_2080661_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_032083599.1|2080778_2082431_+	hypothetical protein	NA	R9TRP8	Vibrio_phage	33.3	5.0e-47
WP_032083598.1|2082433_2082922_+|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	34.1	4.0e-13
WP_032083597.1|2082896_2083115_+|tail	tail protein	tail	A0A077K8R0	Ralstonia_phage	50.7	1.1e-10
WP_032083596.1|2083105_2084194_+	phage late control protein	NA	R9TNM7	Vibrio_phage	29.2	1.1e-31
WP_161620705.1|2084218_2085691_+	hypothetical protein	NA	Q8W611	Enterobacteria_phage	94.7	8.9e-205
WP_161620829.1|2085690_2086269_+	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	93.0	7.7e-96
WP_161620706.1|2086305_2086863_-	Rha family transcriptional regulator	NA	Q8H9L9	Vibrio_phage	62.9	3.5e-29
WP_001296031.1|2086859_2087135_-	hypothetical protein	NA	S5MQL6	Escherichia_phage	52.9	1.1e-10
2087319:2087358	attR	AACATGTCAGTGTGGTACATGGATATCGATACCACCGCCA	NA	NA	NA	NA
>prophage 8
NZ_CP041431	Escherichia coli strain STEC316 chromosome, complete genome	5246433	2394071	2445012	5246433	terminase,portal,tail,protease,lysis	Enterobacteria_phage(43.9%)	60	NA	NA
WP_047628296.1|2394071_2394653_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	8.6e-103
WP_161620716.1|2394652_2397676_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	80.7	4.7e-67
WP_047628564.1|2397740_2398340_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	95.5	5.0e-106
WP_161620717.1|2398407_2401887_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.4	0.0e+00
WP_000090847.1|2401947_2402550_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	1.8e-87
WP_024170790.1|2402486_2403230_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	4.7e-146
WP_001724602.1|2403235_2403934_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	98.7	5.6e-133
WP_000447248.1|2403943_2404273_-|tail	phage tail protein	tail	A0A291AWW9	Escherichia_phage	100.0	1.7e-60
WP_059330973.1|2404272_2407338_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.2	0.0e+00
WP_001161009.1|2407309_2407639_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001297778.1|2407647_2408034_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	99.2	3.6e-65
WP_000211109.1|2408094_2408838_-|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	100.0	7.8e-133
WP_001079398.1|2408849_2409251_-|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_001711248.1|2409247_2409826_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001283153.1|2409837_2410113_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|2410105_2410429_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001136586.1|2410515_2412543_-|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.4	0.0e+00
WP_000985957.1|2412487_2413996_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.6	2.9e-288
WP_001072975.1|2413995_2414208_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_161620718.1|2414204_2416304_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	99.1	0.0e+00
WP_077871916.1|2416312_2416852_-	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	99.4	5.2e-94
WP_000548593.1|2417401_2417608_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
WP_001019207.1|2417903_2418077_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001443523.1|2418249_2418405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071526745.1|2418552_2418741_-	cold-shock protein	NA	NA	NA	NA	NA
WP_001356335.1|2418751_2418964_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.6e-22
WP_001071776.1|2419327_2419825_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_001092966.1|2419821_2420355_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	8.4e-97
WP_000189918.1|2420351_2420663_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	62.6	5.0e-25
WP_000839562.1|2420667_2420883_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.3e-32
WP_001348108.1|2421134_2421509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000506936.1|2421680_2422109_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_029380182.1|2422475_2422604_-	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	96.4	4.7e-06
WP_000762866.1|2423325_2424147_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.0	1.2e-78
WP_047627813.1|2424143_2424518_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.8	3.2e-34
WP_001695976.1|2424530_2425580_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	2.7e-107
WP_032149942.1|2425581_2425860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980999.1|2425926_2426178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000887491.1|2426394_2426607_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	97.1	1.7e-29
WP_000354584.1|2426822_2428310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001151126.1|2428627_2429050_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.0	7.7e-61
WP_001613119.1|2429090_2430056_-	phage replication protein O	NA	U5P0A0	Shigella_phage	61.2	4.5e-56
WP_000705349.1|2430036_2430558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000909905.1|2430541_2430769_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000381212.1|2430849_2431257_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	51.9	7.2e-32
WP_000379589.1|2431425_2431581_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001613120.1|2431582_2432158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|2432644_2432833_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083280.1|2432829_2433021_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_059330971.1|2433114_2435586_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_001296941.1|2435673_2435910_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_001360138.1|2437244_2437355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836057.1|2437412_2438432_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	7.4e-17
WP_001295394.1|2438443_2439658_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|2439863_2440190_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705211.1|2440324_2440666_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|2440700_2441261_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_161620719.1|2441263_2441974_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001307224.1|2442081_2442387_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_059330969.1|2442585_2445012_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	5.9e-214
>prophage 9
NZ_CP041431	Escherichia coli strain STEC316 chromosome, complete genome	5246433	2699189	2791050	5246433	head,terminase,portal,tail,tRNA,protease,capsid,holin,integrase,plate	Enterobacteria_phage(56.25%)	106	2756747:2756762	2784381:2784396
WP_000984517.1|2699189_2700071_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001315679.1|2700262_2702311_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
