The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041425	Escherichia coli strain STEC388 chromosome, complete genome	4928812	779449	784285	4928812	transposase	Stx2-converting_phage(50.0%)	7	NA	NA
WP_161623591.1|779449_780094_-	antitoxin of toxin-antitoxin stability system	NA	A0A2I6PI07	Pseudomonas_phage	32.4	1.4e-26
WP_000692353.1|780112_780334_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001186784.1|780402_780879_-	RadC family protein	NA	NA	NA	NA	NA
WP_000213706.1|780893_781379_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.7	3.1e-13
WP_161623572.1|781669_783241_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	1.7e-169
WP_000624622.1|783260_783608_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_096101123.1|783607_784285_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	47.2	7.3e-21
>prophage 2
NZ_CP041425	Escherichia coli strain STEC388 chromosome, complete genome	4928812	930050	948976	4928812	integrase	Salmonella_phage(27.27%)	17	921060:921074	943309:943323
921060:921074	attL	CGTTTCTCGTCGCAG	NA	NA	NA	NA
WP_001301085.1|930050_930806_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
WP_001580988.1|931122_932337_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.1	1.6e-138
WP_021567027.1|932465_933263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001580986.1|933491_933689_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_161623596.1|933765_934464_+	hypothetical protein	NA	A0A0S2SYC0	Pseudomonas_phage	38.7	1.1e-11
WP_161623597.1|934456_935200_+	antA/AntB antirepressor family protein	NA	A0A0R6PJV6	Moraxella_phage	42.0	1.6e-21
WP_161623598.1|935192_935750_+	transporter	NA	A0A1W6JPH8	Morganella_phage	61.0	7.3e-51
WP_001336359.1|936706_936964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161623599.1|936966_937269_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_161623600.1|937265_939392_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	53.3	3.4e-173
WP_000126713.1|939602_940028_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000164222.1|940064_940562_+	ProQ/FinO family protein	NA	Q2A0A1	Sodalis_phage	46.3	9.2e-13
WP_113402083.1|940542_940959_+	hypothetical protein	NA	A0A077SLR9	Escherichia_phage	71.0	1.2e-21
WP_000995640.1|941325_941532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113402084.1|941628_944160_+	hypothetical protein	NA	Q858G0	Salmonella_phage	80.2	0.0e+00
943309:943323	attR	CGTTTCTCGTCGCAG	NA	NA	NA	NA
WP_113402085.1|944159_946220_+	hypothetical protein	NA	Q858F9	Salmonella_phage	59.8	2.3e-203
WP_113402086.1|946219_948976_+	hypothetical protein	NA	Q858F8	Salmonella_phage	89.2	0.0e+00
>prophage 3
NZ_CP041425	Escherichia coli strain STEC388 chromosome, complete genome	4928812	1077835	1091018	4928812		Escherichia_phage(50.0%)	12	NA	NA
WP_001295182.1|1077835_1078597_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|1078590_1079217_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272590.1|1079356_1080496_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|1080558_1081551_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104429.1|1081644_1083009_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136918.1|1083097_1083874_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|1083878_1084517_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|1084513_1085776_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847974.1|1085772_1086681_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.9e-118
WP_001272546.1|1086846_1087644_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	4.5e-70
WP_001141320.1|1087694_1088351_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	47.0	6.6e-51
WP_161623603.1|1088456_1091018_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
>prophage 4
NZ_CP041425	Escherichia coli strain STEC388 chromosome, complete genome	4928812	1696799	1706241	4928812		Enterobacteria_phage(85.71%)	10	NA	NA
WP_096128932.1|1696799_1697726_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
WP_096128931.1|1697730_1698462_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1698442_1698550_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1698609_1699341_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1699562_1701248_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1701244_1701964_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1702010_1702481_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1702521_1702983_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_096128930.1|1703107_1705108_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_161623622.1|1705104_1706241_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	98.0	6.5e-163
>prophage 5
NZ_CP041425	Escherichia coli strain STEC388 chromosome, complete genome	4928812	1864751	1911210	4928812	tail,holin,lysis,transposase,integrase	Escherichia_phage(37.5%)	51	1849774:1849788	1893486:1893500
1849774:1849788	attL	GGTGCTGCTGCATGG	NA	NA	NA	NA
WP_161623630.1|1864751_1866014_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.0	2.4e-73
WP_000532912.1|1868511_1869228_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060244.1|1869570_1871025_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000378572.1|1871126_1872443_-	shikimate transporter	NA	NA	NA	NA	NA
WP_000477878.1|1872757_1873810_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_001300307.1|1881636_1882434_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_096128842.1|1882833_1883322_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A142KB62	Gordonia_phage	41.6	7.1e-26
WP_096128843.1|1883333_1883819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096128844.1|1883856_1884864_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.3	3.7e-101
WP_000096344.1|1884863_1885067_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_096128845.1|1885125_1887597_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.9	3.8e-59
WP_064484537.1|1887676_1887880_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_064484538.1|1887876_1888065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096128846.1|1888075_1888930_-	transcriptional regulator	NA	A0A0P0ZE80	Stx2-converting_phage	63.0	1.8e-64
WP_001351093.1|1889338_1889776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394534.1|1889753_1890074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086590109.1|1890096_1890315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001678562.1|1890474_1890630_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	4.0e-07
WP_001303511.1|1890922_1891201_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|1891202_1891394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169685.1|1891414_1891786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172735.1|1891883_1892186_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	1.1e-05
WP_096128847.1|1892182_1892608_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_140432539.1|1892679_1893699_+	phage replisome organizer	NA	A0A0U2RT81	Escherichia_phage	88.8	4.5e-99
1893486:1893500	attR	CCATGCAGCAGCACC	NA	NA	NA	NA
WP_074430107.1|1893610_1894153_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.2e-85
WP_140432540.1|1894187_1894949_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	87.4	3.4e-115
WP_096128850.1|1894964_1895387_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.9	3.6e-66
WP_096128851.1|1895383_1895683_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	97.0	3.3e-50
WP_042004587.1|1895729_1896140_+	hypothetical protein	NA	A0A0H4ISY5	Shigella_phage	93.7	8.8e-70
WP_001296187.1|1896117_1896474_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	3.9e-58
WP_063103481.1|1896567_1896750_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	95.0	3.4e-26
WP_061092229.1|1896915_1897275_+	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	76.5	1.6e-38
WP_032313438.1|1897275_1897485_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	95.7	4.7e-35
WP_096129426.1|1897481_1898054_+	DUF551 domain-containing protein	NA	A0A2I6PID2	Escherichia_phage	71.4	1.8e-36
WP_000813254.1|1898325_1898481_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_032231033.1|1898648_1898921_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	2.1e-11
WP_096129427.1|1898922_1899981_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.3	1.2e-89
WP_000139994.1|1899981_1900347_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	4.2e-39
WP_047662436.1|1900343_1901009_+	antiterminator	NA	I6PDF8	Cronobacter_phage	52.4	9.3e-61
WP_057108854.1|1901263_1901977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917767.1|1902150_1902348_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_096129428.1|1902484_1903198_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_096129429.1|1903567_1904527_+	Shiga toxin Stx2 subunit A	NA	Q6DWN9	Enterobacteria_phage	96.2	1.1e-168
WP_000738076.1|1904538_1904808_+	Shiga toxin Stx2d subunit B	NA	Q5TJL5	Enterobacteria_phage	97.8	3.0e-42
WP_096129430.1|1904995_1905319_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	99.1	1.7e-60
WP_000284510.1|1905584_1905800_+|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000193273.1|1905804_1906119_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	99.0	8.3e-52
WP_001274712.1|1906174_1906708_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	96.6	3.4e-98
WP_001082535.1|1907006_1907471_+|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	83.6	5.0e-61
WP_096129526.1|1909062_1910031_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.3	8.5e-172
WP_161623748.1|1910169_1911210_+|tail	phage tail protein	tail	NA	NA	NA	NA
>prophage 6
NZ_CP041425	Escherichia coli strain STEC388 chromosome, complete genome	4928812	1939366	2007499	4928812	tail,plate,transposase	Vibrio_phage(54.29%)	67	NA	NA
