The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041422	Escherichia coli strain STEC409 chromosome, complete genome	4665377	1009847	1023806	4665377		Escherichia_phage(60.0%)	13	NA	NA
WP_001295182.1|1009847_1010609_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|1010602_1011229_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_161620465.1|1011368_1012430_+	murein hydrolase activator NlpD	NA	A0A2L1IV26	Escherichia_phage	100.0	3.6e-06
WP_079850613.1|1013137_1013284_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_000081550.1|1013346_1014339_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104441.1|1014432_1015797_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136918.1|1015885_1016662_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|1016666_1017305_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590405.1|1017301_1018564_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.0	8.3e-135
WP_000847985.1|1018560_1019469_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001272546.1|1019634_1020432_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	4.5e-70
WP_001141320.1|1020482_1021139_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	47.0	6.6e-51
WP_001272928.1|1021244_1023806_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
>prophage 2
NZ_CP041422	Escherichia coli strain STEC409 chromosome, complete genome	4665377	1368314	1454960	4665377	capsid,lysis,portal,terminase,protease,tail,tRNA,head	Enterobacteria_phage(57.14%)	93	NA	NA
WP_001163428.1|1368314_1368515_-	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_032084204.1|1368638_1368983_-	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	98.2	1.0e-58
WP_123005252.1|1369225_1369828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763363.1|1370038_1370260_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_001386642.1|1370358_1370640_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000548531.1|1370650_1370842_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_000682299.1|1370814_1370997_-	DUF1317 domain-containing protein	NA	Q6H9Z1	Enterobacteria_phage	98.3	3.7e-28
WP_032084203.1|1370993_1371674_-	YqaJ viral recombinase family protein	NA	Q6H9Z0	Enterobacteria_phage	99.6	6.0e-132
WP_000100847.1|1371670_1372456_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995452.1|1372461_1372758_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	2.3e-48
WP_000233576.1|1372834_1373041_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_032084202.1|1373521_1373902_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001295669.1|1374131_1374824_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	1.5e-109
WP_000184665.1|1374934_1375162_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
WP_001182882.1|1375192_1375732_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.7	8.9e-62
WP_032084208.1|1375818_1376748_+	replication protein	NA	M1FN81	Enterobacteria_phage	68.0	7.3e-112
WP_032084201.1|1376744_1377446_+	Replication protein P	NA	M1FJ72	Enterobacteria_phage	97.9	1.6e-127
WP_000145941.1|1377442_1377616_+	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	90.9	9.2e-21
WP_001224618.1|1377762_1378257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001038620.1|1378721_1379138_+	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_000520499.1|1379116_1379518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072254492.1|1379641_1379743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032084200.1|1379739_1380195_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	3.1e-60
WP_000224915.1|1380194_1380365_+	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774486.1|1380357_1380648_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
WP_032084199.1|1380644_1381007_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	93.2	1.1e-58
WP_032084198.1|1381003_1381144_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	65.1	4.7e-07
WP_001204791.1|1381229_1381613_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_161620474.1|1381802_1382900_-	porin	NA	Q1MVN1	Enterobacteria_phage	76.8	2.5e-156
WP_000839596.1|1383472_1383688_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_032084197.1|1383687_1384185_+	lysozyme	NA	A5LH83	Enterobacteria_phage	97.0	2.7e-89
WP_001228695.1|1384401_1384584_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738421.1|1384674_1384968_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_032084195.1|1385330_1385525_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	95.2	6.3e-26
WP_000453576.1|1385913_1386459_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	99.4	4.7e-95
WP_016245259.1|1386433_1388359_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
WP_000198149.1|1388355_1388562_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_032084193.1|1388558_1390160_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	1.4e-309
WP_001299443.1|1391469_1391802_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_032084192.1|1391857_1392883_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.7	1.8e-188
WP_023281240.1|1392924_1393323_+	hypothetical protein	NA	A0A0K2FIR1	Enterobacteria_phage	97.0	1.9e-61
WP_032084191.1|1393334_1393688_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	98.3	2.2e-61
WP_000975070.1|1393699_1394278_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	100.0	2.7e-80
WP_000683142.1|1394274_1394670_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	2.9e-70
WP_097722350.1|1394677_1395418_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	96.7	1.2e-128
WP_021545565.1|1395433_1395856_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.7	6.9e-70
WP_000459480.1|1395837_1396272_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	2.0e-64
WP_087634302.1|1396264_1398844_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	98.0	0.0e+00
WP_032084189.1|1398840_1399170_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	94.5	1.6e-53
WP_062873924.1|1399169_1399868_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	1.8e-131
WP_032084187.1|1399873_1400617_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	2.8e-146