WP_000431370.1|2702330_2703029_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001043882.1|2703125_2703623_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_001207283.1|2703752_2705036_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_047082192.1|2705004_2707638_+	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_000057022.1|2707717_2709157_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001295499.1|2709274_2709511_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_000929532.1|2709531_2709807_+	YebW family protein	NA	NA	NA	NA	NA
WP_000812712.1|2709807_2710464_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.7	3.6e-57
WP_000976472.1|2710859_2711201_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879282.1|2711213_2712086_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000204699.1|2712089_2712464_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|2712602_2712833_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011658.1|2712934_2713591_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944256.1|2713614_2714277_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_000936951.1|2714273_2716334_-	oligopeptidase B	NA	NA	NA	NA	NA
WP_000024745.1|2716542_2717202_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001295500.1|2717528_2717885_-	protein YebF	NA	NA	NA	NA	NA
WP_000257738.1|2717951_2718242_-	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
WP_000173493.1|2718375_2719554_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_000800512.1|2719609_2720251_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_001687627.1|2720287_2722099_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_000301727.1|2722333_2723809_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
WP_001056694.1|2724146_2725016_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000091176.1|2725143_2726586_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_000448381.1|2726717_2727689_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_001184045.1|2727808_2729131_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_001342995.1|2729146_2730079_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202996.1|2730157_2730913_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_161620725.1|2730909_2731695_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568519.1|2731841_2732852_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|2732860_2733472_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_001386853.1|2733610_2733676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024930.1|2733746_2734349_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|2734350_2734872_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_000907248.1|2734906_2735647_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001443602.1|2735675_2736128_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_161620726.1|2736245_2738018_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000891610.1|2738327_2738894_+	hydrolase	NA	NA	NA	NA	NA
WP_161620831.1|2739306_2739870_-	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	89.8	6.0e-93
WP_161620727.1|2739869_2741873_-|tail	phage tail protein	tail	A0A0U2SH60	Escherichia_phage	61.6	3.4e-247
WP_097452375.1|2741896_2742427_-|tail	phage tail protein	tail	A0A0U2QV64	Escherichia_phage	99.4	2.4e-96
WP_161620728.1|2742441_2743479_-|tail	phage tail protein	tail	Q8W613	Enterobacteria_phage	82.0	5.9e-155
WP_161620729.1|2743465_2744056_-	DUF2313 domain-containing protein	NA	Q8W614	Enterobacteria_phage	99.0	1.7e-114
WP_000785587.1|2744055_2745138_-|plate	baseplate J/gp47 family protein	plate	Q8W615	Enterobacteria_phage	100.0	2.6e-209
WP_161620730.1|2745130_2745544_-	hypothetical protein	NA	Q8W616	Enterobacteria_phage	99.3	1.3e-73
WP_001013088.1|2745549_2746083_-|plate	phage baseplate assembly protein	plate	Q8W617	Enterobacteria_phage	99.4	2.4e-96
WP_001066647.1|2746082_2747138_-|plate	baseplate protein	plate	Q8W618	Enterobacteria_phage	99.4	3.6e-200
WP_033813297.1|2747134_2748526_-	DNA circularization protein	NA	Q8W619	Enterobacteria_phage	97.2	1.1e-249
WP_032083313.1|2748571_2749054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161620731.1|2749121_2751071_-|tail	phage tail tape measure protein	tail	Q8W620	Enterobacteria_phage	97.4	0.0e+00
WP_000117144.1|2751155_2751485_-|tail	phage tail assembly protein	tail	Q8W621	Enterobacteria_phage	100.0	7.8e-53
WP_001062340.1|2751484_2751841_-	hypothetical protein	NA	Q8W622	Enterobacteria_phage	99.2	5.3e-63
WP_021558831.1|2751840_2753337_-|tail	phage tail sheath protein	tail	Q8W623	Enterobacteria_phage	98.8	3.0e-277
WP_021558832.1|2753320_2753494_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	73.2	1.4e-16
WP_000779452.1|2753503_2754067_-	hypothetical protein	NA	Q8W624	Enterobacteria_phage	98.4	3.0e-105
WP_001076770.1|2754063_2754588_-	hypothetical protein	NA	Q8W625	Enterobacteria_phage	99.4	1.6e-95
WP_000702447.1|2754553_2754970_-|head	phage head closure protein	head	Q8HAC9	Salmonella_phage	68.4	7.6e-45
WP_000924706.1|2754966_2755290_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8W626	Enterobacteria_phage	100.0	3.3e-56
WP_161620732.1|2755336_2756563_-|capsid	phage major capsid protein	capsid	Q8W627	Enterobacteria_phage	92.3	5.7e-197
WP_001193623.1|2756576_2757227_-|head,protease	HK97 family phage prohead protease	head,protease	Q8W628	Enterobacteria_phage	99.5	7.8e-121
2756747:2756762	attL	CCAGCGCATTTTTCAC	NA	NA	NA	NA
WP_094033031.1|2757204_2758446_-|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	94.7	1.2e-231
WP_105459137.1|2758445_2758628_-	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	81.7	6.3e-20
WP_033812955.1|2758639_2760397_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.7	0.0e+00
WP_161620733.1|2760396_2760879_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	98.1	6.7e-85
WP_021558837.1|2761025_2761376_-	HNH endonuclease	NA	Q8W633	Enterobacteria_phage	97.4	4.0e-63
WP_097450134.1|2762221_2762503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161619109.1|2762573_2762951_-	M15 family metallopeptidase	NA	Q9MBZ3	Enterobacteria_phage	96.0	3.3e-63
WP_000950567.1|2762953_2763229_-|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	93.4	9.8e-41
WP_001294582.1|2763218_2763611_-|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	90.0	1.5e-50
WP_000833644.1|2763698_2763851_-	DUF3927 domain-containing protein	NA	A0A0A0YRI9	Escherichia_phage	55.6	2.5e-06
WP_097450102.1|2763847_2764273_-	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	85.8	4.2e-59
WP_161620734.1|2765164_2766211_-	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	93.4	2.5e-193
WP_000917767.1|2766361_2766559_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_161620735.1|2766774_2768004_-	GIY-YIG nuclease family protein	NA	Q9MC01	Enterobacteria_phage	99.8	2.7e-199
WP_015967628.1|2768098_2768479_-	antitermination protein Q	NA	Q8W638	Enterobacteria_phage	100.0	3.4e-68
WP_161620736.1|2768478_2768736_-	hypothetical protein	NA	Q8W639	Enterobacteria_phage	97.5	3.7e-34
WP_161620737.1|2768732_2770124_-	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	96.1	8.0e-256
WP_097449978.1|2770120_2770999_-	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	97.2	1.4e-141
