The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041429	Escherichia coli strain STEC367 chromosome, complete genome	5090010	822791	881651	5090010	integrase,plate	Pseudomonas_phage(25.0%)	56	822840:822857	880350:880367
WP_032255449.1|822791_824129_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
822840:822857	attL	CAGCAGTTTCAGCAGCAG	NA	NA	NA	NA
WP_160520330.1|824125_824779_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_160520329.1|824781_826512_+	OmpA family protein	NA	NA	NA	NA	NA
WP_001007315.1|826517_827009_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_161623808.1|827178_829836_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	32.7	6.7e-94
WP_001559822.1|829832_830399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097464634.1|830392_830935_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_160520327.1|830921_833447_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_097464632.1|833443_835126_+	T6SS effector phospholipase Tle1-EAEC	NA	NA	NA	NA	NA
WP_097464631.1|835145_835823_+	T6SS immunity phospholipase A1-binding lipoprotein Tli1-EAEC	NA	NA	NA	NA	NA
WP_016237387.1|835966_836644_+	T6SS immunity phospholipase A1-binding lipoprotein Tli1-EAEC	NA	NA	NA	NA	NA
WP_000033410.1|836675_836942_+	PAAR domain-containing protein	NA	E5E3Y0	Burkholderia_phage	39.0	6.9e-07
WP_097464629.1|836999_838094_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_161622531.1|838086_841476_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_160520325.1|841475_843074_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_160520324.1|843207_844971_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_160520323.1|844925_846026_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_032252205.1|846006_846543_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_160520322.1|846545_846977_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_089643444.1|847133_847535_+	hypothetical protein	NA	A0A0R6PI25	Moraxella_phage	49.2	1.5e-05
WP_160520321.1|847690_848935_+	GIY-YIG nuclease family protein	NA	Q9MC01	Enterobacteria_phage	64.0	1.4e-78
WP_161622632.1|849170_850916_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_160520320.1|851341_852730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061361451.1|853251_855129_+	NTPase KAP	NA	NA	NA	NA	NA
WP_160520319.1|855128_855938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160520318.1|855934_857200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061361446.1|857196_857955_+	hydrolase TatD	NA	NA	NA	NA	NA
WP_161622633.1|858186_859101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089643363.1|859486_860749_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	43.1	9.0e-81
WP_000779482.1|861212_861539_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001143297.1|861535_861799_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_161620404.1|861870_862737_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000839239.1|862821_863019_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000761678.1|863030_863519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854721.1|863515_863893_-	toxin	NA	NA	NA	NA	NA
WP_161620405.1|863982_864351_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000692295.1|864429_864651_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.1e-10
WP_001186742.1|864719_865196_-	RadC family protein	NA	NA	NA	NA	NA
WP_161623809.1|865211_865697_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.4	3.1e-13
WP_161623810.1|865788_866607_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.6	8.0e-46
WP_001608658.1|866704_867016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001608659.1|867035_867326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032276779.1|867354_867774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089581517.1|867894_868575_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_161620214.1|868777_869662_-	GTPase	NA	NA	NA	NA	NA
WP_160513209.1|869775_870738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161620215.1|870794_871598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161620216.1|873696_874428_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_001380331.1|874786_875347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032216528.1|875415_875646_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_161620217.1|875926_876427_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_053272525.1|877237_877471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161620218.1|877523_877715_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001534969.1|878222_878720_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001559829.1|878741_880286_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_109863007.1|880301_881651_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
880350:880367	attR	CAGCAGTTTCAGCAGCAG	NA	NA	NA	NA
>prophage 2
NZ_CP041429	Escherichia coli strain STEC367 chromosome, complete genome	5090010	902925	953044	5090010	protease,integrase,transposase,plate	Acinetobacter_phage(22.22%)	43	895229:895243	956188:956202
895229:895243	attL	ACTCGCCGCTGGCTG	NA	NA	NA	NA
WP_160527098.1|902925_904695_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_160527099.1|904658_905747_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000259061.1|905782_906307_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_161620406.1|906311_908834_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_161620228.1|908833_910123_+	VRR-NUC domain-containing protein	NA	NA	NA	NA	NA
WP_160527102.1|910135_911353_+	DUF3396 domain-containing protein	NA	NA	NA	NA	NA
WP_161620230.1|911406_912621_+	DUF3396 domain-containing protein	NA	NA	NA	NA	NA
WP_161620231.1|912634_913045_+	DUF2345 domain-containing protein	NA	NA	NA	NA	NA
WP_057492790.1|913316_913772_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_161620407.1|913838_914144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161620232.1|914198_915563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161620233.1|915576_916197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047628102.1|916549_918202_+	membrane protein	NA	NA	NA	NA	NA
WP_161620234.1|918208_918916_+	OmpA family protein	NA	NA	NA	NA	NA
WP_161620235.1|918919_920017_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_112022779.1|920407_921640_+	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	32.9	5.4e-62
WP_112022780.1|921624_922263_+	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.5	7.8e-57
WP_096970642.1|922335_922614_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_161620236.1|922634_923279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112022785.1|924370_925870_-	kinase	NA	NA	NA	NA	NA
WP_112022786.1|925895_927533_-	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_161620237.1|927532_928573_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001253658.1|928657_929296_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_161620238.1|929295_929934_-	TerD family protein	NA	NA	NA	NA	NA
WP_161620239.1|929956_930595_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001176768.1|931058_931526_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_047628139.1|931543_932752_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_000797372.1|932762_933719_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_047628136.1|933718_934798_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.4	2.8e-38
WP_001040060.1|934799_935573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001280116.1|935565_936708_-	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	7.7e-31
WP_125282739.1|936717_937776_-	carbamoyl-phosphate synthase large chain	NA	NA	NA	NA	NA
WP_000254140.1|938097_938679_+	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.5	1.7e-13
WP_112022789.1|938678_939836_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_000007449.1|939858_940314_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_161620240.1|940336_941377_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	1.1e-76
WP_000116680.1|941425_942004_+	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_000301248.1|942072_942648_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.1	2.5e-30
WP_112022790.1|943073_944315_+	tellurium resistance protein TerF	NA	NA	NA	NA	NA
WP_000587091.1|945819_945975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001300563.1|946141_947254_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_161620242.1|950376_951420_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_001218741.1|951853_953044_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	53.1	5.8e-122
956188:956202	attR	ACTCGCCGCTGGCTG	NA	NA	NA	NA
>prophage 3
NZ_CP041429	Escherichia coli strain STEC367 chromosome, complete genome	5090010	1229984	1237124	5090010		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|1229984_1230623_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|1230619_1231882_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|1231878_1232787_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001272549.1|1232952_1233750_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	5.9e-70