WP_042856701.1|1939366_1940062_-	hypothetical protein	NA	A0A0C4UQZ7	Shigella_phage	97.4	8.9e-131
WP_001372435.1|1940012_1940198_-	Com family DNA-binding transcriptional regulator	NA	A0A0C4UQS3	Shigella_phage	72.6	7.5e-21
WP_161623632.1|1940362_1942180_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_161623633.1|1942166_1942697_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	68.2	9.0e-67
WP_161623634.1|1942711_1943521_-|tail	phage tail protein	tail	A0A0U2SAV1	Escherichia_phage	83.6	1.0e-29
WP_065226821.1|1943524_1944109_-	DUF2313 domain-containing protein	NA	M1NVS6	Vibrio_phage	49.2	2.5e-49
WP_106844709.1|1944081_1945170_-|plate	baseplate J/gp47 family protein	plate	A0A2I7S9E5	Vibrio_phage	51.0	2.2e-91
WP_137494560.1|1945159_1945612_-	hypothetical protein	NA	A0A2I7S9F0	Vibrio_phage	41.8	8.3e-21
WP_161623635.1|1945608_1946145_-|plate	phage baseplate assembly protein V	plate	A0A2I7S9F6	Vibrio_phage	39.7	9.2e-27
WP_096129346.1|1946135_1947206_-|tail	phage tail protein	tail	M4M9L5	Vibrio_phage	46.9	1.7e-88
WP_161623636.1|1947205_1948480_-	multidrug DMT transporter	NA	A0A2I7S9E8	Vibrio_phage	39.2	1.2e-77
WP_161623637.1|1948479_1950330_-|tail	phage tail protein	tail	M4MHE6	Vibrio_phage	52.4	2.2e-123
WP_096129348.1|1950416_1950812_-	hypothetical protein	NA	M4MB64	Vibrio_phage	48.7	2.8e-20
WP_032239558.1|1950813_1951170_-|tail	Mu phage tail tube protein GpM	tail	NA	NA	NA	NA
WP_096129349.1|1951179_1952655_-|tail	phage tail protein	tail	M1Q565	Vibrio_phage	55.3	4.6e-153
WP_096129350.1|1952659_1952863_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_096129351.1|1952843_1953455_-	hypothetical protein	NA	M1PJ94	Vibrio_phage	43.8	6.2e-35
WP_053289376.1|1953451_1953994_-	phage morphogenesis protein	NA	A0A2I7S9D7	Vibrio_phage	63.1	2.7e-58
WP_000540583.1|1953993_1954431_-	DUF1320 domain-containing protein	NA	A0A2I7S9E9	Vibrio_phage	49.7	3.7e-34
WP_001557428.1|1954813_1955716_-	hypothetical protein	NA	M4MB71	Vibrio_phage	57.2	2.1e-100
WP_063269237.1|1955715_1956678_-	peptidase	NA	M1Q578	Vibrio_phage	45.7	1.7e-76
WP_063269274.1|1956891_1957656_-	hypothetical protein	NA	M4M9M5	Vibrio_phage	60.5	2.4e-92
WP_063269273.1|1957648_1959220_-	DUF935 domain-containing protein	NA	A0A2I7S9K0	Vibrio_phage	57.5	1.5e-157
WP_161623750.1|1959216_1960743_-	hypothetical protein	NA	M1NVQ0	Vibrio_phage	67.9	3.5e-196
WP_062897834.1|1960748_1961330_-	DUF3486 family protein	NA	M1PJ86	Vibrio_phage	55.5	8.4e-50
WP_000101558.1|1961467_1961767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024168521.1|1961769_1962057_-	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	60.6	1.6e-25
WP_001397890.1|1962062_1962368_-	DUF2730 family protein	NA	M1Q558	Vibrio_phage	39.6	1.6e-12
WP_109955406.1|1962352_1962580_-	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_096098843.1|1962576_1963185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161623572.1|1963498_1965070_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	1.7e-169
WP_161623638.1|1965089_1965314_-|transposase	transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	78.4	1.5e-10
WP_161623639.1|1965290_1965995_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	1.7e-137
WP_000084745.1|1966329_1966722_+	NimC/NimA family protein	NA	NA	NA	NA	NA
WP_001376233.1|1967041_1967326_-	bleomycin resistance protein	NA	NA	NA	NA	NA
WP_001067858.1|1967388_1968093_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001287392.1|1968641_1969046_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_000175476.1|1969543_1969780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001572344.1|1969821_1970277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000490638.1|1970336_1971002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001426317.1|1971059_1971440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000090707.1|1972191_1973034_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001641527.1|1973020_1975144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001049180.1|1975143_1976592_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_001324699.1|1976632_1978189_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000262423.1|1978200_1979127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001097216.1|1979479_1979779_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001239419.1|1980342_1982169_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000647571.1|1982337_1982688_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	61.4	8.1e-16
WP_000790485.1|1982835_1983267_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_000555736.1|1983511_1984993_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.8e-27
WP_000697968.1|1984985_1985666_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	36.0	2.7e-31
WP_000475506.1|1985855_1987241_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_001246155.1|1987268_1987622_+	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_000157620.1|1987735_1989028_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_000574029.1|1989038_1992185_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	NA	NA	NA	NA
WP_000758225.1|1992271_1992712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001353604.1|1992838_1995286_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.3	1.3e-83
WP_000843494.1|1995326_1995524_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_000287501.1|1995557_1996295_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A8ATH6	Listeria_phage	41.0	1.0e-12
WP_001067858.1|1996452_1997157_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001351729.1|1999400_1999793_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000058717.1|1999930_2000815_+	EamA family transporter	NA	NA	NA	NA	NA
WP_000804064.1|2000846_2002046_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000164043.1|2002151_2002802_+	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000844627.1|2002833_2003076_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001067858.1|2006794_2007499_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
>prophage 7
NZ_CP041425	Escherichia coli strain STEC388 chromosome, complete genome	4928812	2098479	2144852	4928812	tail,head,holin,lysis,transposase,protease,integrase,terminase	Enterobacteria_phage(44.12%)	49	2098316:2098343	2129011:2129038
2098316:2098343	attL	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_000113700.1|2098479_2099610_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|2099587_2099836_-	excisionase	NA	NA	NA	NA	NA
WP_096128999.1|2099900_2101223_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.0	8.0e-56
WP_000392434.1|2101978_2102743_+	serine/threonine protein kinase	NA	I6PD73	Cronobacter_phage	40.2	1.7e-45
WP_000615424.1|2102739_2103483_+	protein phosphatase	NA	I6PCV8	Cronobacter_phage	42.3	7.7e-48
WP_000917767.1|2103702_2103900_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_096129455.1|2104050_2105100_+	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	89.7	1.1e-185
WP_000871291.1|2105688_2106024_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_000874243.1|2106284_2106473_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.2	7.2e-27
WP_096129454.1|2106469_2106631_+	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	89.1	1.6e-14
WP_000372595.1|2106780_2106996_+|holin	holin	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_000193273.1|2107000_2107315_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	99.0	8.3e-52
WP_001274712.1|2107370_2107904_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	96.6	3.4e-98
WP_001082535.1|2108202_2108667_+|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	83.6	5.0e-61
WP_000079508.1|2108974_2109385_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_001331705.1|2109442_2109676_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	9.5e-21
WP_001405844.1|2110103_2110610_+	DNA-packaging protein	NA	O64316	Escherichia_phage	48.5	1.6e-33
WP_044720325.1|2110581_2112510_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	2.2e-259
WP_000259002.1|2112493_2112700_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_161623572.1|2113111_2114683_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	1.7e-169
WP_000624622.1|2114702_2115050_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_096101123.1|2115049_2115727_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	47.2	7.3e-21
WP_077756604.1|2115799_2115997_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_096129334.1|2115977_2118551_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	84.1	0.0e+00
WP_000847379.1|2118547_2118877_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001152639.1|2118876_2119575_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_001353245.1|2119580_2120324_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	5.6e-147
WP_161623642.1|2120260_2120893_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	98.6	2.5e-95
WP_096129332.1|2120953_2124349_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	89.7	0.0e+00
WP_096129331.1|2124416_2125016_+	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	89.4	2.7e-99
WP_161623643.1|2125080_2126910_+|tail	phage tail protein	tail	A0A2D1UII2	Escherichia_phage	75.4	7.2e-47
WP_000239886.1|2127420_2128089_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937495.1|2128145_2128415_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
WP_096129093.1|2129188_2129695_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
2129011:2129038	attR	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_001056490.1|2129740_2130241_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|2130326_2130506_-	general stress protein	NA	NA	NA	NA	NA