WP_000090891.1|1400553_1401186_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_134876242.1|1401246_1404729_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.7	0.0e+00
WP_001230340.1|1404795_1405395_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.0	8.8e-111
WP_161620475.1|1405459_1408687_+|tail	phage tail protein	tail	X2KTY7	Enterobacteria_phage	58.8	6.4e-06
WP_033566705.1|1408686_1409268_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.2	1.6e-101
WP_000465928.1|1412515_1413256_-	fimbrial chaperone	NA	NA	NA	NA	NA
WP_000038438.1|1413360_1413945_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000215124.1|1414314_1414794_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_000174639.1|1414790_1416209_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
WP_000937424.1|1416247_1417174_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_001155227.1|1417210_1417666_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_000396036.1|1417843_1418548_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001294674.1|1418562_1419093_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_001619115.1|1419166_1421596_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.1	5.1e-40
WP_000918162.1|1421791_1424326_+	bifunctional glycosyl transferase/transpeptidase	NA	NA	NA	NA	NA
WP_000124438.1|1424545_1426789_+	ferrichrome porin FhuA	NA	NA	NA	NA	NA
WP_001158929.1|1426839_1427637_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	6.0e-14
WP_032083483.1|1427636_1428527_+	Fe(3+)-hydroxamate ABC transporter substrate-binding protein FhuD	NA	NA	NA	NA	NA
WP_000044089.1|1428523_1430506_+	Fe(3+)-hydroxamate ABC transporter permease FhuB	NA	NA	NA	NA	NA
WP_000045290.1|1430663_1431944_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_000845394.1|1432168_1433590_+	H(+)/Cl(-) exchange transporter ClcA	NA	NA	NA	NA	NA
WP_120795373.1|1433613_1433679_+	protein YadW	NA	NA	NA	NA	NA
WP_001295564.1|1433671_1434016_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
WP_000964221.1|1434062_1434686_-	TRIC cation channel family protein	NA	NA	NA	NA	NA
WP_001129927.1|1434723_1435524_-	vitamin B12 ABC transporter substrate-binding protein BtuF	NA	NA	NA	NA	NA
WP_000689844.1|1435516_1436215_-	5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_000057067.1|1436298_1437816_+	dGTPase	NA	NA	NA	NA	NA
WP_000753946.1|1437945_1439370_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
WP_000929443.1|1439524_1440682_+	CdaR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000272188.1|1440770_1441157_-	DUF3461 family protein	NA	NA	NA	NA	NA
WP_161620476.1|1441318_1442131_-	phosphodiesterase YaeI	NA	NA	NA	NA	NA
WP_001186650.1|1442184_1443009_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_001094588.1|1443039_1445712_-	bifunctional uridylyltransferase/uridylyl-removing protein GlnD	NA	NA	NA	NA	NA
WP_001018194.1|1445773_1446568_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_000246882.1|1446935_1447661_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_000818114.1|1447918_1448770_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_000224573.1|1448916_1449642_+	UMP kinase	NA	NA	NA	NA	NA
WP_000622418.1|1449933_1450491_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_000811923.1|1450582_1451779_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_001295562.1|1451967_1452726_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
WP_000922446.1|1452738_1453596_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_001295561.1|1453607_1454960_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
>prophage 3
NZ_CP041422	Escherichia coli strain STEC409 chromosome, complete genome	4665377	1553399	1563506	4665377	integrase	Enterobacteria_phage(100.0%)	12	1544369:1544381	1557820:1557832
1544369:1544381	attL	GTAAATCATGACA	NA	NA	NA	NA
WP_075631356.1|1553399_1554566_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.9	1.5e-143
WP_089537199.1|1554577_1555822_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_072648911.1|1555814_1556468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000446131.1|1556681_1557254_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.8	6.5e-95
WP_000638631.1|1557327_1557828_-	transactivation protein	NA	NA	NA	NA	NA
WP_161620479.1|1557824_1558559_-	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	98.0	4.4e-128
1557820:1557832	attR	GTAAATCATGACA	NA	NA	NA	NA
WP_001149162.1|1559111_1559378_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	98.9	1.4e-44
WP_074530521.1|1559374_1559974_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	81.8	6.0e-51
WP_001244665.1|1559966_1560254_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_000459294.1|1560246_1560702_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
WP_000856729.1|1560837_1561158_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_097302326.1|1561172_1563506_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	99.0	0.0e+00
>prophage 4
NZ_CP041422	Escherichia coli strain STEC409 chromosome, complete genome	4665377	2525805	2574460	4665377	capsid,portal,terminase,plate,holin,tail,integrase,head	Enterobacteria_phage(38.3%)	63	2518770:2518784	2531199:2531213
2518770:2518784	attL	TAATGCCTGGTGAAT	NA	NA	NA	NA
WP_033813123.1|2525805_2526936_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.1	5.7e-103
WP_000113182.1|2526913_2527162_-	excisionase	NA	NA	NA	NA	NA
WP_161620504.1|2527226_2529698_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.0	4.2e-58
WP_032083069.1|2529791_2529983_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_032083068.1|2529979_2530168_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_033813301.1|2530742_2530952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033813300.1|2530952_2531591_-	hypothetical protein	NA	NA	NA	NA	NA
2531199:2531213	attR	TAATGCCTGGTGAAT	NA	NA	NA	NA
WP_001171935.1|2531615_2531822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161620505.1|2531981_2532137_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_064578994.1|2532333_2532822_-	helix-turn-helix domain-containing protein	NA	Q7Y5W5	Haemophilus_phage	47.5	2.4e-13