WP_158177474.1|2771009_2771918_-	DNA-binding protein	NA	Q8W642	Enterobacteria_phage	100.0	1.0e-62
WP_000621197.1|2771904_2772138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000336162.1|2772134_2772368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161620738.1|2772360_2773023_-	hypothetical protein	NA	Q8W643	Enterobacteria_phage	67.9	1.1e-74
WP_161620739.1|2773040_2773250_-	restriction alleviation protein, Lar family	NA	NA	NA	NA	NA
WP_050437784.1|2773249_2774110_-	ORF6N domain-containing protein	NA	F1C5A3	Cronobacter_phage	42.2	1.4e-53
WP_064754158.1|2774186_2774486_-	Cro/Cl family transcriptional regulator	NA	A0A1B5FPK9	Escherichia_phage	90.9	1.8e-35
WP_040073090.1|2774619_2775309_+	LexA family transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	88.6	2.8e-116
WP_161620740.1|2775456_2775909_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPB8	Escherichia_phage	71.1	7.2e-41
WP_000660644.1|2776310_2776499_+	hypothetical protein	NA	Q8W652	Enterobacteria_phage	98.4	1.3e-28
WP_033813157.1|2776495_2777077_+	hypothetical protein	NA	Q8W653	Enterobacteria_phage	94.3	1.2e-107
WP_000720012.1|2777438_2778266_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	100.0	4.3e-132
WP_001695578.1|2778306_2778678_+	hypothetical protein	NA	Q8W655	Enterobacteria_phage	98.4	2.9e-64
WP_021558719.1|2778709_2778952_+	DUF4222 domain-containing protein	NA	Q8W656	Enterobacteria_phage	100.0	6.8e-38
WP_033813160.1|2778955_2779102_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	93.8	2.0e-21
WP_000528717.1|2779110_2779347_+	excisionase family protein	NA	Q8W657	Enterobacteria_phage	100.0	9.9e-42
WP_161620741.1|2779402_2780716_+|integrase	site-specific integrase	integrase	Q8W658	Enterobacteria_phage	99.5	3.7e-255
WP_044151905.1|2780697_2781468_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.1e-72
WP_000252980.1|2781520_2781916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019588.1|2781956_2782700_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000564742.1|2782696_2783668_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000176841.1|2783832_2786262_-	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
2784381:2784396	attR	CCAGCGCATTTTTCAC	NA	NA	NA	NA
WP_001214304.1|2786286_2787387_-	cytochrome c	NA	NA	NA	NA	NA
WP_001185741.1|2787774_2788521_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001300190.1|2788534_2789101_-	VOC family protein	NA	NA	NA	NA	NA
WP_001025326.1|2789316_2791050_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
>prophage 10
NZ_CP041431	Escherichia coli strain STEC316 chromosome, complete genome	5246433	2942230	2950395	5246433	transposase	Bodo_saltans_virus(16.67%)	7	NA	NA
WP_001374037.1|2942230_2942842_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A2H4UVM0	Bodo_saltans_virus	29.3	7.8e-14
WP_001679039.1|2942880_2943861_-	LPS O-antigen chain length determinant protein WzzB	NA	NA	NA	NA	NA
WP_001254940.1|2944403_2945555_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.9	1.5e-42
WP_032212789.1|2945603_2946458_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.4	1.2e-68
WP_032083663.1|2946542_2947547_+	NAD-dependent epimerase	NA	A0A2K9L4U8	Tupanvirus	30.4	8.6e-34
WP_001471753.1|2947598_2948765_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.0	7.7e-111
WP_001376067.1|2948988_2950395_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.0	1.2e-36
>prophage 11
NZ_CP041431	Escherichia coli strain STEC316 chromosome, complete genome	5246433	2956283	2962960	5246433		Enterobacteria_phage(57.14%)	7	NA	NA
WP_021558693.1|2956283_2956676_-	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SGE7	Hokovirus	50.0	6.5e-30
WP_001471760.1|2956689_2957238_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	54.7	5.1e-49
WP_001376204.1|2957241_2958120_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	6.6e-107
WP_001376206.1|2958172_2959072_-	dTDP-4-dehydrorhamnose reductase	NA	A0A140G5S3	Enterobacteria_phage	36.2	6.1e-31
WP_001376207.1|2959074_2960157_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.1	3.7e-99
WP_001376208.1|2960496_2961393_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	41.5	4.5e-42
WP_021558692.1|2961568_2962960_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.8	4.8e-19
>prophage 12
NZ_CP041431	Escherichia coli strain STEC316 chromosome, complete genome	5246433	3053733	3063175	5246433		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001300968.1|3053733_3054870_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
WP_001300967.1|3054866_3056867_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.6	0.0e+00
WP_001296231.1|3056991_3057453_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001295430.1|3057493_3057964_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|3058010_3058730_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|3058726_3060412_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|3060633_3061365_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216961.1|3061424_3061532_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|3061512_3062244_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569329.1|3062248_3063175_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
>prophage 13
NZ_CP041431	Escherichia coli strain STEC316 chromosome, complete genome	5246433	3283126	3349205	5246433	head,terminase,tail,tRNA,capsid,protease,integrase,holin	Enterobacteria_phage(38.46%)	72	3325452:3325466	3350867:3350881
WP_001283590.1|3283126_3283939_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289162.1|3283938_3284952_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000004833.1|3285017_3286175_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	7.9e-23
WP_001560988.1|3286333_3287338_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	55.7	3.4e-99
WP_021580164.1|3287434_3287755_-	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	43.6	1.0e-12
WP_000004248.1|3287870_3288158_+	hypothetical protein	NA	A0A0M4RCW1	Salmonella_phage	53.7	6.7e-24
WP_021580165.1|3288169_3288511_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	76.7	2.0e-43
WP_021580166.1|3288521_3288809_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	76.8	1.3e-32
WP_021580167.1|3288819_3289062_+	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	83.8	9.5e-32
WP_161620296.1|3289058_3289172_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	83.8	1.5e-08
WP_161620295.1|3289265_3289676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985718.1|3289699_3289903_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	97.0	1.5e-30
WP_161620763.1|3289899_3290145_+	winged helix-turn-helix domain-containing protein	NA	A0A0A7NV47	Enterobacteria_phage	91.4	1.5e-37
WP_161620294.1|3290141_3290441_+	ead/Ea22-like family protein	NA	A0A0A7NRX6	Enterobacteria_phage	90.9	5.6e-42
WP_161620411.1|3290650_3291187_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_097335711.1|3291196_3291814_+	hypothetical protein	NA	K7PLX4	Enterobacteria_phage	51.1	3.7e-11