WP_000443067.1|2130886_2131693_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_032294060.1|2131692_2132886_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_053889810.1|2132897_2134256_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
WP_000763511.1|2134259_2135855_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_032294061.1|2135854_2137417_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|2137508_2137553_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285661.1|2137690_2138572_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|2138568_2139189_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001300853.1|2139216_2141112_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291217.1|2141322_2142198_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278906.1|2142237_2142828_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559268.1|2142824_2143583_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_000422045.1|2143802_2144852_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 8
NZ_CP041425	Escherichia coli strain STEC388 chromosome, complete genome	4928812	2589894	2635821	4928812	tail,head,holin,plate,integrase,capsid,tRNA,terminase,portal	Enterobacteria_phage(76.0%)	62	2592297:2592321	2628462:2628486
WP_000029466.1|2589894_2590644_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001154183.1|2590643_2591195_-	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000956529.1|2591257_2592238_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
2592297:2592321	attL	AAAGAAAAAAGGCCGCAGAGCGGCC	NA	NA	NA	NA
WP_001280914.1|2592430_2592868_-	DUF1640 domain-containing protein	NA	NA	NA	NA	NA
WP_138984020.1|2592979_2593378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001247202.1|2593364_2594318_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	51.3	2.6e-80
WP_000904674.1|2594406_2594715_-	helix-turn-helix transcriptional regulator	NA	A0A0M5M1I9	Salmonella_phage	52.1	8.7e-22
WP_001151410.1|2594811_2595090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096129458.1|2595104_2595443_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	83.6	4.9e-50
WP_000158978.1|2595453_2595732_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	70.7	5.4e-31
WP_000357029.1|2595743_2595986_+	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	80.0	2.0e-29
WP_000021660.1|2595982_2596096_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	94.6	1.8e-09
WP_096129459.1|2596182_2596386_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	86.6	2.9e-26
WP_000153685.1|2596382_2596628_+	winged helix-turn-helix domain-containing protein	NA	A0A0A7NV47	Enterobacteria_phage	96.3	2.8e-39
WP_000104328.1|2596624_2596924_+	ead/Ea22-like family protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_001036811.1|2596935_2597139_+	hypothetical protein	NA	A0A0A7NQ74	Enterobacteria_phage	97.0	1.4e-28
WP_000713738.1|2597135_2597966_+	hypothetical protein	NA	A0A0A7NPW9	Enterobacteria_phage	99.3	2.1e-131
WP_001116808.1|2598019_2598640_+	hypothetical protein	NA	S5MQL6	Escherichia_phage	43.1	1.5e-09
WP_161623669.1|2598636_2599002_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	85.6	4.3e-52
WP_161623670.1|2599008_2601831_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.8	0.0e+00
WP_000686519.1|2601907_2602867_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	100.0	2.0e-181
WP_161623671.1|2602871_2603183_+	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	95.1	4.2e-48
WP_096129504.1|2603576_2603891_+	hypothetical protein	NA	A0A0A7NRY2	Enterobacteria_phage	99.0	8.3e-52
WP_122998051.1|2603892_2604102_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	98.6	4.2e-36
WP_096129503.1|2604098_2604440_+	hypothetical protein	NA	H6WRY2	Salmonella_phage	88.6	4.5e-27
WP_027662232.1|2605006_2605531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161623672.1|2605545_2606592_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.4	6.5e-202
WP_096129491.1|2606591_2608343_-	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	98.1	0.0e+00
WP_001262672.1|2608497_2609334_+|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.6	6.0e-150
WP_074468410.1|2609357_2610410_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	99.7	3.4e-198
WP_074468411.1|2610455_2611256_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	98.7	2.7e-123
WP_074468412.1|2611357_2611852_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	98.8	7.8e-89
WP_000864901.1|2611851_2612052_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000104350.1|2612054_2612378_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_001718591.1|2612374_2612767_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	98.5	4.9e-70
WP_000780535.1|2612763_2613171_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	95.6	7.2e-64
WP_000920594.1|2613308_2613776_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
WP_000356339.1|2613768_2614404_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	100.0	1.1e-114
WP_001753459.1|2614400_2614982_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	99.0	1.1e-102
WP_000213447.1|2614978_2615329_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_001111951.1|2615332_2616229_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.3	9.7e-154
WP_000071743.1|2616221_2616830_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	74.9	2.6e-86
WP_161623673.1|2616826_2619424_+	hypothetical protein	NA	A0A0F7LDR4	Escherichia_phage	67.1	1.2e-108
WP_001025468.1|2619470_2619632_+	helix-turn-helix domain-containing protein	NA	A0A0A7NPV4	Enterobacteria_phage	73.9	1.4e-10
WP_000979954.1|2619660_2620149_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.6e-86
WP_074530385.1|2620161_2622969_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	95.8	0.0e+00
WP_000333494.1|2622955_2623111_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	98.0	2.0e-22
WP_000665313.1|2623119_2623485_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	6.4e-56
WP_000290450.1|2623539_2624052_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_161623674.1|2624051_2625236_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.7	1.8e-224
WP_161623675.1|2625393_2626503_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	93.8	1.3e-192
WP_000604994.1|2626625_2627411_-	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_000488107.1|2627606_2627867_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078916.1|2628057_2628198_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_001229265.1|2628503_2628803_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
2628462:2628486	attR	AAAGAAAAAAGGCCGCAGAGCGGCC	NA	NA	NA	NA
WP_155555693.1|2628807_2631195_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018596.1|2631209_2632193_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_001386830.1|2632476_2632521_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|2632643_2633000_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|2633052_2633250_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|2633346_2633889_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144202.1|2633892_2635821_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	9.4e-130
>prophage 9
NZ_CP041425	Escherichia coli strain STEC388 chromosome, complete genome	4928812	2835490	2902288	4928812	tail,head,holin,transposase,protease,plate,integrase,capsid,tRNA,terminase,portal	Shigella_phage(49.25%)	91	2827618:2827632	2895839:2895853
2827618:2827632	attL	CTTCTGGCCCTTGGT	NA	NA	NA	NA
WP_096129526.1|2835490_2836459_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.3	8.5e-172
WP_000146099.1|2837581_2838994_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_000287768.1|2839008_2839419_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_001015023.1|2839418_2839784_+	flagella biosynthesis regulatory protein FliT	NA	NA	NA	NA	NA
WP_001245699.1|2839861_2841349_+	alpha-amylase	NA	NA	NA	NA	NA
WP_001295642.1|2841382_2841796_-	lipoprotein	NA	NA	NA	NA	NA
WP_000118901.1|2841982_2843188_+	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_000789493.1|2843184_2843418_+	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_000334585.1|2843526_2844198_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.8	1.3e-81
WP_161623684.1|2844182_2845346_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	92.5	1.4e-197
WP_001342382.1|2845415_2845538_+|transposase	transposase	transposase	A0A1S5RHE3	Helicobacter_phage	55.0	3.8e-05
WP_032232437.1|2845538_2845784_+|transposase	IS200/IS605 family transposase	transposase	I4AZM1	Saccharomonospora_phage	64.6	7.4e-24
WP_000879835.1|2846716_2847514_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000734031.1|2847523_2848075_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_001070440.1|2848243_2848576_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001274299.1|2848909_2849224_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_096129405.1|2849438_2851097_+	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_000067950.1|2851089_2852085_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_062897844.1|2852714_2853302_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000987080.1|2853442_2853679_+	DNA-binding protein	NA	A0A2D1GNH1	Pseudomonas_phage	53.4	3.2e-16
WP_096129406.1|2853681_2855769_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	49.1	1.4e-174
WP_000129606.1|2855844_2856798_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	40.3	9.9e-56
WP_077627739.1|2856813_2857038_+	hypothetical protein	NA	C9DGL3	Escherichia_phage	85.1	3.4e-31
WP_047088006.1|2857070_2857340_+	hypothetical protein	NA	C9DGL5	Escherichia_phage	98.9	4.8e-32
WP_096098852.1|2857360_2857780_+	hypothetical protein	NA	A0A0C4UR25	Shigella_phage	89.9	3.8e-68