WP_001141330.1|1233800_1234457_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
WP_161622538.1|1234562_1237124_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.4	1.7e-30
>prophage 4
NZ_CP041429	Escherichia coli strain STEC367 chromosome, complete genome	5090010	1308614	1316082	5090010	integrase,transposase	Escherichia_phage(66.67%)	6	1299498:1299511	1316392:1316405
1299498:1299511	attL	TACCGCCGCAGTCA	NA	NA	NA	NA
WP_161620640.1|1308614_1309481_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_000577254.1|1309632_1311351_+	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	99.8	3.2e-307
WP_000214990.1|1311352_1313101_+	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	99.8	0.0e+00
WP_000448925.1|1313172_1313589_-	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
WP_001341819.1|1313627_1314857_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	100.0	1.5e-234
WP_000162574.1|1315599_1316082_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
1316392:1316405	attR	TGACTGCGGCGGTA	NA	NA	NA	NA
>prophage 5
NZ_CP041429	Escherichia coli strain STEC367 chromosome, complete genome	5090010	1765278	1774275	5090010	integrase	Escherichia_phage(16.67%)	13	1767208:1767221	1774958:1774971
WP_130532855.1|1765278_1765788_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	62.5	3.9e-43
WP_000617445.1|1766119_1766407_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_061892452.1|1766403_1766940_-	ProQ/FinO family protein	NA	Q2A0A1	Sodalis_phage	34.0	2.1e-07
WP_061892451.1|1766976_1767399_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
1767208:1767221	attL	GTGCCTGGCCAGTG	NA	NA	NA	NA
WP_061892450.1|1767395_1767638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077170358.1|1767992_1770137_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	52.2	6.7e-177
WP_077170359.1|1770133_1770448_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000543626.1|1770453_1770681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112015754.1|1770673_1770910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112015760.1|1770899_1771379_-	host cell division inhibitor Icd-like protein	NA	Q8SBF3	Shigella_phage	54.3	1.2e-14
WP_077170361.1|1771577_1771757_+	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	56.9	9.9e-10
WP_024235462.1|1772327_1772534_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_077170363.1|1773033_1774275_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	44.0	2.9e-100
1774958:1774971	attR	GTGCCTGGCCAGTG	NA	NA	NA	NA
>prophage 6
NZ_CP041429	Escherichia coli strain STEC367 chromosome, complete genome	5090010	1849229	1858671	5090010		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569329.1|1849229_1850156_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
WP_000783120.1|1850160_1850892_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216961.1|1850872_1850980_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1851039_1851771_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1851992_1853678_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1853674_1854394_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1854440_1854911_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001296231.1|1854951_1855413_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001300967.1|1855537_1857538_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.6	0.0e+00
WP_001300968.1|1857534_1858671_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
>prophage 7
NZ_CP041429	Escherichia coli strain STEC367 chromosome, complete genome	5090010	1949444	1956121	5090010		Enterobacteria_phage(57.14%)	7	NA	NA
WP_161622559.1|1949444_1950836_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.8	4.8e-19
WP_001376208.1|1951011_1951908_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	41.5	4.5e-42
WP_001376207.1|1952247_1953330_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.1	3.7e-99
WP_001376206.1|1953332_1954232_+	dTDP-4-dehydrorhamnose reductase	NA	A0A140G5S3	Enterobacteria_phage	36.2	6.1e-31
WP_001376204.1|1954284_1955163_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	6.6e-107
WP_001471760.1|1955166_1955715_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	54.7	5.1e-49
WP_021558693.1|1955728_1956121_+	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SGE7	Hokovirus	50.0	6.5e-30
>prophage 8
NZ_CP041429	Escherichia coli strain STEC367 chromosome, complete genome	5090010	1962009	1970174	5090010	transposase	Ostreococcus_lucimarinus_virus(16.67%)	7	NA	NA
WP_001376067.1|1962009_1963416_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.0	1.2e-36
WP_001471753.1|1963639_1964806_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.0	7.7e-111
WP_032083663.1|1964857_1965862_-	NAD-dependent epimerase	NA	A0A2K9L4U8	Tupanvirus	30.4	8.6e-34
WP_032212789.1|1965946_1966801_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.4	1.2e-68
WP_001254940.1|1966849_1968001_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.9	1.5e-42
WP_001679039.1|1968543_1969524_+	LPS O-antigen chain length determinant protein WzzB	NA	NA	NA	NA	NA
WP_001374037.1|1969562_1970174_-	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A2H4UVM0	Bodo_saltans_virus	29.3	7.8e-14
>prophage 9
NZ_CP041429	Escherichia coli strain STEC367 chromosome, complete genome	5090010	2121354	2177965	5090010	terminase,tail,portal,capsid,plate,holin,integrase,head,tRNA	Enterobacteria_phage(55.56%)	72	2128691:2128722	2182146:2182177
WP_001025326.1|2121354_2123088_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
WP_001300190.1|2123303_2123870_+	VOC family protein	NA	NA	NA	NA	NA
WP_001185741.1|2123883_2124630_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001214304.1|2125017_2126118_+	cytochrome c	NA	NA	NA	NA	NA
WP_000176841.1|2126142_2128572_+	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
2128691:2128722	attL	GGCCGGATAAGGCATTCACGCCGCATCCGGCA	NA	NA	NA	NA
WP_000564742.1|2128736_2129708_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000019588.1|2129704_2130448_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000252980.1|2130488_2130884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044151905.1|2130936_2131707_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.1e-72
WP_161620741.1|2131688_2133002_-|integrase	site-specific integrase	integrase	Q8W658	Enterobacteria_phage	99.5	3.7e-255
WP_000528717.1|2133057_2133294_-	excisionase family protein	NA	Q8W657	Enterobacteria_phage	100.0	9.9e-42
WP_033813160.1|2133302_2133449_-	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	93.8	2.0e-21
WP_021558719.1|2133452_2133695_-	DUF4222 domain-containing protein	NA	Q8W656	Enterobacteria_phage	100.0	6.8e-38
WP_097449985.1|2133725_2134097_-	hypothetical protein	NA	Q8W655	Enterobacteria_phage	97.6	1.1e-63
WP_000720012.1|2134137_2134965_-	hypothetical protein	NA	Q8W654	Enterobacteria_phage	100.0	4.3e-132
WP_161622563.1|2135326_2135908_-	hypothetical protein	NA	Q8W653	Enterobacteria_phage	93.8	7.5e-107
WP_097449984.1|2135904_2136093_-	hypothetical protein	NA	Q8W652	Enterobacteria_phage	98.4	1.0e-28
WP_000141090.1|2136289_2136496_-	hypothetical protein	NA	Q8W651	Enterobacteria_phage	100.0	1.1e-31
WP_097449983.1|2136651_2137062_-	helix-turn-helix domain-containing protein	NA	Q8W649	Enterobacteria_phage	88.3	2.1e-31
WP_097449982.1|2137207_2137900_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	47.2	1.0e-49
WP_097449981.1|2138019_2138265_+	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	54.3	1.5e-13
WP_000072550.1|2138346_2138592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161622564.1|2138763_2139471_+	DNA-binding protein	NA	Q8W645	Enterobacteria_phage	91.1	3.9e-118
WP_015967622.1|2139523_2140348_+	hypothetical protein	NA	Q8W644	Enterobacteria_phage	100.0	4.1e-159
WP_161622565.1|2140344_2141007_+	hypothetical protein	NA	Q8W643	Enterobacteria_phage	87.0	3.4e-103
WP_021558728.1|2140999_2141233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021558729.1|2141229_2141454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161622566.1|2141450_2142443_+	replication protein	NA	Q8W642	Enterobacteria_phage	98.2	3.8e-58
WP_097449978.1|2142453_2143332_+	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	97.2	1.4e-141
WP_161622567.1|2143328_2144720_+	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	98.1	7.5e-262
WP_001064805.1|2144716_2144974_+	hypothetical protein	NA	Q8W639	Enterobacteria_phage	98.8	1.3e-34
WP_015967628.1|2144973_2145354_+	antitermination protein Q	NA	Q8W638	Enterobacteria_phage	100.0	3.4e-68
WP_015967629.1|2145448_2146678_+	GIY-YIG nuclease family protein	NA	Q9MC01	Enterobacteria_phage	100.0	7.2e-200
WP_000917767.1|2146893_2147091_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_161620734.1|2147241_2148288_+	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	93.4	2.5e-193