WP_000599402.1|3291810_3292176_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	95.9	1.9e-60
WP_161620292.1|3292182_3295005_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	96.9	0.0e+00
WP_074132253.1|3295081_3296041_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.7	7.6e-181
WP_000211287.1|3296045_3296360_+	peptide transporter	NA	A0A0A7NPT5	Enterobacteria_phage	51.4	2.3e-17
WP_000104418.1|3296374_3296662_+	hypothetical protein	NA	A5LH60	Enterobacteria_phage	69.5	1.8e-16
WP_000974052.1|3296673_3297033_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_001300959.1|3297101_3297416_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	45.1	7.3e-16
WP_161620764.1|3298452_3300240_-|terminase	terminase	terminase	A5X9H3	Aeromonas_virus	55.7	6.1e-192
WP_161620765.1|3300434_3301331_+|capsid	capsid protein	capsid	U3PDG3	Vibrio_phage	41.3	1.5e-37
WP_161620657.1|3301345_3302359_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	58.5	6.1e-104
WP_161620656.1|3302376_3303087_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	46.5	1.8e-54
WP_161620655.1|3303186_3303681_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	41.2	2.5e-26
WP_161620654.1|3303690_3304164_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_074500820.1|3304160_3304874_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	40.5	1.1e-30
WP_161620653.1|3304893_3306042_+	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	56.3	6.9e-112
WP_074500818.1|3306038_3306494_+	DUF2597 family protein	NA	A5X9I1	Aeromonas_virus	53.6	2.8e-40
WP_001155241.1|3306497_3306794_+|holin	holin	holin	C7BGD7	Burkholderia_phage	44.7	2.6e-15
WP_000777017.1|3306903_3307245_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	78.2	1.9e-41
WP_000998379.1|3307315_3307603_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	47.6	7.4e-15
WP_074500817.1|3307790_3309887_+|tail	phage tail tape measure protein	tail	A0A2I7RNI7	Vibrio_phage	37.8	7.1e-107
WP_074500815.1|3309876_3310227_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	66.3	1.5e-25
WP_074500814.1|3310219_3311404_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	61.6	1.2e-138
WP_000775221.1|3311400_3312036_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	54.8	1.1e-50
WP_161620289.1|3312032_3313688_+|tail	phage tail protein	tail	Q8W613	Enterobacteria_phage	84.7	1.3e-116
WP_161620288.1|3313690_3314245_+|tail	tail fiber assembly protein	tail	Q8W612	Enterobacteria_phage	89.4	3.9e-89
WP_161620833.1|3315543_3316116_+	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	79.3	1.7e-79
WP_161620651.1|3316261_3316537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000192894.1|3316797_3317373_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	44.0	8.7e-31
WP_161620766.1|3317369_3319067_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	40.6	1.8e-108
WP_000078905.1|3319894_3320038_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	87.2	4.0e-14
WP_000886683.1|3320337_3321630_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067767.1|3321720_3323064_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|3323074_3323686_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077018.1|3323840_3327986_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
3325452:3325466	attL	CTGCTGATATTGCGG	NA	NA	NA	NA
WP_000228473.1|3328120_3328615_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|3329159_3330125_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_001043587.1|3330247_3332014_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_001202188.1|3332014_3333736_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	1.9e-20
WP_001241678.1|3333777_3334482_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3334766_3334985_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|3335669_3337946_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|3337976_3338297_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_063118912.1|3339083_3339368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075842411.1|3339633_3340218_-|terminase	terminase small subunit	terminase	K7PJS9	Enterobacteria_phage	53.8	1.6e-48
WP_089636739.1|3340515_3340941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064986826.1|3340955_3341285_-|head	head decoration protein	head	NA	NA	NA	NA
WP_089565839.1|3341295_3342351_-|capsid	capsid protein	capsid	C6ZCY2	Enterobacteria_phage	45.4	3.4e-73
WP_089565838.1|3342350_3342557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000126642.1|3342815_3343238_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000125504.1|3343234_3343480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048230479.1|3343767_3345585_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	48.1	1.7e-128
WP_001710148.1|3345581_3345881_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_161620767.1|3345887_3346208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161620768.1|3346963_3347158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001206972.1|3347338_3347548_-	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	67.9	3.7e-16
WP_097449680.1|3347966_3349205_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	52.2	1.5e-125
3350867:3350881	attR	CTGCTGATATTGCGG	NA	NA	NA	NA
>prophage 14
NZ_CP041431	Escherichia coli strain STEC316 chromosome, complete genome	5246433	3469913	3525840	5246433	head,terminase,portal,tail,capsid,integrase,lysis	Enterobacteria_phage(52.38%)	79	3501796:3501811	3527548:3527563
WP_063074595.1|3469913_3470495_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	91.7	8.9e-100
WP_161620774.1|3470494_3473566_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	82.1	2.5e-68
WP_001233090.1|3473630_3474230_-	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	97.5	8.2e-109
WP_000515639.1|3474300_3477798_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	97.6	0.0e+00
WP_000090917.1|3477858_3478491_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_000140717.1|3478427_3479171_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.1e-146
WP_032218334.1|3479176_3479875_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	4.0e-131
WP_000847379.1|3479874_3480204_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_000840291.1|3480200_3482762_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	97.9	0.0e+00
WP_000459457.1|3482754_3483189_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479200.1|3483170_3483593_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	85.0	1.4e-59
WP_001317730.1|3483608_3484349_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	5.2e-129
WP_000683129.1|3484356_3484752_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	8.5e-70
WP_000975081.1|3484748_3485327_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000785282.1|3485338_3485692_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
WP_000158875.1|3485703_3486099_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	1.1e-58
WP_000063238.1|3486140_3487166_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.9	4.7e-189