WP_053289472.1|2532892_2533177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161620506.1|2533160_2533586_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_161620507.1|2533657_2534698_+	phage replisome organizer	NA	A0A0U2RT81	Escherichia_phage	87.6	9.6e-105
WP_161620508.1|2534609_2535152_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	3.4e-85
WP_161620509.1|2535186_2535942_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	84.6	2.3e-108
WP_000034249.1|2535928_2536429_+	ead/Ea22-like family protein	NA	G9L663	Escherichia_phage	65.9	1.2e-36
WP_033558349.1|2536523_2536742_+	DUF4014 domain-containing protein	NA	A0A1I9LJM2	Stx_converting_phage	93.1	2.3e-29
WP_062873881.1|2536743_2537193_+	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	79.4	2.6e-38
WP_096111919.1|2537194_2537824_+	dTDP-6-deoxy-L-hexose 3-O-methyltransferase	NA	A0A1U9AJ59	Stx1_converting_phage	53.4	1.7e-48
WP_000673136.1|2538023_2538314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000018425.1|2540230_2540443_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	2.0e-17
WP_042099681.1|2541075_2541354_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	4.8e-11
WP_064578987.1|2541355_2542405_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.4e-108
WP_062873948.1|2542417_2542792_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	65.5	1.1e-37
WP_077170456.1|2542788_2543610_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.2e-78
WP_000917767.1|2543837_2544035_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_062873949.1|2544185_2545244_+	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	99.4	6.2e-208
WP_161620510.1|2545628_2546588_+	Shiga toxin Stx2 subunit A	NA	Q9MBZ8	Enterobacteria_phage	99.1	2.9e-172
WP_000738063.1|2546600_2546864_+	Shiga toxin Stx2e subunit B	NA	Q9MBZ7	Enterobacteria_phage	100.0	2.9e-42
WP_032083190.1|2547282_2547675_+|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	100.0	7.4e-58
WP_032084004.1|2547664_2547940_+|holin	phage holin family protein	holin	Q9MBZ4	Enterobacteria_phage	97.8	9.5e-44
WP_032084002.1|2547942_2548320_+	M15 family metallopeptidase	NA	Q9MBZ3	Enterobacteria_phage	97.6	1.3e-64
WP_032084003.1|2548390_2548672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001305859.1|2548803_2548917_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	89.2	2.5e-11
WP_161620553.1|2549189_2549486_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	95.9	3.6e-49
WP_158122754.1|2550069_2550618_+|terminase	terminase small subunit	terminase	K7PJS9	Enterobacteria_phage	60.6	3.2e-59
WP_161620511.1|2550568_2552506_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	64.0	6.3e-251
WP_161620512.1|2552509_2552719_+|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	49.2	1.4e-10
WP_161620415.1|2552763_2554287_+|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	63.2	7.6e-183
WP_161620513.1|2554276_2555893_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	54.5	2.8e-103
WP_000598339.1|2555931_2556267_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	55.1	1.9e-22
WP_096934545.1|2556336_2557365_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	58.9	1.3e-109
WP_096934544.1|2557415_2557781_+	DNA breaking-rejoining protein	NA	NA	NA	NA	NA
WP_096968565.1|2557783_2558185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097446582.1|2558165_2558888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096934551.1|2558899_2559451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096934541.1|2559434_2560058_+|plate	phage baseplate assembly protein V	plate	F1BUP5	Erwinia_phage	30.2	1.1e-10
WP_040091455.1|2560091_2560448_+|plate	baseplate assembly protein	plate	V5YTB2	Pseudomonas_phage	46.8	2.8e-19
WP_161620514.1|2560422_2561337_+|plate	baseplate assembly protein	plate	D5LGZ3	Escherichia_phage	44.6	1.8e-62
WP_032083602.1|2561329_2561920_+|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	39.2	1.4e-23
WP_032083601.1|2561916_2563134_+	hypothetical protein	NA	Q8W613	Enterobacteria_phage	99.6	1.5e-136
WP_032083600.1|2563136_2563682_+|tail	tail assembly protein	tail	Q8W612	Enterobacteria_phage	95.0	5.6e-96
WP_000015654.1|2563736_2565212_+|tail	tail protein	tail	R9TMQ0	Vibrio_phage	38.7	2.1e-76
WP_000988219.1|2565208_2565727_+|tail	tail protein	tail	NA	NA	NA	NA
WP_001291421.1|2565786_2566089_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_161620515.1|2566206_2567859_+	hypothetical protein	NA	R9TRP8	Vibrio_phage	33.6	1.7e-47
WP_032083598.1|2567861_2568350_+|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	34.1	4.0e-13
WP_032083597.1|2568324_2568543_+|tail	tail protein	tail	A0A077K8R0	Ralstonia_phage	50.7	1.1e-10
WP_032083596.1|2568533_2569622_+	phage late control protein	NA	R9TNM7	Vibrio_phage	29.2	1.1e-31
WP_161620516.1|2569646_2571650_+|tail	phage tail protein	tail	A0A0U2SH60	Escherichia_phage	58.3	1.4e-229
WP_032083574.1|2571649_2572213_+	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	96.8	3.9e-100
WP_001295593.1|2572751_2573186_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_000837924.1|2573326_2574460_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
>prophage 5
NZ_CP041422	Escherichia coli strain STEC409 chromosome, complete genome	4665377	2752149	2803855	4665377	lysis,portal,terminase,protease,tail,transposase,integrase	Enterobacteria_phage(45.83%)	66	2770273:2770288	2809530:2809545
WP_000527809.1|2752149_2753610_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.5e-42
WP_000347482.1|2753698_2754982_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_122985608.1|2755586_2755700_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	83.3	2.9e-07
WP_000836768.1|2755768_2756002_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086527.1|2756318_2756909_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000885587.1|2757006_2757582_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	96.9	2.0e-104
WP_024183964.1|2757581_2760605_-|tail	tail protein	tail	U5N099	Enterobacteria_phage	81.4	2.1e-67
WP_001230352.1|2760669_2761269_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	1.3e-109
WP_095512753.1|2761335_2764734_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	88.7	0.0e+00