WP_097450102.1|2149179_2149605_+	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	85.8	4.2e-59
WP_000833644.1|2149601_2149754_+	DUF3927 domain-containing protein	NA	A0A0A0YRI9	Escherichia_phage	55.6	2.5e-06
WP_001294582.1|2149841_2150234_+|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	90.0	1.5e-50
WP_000950567.1|2150223_2150499_+|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	93.4	9.8e-41
WP_161619109.1|2150501_2150879_+	M15 family metallopeptidase	NA	Q9MBZ3	Enterobacteria_phage	96.0	3.3e-63
WP_161622568.1|2150949_2151231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001233884.1|2151303_2151486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042099690.1|2152000_2152276_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	90.1	2.0e-41
WP_136769139.1|2152745_2153294_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	87.1	1.1e-59
WP_136769138.1|2153265_2155182_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.4	4.3e-252
WP_161622569.1|2155185_2155395_+|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	50.8	2.8e-11
WP_097450122.1|2155439_2156963_+|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	63.4	5.8e-183
WP_161620836.1|2156982_2158707_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	53.6	6.9e-100
WP_032083606.1|2158746_2159082_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	54.2	3.3e-22
WP_096934545.1|2159150_2160179_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	58.9	1.3e-109
WP_001372342.1|2160229_2160595_+	DNA breaking-rejoining protein	NA	NA	NA	NA	NA
WP_032083604.1|2160597_2160999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096095872.1|2160979_2161702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097450120.1|2161713_2162265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000049992.1|2162248_2162872_+|plate	phage baseplate assembly protein V	plate	F1BUP5	Erwinia_phage	29.8	2.4e-10
WP_000579232.1|2162905_2163262_+	hypothetical protein	NA	V5YTB2	Pseudomonas_phage	46.8	1.6e-19
WP_161622629.1|2164145_2164736_+|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	39.7	9.5e-25
WP_161620907.1|2164732_2165989_+|tail	phage tail protein	tail	A0A0U2SAV1	Escherichia_phage	96.5	1.1e-126
WP_161622628.1|2166003_2166531_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	77.5	3.4e-74
WP_033813288.1|2166558_2167092_+|tail	tail assembly chaperone	tail	A0A1S6KZY8	Salmonella_phage	47.3	7.0e-35
WP_096095865.1|2167148_2168624_+|tail	phage tail protein	tail	R9TMQ0	Vibrio_phage	38.3	3.3e-74
WP_033813286.1|2168620_2169139_+|tail	tail protein	tail	NA	NA	NA	NA
WP_033813285.1|2169200_2169503_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_146313824.1|2169620_2171282_+	hypothetical protein	NA	R9TRP8	Vibrio_phage	33.9	7.8e-48
WP_097450115.1|2171284_2171773_+|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	35.0	2.1e-14
WP_001107807.1|2171747_2171966_+|tail	phage tail protein	tail	R9TR63	Vibrio_phage	52.1	4.9e-11
WP_161619105.1|2171956_2173033_+	late control protein	NA	R9TNM7	Vibrio_phage	29.2	6.6e-32
WP_161620810.1|2173057_2174761_+|tail	phage tail protein	tail	A0A0U2SH60	Escherichia_phage	44.6	1.1e-54
WP_001774846.1|2174760_2175324_+	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	94.1	8.9e-97
WP_001217553.1|2175431_2175680_-	DinI family protein	NA	K7PLW4	Enterobacteria_phage	100.0	1.8e-38
WP_000332269.1|2175741_2176839_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_000543841.1|2176927_2177965_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
2182146:2182177	attR	TGCCGGATGCGGCGTGAATGCCTTATCCGGCC	NA	NA	NA	NA
>prophage 10
NZ_CP041429	Escherichia coli strain STEC367 chromosome, complete genome	5090010	2301185	2362571	5090010	protease,terminase,tail,plate,holin,integrase,head,transposase,tRNA	Pseudomonas_phage(16.67%)	78	2298774:2298789	2329401:2329416
2298774:2298789	attL	TACGGTGATAGTTTTC	NA	NA	NA	NA
WP_001294219.1|2301185_2302325_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_001307537.1|2302323_2303871_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_000981977.1|2303842_2304304_+|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_000990312.1|2304322_2305660_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_001122487.1|2305669_2307517_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.4e-60
WP_001280345.1|2307509_2308460_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|2308545_2308854_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460360.1|2308929_2310210_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312488.1|2310295_2311555_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|2311557_2312562_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|2312643_2312841_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|2312944_2314243_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177644.1|2314447_2314873_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076316.1|2314911_2317353_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
WP_001293282.1|2317532_2318264_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000220137.1|2318390_2318792_+	DUF2170 family protein	NA	NA	NA	NA	NA
WP_000511955.1|2318810_2319509_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_103722894.1|2319844_2320471_-	helix-turn-helix transcriptional regulator	NA	L7P7S1	Pseudomonas_phage	36.9	2.8e-06
WP_077781711.1|2320653_2320923_+	transcriptional regulator	NA	A0A2D1GNH1	Pseudomonas_phage	35.8	1.3e-08
WP_161622571.1|2320932_2322975_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	48.7	6.8e-171
WP_100616698.1|2322992_2323886_+	AAA family ATPase	NA	A0A2D1GNS0	Pseudomonas_phage	56.6	4.4e-90
WP_042966146.1|2323900_2324125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042970505.1|2324140_2324392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000051130.1|2324402_2324594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000279302.1|2324583_2324799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161620694.1|2324828_2325473_+	DUF3164 family protein	NA	A4JWM8	Burkholderia_virus	65.4	4.9e-75
WP_047675512.1|2325474_2325708_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_161620695.1|2325688_2325880_+	hypothetical protein	NA	A0A2D1GNV5	Pseudomonas_phage	55.0	9.5e-11
WP_161620696.1|2325960_2326347_+	hypothetical protein	NA	U5PRY6	Bacillus_phage	47.9	2.4e-21
WP_161620697.1|2326411_2326957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161622572.1|2327233_2327944_+	DUF2786 domain-containing protein	NA	NA	NA	NA	NA
WP_161620699.1|2328170_2328395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089653615.1|2328391_2328580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053896997.1|2328946_2329357_+	hypothetical protein	NA	A0A076G6X8	Escherichia_phage	72.8	1.8e-30
WP_000849710.1|2329398_2329584_+	hypothetical protein	NA	NA	NA	NA	NA
2329401:2329416	attR	GAAAACTATCACCGTA	NA	NA	NA	NA
WP_063101261.1|2329588_2329840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149857209.1|2329884_2330199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000914512.1|2330170_2330566_+	regulatory protein GemA	NA	A0A2D1GNN4	Pseudomonas_phage	63.8	7.0e-40
WP_000734972.1|2330562_2330901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161622573.1|2331001_2331469_+	mor transcription activator family protein	NA	A0A2D1GNW5	Pseudomonas_phage	38.8	8.9e-18
WP_000186479.1|2331495_2331774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001372993.1|2331956_2332349_+|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	55.7	1.6e-28
WP_000445984.1|2332338_2332617_+|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	51.1	2.6e-17
WP_000014543.1|2332619_2332997_+	M15 family metallopeptidase	NA	Q9MBZ3	Enterobacteria_phage	91.9	2.4e-61
WP_001082043.1|2333010_2333193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000312574.1|2333419_2333920_+	DUF1804 family protein	NA	A0A0M3VI86	Ralstonia_phage	47.2	4.9e-38
WP_161622574.1|2333966_2334707_+	site-specific DNA-methyltransferase	NA	Q775B4	Bordetella_phage	52.4	4.1e-65
WP_161622575.1|2334708_2336349_+|terminase	phage terminase large subunit	terminase	B7SDN0	Haemophilus_phage	63.3	3.9e-193
WP_161620615.1|2336352_2337948_+	DUF935 domain-containing protein	NA	A0A0U5KSI0	unidentified_phage	46.4	4.1e-123
WP_161620616.1|2337934_2339101_+|head	phage head morphogenesis protein	head	A0A0M4UTA3	Ralstonia_phage	45.7	5.4e-56
WP_059273813.1|2339097_2339649_+	phage virion morphogenesis protein	NA	A0A0M3LSP9	Mannheimia_phage	30.1	3.1e-09
WP_161622576.1|2339858_2340974_+	hypothetical protein	NA	A0A0M5N0Q6	Ralstonia_phage	39.7	7.3e-50
WP_032300900.1|2340974_2341370_+	hypothetical protein	NA	A0A2H4IZH5	uncultured_Caudovirales_phage	38.6	2.2e-17
WP_021564529.1|2341380_2342289_+	hypothetical protein	NA	A0A2H4J778	uncultured_Caudovirales_phage	59.7	5.6e-101
WP_021564530.1|2342291_2342633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021564531.1|2342636_2343068_+	DUF1320 domain-containing protein	NA	A0A1X9SGZ3	Bradyrhizobium_phage	28.1	4.1e-09