WP_001299443.1|3487221_3487554_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_024222987.1|3487563_3488883_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	2.0e-232
WP_000140265.1|3490452_3490734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000835282.1|3490745_3491288_-|terminase	terminase	terminase	O64316	Escherichia_phage	48.8	3.4e-37
WP_001179424.1|3491489_3491873_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000190771.1|3491884_3492226_-|head	head decoration protein	head	NA	NA	NA	NA
WP_063074605.1|3492235_3493276_-|capsid	capsid protein	capsid	C6ZCY2	Enterobacteria_phage	41.9	8.8e-66
WP_000126640.1|3493493_3493916_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000161636.1|3493912_3494164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000761841.1|3494511_3496266_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	40.1	7.8e-91
WP_000425299.1|3496262_3496562_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001091146.1|3496579_3496801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001156310.1|3496801_3496993_-	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	59.3	1.1e-11
WP_000920679.1|3496992_3497178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001390072.1|3497170_3497368_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000179580.1|3497558_3497864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063074606.1|3498197_3498776_-	antirepressor protein	NA	A0A1W6JPH8	Morganella_phage	62.3	7.8e-56
WP_029488835.1|3498832_3499090_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000963723.1|3499091_3500333_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	42.9	9.1e-94
WP_063074607.1|3500481_3501363_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	97.8	4.0e-160
WP_000198149.1|3501359_3501566_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_161620775.1|3501562_3503488_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
3501796:3501811	attL	GCTCTTCAGCAGTCAG	NA	NA	NA	NA
WP_000453580.1|3503462_3504008_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	100.0	2.8e-95
WP_000105084.1|3504396_3504630_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	94.4	7.3e-21
WP_000079508.1|3504686_3505097_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_001028465.1|3505446_3505968_-	DNA-binding protein	NA	K7P7K9	Enterobacteria_phage	100.0	1.5e-93
WP_000092234.1|3506173_3506611_-|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	94.5	3.0e-68
WP_001135297.1|3506607_3507105_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.6	3.2e-90
WP_000839596.1|3507104_3507320_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737266.1|3507908_3509006_+	porin	NA	Q1MVN1	Enterobacteria_phage	76.5	2.2e-155
WP_001204791.1|3509195_3509579_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_001586249.1|3509664_3509805_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	5.5e-08
WP_001099516.1|3509801_3510164_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	94.0	2.3e-58
WP_000774490.1|3510160_3510451_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	2.5e-47
WP_000224916.1|3510443_3510614_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	1.5e-12
WP_001050829.1|3510613_3511069_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	5.4e-60
WP_072106870.1|3511065_3511167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063074663.1|3511258_3511741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000371307.1|3511997_3512750_-	DUF4145 domain-containing protein	NA	A0A1S6L018	Salmonella_phage	36.5	3.9e-31
WP_000145946.1|3513038_3513332_-	winged helix-turn-helix transcriptional regulator	NA	A0A0P0ZCJ0	Stx2-converting_phage	84.9	3.7e-38
WP_001361480.1|3513328_3514030_-	replication P family protein	NA	M1FJ72	Enterobacteria_phage	98.7	1.4e-128
WP_161620834.1|3514026_3514956_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.8	2.3e-110
WP_001182887.1|3515042_3515582_-	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	67.0	2.6e-61
WP_000184665.1|3515612_3515840_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
WP_001295669.1|3515950_3516643_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	1.5e-109
WP_000741702.1|3516772_3517912_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_000581650.1|3517908_3518421_+	DUF4411 family protein	NA	NA	NA	NA	NA
WP_000233576.1|3518899_3519106_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995420.1|3519182_3519479_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	1.8e-48
WP_063074664.1|3519484_3520270_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	2.4e-148
WP_000186804.1|3520266_3520947_+	YqaJ viral recombinase family protein	NA	A0A0N6WET1	Escherichia_phage	98.7	1.3e-131
WP_000682313.1|3520943_3521126_+	DUF1317 family protein	NA	A0A0P0ZAS9	Stx2-converting_phage	91.7	2.2e-25
WP_000548537.1|3521098_3521290_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_001395510.1|3521300_3521582_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	100.0	2.5e-47
WP_000763365.1|3521680_3521902_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	97.3	1.4e-34
WP_001289863.1|3521898_3522306_+	ead/Ea22-like family protein	NA	A0A125RPT9	Escherichia_phage	97.0	1.4e-67
WP_000582228.1|3522307_3523063_+	hypothetical protein	NA	A0A1R3Y5Q7	Salmonella_virus	92.8	2.5e-142
WP_000208012.1|3523073_3523649_+	hypothetical protein	NA	K7P7E3	Enterobacteria_phage	96.5	8.3e-58
WP_001336414.1|3523733_3524018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001336413.1|3523995_3524148_+	hypothetical protein	NA	Q71T70	Escherichia_phage	73.7	5.1e-07
WP_001303849.1|3524573_3524792_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533642.1|3524769_3525840_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	100.0	5.1e-202
3527548:3527563	attR	GCTCTTCAGCAGTCAG	NA	NA	NA	NA
>prophage 15
NZ_CP041431	Escherichia coli strain STEC316 chromosome, complete genome	5246433	4077601	4139791	5246433	transposase,protease,plate,tRNA	Cronobacter_phage(12.5%)	52	NA	NA
WP_000611742.1|4077601_4078015_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393844.1|4078018_4079869_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348793.1|4079832_4080915_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113722.1|4080939_4082220_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080144.1|4082216_4082741_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246416.1|4082743_4084075_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000343293.1|4084079_4084841_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000614335.1|4084849_4087609_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	31.0	2.7e-82
WP_000088873.1|4087605_4088349_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_001240543.1|4088353_4089769_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_122985795.1|4089877_4093312_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_000377959.1|4093322_4094675_+	membrane protein	NA	NA	NA	NA	NA