WP_042099546.1|2857792_2858080_+	hypothetical protein	NA	A0A0C4UQR4	Shigella_phage	93.7	2.2e-43
WP_001107927.1|2858100_2858625_+	host-nuclease inhibitor protein Gam	NA	A0A0C4UQY5	Shigella_phage	96.6	1.4e-88
WP_096129501.1|2858723_2859263_+	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	85.8	4.7e-87
WP_159390727.1|2859255_2859438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042856716.1|2859430_2859745_+	hypothetical protein	NA	A0A0C4UQY6	Shigella_phage	70.7	3.6e-31
WP_079916120.1|2859683_2859950_-	hypothetical protein	NA	Q38493	Escherichia_phage	52.3	1.4e-15
WP_042856715.1|2860023_2860575_+	regulatory protein GemA	NA	A0A0C4UQU3	Shigella_phage	81.9	6.5e-84
WP_040100375.1|2860571_2861021_+	Middle operon regulator	NA	A0A0C4UR27	Shigella_phage	62.7	4.2e-41
WP_096129506.1|2861106_2861703_+	N-acetylmuramidase	NA	A0A2I7S9B9	Vibrio_phage	42.8	2.7e-35
WP_161623685.1|2861704_2861956_+	hypothetical protein	NA	A0A0C4UQR6	Shigella_phage	67.6	9.0e-25
WP_161623686.1|2861930_2862107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096101123.1|2862106_2862784_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	47.2	7.3e-21
WP_000624622.1|2862783_2863131_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_161623572.1|2863150_2864722_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	1.7e-169
WP_096129233.1|2865042_2865627_-	YmfQ family protein	NA	O22003	Shigella_phage	99.0	3.5e-112
WP_096129234.1|2865617_2866676_-|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	97.7	8.9e-199
WP_000424742.1|2866662_2867088_-	hypothetical protein	NA	U5P0R9	Shigella_phage	99.3	6.7e-81
WP_096129235.1|2867087_2867636_-|plate	phage baseplate assembly protein	plate	Q8SBG6	Shigella_phage	99.5	1.5e-96
WP_096129236.1|2867635_2868715_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.7	2.6e-206
WP_123015697.1|2868711_2870040_-	DNA circularization protein	NA	Q8SBG8	Shigella_phage	99.3	6.5e-247
WP_096129238.1|2870150_2870597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096129239.1|2870628_2872461_-|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	98.5	1.1e-302
WP_000661054.1|2872602_2872872_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
WP_000090998.1|2872871_2873228_-	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_096129241.1|2873227_2874724_-|tail	phage tail protein	tail	M1FN90	Enterobacteria_phage	98.4	1.2e-270
WP_000497751.1|2874707_2874878_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000779279.1|2874886_2875447_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	99.5	2.3e-105
WP_000213502.1|2875443_2875950_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	100.0	1.7e-91
WP_000702388.1|2875924_2876335_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	97.8	5.9e-74
WP_000927719.1|2876331_2876655_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_000601360.1|2876657_2876858_-	hypothetical protein	NA	S5FNU1	Shigella_phage	97.0	3.8e-26
WP_052907892.1|2876906_2878112_-|capsid	phage major capsid protein	capsid	A0A1B5FPI9	Escherichia_phage	99.3	2.0e-223
WP_001193635.1|2878126_2878777_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	98.6	2.4e-117
WP_001407096.1|2878754_2879996_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.3	1.0e-241
WP_001407095.1|2879995_2880178_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	96.7	1.9e-24
WP_072011717.1|2880189_2881686_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.8	7.4e-300
WP_021576717.1|2881919_2882414_-|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	98.8	2.5e-87
WP_044687619.1|2882539_2882890_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	95.7	2.3e-63
WP_122986503.1|2882916_2883189_-	peptidase	NA	Q8SBD8	Shigella_phage	97.7	2.4e-39
WP_024221340.1|2883073_2883466_-	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	98.5	5.8e-63
WP_001157006.1|2883449_2883926_-	glycoside hydrolase family protein	NA	S5FV07	Shigella_phage	95.6	1.0e-85
WP_001120491.1|2883929_2884256_-|holin	phage holin, lambda family	holin	S5FM86	Shigella_phage	99.1	6.8e-57
WP_024221339.1|2884553_2885369_+	TIR domain-containing protein	NA	K7PLZ9	Enterobacterial_phage	59.2	1.8e-82
WP_086258419.1|2885408_2885777_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	82.5	8.8e-53
WP_024221336.1|2885791_2886781_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	4.7e-194
WP_001061397.1|2886788_2887586_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.6	4.4e-150
WP_044722835.1|2887605_2887995_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PH72	Enterobacteria_phage	96.1	1.5e-66
WP_000210169.1|2887991_2888318_-	LexA family transcriptional regulator	NA	K7PLX6	Enterobacteria_phage	100.0	9.2e-54
WP_047089416.1|2888314_2888968_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	98.6	6.2e-126
WP_016236627.1|2888967_2889462_-	PerC family transcriptional regulator	NA	U5P0U0	Shigella_phage	97.6	4.3e-87
WP_000104959.1|2889458_2890400_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	99.4	1.9e-152
WP_001250269.1|2890389_2890569_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515845.1|2890744_2891296_-	protein YmfL	NA	S5FXP0	Shigella_phage	99.5	3.4e-101
WP_001191674.1|2891288_2891549_-	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
WP_001020634.1|2891646_2892339_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	100.0	1.0e-126
WP_000549623.1|2892678_2892885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016389.1|2892856_2893291_-	hypothetical protein	NA	U5P096	Shigella_phage	100.0	8.4e-79
WP_021547451.1|2893835_2894384_+	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	96.0	6.2e-95
WP_021547450.1|2894427_2894673_+	phage excisionase	NA	NA	NA	NA	NA
WP_074418785.1|2894653_2895784_+|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	62.1	5.9e-124
WP_021547448.1|2895773_2896634_-	DNA adenine methylase	NA	NA	NA	NA	NA
2895839:2895853	attR	CTTCTGGCCCTTGGT	NA	NA	NA	NA
WP_021547447.1|2896703_2898413_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_000444487.1|2898581_2899832_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248691.1|2900003_2900657_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|2900666_2901128_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001297484.1|2901181_2902288_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 10
NZ_CP041425	Escherichia coli strain STEC388 chromosome, complete genome	4928812	3355848	3451345	4928812	tail,transposase,protease,plate,tRNA	Vibrio_phage(40.0%)	93	NA	NA
WP_161623753.1|3355848_3356934_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000832342.1|3357589_3358159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024238156.1|3359706_3360027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161623695.1|3360033_3364227_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.9	3.3e-26
WP_000424924.1|3364469_3364676_-	YbfA family protein	NA	NA	NA	NA	NA
WP_001272653.1|3364988_3365078_+	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_161623696.1|3365077_3366751_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_000087939.1|3366773_3368822_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.0	2.4e-27
WP_096129383.1|3368830_3369403_+	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_161623697.1|3369395_3372080_+	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.8	6.5e-12
WP_000186109.1|3372076_3372754_+	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	31.1	6.8e-27
WP_001312672.1|3373028_3373133_+	DUF2618 domain-containing protein	NA	NA	NA	NA	NA
WP_016246951.1|3373443_3375642_+	ornithine decarboxylase SpeF	NA	NA	NA	NA	NA
WP_096129385.1|3375638_3376958_+	putrescine-ornithine antiporter	NA	NA	NA	NA	NA
WP_000856355.1|3378774_3379269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295675.1|3379482_3381123_-	alpha-D-glucose phosphate-specific phosphoglucomutase	NA	NA	NA	NA	NA
WP_000848387.1|3381148_3381694_-	replication initiation negative regulator SeqA	NA	NA	NA	NA	NA
WP_000773304.1|3381878_3382643_+	esterase	NA	NA	NA	NA	NA
WP_000291238.1|3382713_3383076_+	LexA regulated protein	NA	NA	NA	NA	NA
WP_001018618.1|3383215_3383746_+	flavodoxin FldA	NA	NA	NA	NA	NA
WP_001406816.1|3383955_3384042_+	fur leader peptide	NA	NA	NA	NA	NA
WP_000131702.1|3384034_3384481_+	ferric iron uptake transcriptional regulator	NA	NA	NA	NA	NA
WP_000733572.1|3384565_3384892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096129432.1|3384941_3386348_-	chitoporin	NA	NA	NA	NA	NA
WP_137466630.1|3386584_3387280_-	protein mom	NA	A0A0C4UQZ7	Shigella_phage	96.5	7.5e-130
WP_001557410.1|3387230_3387416_-	Com family DNA-binding transcriptional regulator	NA	A0A0C4UQS3	Shigella_phage	71.0	8.3e-20
WP_096129489.1|3387580_3389398_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_096101152.1|3389384_3389915_-|tail	phage tail protein	tail	A0A0U2QV64	Escherichia_phage	68.8	1.4e-67
WP_161623698.1|3389929_3390739_-|tail	phage tail protein	tail	A0A0U2SAV1	Escherichia_phage	83.6	2.7e-30
WP_065226821.1|3390742_3391327_-	DUF2313 domain-containing protein	NA	M1NVS6	Vibrio_phage	49.2	2.5e-49
WP_161623572.1|3392279_3393851_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	1.7e-169
WP_000624622.1|3393870_3394218_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_096101123.1|3394217_3394895_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	47.2	7.3e-21
WP_096101100.1|3395084_3395537_-	hypothetical protein	NA	A0A2I7S9F0	Vibrio_phage	40.7	1.4e-20
WP_161623699.1|3395533_3396070_-|plate	phage baseplate assembly protein V	plate	A0A2I7S9F6	Vibrio_phage	40.2	7.1e-27
WP_096129346.1|3396060_3397131_-|tail	phage tail protein	tail	M4M9L5	Vibrio_phage	46.9	1.7e-88
WP_161623636.1|3397130_3398405_-	multidrug DMT transporter	NA	A0A2I7S9E8	Vibrio_phage	39.2	1.2e-77
WP_161623700.1|3398404_3400198_-|tail	phage tail protein	tail	M4MHE6	Vibrio_phage	42.6	1.0e-90