WP_149857199.1|2343064_2343718_+	DUF1834 family protein	NA	NA	NA	NA	NA
WP_149857210.1|2343731_2343941_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_149857200.1|2343933_2345355_+|tail	phage tail protein	tail	B7SDP8	Haemophilus_phage	44.5	3.5e-97
WP_073521083.1|2345367_2345742_+|tail	phage tail protein	tail	F6MIK8	Haemophilus_phage	59.3	8.7e-32
WP_105494270.1|2345738_2346122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161622577.1|2346284_2348555_+|tail	tail length tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	37.8	5.6e-89
WP_161622578.1|2348554_2349904_+	multidrug DMT transporter permease	NA	F6MIL2	Haemophilus_phage	25.7	6.5e-37
WP_161622579.1|2349887_2351099_+|tail	phage tail protein	tail	A0A2H4J9E6	uncultured_Caudovirales_phage	38.3	4.8e-71
WP_161622580.1|2351095_2351749_+|plate	phage baseplate assembly protein	plate	F6MIL4	Haemophilus_phage	48.2	1.4e-40
WP_023982056.1|2351802_2352153_+	hypothetical protein	NA	A0A2H4JDR8	uncultured_Caudovirales_phage	63.8	6.2e-32
WP_161622581.1|2352152_2353232_+|plate	baseplate J/gp47 family protein	plate	A0A0M3LQN4	Mannheimia_phage	44.9	9.1e-74
WP_112039567.1|2353236_2353809_+	DUF2313 domain-containing protein	NA	A0A2H4J9D6	uncultured_Caudovirales_phage	32.6	1.7e-18
WP_161622582.1|2353808_2354612_+|tail	phage tail protein	tail	A0A0U2SAV1	Escherichia_phage	84.9	1.2e-30
WP_161622583.1|2354626_2355151_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	66.7	1.9e-64
WP_161622584.1|2355198_2356902_+|tail	phage tail protein	tail	A0A0U2SH60	Escherichia_phage	42.6	6.7e-47
WP_161622585.1|2356901_2357468_+	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	89.2	1.5e-91
WP_000012553.1|2357580_2358240_+	YjfK family protein	NA	NA	NA	NA	NA
WP_000547760.1|2358257_2358656_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000101649.1|2358665_2359304_+	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_047627504.1|2359306_2360470_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.5	1.7e-81
WP_001339483.1|2360553_2362179_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000811566.1|2362295_2362571_-|protease	protease activator YjfN	protease	NA	NA	NA	NA
>prophage 11
NZ_CP041429	Escherichia coli strain STEC367 chromosome, complete genome	5090010	2410796	2467609	5090010	protease,integrase,tRNA,transposase,plate	Enterobacteria_phage(16.67%)	47	2435990:2436005	2465357:2465372
WP_001162164.1|2410796_2412149_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_161620804.1|2412204_2412591_+	cytochrome b562	NA	NA	NA	NA	NA
WP_161620803.1|2412635_2413100_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	58.3	1.9e-52
WP_000187798.1|2413257_2415396_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
WP_016246824.1|2415789_2417445_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_016246825.1|2417494_2418916_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001181324.1|2419034_2419982_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
WP_001387276.1|2420166_2420220_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_016246826.1|2420360_2423057_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	6.9e-46
WP_001130089.1|2423101_2423557_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000047539.1|2423623_2424010_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|2424082_2424544_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013046.1|2424556_2425492_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_001296693.1|2425495_2425630_-	pyr operon leader peptide	NA	NA	NA	NA	NA
WP_000230272.1|2425910_2426306_-	RidA family protein	NA	NA	NA	NA	NA
WP_000500694.1|2426437_2427151_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000256673.1|2427221_2427815_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001315168.1|2427959_2428412_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000036417.1|2428534_2430187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000012907.1|2430258_2431263_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000002953.1|2431424_2431841_+	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_001059394.1|2431886_2432390_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000079656.1|2432582_2433779_+	DUF898 domain-containing protein	NA	NA	NA	NA	NA
WP_000416390.1|2433834_2436690_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.8	2.1e-141
2435990:2436005	attL	GCCACGCCGGTATCGC	NA	NA	NA	NA
WP_000786399.1|2436689_2437133_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|2437266_2438778_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584114.1|2439044_2440145_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001295681.1|2440144_2441227_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_001376011.1|2441387_2442890_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	2.1e-84
WP_001575402.1|2443019_2444039_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.1	4.2e-44
WP_001218930.1|2444505_2445771_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.0	2.2e-79
WP_097377504.1|2446094_2447594_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_096998512.1|2447745_2448486_-	porin family protein	NA	NA	NA	NA	NA
WP_085429796.1|2449277_2451434_+	ATPase	NA	NA	NA	NA	NA
WP_000117526.1|2451437_2452754_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_161622588.1|2452750_2454949_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_097377507.1|2455385_2456030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097377514.1|2456050_2456320_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000502848.1|2456398_2457037_-	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.5	1.5e-55
WP_097377508.1|2457021_2458254_-	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	33.3	7.7e-61
WP_097377515.1|2458754_2460923_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_021552177.1|2462030_2463395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032157452.1|2463449_2463755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021552179.1|2463821_2464271_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_021552180.1|2464273_2464810_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_097377509.1|2464790_2465891_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
2465357:2465372	attR	GCGATACCGGCGTGGC	NA	NA	NA	NA
WP_021552182.1|2465845_2467609_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 12
NZ_CP041429	Escherichia coli strain STEC367 chromosome, complete genome	5090010	2787716	2849908	5090010	protease,plate,transposase,tRNA	Emiliania_huxleyi_virus(12.5%)	51	NA	NA
WP_001295561.1|2787716_2789069_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|2789098_2791531_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|2791652_2792138_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139279.1|2792141_2793167_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|2793271_2793727_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|2793730_2794519_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139659.1|2794518_2795667_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569430.1|2795663_2796260_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_001294757.1|2796296_2799779_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000055741.1|2799791_2800751_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001021030.1|2800849_2802991_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|2803047_2803437_+	VOC family protein	NA	NA	NA	NA	NA
WP_000176573.1|2803501_2804800_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|2804848_2805109_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|2805095_2805296_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185293.1|2805461_2806007_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635545.1|2806003_2806426_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239192.1|2806439_2807150_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000399648.1|2807399_2808380_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_001346133.1|2808582_2809407_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_047628473.1|2809459_2811178_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094011.1|2811288_2811996_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|2811992_2812397_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874224.1|2812514_2813330_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|2813369_2814023_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|2814015_2815047_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140175.1|2815234_2815810_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997049.1|2821570_2822374_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.1	1.2e-38