WP_001284199.1|4094698_4095181_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000908057.1|4095224_4096139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001236649.1|4096148_4096628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086142.1|4096764_4097550_-	aminopeptidase	NA	NA	NA	NA	NA
WP_161620787.1|4098085_4098817_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_000917883.1|4098881_4099349_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001295200.1|4099345_4100068_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052707.1|4100101_4100857_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|4100928_4102287_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000211726.1|4102334_4103105_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|4103182_4103983_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648576.1|4104223_4105138_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997049.1|4105134_4105938_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.1	1.2e-38
WP_001140175.1|4111697_4112273_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000593994.1|4112460_4113492_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001294600.1|4113484_4114138_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874224.1|4114177_4114993_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202329.1|4115110_4115515_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094011.1|4115511_4116219_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_047628473.1|4116329_4118048_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001346133.1|4118100_4118925_+	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000399648.1|4119127_4120108_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000239192.1|4120357_4121068_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000635545.1|4121081_4121504_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001185293.1|4121500_4122046_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_000417058.1|4122211_4122412_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062312.1|4122398_4122659_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000176573.1|4122707_4124006_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000901098.1|4124070_4124460_-	VOC family protein	NA	NA	NA	NA	NA
WP_001021030.1|4124516_4126658_-	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000055741.1|4126756_4127716_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001294757.1|4127728_4131211_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000569430.1|4131247_4131844_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_000139659.1|4131840_4132989_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000565966.1|4132988_4133777_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|4133780_4134236_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_001139279.1|4134340_4135366_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000758956.1|4135369_4135855_-	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001240896.1|4135976_4138409_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_001295561.1|4138438_4139791_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
>prophage 16
NZ_CP041431	Escherichia coli strain STEC316 chromosome, complete genome	5246433	4446600	4515120	5246433	transposase,protease,integrase,tRNA	Stx2-converting_phage(15.0%)	56	4469014:4469030	4491764:4491780
WP_001547431.1|4446600_4448139_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.0e-299
WP_160391274.1|4448188_4448536_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	99.1	8.2e-61
WP_001171554.1|4448532_4448913_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000271619.1|4449376_4450609_-	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_000878209.1|4450759_4451626_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	1.8e-51
WP_064733652.1|4451622_4451853_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000174035.1|4452088_4453069_+	thymidylate synthase	NA	A0A218MLB7	uncultured_virus	34.2	7.3e-22
WP_000820616.1|4453065_4454010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161620798.1|4454012_4455095_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A075BTZ7	Microcystis_phage	38.6	5.5e-10
WP_000676590.1|4455561_4455825_+	hypothetical protein	NA	A0A1L2CUJ8	Pectobacterium_phage	71.6	1.0e-26
WP_161620799.1|4457249_4460663_+	DEAD/DEAH box helicase family protein	NA	Q6NDX2	Leptospira_phage	26.2	5.0e-17
WP_000627728.1|4460726_4462361_+	N-6 DNA methylase	NA	J7I0U9	Acinetobacter_phage	30.9	2.6e-32
WP_000742120.1|4462357_4463500_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_000778955.1|4463508_4465131_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000499115.1|4465130_4466027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000571844.1|4466648_4467395_+	porin family protein	NA	NA	NA	NA	NA
WP_000228488.1|4467814_4468711_+	WYL domain-containing protein	NA	A0A0R6PH67	Moraxella_phage	27.3	2.1e-31
WP_001207396.1|4468759_4469839_+	hypothetical protein	NA	NA	NA	NA	NA
4469014:4469030	attL	CCTGGCGCGTCTGGAAA	NA	NA	NA	NA
WP_161620800.1|4469885_4471457_+	coiled-coil domain-containing protein 22	NA	NA	NA	NA	NA
WP_000766274.1|4471453_4471720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021552163.1|4472109_4473771_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_021552161.1|4474231_4475524_-	MFS transporter	NA	NA	NA	NA	NA
WP_032082893.1|4476657_4477371_+	porin family protein	NA	NA	NA	NA	NA
WP_021552159.1|4477545_4479045_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_001218930.1|4480145_4481411_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.0	2.2e-79
WP_001575402.1|4481877_4482897_+	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.1	4.2e-44
WP_001376011.1|4483026_4484529_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	2.1e-84
WP_001295681.1|4484689_4485772_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_000584114.1|4485771_4486872_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_000397144.1|4487138_4488650_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000786399.1|4488783_4489227_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000416390.1|4489226_4492082_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.8	2.1e-141
4491764:4491780	attR	CCTGGCGCGTCTGGAAA	NA	NA	NA	NA
WP_000079656.1|4492137_4493334_-	DUF898 domain-containing protein	NA	NA	NA	NA	NA
WP_001059394.1|4493526_4494030_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000002953.1|4494075_4494492_-	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_000012907.1|4494653_4495658_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_161620801.1|4495729_4496053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161620802.1|4496314_4497382_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_001315168.1|4497504_4497957_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000256673.1|4498101_4498695_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000500694.1|4498765_4499479_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000230272.1|4499610_4500006_+	RidA family protein	NA	NA	NA	NA	NA