WP_096129348.1|3400284_3400680_-	hypothetical protein	NA	M4MB64	Vibrio_phage	48.7	2.8e-20
WP_032239558.1|3400681_3401038_-|tail	Mu phage tail tube protein GpM	tail	NA	NA	NA	NA
WP_096129349.1|3401047_3402523_-|tail	phage tail protein	tail	M1Q565	Vibrio_phage	55.3	4.6e-153
WP_096129350.1|3402527_3402731_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_096129351.1|3402711_3403323_-	hypothetical protein	NA	M1PJ94	Vibrio_phage	43.8	6.2e-35
WP_053289376.1|3403319_3403862_-	phage morphogenesis protein	NA	A0A2I7S9D7	Vibrio_phage	63.1	2.7e-58
WP_096129352.1|3403861_3404299_-	DUF1320 domain-containing protein	NA	A0A2I7S9E9	Vibrio_phage	49.7	2.2e-34
WP_001557428.1|3404681_3405584_-	hypothetical protein	NA	M4MB71	Vibrio_phage	57.2	2.1e-100
WP_096129354.1|3405583_3406546_-	peptidase	NA	M1Q578	Vibrio_phage	46.0	1.0e-76
WP_063269274.1|3406759_3407524_-	hypothetical protein	NA	M4M9M5	Vibrio_phage	60.5	2.4e-92
WP_063269273.1|3407516_3409088_-	DUF935 domain-containing protein	NA	A0A2I7S9K0	Vibrio_phage	57.5	1.5e-157
WP_096129355.1|3409084_3410611_-	hypothetical protein	NA	M1NVQ0	Vibrio_phage	67.9	7.8e-196
WP_032084913.1|3410616_3411198_-	DUF3486 family protein	NA	M1PJ86	Vibrio_phage	56.0	3.8e-50
WP_000101558.1|3411335_3411635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024168521.1|3411637_3411925_-	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	60.6	1.6e-25
WP_161623701.1|3411930_3412236_-	DUF2730 family protein	NA	M1Q558	Vibrio_phage	38.5	8.1e-12
WP_000128966.1|3412220_3412448_-	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_096129488.1|3412444_3413053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096129487.1|3413040_3413451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096129486.1|3413425_3413677_-	hypothetical protein	NA	A0A0C4UQR6	Shigella_phage	67.6	9.0e-25
WP_096129485.1|3413678_3414275_-	N-acetylmuramidase	NA	A0A2I7S9B9	Vibrio_phage	41.7	1.7e-34
WP_096129484.1|3414360_3414810_-	transcriptional regulator	NA	A0A0C4UR27	Shigella_phage	63.5	1.5e-41
WP_079916120.1|3415361_3415628_+	hypothetical protein	NA	Q38493	Escherichia_phage	52.3	1.4e-15
WP_042856716.1|3415566_3415881_-	hypothetical protein	NA	A0A0C4UQY6	Shigella_phage	70.7	3.6e-31
WP_042856717.1|3415873_3416056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096129501.1|3416048_3416588_-	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	85.8	4.7e-87
WP_001107927.1|3416686_3417211_-	host-nuclease inhibitor protein Gam	NA	A0A0C4UQY5	Shigella_phage	96.6	1.4e-88
WP_000586546.1|3417231_3417519_-	hypothetical protein	NA	A0A0C4UQR4	Shigella_phage	92.6	2.4e-42
WP_096129512.1|3417537_3417807_-	hypothetical protein	NA	C9DGL5	Escherichia_phage	60.7	9.0e-23
WP_077627739.1|3417839_3418064_-	hypothetical protein	NA	C9DGL3	Escherichia_phage	85.1	3.4e-31
WP_001026712.1|3418063_3419023_-	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	77.2	2.7e-130
WP_096129165.1|3419061_3421062_-|transposase	transposase	transposase	C9DGL1	Escherichia_phage	92.4	0.0e+00
WP_000985458.1|3421064_3421283_-	transcriptional regulator	NA	A0A0C4UQU0	Shigella_phage	66.7	5.4e-18
WP_079916135.1|3421483_3421999_+	DNA-binding protein	NA	A0A0C4UQZ2	Shigella_phage	38.9	1.9e-21
WP_001287154.1|3422798_3424463_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	99.1	0.0e+00
WP_001023145.1|3424730_3426677_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.6e-07
WP_001237072.1|3427009_3427810_+	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_000271170.1|3427869_3429018_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_032250170.1|3429026_3430247_+	DNA-binding transcriptional regulator NagC	NA	NA	NA	NA	NA
WP_000153129.1|3430294_3431047_+	ribonucleotide monophosphatase NagD	NA	NA	NA	NA	NA
WP_000337087.1|3431443_3433108_+	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.1	1.0e-84
WP_000184585.1|3434343_3435519_-	2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase	NA	NA	NA	NA	NA
WP_000162733.1|3435664_3437089_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_000490838.1|3437202_3438282_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.3e-47
WP_000084469.1|3438278_3438746_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_001278605.1|3438835_3439714_+	CNNM family magnesium/cobalt transport protein CorC	NA	NA	NA	NA	NA
WP_000853023.1|3439738_3441277_+	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_001276770.1|3441403_3443281_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_001177088.1|3443735_3444644_+	glutamate/aspartate ABC transporter substrate-binding protein GltI	NA	NA	NA	NA	NA
WP_000020941.1|3444813_3445554_+	glutamate/aspartate ABC transporter permease GltJ	NA	NA	NA	NA	NA
WP_000272824.1|3445553_3446228_+	glutamate/aspartate ABC transporter permease GltK	NA	NA	NA	NA	NA
WP_000631384.1|3446227_3446953_+	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
WP_001207499.1|3447070_3448006_+	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_001044880.1|3448045_3448528_-	zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_001487837.1|3448762_3451345_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.3	3.1e-184
>prophage 11
NZ_CP041425	Escherichia coli strain STEC388 chromosome, complete genome	4928812	3542100	3571520	4928812	integrase,lysis,portal,transposase	Enterobacteria_phage(57.14%)	42	3562258:3562317	3570136:3570903
WP_161623572.1|3542100_3543672_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	1.7e-169
WP_000624622.1|3543691_3544039_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_096101123.1|3544038_3544716_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	47.2	7.3e-21
WP_161623703.1|3544715_3545123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161623704.1|3545122_3547540_-|portal	phage portal protein	portal	A0A0K2FJ14	Enterobacteria_phage	98.8	0.0e+00
WP_000453611.1|3547514_3548060_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
WP_032145128.1|3548448_3548643_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	95.2	1.6e-26
WP_000738421.1|3549003_3549297_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_001228695.1|3549387_3549570_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001135277.1|3549786_3550284_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
WP_000839596.1|3550283_3550499_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737275.1|3551088_3552171_+	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	76.3	8.9e-154
WP_001204791.1|3552359_3552743_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000971068.1|3552828_3552969_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	5.5e-08
WP_001297087.1|3552965_3553328_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	94.8	6.2e-59
WP_000774478.1|3553324_3553615_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	6.7e-48
WP_000224907.1|3553607_3553778_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001010744.1|3553777_3554233_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	69.5	1.5e-62
WP_072186465.1|3554229_3554331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042815059.1|3554427_3554934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042815056.1|3555172_3555496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000709067.1|3555607_3557134_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.7	7.9e-31
WP_032139864.1|3557191_3557299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070442.1|3557390_3557723_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145900.1|3557790_3558093_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788890.1|3558089_3558791_-	Replication protein P	NA	M1FJ72	Enterobacteria_phage	97.4	7.9e-127
WP_096129341.1|3559803_3560343_-	regulator	NA	M9NZI6	Enterobacteria_phage	67.2	4.0e-62
WP_001067458.1|3560412_3560643_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_000259990.1|3560681_3561437_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	1.4e-92
3562258:3562317	attL	GGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCAGTGGC	NA	NA	NA	NA
WP_000233576.1|3563706_3563913_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995419.1|3563988_3564285_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	6.8e-48
WP_000100847.1|3564290_3565076_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000611716.1|3565072_3565753_+	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	3.0e-131
WP_000149544.1|3565749_3565932_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
WP_000548537.1|3565904_3566096_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_001443983.1|3566106_3566388_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	7.2e-47
WP_000763385.1|3566486_3566705_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
WP_000488407.1|3566752_3567031_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000446905.1|3567002_3567374_+	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
WP_161623705.1|3567229_3568393_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.3	1.5e-199
WP_000805428.1|3568719_3569352_+	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
WP_000729160.1|3570653_3571520_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
3570136:3570903	attR	GCCACTGGAGCACCTCAAAAACACCATCATACACTAAATCAGTAAGTTGGCAGCATCACCAATCTCATTTATCGACTCCACATCCGTATATAACCGATTACTTTATTTAAGACACTGATAGTAGTAAATTCCTTTTTATCCTCTAAGAATGTCTTAATTGAAAATATGTACTCTATTCTAAAAAATAGAGAGCCCCGTTAGATGAATACTTCCGCGCAAAATATATTCAACACAAATATAGACCTGAAGCGGTAAATTACCAGGCTGAAAATTCTTTTTATATTGTCAGGTATTTCTTAAATTATCTTAATCCTTAGACAAGGAAATAAATCAGTTCCAGATTTACAACGCCATCATGGACGAAAAATGAAGCTTTCAGTCTCAGCGACGGTGCGCCTCACCTTCGCAAGAGGTCGCTTCACGCGATAAATCTGAAACGAAACCTGACAGCGCGCCCCGCTTCTGACAAAATAGGCGCATCCCCTTCGACCTACGTAACAGATGGAATCCTCTCTCTGATGGCAGCAAAGATTATTGACGGTAAAACGATTGCGCAGCAGGTGCGCTCTGAAGTTGCTCAAAAAGTTCAGGCGCGTATTGCAGCCGGACTGCGGGCACCAGGACTGGCCGTTGTGCTGGTGGGTAGTAACCCTGCATCGCAAATTTATGTCGCAAGCAAACGCAAGGCTTGTGAAGAAGTCGGGTTCGTCTCCCGCTCTTATGACCTCCCGGAAACCACCAGCGAAGCGGAGCTGCTGGAGCTTATCG	NA	NA	NA	NA