WP_000648576.1|2822370_2823285_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|2823525_2824326_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211726.1|2824403_2825174_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|2825221_2826580_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052707.1|2826651_2827407_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001295200.1|2827440_2828163_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|2828159_2828627_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297205.1|2828691_2829423_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_001086142.1|2829958_2830744_+	aminopeptidase	NA	NA	NA	NA	NA
WP_000908057.1|2831370_2832285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284199.1|2832328_2832811_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000377959.1|2832834_2834187_-	membrane protein	NA	NA	NA	NA	NA
WP_122985795.1|2834197_2837632_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240543.1|2837740_2839156_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088873.1|2839160_2839904_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614335.1|2839900_2842660_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	31.0	2.7e-82
WP_000343293.1|2842668_2843430_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246416.1|2843434_2844766_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080144.1|2844768_2845293_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113722.1|2845289_2846570_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348793.1|2846594_2847677_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393844.1|2847640_2849491_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000611742.1|2849494_2849908_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 13
NZ_CP041429	Escherichia coli strain STEC367 chromosome, complete genome	5090010	3393239	3449166	5090010	terminase,tail,portal,capsid,integrase,head,lysis	Enterobacteria_phage(52.38%)	79	3409126:3409141	3422994:3423009
WP_000533642.1|3393239_3394310_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	100.0	5.1e-202
WP_001303849.1|3394287_3394506_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_001336413.1|3394931_3395084_-	hypothetical protein	NA	Q71T70	Escherichia_phage	73.7	5.1e-07
WP_001336414.1|3395061_3395346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208012.1|3395430_3396006_-	hypothetical protein	NA	K7P7E3	Enterobacteria_phage	96.5	8.3e-58
WP_000582228.1|3396016_3396772_-	hypothetical protein	NA	A0A1R3Y5Q7	Salmonella_virus	92.8	2.5e-142
WP_001289863.1|3396773_3397181_-	ead/Ea22-like family protein	NA	A0A125RPT9	Escherichia_phage	97.0	1.4e-67
WP_000763365.1|3397177_3397399_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	97.3	1.4e-34
WP_001395510.1|3397497_3397779_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	100.0	2.5e-47
WP_000548537.1|3397789_3397981_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_000682313.1|3397953_3398136_-	DUF1317 family protein	NA	A0A0P0ZAS9	Stx2-converting_phage	91.7	2.2e-25
WP_000186804.1|3398132_3398813_-	YqaJ viral recombinase family protein	NA	A0A0N6WET1	Escherichia_phage	98.7	1.3e-131
WP_063074664.1|3398809_3399595_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	2.4e-148
WP_000995420.1|3399600_3399897_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	1.8e-48
WP_000233576.1|3399973_3400180_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000581650.1|3400658_3401171_-	DUF4411 family protein	NA	NA	NA	NA	NA
WP_000741702.1|3401167_3402307_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_001295669.1|3402436_3403129_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	1.5e-109
WP_000184665.1|3403239_3403467_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
WP_001182887.1|3403497_3404037_+	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	67.0	2.6e-61
WP_001361484.1|3404123_3405053_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.8	4.0e-110
WP_001361480.1|3405049_3405751_+	replication P family protein	NA	M1FJ72	Enterobacteria_phage	98.7	1.4e-128
WP_000145946.1|3405747_3406041_+	winged helix-turn-helix transcriptional regulator	NA	A0A0P0ZCJ0	Stx2-converting_phage	84.9	3.7e-38
WP_000371307.1|3406329_3407082_+	DUF4145 domain-containing protein	NA	A0A1S6L018	Salmonella_phage	36.5	3.9e-31
WP_063074663.1|3407338_3407821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072106870.1|3407912_3408014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001050829.1|3408010_3408466_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	5.4e-60
WP_000224916.1|3408465_3408636_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	1.5e-12
WP_000774490.1|3408628_3408919_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	2.5e-47
WP_001099516.1|3408915_3409278_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	94.0	2.3e-58
3409126:3409141	attL	CTGGATAATCTGCAAA	NA	NA	NA	NA
WP_001586249.1|3409274_3409415_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	5.5e-08
WP_001204791.1|3409500_3409884_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000737266.1|3410073_3411171_-	porin	NA	Q1MVN1	Enterobacteria_phage	76.5	2.2e-155
WP_000839596.1|3411759_3411975_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135297.1|3411974_3412472_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.6	3.2e-90
WP_000092234.1|3412468_3412906_+|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	94.5	3.0e-68
WP_001028465.1|3413111_3413633_+	DNA-binding protein	NA	K7P7K9	Enterobacteria_phage	100.0	1.5e-93
WP_000079508.1|3413982_3414393_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_000105084.1|3414449_3414683_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	94.4	7.3e-21
WP_000453580.1|3415071_3415617_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	100.0	2.8e-95
WP_161620775.1|3415591_3417517_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_000198149.1|3417513_3417720_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_063074607.1|3417716_3418598_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	97.8	4.0e-160
WP_000963723.1|3418746_3419988_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	42.9	9.1e-94
WP_029488835.1|3419989_3420247_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_063074606.1|3420303_3420882_+	antirepressor protein	NA	A0A1W6JPH8	Morganella_phage	62.3	7.8e-56
WP_000179580.1|3421215_3421521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001390072.1|3421711_3421909_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000920679.1|3421901_3422087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001156310.1|3422086_3422278_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	59.3	1.1e-11
WP_001091146.1|3422278_3422500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000425299.1|3422517_3422817_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000761841.1|3422813_3424568_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	40.1	7.8e-91
3422994:3423009	attR	CTGGATAATCTGCAAA	NA	NA	NA	NA
WP_000161636.1|3424915_3425167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126640.1|3425163_3425586_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_063074605.1|3425803_3426844_+|capsid	capsid protein	capsid	C6ZCY2	Enterobacteria_phage	41.9	8.8e-66
WP_000190771.1|3426853_3427195_+|head	head decoration protein	head	NA	NA	NA	NA
WP_001179424.1|3427206_3427590_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000835282.1|3427791_3428334_+|terminase	terminase	terminase	O64316	Escherichia_phage	48.8	3.4e-37
WP_000140265.1|3428345_3428627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024222987.1|3430196_3431516_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	2.0e-232
WP_001299443.1|3431525_3431858_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_000063238.1|3431913_3432939_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.9	4.7e-189
WP_000158875.1|3432980_3433376_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	1.1e-58
WP_000785282.1|3433387_3433741_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
WP_000975081.1|3433752_3434331_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000683129.1|3434327_3434723_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	8.5e-70
WP_001317730.1|3434730_3435471_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	5.2e-129
WP_000479200.1|3435486_3435909_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	85.0	1.4e-59
WP_000459457.1|3435890_3436325_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_161623825.1|3436317_3438879_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	97.8	0.0e+00
WP_000847379.1|3438875_3439205_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_032218334.1|3439204_3439903_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	4.0e-131
WP_000140717.1|3439908_3440652_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.1e-146
WP_000090917.1|3440588_3441221_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_000515639.1|3441281_3444779_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	97.6	0.0e+00
WP_001233090.1|3444849_3445449_+	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	97.5	8.2e-109
WP_161620774.1|3445513_3448585_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	82.1	2.5e-68