WP_023277304.1|2764794_2765442_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.9	4.7e-110
WP_020219026.1|2765339_2766083_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.4	9.2e-150
WP_040091753.1|2766087_2766786_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	97.8	2.4e-131
WP_000447253.1|2766795_2767125_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001365823.1|2767124_2770190_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	99.3	0.0e+00
WP_001161009.1|2770161_2770491_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
2770273:2770288	attL	AAGGCTGAAATCAGCC	NA	NA	NA	NA
WP_001297778.1|2770499_2770886_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	99.2	3.6e-65
WP_000211109.1|2770946_2771690_-|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	100.0	7.8e-133
WP_001079398.1|2771701_2772103_-|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_020219021.1|2772099_2772678_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001283153.1|2772689_2772965_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|2772957_2773281_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001136587.1|2773367_2775395_-|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.5	0.0e+00
WP_011478361.1|2775339_2776920_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	100.0	4.3e-290
WP_001072975.1|2776847_2777060_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_001774468.1|2777056_2779156_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	96.4	0.0e+00
WP_000421825.1|2779164_2779704_-	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
WP_001031431.1|2780264_2780471_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	91.2	6.7e-26
WP_000035574.1|2780771_2781182_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	89.0	2.1e-63
WP_001019606.1|2781333_2781507_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|2781678_2781834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122134696.1|2781913_2781979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071524604.1|2781981_2782170_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|2782180_2782393_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|2782756_2783254_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|2783250_2783784_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189915.1|2783780_2784092_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|2784096_2784312_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|2785065_2785281_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|2785581_2785794_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|2785848_2785938_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047135.1|2786215_2786968_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001265198.1|2786981_2788031_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_012304870.1|2788032_2788311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|2788377_2788629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|2788845_2789001_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|2789072_2789360_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|2789359_2789599_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|2789623_2789929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001317460.1|2790131_2790464_+	protein flxA	NA	NA	NA	NA	NA
WP_000589012.1|2790900_2792241_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_001151195.1|2792274_2792694_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	93.4	1.3e-55
WP_032084229.1|2792734_2793700_-	phage O protein family	NA	U5P0A0	Shigella_phage	61.2	1.7e-55
WP_000705349.1|2793680_2794202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000476993.1|2794185_2794413_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001003381.1|2794490_2794898_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
WP_000379589.1|2795090_2795246_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_000344954.1|2795247_2795823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|2796309_2796498_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083280.1|2796494_2796686_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000048324.1|2796779_2799251_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_001296941.1|2799338_2799575_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_021533434.1|2799609_2800890_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	6.6e-156
WP_001360138.1|2800909_2801020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836066.1|2801077_2802097_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001619484.1|2802108_2803323_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|2803528_2803855_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
2809530:2809545	attR	AAGGCTGAAATCAGCC	NA	NA	NA	NA
>prophage 6
NZ_CP041422	Escherichia coli strain STEC409 chromosome, complete genome	4665377	2942605	2989340	4665377	capsid,portal,terminase,plate,holin,tail,tRNA,integrase,head	Enterobacteria_phage(80.0%)	60	2945008:2945032	2981982:2982006
WP_032083498.1|2942605_2943355_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001154183.1|2943354_2943906_-	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000956529.1|2943968_2944949_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
2945008:2945032	attL	AAAGAAAAAAGGCCGCAGAGCGGCC	NA	NA	NA	NA
WP_000416306.1|2945138_2945534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001247208.1|2945544_2946480_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	50.8	5.6e-80
WP_000904672.1|2946568_2946877_-	helix-turn-helix domain-containing protein	NA	A0A0M5M1I9	Salmonella_phage	53.1	1.3e-22
WP_001151410.1|2946973_2947252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917809.1|2947266_2947605_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	87.1	2.3e-52
WP_032083497.1|2947615_2947903_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	75.8	3.0e-32
WP_000514277.1|2947914_2948157_+	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_032083496.1|2948153_2948291_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	90.9	3.0e-06