>prophage 12
NZ_CP041425	Escherichia coli strain STEC388 chromosome, complete genome	4928812	3787179	3866885	4928812	holin,plate,transposase	Stx2-converting_phage(37.5%)	63	NA	NA
WP_000131044.1|3787179_3789213_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001335745.1|3789341_3789929_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089110.1|3789942_3791415_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159094.1|3791428_3793099_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_001209100.1|3793311_3793980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000370307.1|3794222_3794918_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023927.1|3794910_3796338_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_096129133.1|3796348_3797068_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339601.1|3797595_3798450_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_100035988.1|3798675_3800001_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	6.5e-114
WP_000474077.1|3800109_3800346_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001306921.1|3800357_3800951_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000621009.1|3801540_3802392_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001285288.1|3803638_3804742_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893260.1|3804753_3806007_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	1.7e-95
WP_001111347.1|3806323_3806734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000121328.1|3806712_3807669_-	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_096129127.1|3807678_3809877_-	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.1	5.6e-38
WP_032293878.1|3809873_3810830_-	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
WP_000070699.1|3810826_3811516_-	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_001019917.1|3811933_3812548_+	YagU family protein	NA	NA	NA	NA	NA
WP_001303809.1|3812795_3813125_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001296887.1|3813437_3814148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096129130.1|3814116_3815760_-	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_089585283.1|3815749_3818275_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000716398.1|3818300_3818969_-	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_000730974.1|3819026_3819614_-	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_161623714.1|3820465_3821008_-	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_001147279.1|3821830_3822058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000866436.1|3822092_3822233_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_000803998.1|3822232_3822496_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000662258.1|3822859_3822961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096129132.1|3824075_3828332_+	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
WP_161623754.1|3829111_3830122_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.9	4.5e-115
WP_000174677.1|3830160_3830562_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189541.1|3830619_3831864_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|3831955_3832414_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293003.1|3832674_3834132_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001295202.1|3834488_3834755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096129125.1|3835061_3835514_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001226164.1|3835510_3836566_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000207587.1|3836636_3837422_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_096129124.1|3837366_3839106_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000006260.1|3839329_3839827_-|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_000009292.1|3840002_3840761_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.5	9.1e-20
WP_001225679.1|3841052_3841793_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000333379.1|3841763_3842531_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|3842736_3843315_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973083.1|3843554_3845999_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000532698.1|3846041_3846515_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_096129123.1|3846668_3847439_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_096129445.1|3849339_3853593_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	44.2	1.4e-21
WP_001142958.1|3856019_3856538_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_161623715.1|3857235_3857736_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|3857770_3857995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056978.1|3858045_3859521_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000611742.1|3859527_3859941_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_161623572.1|3861243_3862815_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	1.7e-169
WP_000624622.1|3862834_3863182_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_096101123.1|3863181_3863859_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	47.2	7.3e-21
WP_096101123.1|3864269_3864947_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	47.2	7.3e-21
WP_000624622.1|3864946_3865294_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_161623572.1|3865313_3866885_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	1.7e-169
>prophage 13
NZ_CP041425	Escherichia coli strain STEC388 chromosome, complete genome	4928812	4086081	4092327	4928812	tail,plate	Vibrio_phage(42.86%)	8	NA	NA
WP_137466630.1|4086081_4086777_-	protein mom	NA	A0A0C4UQZ7	Shigella_phage	96.5	7.5e-130
WP_001557410.1|4086727_4086913_-	Com family DNA-binding transcriptional regulator	NA	A0A0C4UQS3	Shigella_phage	71.0	8.3e-20
WP_096129489.1|4087077_4088895_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_096101152.1|4088881_4089412_-|tail	phage tail protein	tail	A0A0U2QV64	Escherichia_phage	68.8	1.4e-67
WP_161623698.1|4089426_4090236_-|tail	phage tail protein	tail	A0A0U2SAV1	Escherichia_phage	83.6	2.7e-30
WP_065226821.1|4090239_4090824_-	DUF2313 domain-containing protein	NA	M1NVS6	Vibrio_phage	49.2	2.5e-49
WP_001557416.1|4090796_4091885_-|plate	baseplate J/gp47 family protein	plate	A0A2I7S9E5	Vibrio_phage	51.3	1.3e-91
WP_096101100.1|4091874_4092327_-	hypothetical protein	NA	A0A2I7S9F0	Vibrio_phage	40.7	1.4e-20
>prophage 14
NZ_CP041425	Escherichia coli strain STEC388 chromosome, complete genome	4928812	4702386	4768662	4928812	tail,head,transposase,plate,integrase,tRNA	Vibrio_phage(41.67%)	65	4713805:4713819	4769776:4769790
WP_000560983.1|4702386_4702824_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_000920762.1|4702820_4703693_-	virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_001295269.1|4703686_4704286_-	glucose-1-phosphatase	NA	NA	NA	NA	NA
WP_000059678.1|4704384_4705170_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	8.2e-24
WP_000621656.1|4705203_4706100_-	sulfofructose kinase	NA	NA	NA	NA	NA
WP_000718893.1|4706267_4707164_+	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	90.7	1.3e-60
WP_001046453.1|4707187_4708066_+	sulfofructosephosphate aldolase	NA	NA	NA	NA	NA
WP_000870916.1|4708082_4709324_+	sulfoquinovose isomerase	NA	NA	NA	NA	NA
WP_161623740.1|4710562_4712599_+	sulfoquinovosidase	NA	NA	NA	NA	NA
WP_000018380.1|4712644_4714030_+	MFS transporter	NA	NA	NA	NA	NA
4713805:4713819	attL	GGCGCTGGCTGGTTT	NA	NA	NA	NA
WP_096129170.1|4714072_4715476_+	MFS transporter	NA	NA	NA	NA	NA
WP_000723465.1|4715543_4716236_+	porin OmpL	NA	NA	NA	NA	NA
WP_000956313.1|4716326_4717592_-	MFS transporter	NA	NA	NA	NA	NA
WP_000256399.1|4717693_4718674_-	TIM barrel protein	NA	NA	NA	NA	NA
WP_000829798.1|4718681_4719392_-	UTRA domain-containing protein	NA	NA	NA	NA	NA
WP_161623741.1|4719609_4721433_-	ribosome-dependent GTPase TypA	NA	NA	NA	NA	NA
WP_001271717.1|4721805_4723215_+	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_000190577.1|4723388_4724438_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
WP_001188775.1|4724449_4725859_+	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
WP_000893994.1|4725970_4726081_+	YshB family small membrane protein	NA	NA	NA	NA	NA
WP_000116090.1|4726270_4727644_-	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_096129169.1|4727832_4728342_-	Der GTPase-activating protein YihI	NA	NA	NA	NA	NA
WP_000183349.1|4728924_4729557_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_000250006.1|4729938_4732725_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	1.7e-71
WP_000115994.1|4732726_4732969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001311257.1|4733088_4734021_+	acyltransferase	NA	NA	NA	NA	NA
WP_105447861.1|4735451_4736159_-	protein mom	NA	A0A0C4UQZ7	Shigella_phage	98.3	6.3e-132
WP_001372435.1|4736109_4736295_-	Com family DNA-binding transcriptional regulator	NA	A0A0C4UQS3	Shigella_phage	72.6	7.5e-21
WP_161623742.1|4736459_4738277_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_161623633.1|4738263_4738794_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	68.2	9.0e-67
WP_161623634.1|4738808_4739618_-|tail	phage tail protein	tail	A0A0U2SAV1	Escherichia_phage	83.6	1.0e-29
WP_065226821.1|4739621_4740206_-	DUF2313 domain-containing protein	NA	M1NVS6	Vibrio_phage	49.2	2.5e-49
WP_106844709.1|4740178_4741267_-|plate	baseplate J/gp47 family protein	plate	A0A2I7S9E5	Vibrio_phage	51.0	2.2e-91
WP_096101100.1|4741256_4741709_-	hypothetical protein	NA	A0A2I7S9F0	Vibrio_phage	40.7	1.4e-20