WP_063074595.1|3448584_3449166_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	91.7	8.9e-100
>prophage 14
NZ_CP041429	Escherichia coli strain STEC367 chromosome, complete genome	5090010	4034738	4092423	5090010	terminase,plate,tail,holin,integrase,transposase,tRNA	Escherichia_phage(84.13%)	70	4033578:4033592	4045692:4045706
4033578:4033592	attL	TCGGTGTAGTCTGCG	NA	NA	NA	NA
WP_000628065.1|4034738_4035971_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|4036225_4037209_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001296046.1|4037483_4037657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000123738.1|4037686_4039060_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157377.1|4039188_4040124_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	100.0	2.8e-148
WP_071998909.1|4040175_4041411_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	99.5	1.4e-240
WP_000079604.1|4041412_4041628_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_001383994.1|4041727_4041916_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	100.0	1.9e-27
WP_010989194.1|4041908_4042103_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	98.4	4.5e-32
WP_001774814.1|4042166_4043219_-	recombinase RecT	NA	A0A0U2S5Y9	Escherichia_phage	63.3	5.5e-116
WP_032221030.1|4043230_4046380_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	79.2	0.0e+00
4045692:4045706	attR	TCGGTGTAGTCTGCG	NA	NA	NA	NA
WP_000022247.1|4046403_4046700_-	hypothetical protein	NA	K7P7B3	Enterobacteria_phage	39.3	5.1e-11
WP_077633604.1|4046774_4046945_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	69.6	5.1e-16
WP_001774817.1|4046944_4047166_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	95.9	2.2e-35
WP_032221031.1|4047561_4047795_+	hypothetical protein	NA	A0A0U2S658	Escherichia_phage	98.7	1.5e-34
WP_032221032.1|4047756_4048062_-	hypothetical protein	NA	A0A0U2S618	Escherichia_phage	98.0	2.5e-45
WP_001774820.1|4048312_4048774_-	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	99.3	4.4e-78
WP_001774821.1|4048881_4049157_+	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	98.8	5.7e-41
WP_032083632.1|4049140_4049563_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	93.6	1.0e-68
WP_077170433.1|4049640_4050765_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	65.3	1.5e-42
WP_032083631.1|4050771_4051518_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	80.1	9.0e-113
WP_032221033.1|4051540_4052302_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	85.4	1.7e-111
WP_032083629.1|4052318_4052741_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.1	9.4e-67
WP_024193792.1|4053030_4053423_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	58.3	2.2e-33
WP_001298823.1|4053419_4054013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032221034.1|4054053_4054482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000893387.1|4054478_4055570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001774828.1|4055913_4056069_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.1	1.6e-16
WP_161623829.1|4056262_4057375_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_032221036.1|4057978_4058578_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	94.5	1.8e-108
WP_032221037.1|4058577_4058868_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	1.3e-46
WP_032221038.1|4058864_4059407_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	75.7	3.7e-76
WP_001774831.1|4059794_4060520_+	hypothetical protein	NA	A0A0U2KD26	Escherichia_phage	66.0	7.5e-80
WP_000823297.1|4060587_4061013_+	subtilase	NA	NA	NA	NA	NA
WP_032221039.1|4061070_4061463_+|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	88.5	1.3e-49
WP_001355273.1|4061452_4061731_+|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	81.5	4.0e-34
WP_000836752.1|4061732_4062278_+	glycoside hydrolase family 108 protein	NA	A0A0U2I1S0	Escherichia_phage	91.7	1.6e-95
WP_032221041.1|4062366_4063146_+	enterotoxin	NA	A0A0U2QV53	Escherichia_phage	98.8	1.8e-148
WP_000095643.1|4063135_4063507_+	enterotoxin	NA	A0A0U2SHA2	Escherichia_phage	100.0	4.5e-65
WP_000021154.1|4064608_4065937_+|terminase	terminase	terminase	A0A0U2JTW9	Escherichia_phage	99.8	3.4e-264
WP_001774832.1|4065955_4067392_+	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	99.8	2.3e-274
WP_077879478.1|4067450_4068170_+	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	99.2	4.3e-136
WP_000059661.1|4068150_4069443_+	DUF2213 domain-containing protein	NA	A0A0U2QW61	Escherichia_phage	100.0	4.6e-197
WP_001383990.1|4069435_4070053_+	hypothetical protein	NA	A0A0U2S600	Escherichia_phage	99.5	5.9e-118
WP_001272367.1|4070067_4071096_+	hypothetical protein	NA	A0A0U2QQI2	Escherichia_phage	99.7	1.9e-190
WP_000780862.1|4071152_4071623_+	hypothetical protein	NA	A0A0U2SAX6	Escherichia_phage	99.4	4.2e-84
WP_161623830.1|4071622_4072063_+	hypothetical protein	NA	A0A0U2S646	Escherichia_phage	98.6	3.6e-77
WP_161623831.1|4072059_4072500_+	hypothetical protein	NA	A0A0U2RTA8	Escherichia_phage	83.6	1.2e-67
WP_053272721.1|4072486_4073431_+	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	99.4	2.8e-172
WP_161623832.1|4073430_4074768_+	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	97.1	2.1e-245
WP_000613368.1|4074791_4075223_+	hypothetical protein	NA	A0A0U2S616	Escherichia_phage	100.0	3.3e-75
WP_161623833.1|4075219_4075837_+	hypothetical protein	NA	A0A0U2S634	Escherichia_phage	98.5	2.5e-108
WP_161623834.1|4075900_4077889_+	transglycosylase SLT domain-containing protein	NA	A0A0U2QV45	Escherichia_phage	98.6	0.0e+00
WP_161623835.1|4077892_4078561_+	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	97.3	1.8e-120
WP_000209261.1|4078557_4078824_+	hypothetical protein	NA	A0A0U2JGJ3	Escherichia_phage	98.9	1.7e-45
WP_161623836.1|4078823_4079831_+	hypothetical protein	NA	A0A0U2QL72	Escherichia_phage	91.0	6.1e-181
WP_097446552.1|4079830_4080544_+|plate	phage baseplate protein	plate	A0A0U2JTX5	Escherichia_phage	95.8	2.8e-124
WP_063100420.1|4081041_4081596_+	Rha family transcriptional regulator	NA	A0A088CBJ5	Shigella_phage	87.6	1.2e-85
WP_001261330.1|4081645_4081993_+	hypothetical protein	NA	A0A0U2I1S2	Escherichia_phage	99.1	4.4e-62
WP_161623837.1|4081968_4082526_-	phage antirepressor Ant	NA	A0A0U2QL80	Escherichia_phage	98.4	2.0e-101
WP_161623838.1|4082805_4083270_-	hypothetical protein	NA	A0A0U2JTY1	Escherichia_phage	99.4	1.7e-85
WP_062873730.1|4083288_4083837_-	hypothetical protein	NA	A0A0U2SH92	Escherichia_phage	99.5	5.2e-102
WP_074148503.1|4083858_4085085_+	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	99.5	4.0e-227
WP_161623839.1|4085068_4085695_+	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	98.6	6.4e-120
WP_161623840.1|4085691_4087035_+|tail	phage tail protein	tail	A0A0U2SAV1	Escherichia_phage	88.2	2.3e-228
WP_097450069.1|4087037_4087586_+|tail	phage tail protein	tail	Q8W612	Enterobacteria_phage	95.6	3.0e-97
WP_161623841.1|4087609_4089613_+|tail	phage tail protein	tail	A0A0U2SH60	Escherichia_phage	61.0	2.7e-244
WP_161623845.1|4089612_4090176_+	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	95.7	5.6e-99
WP_001082294.1|4090714_4091149_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.0e-28
WP_000837931.1|4091289_4092423_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	4.1e-117
>prophage 15
NZ_CP041429	Escherichia coli strain STEC367 chromosome, complete genome	5090010	4301543	4353744	5090010	protease,terminase,tail,portal,lysis,transposase	Enterobacteria_phage(43.9%)	59	NA	NA
WP_047628296.1|4301543_4302125_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	8.6e-103
WP_161620716.1|4302124_4305148_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	80.7	4.7e-67
WP_047628564.1|4305212_4305812_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	95.5	5.0e-106
WP_161620717.1|4305879_4309359_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.4	0.0e+00
WP_000090847.1|4309419_4310022_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	1.8e-87
WP_024170790.1|4309958_4310702_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	4.7e-146
WP_001724602.1|4310707_4311406_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	98.7	5.6e-133
WP_000447248.1|4311415_4311745_-|tail	phage tail protein	tail	A0A291AWW9	Escherichia_phage	100.0	1.7e-60
WP_059330973.1|4311744_4314810_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.2	0.0e+00
WP_001161009.1|4314781_4315111_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001297778.1|4315119_4315506_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	99.2	3.6e-65
WP_000211109.1|4315566_4316310_-|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	100.0	7.8e-133
WP_001079398.1|4316321_4316723_-|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_001711248.1|4316719_4317298_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001283153.1|4317309_4317585_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|4317577_4317901_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001136586.1|4317987_4320015_-|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.4	0.0e+00