WP_032083495.1|2948358_2948775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985156.1|2948798_2949002_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	82.1	4.2e-25
WP_000153711.1|2948998_2949265_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	3.4e-30
WP_032083494.1|2949261_2949561_+	phage protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	4.8e-41
WP_124827308.1|2949572_2950190_+	hypothetical protein	NA	S5MQL6	Escherichia_phage	37.8	2.1e-06
WP_032083492.1|2950186_2950576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096123900.1|2950572_2953413_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	88.6	0.0e+00
WP_000686499.1|2953489_2954449_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.7	2.0e-181
WP_000211289.1|2954453_2954765_+	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	95.1	1.2e-47
WP_001289966.1|2954828_2955419_+	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	51.3	3.6e-32
WP_001407222.1|2955985_2956510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000087824.1|2956524_2957571_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.1	1.9e-201
WP_032083489.1|2957570_2959322_-	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	98.3	0.0e+00
WP_001262688.1|2959476_2960313_+|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	80.6	1.5e-119
WP_001055104.1|2960336_2961389_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.7	1.3e-194
WP_000632335.1|2961434_2962235_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	91.7	2.3e-130
WP_000063074.1|2962338_2962833_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	100.0	4.1e-90
WP_000864901.1|2962832_2963033_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000104350.1|2963035_2963359_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000072327.1|2963355_2963748_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_032083488.1|2963744_2964152_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	98.5	2.0e-66
WP_000920594.1|2964289_2964757_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
WP_000356358.1|2964749_2965385_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	3.1e-114
WP_001271920.1|2965381_2965963_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.9	7.3e-102
WP_000213447.1|2965959_2966310_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_001111938.1|2966313_2967210_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	99.3	7.1e-157
WP_021293091.1|2967202_2967733_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	5.1e-94
WP_032083487.1|2967735_2969847_+|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	97.7	9.7e-112
WP_161620555.1|2971061_2971223_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	90.0	1.9e-12
WP_001100987.1|2971317_2972496_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_000979954.1|2972592_2973081_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.6e-86
WP_032083444.1|2973093_2975901_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	88.2	0.0e+00
WP_000763327.1|2975887_2976016_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
WP_000665308.1|2976051_2976417_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	3.8e-56
WP_000290450.1|2976471_2976984_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000005409.1|2976983_2978168_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.0	3.6e-225
WP_032083445.1|2978325_2979435_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	93.5	1.5e-193
WP_032083446.1|2979668_2980256_+	amidophosphoribosyltransferase	NA	NA	NA	NA	NA
WP_032083447.1|2980258_2980816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000488107.1|2981128_2981389_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078916.1|2981579_2981720_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_001229265.1|2982023_2982323_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
2981982:2982006	attR	AAAGAAAAAAGGCCGCAGAGCGGCC	NA	NA	NA	NA
WP_000672380.1|2982327_2984715_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018596.1|2984729_2985713_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_001386830.1|2985995_2986040_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|2986162_2986519_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|2986571_2986769_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|2986865_2987408_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144202.1|2987411_2989340_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	9.4e-130
>prophage 7
NZ_CP041422	Escherichia coli strain STEC409 chromosome, complete genome	4665377	3292474	3300639	4665377	transposase	Bodo_saltans_virus(16.67%)	7	NA	NA
WP_001374037.1|3292474_3293086_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A2H4UVM0	Bodo_saltans_virus	29.3	7.8e-14
WP_097722326.1|3293124_3294105_-	LPS O-antigen chain length determinant protein WzzB	NA	NA	NA	NA	NA
WP_001254940.1|3294647_3295799_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.9	1.5e-42
WP_032212789.1|3295847_3296702_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.4	1.2e-68
WP_032083663.1|3296786_3297791_+	NAD-dependent epimerase	NA	A0A2K9L4U8	Tupanvirus	30.4	8.6e-34
WP_001471753.1|3297842_3299009_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.0	7.7e-111
WP_001376067.1|3299232_3300639_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.0	1.2e-36
>prophage 8
NZ_CP041422	Escherichia coli strain STEC409 chromosome, complete genome	4665377	3306527	3313204	4665377		Enterobacteria_phage(57.14%)	7	NA	NA
WP_021558693.1|3306527_3306920_-	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SGE7	Hokovirus	50.0	6.5e-30
WP_001471760.1|3306933_3307482_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	54.7	5.1e-49
WP_001376204.1|3307485_3308364_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	6.6e-107
WP_001376206.1|3308416_3309316_-	dTDP-4-dehydrorhamnose reductase	NA	A0A140G5S3	Enterobacteria_phage	36.2	6.1e-31
WP_001376207.1|3309318_3310401_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.1	3.7e-99
WP_001376208.1|3310740_3311637_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	41.5	4.5e-42