WP_161623699.1|4741705_4742242_-|plate	phage baseplate assembly protein V	plate	A0A2I7S9F6	Vibrio_phage	40.2	7.1e-27
WP_096129346.1|4742232_4743303_-|tail	phage tail protein	tail	M4M9L5	Vibrio_phage	46.9	1.7e-88
WP_161623636.1|4743302_4744577_-	multidrug DMT transporter	NA	A0A2I7S9E8	Vibrio_phage	39.2	1.2e-77
WP_096129349.1|4747283_4748759_-|tail	phage tail protein	tail	M1Q565	Vibrio_phage	55.3	4.6e-153
WP_096129350.1|4748763_4748967_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_096129351.1|4748947_4749559_-	hypothetical protein	NA	M1PJ94	Vibrio_phage	43.8	6.2e-35
WP_053289376.1|4749555_4750098_-	phage morphogenesis protein	NA	A0A2I7S9D7	Vibrio_phage	63.1	2.7e-58
WP_161623743.1|4750912_4751815_-|head	phage head protein	head	M4MB71	Vibrio_phage	56.2	3.5e-95
WP_063269274.1|4752989_4753754_-	hypothetical protein	NA	M4M9M5	Vibrio_phage	60.5	2.4e-92
WP_063269273.1|4753746_4755318_-	DUF935 domain-containing protein	NA	A0A2I7S9K0	Vibrio_phage	57.5	1.5e-157
WP_161623750.1|4755314_4756841_-	hypothetical protein	NA	M1NVQ0	Vibrio_phage	67.9	3.5e-196
WP_001557433.1|4756846_4757428_-	DUF3486 family protein	NA	M1PJ86	Vibrio_phage	55.5	6.4e-50
WP_000101558.1|4757565_4757865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024168521.1|4757867_4758155_-	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	60.6	1.6e-25
WP_001397890.1|4758160_4758466_-	DUF2730 family protein	NA	M1Q558	Vibrio_phage	39.6	1.6e-12
WP_042856712.1|4758450_4758678_-	conjugal transfer protein TraR	NA	NA	NA	NA	NA
WP_130570126.1|4758674_4759283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001033674.1|4759270_4759681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001557440.1|4759655_4759907_-	hypothetical protein	NA	A0A0C4UQR6	Shigella_phage	68.9	1.8e-25
WP_040100375.1|4760590_4761040_-	Middle operon regulator	NA	A0A0C4UR27	Shigella_phage	62.7	4.2e-41
WP_105269181.1|4761036_4761588_-	regulatory protein GemA	NA	A0A0C4UQU3	Shigella_phage	81.3	3.2e-83
WP_001057678.1|4761565_4761955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000240903.1|4761947_4762130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161623744.1|4762122_4762662_-	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	86.9	7.2e-88
WP_032239583.1|4763597_4764017_-	hypothetical protein	NA	A0A0C4UR25	Shigella_phage	89.2	1.1e-67
WP_161623745.1|4764037_4764307_-	hypothetical protein	NA	C9DGL5	Escherichia_phage	97.8	2.4e-31
WP_077627739.1|4764339_4764564_-	hypothetical protein	NA	C9DGL3	Escherichia_phage	85.1	3.4e-31
WP_097333647.1|4764580_4765519_-	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	88.7	1.4e-155
WP_063269192.1|4765556_4767638_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	50.7	9.0e-179
WP_063269193.1|4767640_4767892_-	DNA-binding protein	NA	A0A2D1GNH1	Pseudomonas_phage	54.2	2.0e-16
WP_097333648.1|4768056_4768662_+	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	49.1	1.1e-33
4769776:4769790	attR	AAACCAGCCAGCGCC	NA	NA	NA	NA
>prophage 1
NZ_CP041426	Escherichia coli strain STEC388 plasmid pSTEC388_1, complete sequence	114158	2761	104525	114158	tRNA,transposase,capsid,tail,portal	Salmonella_phage(90.11%)	105	NA	NA
WP_161623756.1|2761_3931_+	uracil-DNA glycosylase	NA	J9Q7Z2	Salmonella_phage	92.2	1.7e-206
WP_000627054.1|4056_4488_+	hypothetical protein	NA	J9Q6I8	Salmonella_phage	86.7	1.5e-64
WP_000047683.1|4605_5634_+	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	84.6	4.8e-141
WP_161623726.1|6079_7102_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.4	1.0e-199
WP_161623727.1|7101_7881_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.2	1.3e-138
WP_161623757.1|7924_9274_-	AAA family ATPase	NA	J9Q7G4	Salmonella_phage	93.0	2.1e-232
WP_096127582.1|9317_10058_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	89.2	1.1e-126
WP_000342417.1|10342_11110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160378290.1|11162_11516_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	97.9	1.4e-44
WP_000161228.1|11521_12190_-	AAA family ATPase	NA	J9Q7R7	Salmonella_phage	91.4	1.7e-110
WP_001711191.1|12509_12779_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_000072677.1|12786_13308_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_161623758.1|13476_13728_-	hypothetical protein	NA	J9Q7R6	Salmonella_phage	76.8	5.3e-25
WP_161623759.1|13729_14422_-	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	94.3	9.5e-125
WP_000064175.1|14435_14759_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	88.8	2.9e-44
WP_096127586.1|15129_16170_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_161623760.1|17100_20790_-|tail	phage tail protein	tail	J9Q713	Salmonella_phage	69.0	0.0e+00
WP_001293195.1|20807_21401_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	90.9	2.0e-99
WP_097497806.1|21388_22186_-|tail	phage tail protein	tail	J9Q7R4	Salmonella_phage	93.6	2.9e-154
WP_000511446.1|22178_22877_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	97.0	5.1e-134
WP_000442113.1|22959_23295_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	86.4	3.0e-52
WP_161623761.1|23337_27867_-	tape measure protein	NA	J9Q712	Salmonella_phage	66.0	0.0e+00
WP_000952686.1|27874_28099_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	94.6	8.8e-32
WP_000163861.1|28224_28542_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	96.2	8.6e-49
WP_000072377.1|28597_29344_-	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	93.5	2.8e-122
WP_000469440.1|29418_29802_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	82.7	1.2e-57
WP_000523628.1|29803_30277_-	hypothetical protein	NA	J9Q711	Salmonella_phage	90.4	3.3e-76
WP_001027663.1|30267_30612_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	95.6	2.3e-55
WP_000057118.1|30691_31525_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	92.1	1.3e-141
WP_000801185.1|31524_31959_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	82.6	1.1e-59
WP_161623762.1|32003_32924_-	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	83.6	3.7e-132
WP_161623763.1|32997_33873_-|capsid	phage major capsid protein	capsid	J9Q710	Salmonella_phage	94.5	1.5e-154
WP_072328019.1|33898_34786_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	88.9	2.1e-132
WP_161623764.1|34807_36382_-|portal	phage portal protein	portal	J9Q7R1	Salmonella_phage	92.7	1.4e-285
WP_001007301.1|36408_37665_-	hypothetical protein	NA	J9Q7Y2	Salmonella_phage	96.7	7.5e-245
WP_000215413.1|37664_38297_-	hypothetical protein	NA	J9Q6D4	Salmonella_phage	83.8	1.8e-90
WP_000176292.1|38493_38760_-	hypothetical protein	NA	J9Q757	Salmonella_phage	88.6	1.4e-36
WP_000129633.1|38769_39660_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	98.6	2.6e-167
WP_001717191.1|39656_40322_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	98.6	2.8e-110
WP_000161986.1|40318_40987_-	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	89.6	5.6e-106
WP_021547990.1|40986_41667_-	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	87.6	4.6e-108
WP_161623765.1|41749_43309_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	92.3	8.3e-278
WP_001291061.1|43311_43590_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	58.2	4.6e-22
WP_001308871.1|43622_44222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161623766.1|44362_44911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161623767.1|44938_45358_+	hypothetical protein	NA	J9Q806	Salmonella_phage	58.8	1.4e-38
WP_032083927.1|45362_45887_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	79.1	1.5e-66
WP_161623768.1|46262_46649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161623769.1|46843_47494_+	hypothetical protein	NA	J9Q754	Salmonella_phage	83.8	6.4e-99
WP_161623770.1|47542_47746_+	hypothetical protein	NA	J9Q7I3	Salmonella_phage	92.5	2.7e-27
WP_161623771.1|48613_49096_-	hypothetical protein	NA	J9Q805	Salmonella_phage	69.8	2.3e-61
WP_048948307.1|49446_49857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161623772.1|49938_50334_-	hypothetical protein	NA	J9Q7I1	Salmonella_phage	54.6	5.4e-32
WP_000749406.1|50459_50771_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	64.1	3.3e-29
WP_001755489.1|50925_51255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032252448.1|52831_53230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032252493.1|53524_53767_-	DUF1380 domain-containing protein	NA	J9Q7H8	Salmonella_phage	78.4	2.0e-29
WP_001755492.1|53926_55960_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	24.1	2.2e-44
WP_000004356.1|56117_57218_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_032252452.1|57516_57897_-	hypothetical protein	NA	J9Q801	Salmonella_phage	66.3	8.5e-27
WP_161623773.1|57896_58601_-	hypothetical protein	NA	J9Q6K2	Salmonella_phage	76.4	3.0e-86
WP_161623774.1|58662_60348_-	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	92.2	0.0e+00
WP_000467662.1|60451_61066_-	hypothetical protein	NA	A0A0E3GMH9	Enterobacteria_phage	82.8	1.2e-99
WP_001718087.1|61405_61975_-	hypothetical protein	NA	J9Q7H6	Salmonella_phage	61.4	1.4e-52
WP_014962273.1|62114_62273_-	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_161623775.1|62272_62698_-	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	83.7	2.1e-58
WP_014962274.1|62791_62980_-	hypothetical protein	NA	J9Q800	Salmonella_phage	51.6	9.4e-11
WP_021512350.1|62989_63484_-	hypothetical protein	NA	J9Q6J9	Salmonella_phage	56.2	3.0e-24
WP_001404443.1|63632_64223_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	83.8	3.7e-93
WP_000121543.1|64805_65036_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	84.2	5.9e-31
WP_000559570.1|65221_65815_-	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	86.3	3.4e-99
WP_032252459.1|65998_66808_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	52.9	2.9e-64