WP_000985957.1|4319959_4321468_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.6	2.9e-288
WP_001072975.1|4321467_4321680_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_059330972.1|4321676_4323776_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	99.3	0.0e+00
WP_077871916.1|4323784_4324324_-	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	99.4	5.2e-94
WP_000548593.1|4324873_4325080_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
WP_001443523.1|4325720_4325876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071526745.1|4326023_4326212_-	cold-shock protein	NA	NA	NA	NA	NA
WP_001356335.1|4326222_4326435_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.6e-22
WP_001071776.1|4326798_4327296_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_001092966.1|4327292_4327826_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	8.4e-97
WP_000189918.1|4327822_4328134_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	62.6	5.0e-25
WP_000839562.1|4328138_4328354_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.3e-32
WP_001348108.1|4328605_4328980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000506936.1|4329151_4329580_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_029380182.1|4329946_4330075_-	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	96.4	4.7e-06
WP_000762866.1|4330796_4331618_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.0	1.2e-78
WP_047627813.1|4331614_4331989_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.8	3.2e-34
WP_001695976.1|4332001_4333051_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	2.7e-107
WP_032149942.1|4333052_4333331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980999.1|4333397_4333649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000887491.1|4333865_4334078_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	97.1	1.7e-29
WP_000878218.1|4335239_4336106_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_000169527.1|4336102_4336402_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001151126.1|4337359_4337782_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.0	7.7e-61
WP_000705349.1|4338768_4339290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000909905.1|4339273_4339501_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000381212.1|4339581_4339989_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	51.9	7.2e-32
WP_000379589.1|4340157_4340313_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001613120.1|4340314_4340890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|4341376_4341565_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083280.1|4341561_4341753_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_059330971.1|4341846_4344318_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_001296941.1|4344405_4344642_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_001360138.1|4345976_4346087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836057.1|4346144_4347164_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	7.4e-17
WP_001295394.1|4347175_4348390_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|4348595_4348922_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705211.1|4349056_4349398_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|4349432_4349993_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_161620719.1|4349995_4350706_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001307224.1|4350813_4351119_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_059330969.1|4351317_4353744_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	5.9e-214
>prophage 16
NZ_CP041429	Escherichia coli strain STEC367 chromosome, complete genome	5090010	4607917	4694908	5090010	protease,terminase,capsid,tail,portal,holin,head,tRNA,plate	Enterobacteria_phage(32.81%)	105	NA	NA
WP_000984517.1|4607917_4608799_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001315679.1|4608990_4611039_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
WP_000431370.1|4611058_4611757_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001043882.1|4611853_4612351_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_001207283.1|4612480_4613764_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_047082192.1|4613732_4616366_+	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_161623843.1|4616445_4617885_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001295499.1|4618002_4618239_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_000929532.1|4618259_4618535_+	YebW family protein	NA	NA	NA	NA	NA
WP_000812712.1|4618535_4619192_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.7	3.6e-57
WP_000976472.1|4619587_4619929_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879282.1|4619941_4620814_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000204699.1|4620817_4621192_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|4621330_4621561_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011658.1|4621662_4622319_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944256.1|4622342_4623005_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_000936951.1|4623001_4625062_-	oligopeptidase B	NA	NA	NA	NA	NA
WP_000024745.1|4625270_4625930_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001295500.1|4626256_4626613_-	protein YebF	NA	NA	NA	NA	NA
WP_000257738.1|4626679_4626970_-	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
WP_000173493.1|4627103_4628282_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_000800512.1|4628337_4628979_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_001687627.1|4629015_4630827_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_000301727.1|4631061_4632537_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
WP_001056694.1|4632874_4633744_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000091176.1|4633871_4635314_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_000448381.1|4635445_4636417_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_001184045.1|4636536_4637859_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_001342995.1|4637874_4638807_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202996.1|4638885_4639641_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_000571479.1|4639637_4640423_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568519.1|4640569_4641580_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|4641588_4642200_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_001386853.1|4642338_4642404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024930.1|4642474_4643077_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|4643078_4643600_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_000907248.1|4643634_4644375_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001443602.1|4644403_4644856_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001258662.1|4644973_4646746_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000891610.1|4647055_4647622_+	hydrolase	NA	NA	NA	NA	NA
WP_161620831.1|4648034_4648598_-	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	89.8	6.0e-93
WP_161622627.1|4648597_4650601_-|tail	phage tail protein	tail	A0A0U2SH60	Escherichia_phage	59.4	1.1e-229
WP_136769135.1|4650625_4651702_-	late control protein	NA	R9TNM7	Vibrio_phage	28.9	1.9e-31
WP_001107807.1|4651692_4651911_-|tail	phage tail protein	tail	R9TR63	Vibrio_phage	52.1	4.9e-11
WP_097450115.1|4651885_4652374_-|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	35.0	2.1e-14
WP_097450116.1|4652376_4654038_-	hypothetical protein	NA	R9TRP8	Vibrio_phage	34.2	2.7e-48
WP_033813285.1|4654155_4654458_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_033813286.1|4654519_4655038_-|tail	tail protein	tail	NA	NA	NA	NA
WP_096095865.1|4655034_4656510_-|tail	phage tail protein	tail	R9TMQ0	Vibrio_phage	38.3	3.3e-74
WP_033813288.1|4656566_4657100_-|tail	tail assembly chaperone	tail	A0A1S6KZY8	Salmonella_phage	47.3	7.0e-35
WP_161622628.1|4657127_4657655_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	77.5	3.4e-74
WP_161620907.1|4657669_4658926_-|tail	phage tail protein	tail	A0A0U2SAV1	Escherichia_phage	96.5	1.1e-126
WP_161622629.1|4658922_4659513_-|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	39.7	9.5e-25
WP_000235847.1|4659505_4660420_-|plate	baseplate assembly protein	plate	D5LGZ3	Escherichia_phage	43.6	7.5e-61
WP_000579232.1|4660394_4660751_-	hypothetical protein	NA	V5YTB2	Pseudomonas_phage	46.8	1.6e-19
WP_000049992.1|4660784_4661408_-|plate	phage baseplate assembly protein V	plate	F1BUP5	Erwinia_phage	29.8	2.4e-10
WP_097450120.1|4661391_4661943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096095872.1|4661954_4662677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032083604.1|4662657_4663059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001372342.1|4663061_4663427_-	DNA breaking-rejoining protein	NA	NA	NA	NA	NA