WP_021558692.1|3311812_3313204_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.8	4.8e-19
>prophage 9
NZ_CP041422	Escherichia coli strain STEC409 chromosome, complete genome	4665377	3403278	3412720	4665377		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001373529.1|3403278_3404415_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.9e-162
WP_001423058.1|3404411_3406412_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.6	0.0e+00
WP_001373589.1|3406536_3406998_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	98.7	1.6e-75
WP_001295430.1|3407038_3407509_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|3407555_3408275_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|3408271_3409957_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|3410178_3410910_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|3410969_3411077_+	protein YohO	NA	NA	NA	NA	NA
WP_097317198.1|3411057_3411789_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569316.1|3411793_3412720_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
>prophage 10
NZ_CP041422	Escherichia coli strain STEC409 chromosome, complete genome	4665377	4232648	4281314	4665377	capsid,portal,terminase,plate,holin,tail,tRNA,integrase,head	Enterobacteria_phage(44.64%)	69	4223460:4223475	4256814:4256829
4223460:4223475	attL	ACGCCAGTTGAATGGG	NA	NA	NA	NA
WP_023277396.1|4232648_4233686_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332269.1|4233774_4234872_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_001217553.1|4234933_4235182_+	DinI family protein	NA	K7PLW4	Enterobacteria_phage	100.0	1.8e-38
WP_032083574.1|4235289_4235853_-	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	96.8	3.9e-100
WP_161620516.1|4235852_4237856_-|tail	phage tail protein	tail	A0A0U2SH60	Escherichia_phage	58.3	1.4e-229
WP_032083596.1|4237880_4238969_-	phage late control protein	NA	R9TNM7	Vibrio_phage	29.2	1.1e-31
WP_032083597.1|4238959_4239178_-|tail	tail protein	tail	A0A077K8R0	Ralstonia_phage	50.7	1.1e-10
WP_032083598.1|4239152_4239641_-|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	34.1	4.0e-13
WP_161620515.1|4239643_4241296_-	hypothetical protein	NA	R9TRP8	Vibrio_phage	33.6	1.7e-47
WP_001291421.1|4241413_4241716_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000988219.1|4241775_4242294_-|tail	tail protein	tail	NA	NA	NA	NA
WP_000015654.1|4242290_4243766_-|tail	tail protein	tail	R9TMQ0	Vibrio_phage	38.7	2.1e-76
WP_032083600.1|4243820_4244366_-|tail	tail assembly protein	tail	Q8W612	Enterobacteria_phage	95.0	5.6e-96
WP_032083601.1|4244368_4245586_-	hypothetical protein	NA	Q8W613	Enterobacteria_phage	99.6	1.5e-136
WP_032083602.1|4245582_4246173_-|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	39.2	1.4e-23
WP_000235848.1|4246165_4247080_-|plate	baseplate assembly protein	plate	D5LGZ3	Escherichia_phage	44.6	1.4e-62
WP_000579231.1|4247054_4247411_-|plate	baseplate assembly protein	plate	V5YTB2	Pseudomonas_phage	46.8	2.8e-19
WP_000049992.1|4247444_4248068_-|plate	phage baseplate assembly protein V	plate	F1BUP5	Erwinia_phage	29.8	2.4e-10
WP_001406275.1|4248051_4248603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032083603.1|4248614_4249337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096968565.1|4249317_4249719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096934544.1|4249721_4250087_-	DNA breaking-rejoining protein	NA	NA	NA	NA	NA
WP_096934545.1|4250137_4251166_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	58.9	1.3e-109
WP_000598339.1|4251235_4251571_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	55.1	1.9e-22
WP_161620513.1|4251609_4253226_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	54.5	2.8e-103
WP_161620415.1|4253215_4254739_-|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	63.2	7.6e-183
WP_000263126.1|4254783_4254993_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	49.2	1.4e-10
WP_161620341.1|4254996_4256913_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	64.2	3.7e-251
4256814:4256829	attR	CCCATTCAACTGGCGT	NA	NA	NA	NA
WP_136769147.1|4256884_4257394_-|terminase	terminase	terminase	NA	NA	NA	NA
WP_136769154.1|4257867_4258143_-	hypothetical protein	NA	Q8W634	Enterobacteria_phage	91.2	8.9e-42
WP_001233884.1|4258657_4258840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161620545.1|4258912_4259194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161619109.1|4259264_4259642_-	M15 family metallopeptidase	NA	Q9MBZ3	Enterobacteria_phage	96.0	3.3e-63
WP_161620546.1|4259644_4259920_-|holin	phage holin family protein	holin	Q9MBZ4	Enterobacteria_phage	91.2	8.3e-40
WP_097449971.1|4259909_4260302_-|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	86.9	5.5e-53
WP_097449972.1|4260480_4260753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097449973.1|4260718_4261063_-	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	83.0	2.0e-46
WP_097449974.1|4261067_4261283_-|holin	holin	holin	G9L6J5	Escherichia_phage	97.2	2.2e-32
WP_096129430.1|4261548_4261872_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	99.1	1.7e-60
WP_000738076.1|4262059_4262329_-	Shiga toxin Stx2d subunit B	NA	Q5TJL5	Enterobacteria_phage	97.8	3.0e-42
WP_161620547.1|4262340_4263300_-	Shiga toxin Stx2 subunit A	NA	Q6DWN9	Enterobacteria_phage	96.2	8.7e-169
WP_097449976.1|4263669_4264383_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917767.1|4264519_4264717_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_057108854.1|4264890_4265604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_136769106.1|4265858_4266524_-	antiterminator	NA	I6PDF8	Cronobacter_phage	52.9	1.9e-61
WP_136769107.1|4266520_4266880_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.7	1.8e-39
WP_136769108.1|4266892_4267882_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	95.7	4.6e-189
WP_001061438.1|4267889_4268699_-	KilA-N domain-containing protein	NA	A5LH75	Enterobacteria_phage	100.0	8.2e-152
WP_000767141.1|4268718_4269108_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A291AX14	Escherichia_phage	99.2	1.6e-68
WP_000210169.1|4269104_4269431_-	LexA family transcriptional regulator	NA	K7PLX6	Enterobacteria_phage	100.0	9.2e-54