WP_001296693.1|4500286_4500421_+	pyr operon leader peptide	NA	NA	NA	NA	NA
WP_000013046.1|4500424_4501360_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_000148581.1|4501372_4501834_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000047539.1|4501906_4502293_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_001130089.1|4502359_4502815_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016246826.1|4502859_4505556_-	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	6.9e-46
WP_001387276.1|4505696_4505750_-	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_001181324.1|4505934_4506882_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
WP_016246825.1|4507000_4508422_+	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_016246824.1|4508471_4510127_+	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_000187798.1|4510520_4512659_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
WP_161620803.1|4512816_4513281_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	58.3	1.9e-52
WP_161620804.1|4513325_4513712_-	cytochrome b562	NA	NA	NA	NA	NA
WP_001162164.1|4513767_4515120_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
>prophage 17
NZ_CP041431	Escherichia coli strain STEC316 chromosome, complete genome	5246433	4617988	4666285	5246433	transposase,protease,plate,integrase	Acinetobacter_phage(30.0%)	42	4613777:4613791	4647301:4647315
4613777:4613791	attL	TGCAGGTTGCTGGCG	NA	NA	NA	NA
WP_001218741.1|4617988_4619179_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	53.1	5.8e-122
WP_161620242.1|4619612_4620656_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_123002973.1|4622339_4623848_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	32.0	9.5e-45
WP_112022790.1|4625367_4626609_-	tellurium resistance protein TerF	NA	NA	NA	NA	NA
WP_000301248.1|4627034_4627610_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.1	2.5e-30
WP_000116680.1|4627678_4628257_-	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_161620240.1|4628305_4629346_-	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	1.1e-76
WP_000007449.1|4629368_4629824_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_112022789.1|4629846_4631004_-	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_000254140.1|4631003_4631585_-	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.5	1.7e-13
WP_125282739.1|4631906_4632965_+	carbamoyl-phosphate synthase large chain	NA	NA	NA	NA	NA
WP_001280116.1|4632974_4634117_+	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	7.7e-31
WP_001040060.1|4634109_4634883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047628136.1|4634884_4635964_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.4	2.8e-38
WP_000797372.1|4635963_4636920_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_047628139.1|4636930_4638139_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_001176768.1|4638156_4638624_+	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_161620239.1|4639087_4639726_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_161620238.1|4639748_4640387_+	TerD family protein	NA	NA	NA	NA	NA
WP_001253658.1|4640386_4641025_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_161620237.1|4641109_4642150_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_112022786.1|4642149_4643787_+	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_112022785.1|4643812_4645312_+	kinase	NA	NA	NA	NA	NA
WP_161620236.1|4646403_4647048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096970642.1|4647068_4647347_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
4647301:4647315	attR	CGCCAGCAACCTGCA	NA	NA	NA	NA
WP_112022780.1|4647419_4648058_-	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.5	7.8e-57
WP_000169527.1|4648627_4648927_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_161620806.1|4648923_4649790_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.2	6.7e-51
WP_161620235.1|4650926_4652024_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_161620234.1|4652027_4652735_-	OmpA family protein	NA	NA	NA	NA	NA
WP_047628102.1|4652741_4654394_-	membrane protein	NA	NA	NA	NA	NA
WP_161620233.1|4654746_4655367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161620232.1|4655380_4656745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161620407.1|4656799_4657105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057492790.1|4657171_4657627_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_161620231.1|4657898_4658309_-	DUF2345 domain-containing protein	NA	NA	NA	NA	NA
WP_161620230.1|4658322_4659537_-	DUF3396 domain-containing protein	NA	NA	NA	NA	NA
WP_160527102.1|4659590_4660808_-	DUF3396 domain-containing protein	NA	NA	NA	NA	NA
WP_161620228.1|4660820_4662110_-	VRR-NUC domain-containing protein	NA	NA	NA	NA	NA
WP_161620406.1|4662109_4664632_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_000259061.1|4664636_4665161_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_160527099.1|4665196_4666285_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 18
NZ_CP041431	Escherichia coli strain STEC316 chromosome, complete genome	5246433	4799092	4851331	5246433	head,terminase,portal,tail,tRNA,capsid,integrase,holin,plate	Enterobacteria_phage(37.93%)	71	4793835:4793850	4820659:4820674
4793835:4793850	attL	CACTGCCTGCTGATAA	NA	NA	NA	NA
WP_000918363.1|4799092_4800508_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
WP_000235522.1|4800590_4801574_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000891404.1|4801739_4801982_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000543841.1|4802115_4803153_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332269.1|4803241_4804339_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_001217553.1|4804400_4804649_+	DinI family protein	NA	K7PLW4	Enterobacteria_phage	100.0	1.8e-38
WP_001774846.1|4804756_4805320_-	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	94.1	8.9e-97
WP_161620810.1|4805319_4807023_-|tail	phage tail protein	tail	A0A0U2SH60	Escherichia_phage	44.6	1.1e-54
WP_161619105.1|4807047_4808124_-	late control protein	NA	R9TNM7	Vibrio_phage	29.2	6.6e-32
WP_001107807.1|4808114_4808333_-|tail	phage tail protein	tail	R9TR63	Vibrio_phage	52.1	4.9e-11
WP_161620811.1|4808307_4808796_-|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	34.1	8.2e-14
WP_146313824.1|4808798_4810460_-	hypothetical protein	NA	R9TRP8	Vibrio_phage	33.9	7.8e-48
WP_033813285.1|4810577_4810880_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_033813286.1|4810941_4811460_-|tail	tail protein	tail	NA	NA	NA	NA
WP_096095865.1|4811456_4812932_-|tail	phage tail protein	tail	R9TMQ0	Vibrio_phage	38.3	3.3e-74
WP_033813288.1|4812988_4813522_-|tail	tail assembly chaperone	tail	A0A1S6KZY8	Salmonella_phage	47.3	7.0e-35
WP_033813289.1|4813549_4814077_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	76.3	9.9e-74
WP_161620812.1|4814091_4815348_-|tail	phage tail protein	tail	A0A0U2SAV1	Escherichia_phage	89.6	2.4e-118
WP_042099704.1|4815344_4815935_-|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	39.0	2.1e-24