WP_062859151.1|66966_67524_-	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	82.5	4.8e-87
WP_001718079.1|67533_67953_-	hypothetical protein	NA	J9Q743	Salmonella_phage	71.9	3.2e-51
WP_032252462.1|68014_68659_-	AAA family ATPase	NA	J9Q7H4	Salmonella_phage	80.8	3.0e-96
WP_160378288.1|68658_69129_-	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	90.4	2.8e-80
WP_001348729.1|69131_69545_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	84.7	2.3e-62
WP_022644976.1|69546_70650_-	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	86.9	3.2e-191
WP_001011859.1|70821_71691_-	hypothetical protein	NA	J9Q742	Salmonella_phage	81.0	3.1e-133
WP_000122502.1|71768_72911_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	88.7	2.6e-196
WP_000623685.1|73017_75333_-	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	84.4	0.0e+00
WP_000037962.1|75406_75976_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	86.8	1.1e-91
WP_161623776.1|75985_76729_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	47.2	1.2e-51
WP_001404451.1|76718_78635_-	AAA family ATPase	NA	J9Q741	Salmonella_phage	73.2	4.5e-249
WP_161623777.1|78864_79950_-	exonuclease SbcCD subunit D	NA	J9Q7S9	Salmonella_phage	87.0	3.7e-184
WP_000364573.1|80204_80849_-	hypothetical protein	NA	J9Q739	Salmonella_phage	86.3	2.9e-107
WP_001348683.1|81050_82265_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	45.4	8.4e-76
WP_001229345.1|82844_83057_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	94.3	3.4e-33
WP_032252468.1|83056_83392_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	84.7	1.6e-48
WP_023135695.1|83388_83568_-	hypothetical protein	NA	J9Q6J1	Salmonella_phage	81.4	1.6e-15
WP_023135696.1|83607_83883_-	hypothetical protein	NA	J9Q738	Salmonella_phage	91.2	1.1e-44
WP_032187690.1|84763_87781_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	25.2	2.3e-21
WP_106735854.1|87795_88959_-	DUF4268 domain-containing protein	NA	NA	NA	NA	NA
WP_161623778.1|88968_90297_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_161623779.1|90296_92726_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U4	Liberibacter_phage	28.4	6.1e-25
WP_001711109.1|93153_93354_-	membrane protein	NA	J9Q6J0	Salmonella_phage	54.5	1.8e-07
WP_161623783.1|93444_95784_-	recombinase RecA	NA	J9Q736	Salmonella_phage	85.1	1.8e-29
WP_161623727.1|96769_97549_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.2	1.3e-138
WP_161623726.1|97548_98571_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.4	1.0e-199
WP_161623784.1|98824_99940_+	DNA primase	NA	J9Q720	Salmonella_phage	93.2	1.3e-208
WP_161623780.1|100015_100792_+	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	41.1	2.0e-51
WP_161623785.1|101072_101330_+	hypothetical protein	NA	J9Q7R9	Salmonella_phage	59.0	8.6e-15
WP_096129526.1|102135_103104_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.3	8.5e-172
WP_000979130.1|103710_103890_+	hypothetical protein	NA	J9Q729	Salmonella_phage	72.4	1.4e-16
WP_106889137.1|104234_104525_+	C-type natriuretic protein	NA	J9Q7S1	Salmonella_phage	77.1	1.5e-36
>prophage 1
NZ_CP041427	Escherichia coli strain STEC388 plasmid pSTEC388_2, complete sequence	67518	14175	58362	67518	transposase,integrase	Stx2-converting_phage(35.71%)	39	11249:11263	41570:41584
11249:11263	attL	TCCCTGACGGCGCAG	NA	NA	NA	NA
WP_000082158.1|14175_15147_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000271717.1|15768_16188_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001436678.1|16234_16537_-	antirestriction protein	NA	NA	NA	NA	NA
WP_000274480.1|17906_18341_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001104880.1|18354_18576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096095885.1|18576_19230_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	38.4	6.8e-24
WP_096095886.1|19809_21510_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	53.1	1.7e-170
WP_001309256.1|21739_22051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001385002.1|22114_22474_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000270807.1|22480_22624_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000756328.1|23801_24764_-	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	68.2	2.3e-113
WP_000817635.1|24760_25966_-	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	89.2	1.6e-204
WP_001132895.1|26682_26934_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_001270417.1|26930_27218_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	47.4	2.2e-19
WP_000361610.1|28144_29122_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.2	1.4e-100
WP_096095888.1|29406_30147_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_096095891.1|30267_30393_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_096095946.1|32814_33393_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_072101556.1|33469_34183_+	molecular chaperone	NA	NA	NA	NA	NA
WP_052943207.1|34184_34595_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_161623788.1|34615_37120_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_161623789.1|37304_37964_+	molecular chaperone	NA	NA	NA	NA	NA
WP_161623790.1|37954_38464_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_161623791.1|38480_39590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096095951.1|39700_40489_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000169527.1|41009_41309_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000878218.1|41305_42172_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
41570:41584	attR	CTGCGCCGTCAGGGA	NA	NA	NA	NA
WP_086563478.1|43113_43899_-	YaiO family outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_086563480.1|43895_44495_-	acetyltransferase	NA	NA	NA	NA	NA
WP_096095959.1|44445_45657_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_096095958.1|45660_46320_-	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_161623572.1|49498_51070_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	1.7e-169
WP_161623792.1|51089_51407_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	77.2	4.7e-39
WP_096101123.1|51447_52125_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	47.2	7.3e-21
WP_000624622.1|52124_52472_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_161623572.1|52491_54063_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	1.7e-169
WP_096095970.1|55910_56714_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000169527.1|57199_57499_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000878218.1|57495_58362_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
>prophage 1
NZ_CP041428	Escherichia coli strain STEC388 plasmid pSTEC388_3, complete sequence	67626	21900	57693	67626	transposase	Stx2-converting_phage(69.23%)	35	NA	NA
WP_001278689.1|21900_22122_+	conjugal transfer protein TraR	NA	A2I309	Vibrio_virus	40.8	3.3e-07
WP_161623800.1|22281_23547_+	TraC family protein	NA	NA	NA	NA	NA
WP_096101123.1|23583_24261_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	47.2	7.3e-21
WP_000624622.1|24260_24608_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_161623572.1|24627_26199_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	1.7e-169
WP_096101123.1|26659_27337_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	47.2	7.3e-21
WP_000624622.1|27336_27684_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_161623572.1|27703_29275_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	1.7e-169
WP_161623806.1|29324_30323_+	conjugal transfer protein TraC	NA	NA	NA	NA	NA
WP_000214084.1|30319_30706_+	type-F conjugative transfer system protein TrbI	NA	NA	NA	NA	NA
WP_001203745.1|30702_31335_+	type-F conjugative transfer system protein TraW	NA	NA	NA	NA	NA
WP_096094291.1|31331_32324_+	conjugal transfer pilus assembly protein TraU	NA	NA	NA	NA	NA
WP_000277845.1|32349_32811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161623801.1|33320_33959_+	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
WP_000821821.1|33955_35764_+	type-F conjugative transfer system mating-pair stabilization protein TraN	NA	NA	NA	NA	NA
WP_000864325.1|35790_36048_+	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
WP_001030376.1|36040_36784_+	type-F conjugative transfer system pilin assembly protein TraF	NA	NA	NA	NA	NA
WP_001287898.1|36799_37147_+	conjugal transfer protein TrbA	NA	NA	NA	NA	NA
WP_000624108.1|37265_37550_+	type-F conjugative transfer system pilin chaperone TraQ	NA	NA	NA	NA	NA
WP_000052618.1|37536_38082_+	type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB	NA	NA	NA	NA	NA
WP_001443292.1|38011_38374_+	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
WP_000982833.1|38370_39747_+	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_161623802.1|39743_42566_+	conjugal transfer mating pair stabilization protein TraG	NA	NA	NA	NA	NA
WP_001454501.1|42587_43067_+	surface exclusion inner membrane protein	NA	NA	NA	NA	NA
WP_000782454.1|43115_43847_+	complement resistance protein TraT	NA	NA	NA	NA	NA
WP_000009363.1|44099_46325_+	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_161623803.1|46324_51595_+	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_021518885.1|51614_52361_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.9	1.9e-09
WP_000704522.1|52419_53280_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.0	2.3e-11
WP_161623804.1|53382_53943_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_001372275.1|54074_54326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161623572.1|54358_55930_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	1.7e-169
WP_000624622.1|55949_56297_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_096101123.1|56296_56974_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	47.2	7.3e-21
WP_001233868.1|57231_57693_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.7	2.5e-20