WP_096934545.1|4663477_4664506_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	58.9	1.3e-109
WP_032083606.1|4664574_4664910_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	54.2	3.3e-22
WP_161620836.1|4664949_4666674_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	53.6	6.9e-100
WP_097450122.1|4666693_4668217_-|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	63.4	5.8e-183
WP_000263126.1|4668261_4668471_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	49.2	1.4e-10
WP_161620813.1|4668474_4670391_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.4	3.3e-252
WP_032083611.1|4670362_4670911_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	98.6	2.6e-69
WP_161623844.1|4672506_4672788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161619109.1|4672858_4673236_-	M15 family metallopeptidase	NA	Q9MBZ3	Enterobacteria_phage	96.0	3.3e-63
WP_161619110.1|4673238_4673514_-|holin	phage holin family protein	holin	Q9MBZ4	Enterobacteria_phage	94.5	2.8e-43
WP_097449971.1|4673503_4673896_-|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	86.9	5.5e-53
WP_097449972.1|4674074_4674347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097449973.1|4674312_4674657_-	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	83.0	2.0e-46
WP_097449974.1|4674661_4674877_-|holin	holin	holin	G9L6J5	Escherichia_phage	97.2	2.2e-32
WP_096129430.1|4675142_4675466_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	99.1	1.7e-60
WP_000738076.1|4675653_4675923_-	Shiga toxin Stx2d subunit B	NA	Q5TJL5	Enterobacteria_phage	97.8	3.0e-42
WP_097449975.1|4675934_4676894_-	Shiga toxin Stx2 subunit A	NA	Q6DWN9	Enterobacteria_phage	96.6	1.8e-169
WP_097449976.1|4677263_4677977_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917767.1|4678113_4678311_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_161620815.1|4678484_4679198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161619112.1|4679452_4680118_-	antiterminator	NA	I6PDF8	Cronobacter_phage	52.9	1.1e-61
WP_136769107.1|4680114_4680474_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.7	1.8e-39
WP_136769108.1|4680486_4681476_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	95.7	4.6e-189
WP_001061438.1|4681483_4682293_-	KilA-N domain-containing protein	NA	A5LH75	Enterobacteria_phage	100.0	8.2e-152
WP_000767141.1|4682312_4682702_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A291AX14	Escherichia_phage	99.2	1.6e-68
WP_000210169.1|4682698_4683025_-	LexA family transcriptional regulator	NA	K7PLX6	Enterobacteria_phage	100.0	9.2e-54
WP_072127929.1|4683673_4684168_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	98.1	3.6e-86
WP_024211007.1|4684164_4684983_-	helix-turn-helix domain-containing protein	NA	A0A291AWW0	Escherichia_phage	99.3	1.8e-122
WP_000620696.1|4684979_4685204_-	hypothetical protein	NA	A5LH70	Enterobacteria_phage	100.0	5.7e-39
WP_136769109.1|4685200_4686352_-	peptidase	NA	K7PLX4	Enterobacteria_phage	96.1	6.9e-205
WP_000515862.1|4686348_4686900_-	hypothetical protein	NA	Q8SBF4	Shigella_phage	99.5	9.9e-101
WP_001191669.1|4686892_4687153_-	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
WP_001345148.1|4687250_4687943_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.1	8.3e-121
WP_000135680.1|4688666_4689029_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_161620816.1|4689094_4689919_+	YfdQ family protein	NA	Q8SBF9	Shigella_phage	99.3	1.7e-149
WP_000008178.1|4690047_4690584_+	5'-deoxynucleotidase	NA	A0A0P0ZCH9	Stx2-converting_phage	99.4	2.2e-100
WP_097455379.1|4690574_4690937_+	hypothetical protein	NA	K7PH61	Enterobacteria_phage	97.5	2.3e-66
WP_000111289.1|4690933_4691137_+	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	98.5	1.0e-31
WP_000476211.1|4691129_4691369_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	98.7	2.2e-36
WP_027661982.1|4691365_4691620_+	hypothetical protein	NA	A0A0U2RK51	Escherichia_phage	97.6	3.3e-43
WP_136769110.1|4691986_4692949_+	DUF551 domain-containing protein	NA	Q8VNQ2	Enterobacteria_phage	94.3	2.1e-69
WP_097455382.1|4692948_4693521_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	97.4	4.3e-107
WP_001093911.1|4693557_4693830_+	hypothetical protein	NA	S5MQM5	Escherichia_phage	100.0	7.2e-44
WP_053878051.1|4693863_4694412_-	hypothetical protein	NA	S5M7T3	Escherichia_phage	86.3	2.0e-77
WP_059242328.1|4694434_4694908_-	SocA family protein	NA	K4NZT7	Burkholderia_phage	31.8	2.4e-18
>prophage 1
NZ_CP041430	Escherichia coli strain STEC367 plasmid pSTEC367, complete sequence	80039	0	2927	80039		Xanthomonas_phage(50.0%)	5	NA	NA
WP_000005990.1|650_884_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_161620593.1|946_1486_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	73.0	7.6e-45
WP_072018947.1|1719_1908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135460463.1|1958_2213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042111888.1|2363_2927_-	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	37.3	1.4e-20
>prophage 2
NZ_CP041430	Escherichia coli strain STEC367 plasmid pSTEC367, complete sequence	80039	8636	49034	80039	transposase,integrase,tRNA,bacteriocin	Acidithiobacillus_phage(22.22%)	40	12340:12355	45309:45324
WP_000085940.1|8636_9320_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	1.9e-29
WP_096117507.1|9396_9690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000959883.1|9837_10800_+	plasmid segregation protein ParM	NA	A0A222YXF2	Escherichia_phage	53.9	9.2e-94
WP_000361384.1|10802_11153_+	protein stbB	NA	NA	NA	NA	NA
WP_001027529.1|11303_11816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077170529.1|12257_13793_+|bacteriocin	pore-forming bacteriocin colicin B	bacteriocin	NA	NA	NA	NA
12340:12355	attL	TTCCGGGCGGTGATGT	NA	NA	NA	NA
WP_032084022.1|13810_14338_-	colicin B immunity protein	NA	NA	NA	NA	NA
WP_032084023.1|14581_15397_+|bacteriocin	lipid II-degrading bacteriocin colicin M	bacteriocin	NA	NA	NA	NA
WP_000864812.1|15446_15800_-	colicin M immunity protein	NA	NA	NA	NA	NA
WP_001164199.1|15972_16755_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	97.3	1.2e-54
WP_000465045.1|16756_17170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032084040.1|20165_21089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001105066.1|22440_22722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032084131.1|22827_23103_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_032084130.1|23102_23387_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_160391234.1|23803_24646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143361631.1|24796_25177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112015974.1|25292_25976_-	fimbrial chaperone	NA	NA	NA	NA	NA
WP_161620840.1|25977_28389_-	PefC/AfrB family outer membrane usher protein	NA	NA	NA	NA	NA
WP_096117498.1|28496_29009_-	fimbrial protein	NA	NA	NA	NA	NA
WP_161620442.1|29139_29412_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_096117496.1|29647_30523_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000878218.1|32092_32959_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_000169527.1|32955_33255_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001298859.1|33464_35006_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_001016257.1|35020_35767_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	48.5	5.0e-55
WP_096117481.1|35934_36204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001401515.1|37119_37977_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001375168.1|37969_38044_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000083826.1|38277_38535_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_032082916.1|38774_39365_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_001302200.1|39402_39612_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_021545193.1|39657_40119_-	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.1	4.2e-20
WP_021545194.1|40417_40576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000840464.1|40708_41269_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_000704511.1|41371_42232_-	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.0	2.3e-11
WP_000205749.1|42290_43037_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	29.7	8.7e-07
WP_161620837.1|43056_48327_-	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
45309:45324	attR	ACATCACCGCCCGGAA	NA	NA	NA	NA
WP_000450532.1|48408_48636_+	toxin-antitoxin system antitoxin VapB	NA	NA	NA	NA	NA
WP_000911317.1|48635_49034_+|tRNA	tRNA(fMet)-specific endonuclease VapC	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP041430	Escherichia coli strain STEC367 plasmid pSTEC367, complete sequence	80039	66724	66946	80039		Vibrio_virus(100.0%)	1	NA	NA
WP_001278689.1|66724_66946_-	conjugal transfer protein TraR	NA	A2I309	Vibrio_virus	40.8	3.3e-07
>prophage 4
NZ_CP041430	Escherichia coli strain STEC367 plasmid pSTEC367, complete sequence	80039	74875	75697	80039		Yersinia_phage(100.0%)	1	NA	NA
WP_074014913.1|74875_75697_-	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.2	4.4e-44