WP_000235847.1|4815927_4816842_-|plate	baseplate assembly protein	plate	D5LGZ3	Escherichia_phage	43.6	7.5e-61
WP_000579232.1|4816816_4817173_-	hypothetical protein	NA	V5YTB2	Pseudomonas_phage	46.8	1.6e-19
WP_000049992.1|4817206_4817830_-|plate	phage baseplate assembly protein V	plate	F1BUP5	Erwinia_phage	29.8	2.4e-10
WP_097450120.1|4817813_4818365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096095872.1|4818376_4819099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032083604.1|4819079_4819481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001372342.1|4819483_4819849_-	DNA breaking-rejoining protein	NA	NA	NA	NA	NA
WP_096934545.1|4819899_4820928_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	58.9	1.3e-109
4820659:4820674	attR	CACTGCCTGCTGATAA	NA	NA	NA	NA
WP_032083606.1|4820996_4821332_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	54.2	3.3e-22
WP_161620836.1|4821371_4823096_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	53.6	6.9e-100
WP_097450122.1|4823115_4824639_-|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	63.4	5.8e-183
WP_000263126.1|4824683_4824893_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	49.2	1.4e-10
WP_161620813.1|4824896_4826813_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.4	3.3e-252
WP_032083611.1|4826784_4827333_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	98.6	2.6e-69
WP_097450134.1|4828929_4829211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161619109.1|4829281_4829659_-	M15 family metallopeptidase	NA	Q9MBZ3	Enterobacteria_phage	96.0	3.3e-63
WP_161619110.1|4829661_4829937_-|holin	phage holin family protein	holin	Q9MBZ4	Enterobacteria_phage	94.5	2.8e-43
WP_097449971.1|4829926_4830319_-|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	86.9	5.5e-53
WP_097449972.1|4830497_4830770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097449973.1|4830735_4831080_-	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	83.0	2.0e-46
WP_097449974.1|4831084_4831300_-|holin	holin	holin	G9L6J5	Escherichia_phage	97.2	2.2e-32
WP_096129430.1|4831565_4831889_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	99.1	1.7e-60
WP_000738076.1|4832076_4832346_-	Shiga toxin Stx2d subunit B	NA	Q5TJL5	Enterobacteria_phage	97.8	3.0e-42
WP_097449975.1|4832357_4833317_-	Shiga toxin Stx2 subunit A	NA	Q6DWN9	Enterobacteria_phage	96.6	1.8e-169
WP_161620814.1|4833686_4834400_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917767.1|4834536_4834734_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_161620815.1|4834907_4835621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161619112.1|4835875_4836541_-	antiterminator	NA	I6PDF8	Cronobacter_phage	52.9	1.1e-61
WP_136769107.1|4836537_4836897_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.7	1.8e-39
WP_136769108.1|4836909_4837899_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	95.7	4.6e-189
WP_001061438.1|4837906_4838716_-	KilA-N domain-containing protein	NA	A5LH75	Enterobacteria_phage	100.0	8.2e-152
WP_000767141.1|4838735_4839125_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A291AX14	Escherichia_phage	99.2	1.6e-68
WP_000210169.1|4839121_4839448_-	LexA family transcriptional regulator	NA	K7PLX6	Enterobacteria_phage	100.0	9.2e-54
WP_072127929.1|4840096_4840591_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	98.1	3.6e-86
WP_024211007.1|4840587_4841406_-	helix-turn-helix domain-containing protein	NA	A0A291AWW0	Escherichia_phage	99.3	1.8e-122
WP_000620696.1|4841402_4841627_-	hypothetical protein	NA	A5LH70	Enterobacteria_phage	100.0	5.7e-39
WP_136769109.1|4841623_4842775_-	peptidase	NA	K7PLX4	Enterobacteria_phage	96.1	6.9e-205
WP_000515862.1|4842771_4843323_-	hypothetical protein	NA	Q8SBF4	Shigella_phage	99.5	9.9e-101
WP_001191669.1|4843315_4843576_-	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
WP_001345148.1|4843673_4844366_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.1	8.3e-121
WP_000135680.1|4845089_4845452_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_161620816.1|4845517_4846342_+	YfdQ family protein	NA	Q8SBF9	Shigella_phage	99.3	1.7e-149
WP_000008178.1|4846470_4847007_+	5'-deoxynucleotidase	NA	A0A0P0ZCH9	Stx2-converting_phage	99.4	2.2e-100
WP_097455379.1|4846997_4847360_+	hypothetical protein	NA	K7PH61	Enterobacteria_phage	97.5	2.3e-66
WP_000111289.1|4847356_4847560_+	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	98.5	1.0e-31
WP_000476211.1|4847552_4847792_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	98.7	2.2e-36
WP_027661982.1|4847788_4848043_+	hypothetical protein	NA	A0A0U2RK51	Escherichia_phage	97.6	3.3e-43
WP_161620817.1|4848409_4849105_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.3	1.5e-69
WP_097455382.1|4849371_4849944_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	97.4	4.3e-107
WP_001093911.1|4849980_4850253_+	hypothetical protein	NA	S5MQM5	Escherichia_phage	100.0	7.2e-44
WP_053878051.1|4850286_4850835_-	hypothetical protein	NA	S5M7T3	Escherichia_phage	86.3	2.0e-77
WP_059242328.1|4850857_4851331_-	SocA family protein	NA	K4NZT7	Burkholderia_phage	31.8	2.4e-18
>prophage 1
NZ_CP041432	Escherichia coli strain STEC316 plasmid pSTEC316, complete sequence	80029	51874	74623	80029	integrase,transposase,bacteriocin	Macacine_betaherpesvirus(33.33%)	20	51268:51281	57795:57808
51268:51281	attL	CCAGAGGAATATCA	NA	NA	NA	NA
WP_077170529.1|51874_53410_+|bacteriocin	pore-forming bacteriocin colicin B	bacteriocin	NA	NA	NA	NA
WP_032084022.1|53427_53955_-	colicin B immunity protein	NA	NA	NA	NA	NA
WP_032084023.1|54198_55014_+|bacteriocin	lipid II-degrading bacteriocin colicin M	bacteriocin	NA	NA	NA	NA
WP_000864812.1|55063_55417_-	colicin M immunity protein	NA	NA	NA	NA	NA
WP_001164199.1|55589_56372_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	97.3	1.2e-54
WP_000465045.1|56373_56787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032084040.1|59782_60706_+	hypothetical protein	NA	NA	NA	NA	NA
57795:57808	attR	TGATATTCCTCTGG	NA	NA	NA	NA
WP_001105066.1|62057_62339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032084131.1|62444_62720_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_032084130.1|62719_63004_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_160391234.1|63420_64263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143361631.1|64413_64794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112015974.1|64909_65593_-	fimbrial chaperone	NA	NA	NA	NA	NA
WP_161620840.1|65594_68006_-	PefC/AfrB family outer membrane usher protein	NA	NA	NA	NA	NA
WP_096117498.1|68113_68626_-	fimbrial protein	NA	NA	NA	NA	NA
WP_161620442.1|68756_69029_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_096117496.1|69264_70140_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000878218.1|71709_72576_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_000169527.1|72572_72872_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001298859.1|73081_74623_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