WP_072127929.1|4270079_4270574_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	98.1	3.6e-86
WP_161620548.1|4270570_4271389_-	helix-turn-helix domain-containing protein	NA	A0A291AWW0	Escherichia_phage	98.9	1.5e-121
WP_000620696.1|4271385_4271610_-	hypothetical protein	NA	A5LH70	Enterobacteria_phage	100.0	5.7e-39
WP_136769109.1|4271606_4272758_-	peptidase	NA	K7PLX4	Enterobacteria_phage	96.1	6.9e-205
WP_000515862.1|4272754_4273306_-	hypothetical protein	NA	Q8SBF4	Shigella_phage	99.5	9.9e-101
WP_001191669.1|4273298_4273559_-	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
WP_001345148.1|4273656_4274349_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.1	8.3e-121
WP_000135680.1|4275072_4275435_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_097455378.1|4275500_4276325_+	YfdQ family protein	NA	Q8SBF9	Shigella_phage	98.9	3.9e-149
WP_000008178.1|4276453_4276990_+	5'-deoxynucleotidase	NA	A0A0P0ZCH9	Stx2-converting_phage	99.4	2.2e-100
WP_097455379.1|4276980_4277343_+	hypothetical protein	NA	K7PH61	Enterobacteria_phage	97.5	2.3e-66
WP_000111289.1|4277339_4277543_+	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	98.5	1.0e-31
WP_000476211.1|4277535_4277775_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	98.7	2.2e-36
WP_027661982.1|4277771_4278026_+	hypothetical protein	NA	A0A0U2RK51	Escherichia_phage	97.6	3.3e-43
WP_136769110.1|4278392_4279355_+	DUF551 domain-containing protein	NA	Q8VNQ2	Enterobacteria_phage	94.3	2.1e-69
WP_136769111.1|4279354_4279927_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	96.8	7.4e-107
WP_001093911.1|4279963_4280236_+	hypothetical protein	NA	S5MQM5	Escherichia_phage	100.0	7.2e-44
WP_053878051.1|4280269_4280818_-	hypothetical protein	NA	S5M7T3	Escherichia_phage	86.3	2.0e-77
WP_059242328.1|4280840_4281314_-	SocA family protein	NA	K4NZT7	Burkholderia_phage	31.8	2.4e-18
>prophage 1
NZ_CP041423	Escherichia coli strain STEC409 plasmid pSTEC409_1, complete sequence	110902	4266	109608	110902	capsid,terminase,portal,tail,tRNA	Salmonella_phage(92.08%)	111	NA	NA
WP_161620558.1|4266_6375_+	cobalamin biosynthesis protein CobT	NA	J9Q7G6	Salmonella_phage	66.5	2.8e-228
WP_085431619.1|6470_7706_+	AAA domain-containing protein	NA	J9Q733	Salmonella_phage	81.3	5.2e-198
WP_161620559.1|7886_11405_+	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	94.4	0.0e+00
WP_001404458.1|11529_11961_+	hypothetical protein	NA	J9Q6I8	Salmonella_phage	86.0	4.4e-64
WP_001717300.1|12078_13107_+	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	86.3	1.4e-143
WP_001755518.1|13167_14112_+	5'-3' exonuclease SAM fold family protein	NA	J9Q7S6	Salmonella_phage	88.9	1.0e-161
WP_160378289.1|14425_15454_+	recombinase	NA	J9Q736	Salmonella_phage	94.7	1.1e-188
WP_021533191.1|15546_15747_+	hypothetical protein	NA	J9Q6J0	Salmonella_phage	59.1	7.2e-09
WP_000715581.1|15750_16581_+	hypothetical protein	NA	J9Q7Z4	Salmonella_phage	94.9	3.1e-122
WP_161620560.1|16672_17098_+	hypothetical protein	NA	J9Q7G9	Salmonella_phage	74.6	1.9e-59
WP_001265407.1|17153_17429_+	hypothetical protein	NA	J9Q738	Salmonella_phage	75.8	4.0e-34
WP_000644408.1|17644_17980_+	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	73.9	6.6e-39
WP_001229345.1|17979_18192_+	hypothetical protein	NA	J9Q7S8	Salmonella_phage	94.3	3.4e-33
WP_001717293.1|18771_19986_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	45.4	1.1e-75
WP_096965674.1|20187_20832_+	hypothetical protein	NA	J9Q739	Salmonella_phage	86.3	8.3e-107
WP_000174804.1|21086_22172_+	exonuclease	NA	J9Q7S9	Salmonella_phage	87.3	6.8e-186
WP_096965676.1|22401_24318_+	AAA family ATPase	NA	J9Q741	Salmonella_phage	73.2	1.0e-248
WP_161620561.1|24307_25051_+	hypothetical protein	NA	J9Q6J5	Salmonella_phage	47.2	2.0e-51
WP_059277759.1|25060_25630_+	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	86.2	9.6e-91
WP_161620562.1|25703_28019_+	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	84.3	0.0e+00
WP_000122502.1|28123_29266_+	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	88.7	2.6e-196
WP_001011861.1|29343_30213_+	hypothetical protein	NA	J9Q742	Salmonella_phage	80.6	5.3e-133
WP_161620563.1|30383_31487_+	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	87.7	7.6e-193
WP_033803588.1|31488_31902_+	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	86.1	3.6e-63
WP_160393999.1|31904_32375_+	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	89.1	1.8e-79
WP_161620564.1|32374_33019_+	AAA family ATPase	NA	J9Q7H4	Salmonella_phage	81.3	6.0e-97
WP_000490619.1|33080_33500_+	hypothetical protein	NA	J9Q743	Salmonella_phage	71.9	1.9e-51
WP_000208156.1|33509_34067_+	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	83.6	2.8e-87
WP_012640763.1|34227_35037_+	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	52.9	6.8e-66
WP_000559568.1|35219_35813_+	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	86.3	2.0e-99
WP_000121543.1|35998_36229_+	hypothetical protein	NA	J9Q7H5	Salmonella_phage	84.2	5.9e-31
WP_161620565.1|36758_37403_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	82.3	3.2e-98
WP_085458137.1|37551_38046_+	hypothetical protein	NA	J9Q6J9	Salmonella_phage	56.2	1.8e-24
WP_115205804.1|38055_38244_+	hypothetical protein	NA	J9Q800	Salmonella_phage	51.6	3.2e-11
WP_000900261.1|38337_38763_+	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	78.7	5.7e-56
WP_000893470.1|38762_38921_+	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_161620566.1|39060_39627_+	hypothetical protein	NA	J9Q7H6	Salmonella_phage	63.1	1.1e-54
WP_022644971.1|39768_41454_+	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	92.2	0.0e+00
WP_114569651.1|41514_42219_+	hypothetical protein	NA	J9Q6K2	Salmonella_phage	76.4	9.4e-88
WP_161620567.1|42218_42599_+	hypothetical protein	NA	J9Q801	Salmonella_phage	67.4	2.2e-27
WP_161620568.1|42737_43151_+	hypothetical protein	NA	A0A1B5FPC7	Escherichia_phage	51.0	8.1e-15
WP_024184642.1|43155_43341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000206790.1|43340_44045_+	DUF551 domain-containing protein	NA	K7P7E4	Enterobacteria_phage	43.0	2.0e-45
WP_000108704.1|44635_45262_+	hypothetical protein	NA	C6ZR26	Salmonella_phage	68.4	1.2e-06
WP_000506720.1|46063_46453_+	DNA repair protein	NA	A0A077SK24	Escherichia_phage	93.0	8.6e-67
WP_000004355.1|46490_47591_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001755492.1|47748_49782_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	24.1	2.2e-44
WP_077896438.1|50021_50243_+	hypothetical protein	NA	J9Q750	Salmonella_phage	52.2	7.4e-15
WP_072647507.1|50413_51604_+	hypothetical protein	NA	J9Q803	Salmonella_phage	55.6	4.0e-123
WP_161620584.1|53188_53404_+	hypothetical protein	NA	J9Q804	Salmonella_phage	88.7	7.2e-31
WP_022644956.1|53542_53872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000749407.1|54025_54337_+	hypothetical protein	NA	J9Q7T7	Salmonella_phage	63.1	5.7e-29
WP_000216801.1|54464_54860_+	hypothetical protein	NA	J9Q7I1	Salmonella_phage	54.6	3.1e-32
WP_023908299.1|54941_55352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000129290.1|55687_55969_+	hypothetical protein	NA	J9Q753	Salmonella_phage	79.6	1.6e-38
WP_001009193.1|56173_56656_+	hypothetical protein	NA	J9Q805	Salmonella_phage	69.8	7.9e-62
WP_161620569.1|57261_57492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031323041.1|57512_57716_-	hypothetical protein	NA	J9Q7I3	Salmonella_phage	89.6	1.7e-26
WP_025670496.1|57764_58415_-	hypothetical protein	NA	J9Q754	Salmonella_phage	85.2	7.6e-100
WP_161620570.1|58710_59235_-	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	78.4	3.7e-65
WP_024180334.1|59231_59831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161620571.1|59846_60335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023145145.1|60480_61080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001291061.1|61112_61391_-	hypothetical protein	NA	J9Q7T9	Salmonella_phage	58.2	4.6e-22
WP_049076836.1|61393_62953_-	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	92.5	4.1e-277
WP_161620572.1|63017_63716_+	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	86.6	3.3e-109
WP_161620573.1|63715_64384_+	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	89.2	4.7e-105
WP_085453109.1|64380_65046_+	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	98.1	6.3e-110
WP_000129633.1|65042_65933_+	hypothetical protein	NA	J9Q7I6	Salmonella_phage	98.6	2.6e-167
WP_161620574.1|65942_66209_+	hypothetical protein	NA	J9Q757	Salmonella_phage	87.5	2.0e-35
WP_000215413.1|66404_67037_+	hypothetical protein	NA	J9Q6D4	Salmonella_phage	83.8	1.8e-90
WP_161620575.1|67036_68293_+|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	96.7	4.8e-244
WP_085457362.1|68319_69894_+|portal	phage portal protein	portal	J9Q7R1	Salmonella_phage	92.9	1.9e-285
WP_161620576.1|69915_70803_+	hypothetical protein	NA	J9Q7F4	Salmonella_phage	88.9	6.0e-132
WP_161620577.1|70828_71704_+|capsid	phage major capsid protein	capsid	J9Q710	Salmonella_phage	94.2	1.5e-154
WP_161620578.1|71777_72698_+	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	83.2	5.3e-131
WP_000801186.1|72742_73177_+	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	81.9	1.9e-59
WP_161620579.1|73176_74010_+	hypothetical protein	NA	J9Q7R2	Salmonella_phage	91.7	3.0e-141
WP_001027663.1|74089_74434_+	hypothetical protein	NA	J9Q7F6	Salmonella_phage	95.6	2.3e-55
WP_000523628.1|74424_74898_+	hypothetical protein	NA	J9Q711	Salmonella_phage	90.4	3.3e-76
WP_001718040.1|74899_75283_+	hypothetical protein	NA	J9Q6D8	Salmonella_phage	81.9	4.7e-57
WP_052895960.1|75357_76104_+	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	83.0	1.4e-105
WP_052895958.1|76165_76483_+	hypothetical protein	NA	J9Q7R3	Salmonella_phage	94.3	7.3e-48
WP_000952686.1|76608_76833_+	hypothetical protein	NA	J9Q7F7	Salmonella_phage	94.6	8.8e-32
WP_161620580.1|76840_81418_+	tape measure protein	NA	J9Q712	Salmonella_phage	83.9	0.0e+00
WP_000442113.1|81460_81796_+|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	86.4	3.0e-52
WP_161620581.1|81878_82577_+|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	96.1	1.2e-132
WP_001405045.1|82569_83367_+	hypothetical protein	NA	J9Q7R4	Salmonella_phage	94.0	1.3e-154
WP_031323046.1|83354_83948_+|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	91.9	8.2e-101
WP_161620582.1|83965_88690_+	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	74.9	0.0e+00
WP_033803600.1|90853_92941_+	chaperone of endosialidase	NA	Q71TP5	Escherichia_phage	69.1	2.2e-60
WP_000120168.1|93001_93256_+	hypothetical protein	NA	J9Q7R5	Salmonella_phage	69.0	6.1e-29
WP_032328862.1|93255_93864_+	hypothetical protein	NA	J9Q7G0	Salmonella_phage	73.8	4.5e-78
WP_001717323.1|94186_94510_+	hypothetical protein	NA	J9Q6E7	Salmonella_phage	89.7	5.9e-45
WP_000856758.1|94523_95216_+	membrane protein	NA	J9Q7Y7	Salmonella_phage	93.9	1.4e-123
WP_001717322.1|95217_95469_+	hypothetical protein	NA	J9Q7R6	Salmonella_phage	81.9	1.9e-27
WP_000931257.1|95841_96225_+	hypothetical protein	NA	A0A077SLR3	Escherichia_phage	43.3	1.3e-11
WP_001717321.1|96209_96962_+	hypothetical protein	NA	J9Q7Y8	Salmonella_phage	31.1	2.7e-16
WP_000161228.1|97138_97807_+	AAA family ATPase	NA	J9Q7R7	Salmonella_phage	91.4	1.7e-110
WP_160378290.1|97812_98166_+	hypothetical protein	NA	J9Q7G3	Salmonella_phage	97.9	1.4e-44
WP_000443723.1|98217_99912_+	hypothetical protein	NA	X2KLG0	Campylobacter_phage	24.9	4.1e-12
WP_001755535.1|100090_100831_+	hypothetical protein	NA	J9Q7R8	Salmonella_phage	89.2	3.7e-127
WP_161620585.1|103139_104255_+	DNA primase	NA	J9Q720	Salmonella_phage	90.8	9.7e-204
WP_161620583.1|104246_105392_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_021512314.1|105624_106038_+	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	47.7	1.5e-24
WP_001755528.1|106163_106940_+	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	41.1	4.1e-52
WP_000989357.1|107220_107478_+	hypothetical protein	NA	J9Q7R9	Salmonella_phage	59.0	3.9e-15
WP_001755526.1|107474_108797_+	ATP-dependent DNA ligase	NA	J9Q7G5	Salmonella_phage	91.4	4.0e-241
WP_021512312.1|108793_108973_+	hypothetical protein	NA	J9Q729	Salmonella_phage	70.7	9.2e-16
WP_085431613.1|108956_109172_+	hypothetical protein	NA	J9Q6I3	Salmonella_phage	72.1	9.7e-20
WP_000067985.1|109317_109608_+	hypothetical protein	NA	J9Q7S1	Salmonella_phage	79.2	2.4e-37
