The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041411	Escherichia coli strain STEC719 chromosome, complete genome	4987940	808381	858356	4987940	plate,protease	Cronobacter_phage(11.11%)	41	NA	NA
WP_021558527.1|808381_809068_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001554638.1|809167_809626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021558529.1|810084_810633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161622377.1|811301_811529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047628059.1|812034_812658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000124181.1|812754_812988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001287791.1|813040_813232_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_047628062.1|813739_814237_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001380969.1|814258_815803_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_061356632.1|815818_817156_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001380972.1|817152_817806_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_161622378.1|817808_819539_+	OmpA family protein	NA	NA	NA	NA	NA
WP_001007315.1|819544_820036_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_161622379.1|820205_822893_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	32.8	5.2e-94
WP_061356731.1|822879_823521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032175927.1|823823_826346_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.7	3.0e-03
WP_047628114.1|826420_828253_+	lipase family protein	NA	A0A2R8FER2	Brazilian_cedratvirus	28.6	2.1e-09
WP_032175926.1|828236_828998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047628076.1|829601_829868_+	PAAR domain-containing protein	NA	E5E3Y0	Burkholderia_phage	39.0	1.5e-06
WP_139127355.1|829925_831020_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_061356729.1|831012_834402_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_061356728.1|834401_836000_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_061356727.1|835956_836694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032252203.1|836701_838465_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_161622380.1|838419_839520_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_161622381.1|839500_840037_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_047628090.1|840039_840501_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_032175932.1|840623_841025_+	hypothetical protein	NA	A0A0R6PI25	Moraxella_phage	49.2	1.5e-05
WP_160440285.1|841180_842425_+	GIY-YIG nuclease family protein	NA	Q9MC01	Enterobacteria_phage	65.0	3.4e-80
WP_161622476.1|842660_844406_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_047628098.1|844831_846196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161622382.1|847181_848834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047628104.1|848840_849548_+	OmpA family protein	NA	NA	NA	NA	NA
WP_047628105.1|849551_850649_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_161622383.1|851039_852272_+	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	32.5	6.5e-60
WP_061356723.1|852256_852895_+	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.0	3.9e-56
WP_047628619.1|852973_853243_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001176768.1|854616_855084_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_047628139.1|855101_856310_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_061356722.1|856320_857277_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_047628136.1|857276_858356_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.4	2.8e-38
>prophage 2
NZ_CP041411	Escherichia coli strain STEC719 chromosome, complete genome	4987940	1148787	1155927	4987940		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|1148787_1149426_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590385.1|1149422_1150685_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	3.7e-135
WP_000847985.1|1150681_1151590_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001272549.1|1151755_1152553_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	5.9e-70
WP_001141329.1|1152603_1153260_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	7.3e-50
WP_001272898.1|1153365_1155927_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
>prophage 3
NZ_CP041411	Escherichia coli strain STEC719 chromosome, complete genome	4987940	1226289	1233757	4987940	transposase,integrase	Escherichia_phage(66.67%)	6	1217154:1217167	1234067:1234080
1217154:1217167	attL	TACCGCCGCAGTCA	NA	NA	NA	NA
WP_000878196.1|1226289_1227156_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_000577247.1|1227307_1229026_+	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	99.5	5.5e-307
WP_161622388.1|1229027_1230776_+	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	99.5	0.0e+00
WP_000448925.1|1230847_1231264_-	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
WP_001341819.1|1231302_1232532_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	100.0	1.5e-234
WP_000162574.1|1233274_1233757_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
1234067:1234080	attR	TGACTGCGGCGGTA	NA	NA	NA	NA
>prophage 4
NZ_CP041411	Escherichia coli strain STEC719 chromosome, complete genome	4987940	1497427	1618614	4987940	lysis,holin,integrase,capsid,terminase,tRNA,tail,portal,protease,head	Enterobacteria_phage(53.06%)	141	1578030:1578053	1622430:1622453
WP_000194515.1|1497427_1498861_-	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
WP_001274887.1|1499076_1499991_+	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_001197023.1|1500062_1501310_+	oligosaccharide MFS transporter	NA	NA	NA	NA	NA
WP_001163428.1|1501839_1502040_-	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_001281193.1|1502163_1502508_-	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	98.2	1.0e-58
WP_000120059.1|1502750_1503353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763363.1|1503563_1503785_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000084446.1|1503938_1505003_-	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	64.8	1.0e-133
WP_000682291.1|1504999_1505158_-	DUF1317 family protein	NA	M1FJ61	Enterobacteria_phage	88.5	1.3e-21
WP_000186782.1|1505154_1505835_-	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	97.8	1.9e-130
WP_000100847.1|1505831_1506617_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995414.1|1506622_1506919_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
WP_000233576.1|1506993_1507200_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000866321.1|1507680_1508058_-	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	49.2	1.3e-30
WP_000380252.1|1508035_1509097_-	hypothetical protein	NA	Q6SE88	Lactobacillus_prophage	42.0	2.9e-64
WP_000712396.1|1509177_1509870_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	85.3	2.5e-109
WP_000184665.1|1509980_1510208_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
WP_001182881.1|1510238_1510778_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.7	8.9e-62
WP_161622477.1|1510864_1511794_+	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	68.3	7.3e-112
WP_000788786.1|1511790_1512492_+	Replication protein P	NA	K7P6G2	Enterobacteria_phage	99.6	1.3e-129
WP_000145915.1|1512488_1512791_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001070442.1|1512858_1513191_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_032139864.1|1513282_1513390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709069.1|1513447_1514974_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.7	6.1e-31
WP_001567061.1|1515085_1515403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000068668.1|1515607_1516537_+	hypothetical protein	NA	A0A1R3Y6Z6	Salmonella_virus	40.0	3.0e-57
WP_001309322.1|1516635_1516737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053033.1|1516733_1517189_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	3.7e-61
WP_000224919.1|1517188_1517359_+	NinE family protein	NA	NA	NA	NA	NA
WP_000774488.1|1517351_1517642_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	4.3e-47
WP_001099700.1|1517638_1518001_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	7.3e-60
WP_000971068.1|1517997_1518138_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	5.5e-08
WP_001204791.1|1518223_1518607_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000737266.1|1518796_1519894_-	porin	NA	Q1MVN1	Enterobacteria_phage	76.5	2.2e-155
WP_000839596.1|1520482_1520698_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135280.1|1520697_1521195_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.6	1.1e-90
WP_001228695.1|1521411_1521594_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738421.1|1521684_1521978_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_001307652.1|1522340_1522535_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000453587.1|1522924_1523470_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001027269.1|1523444_1525370_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000198149.1|1525366_1525573_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001358553.1|1525569_1527171_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.4	2.9e-310
WP_000123248.1|1527151_1528471_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.6	1.8e-233
WP_001358225.1|1528480_1528813_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	2.5e-54
WP_000063250.1|1528868_1529894_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.9	1.1e-188
WP_000158875.1|1529935_1530331_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	1.1e-58
WP_000785282.1|1530342_1530696_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
WP_000975081.1|1530707_1531286_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000683105.1|1531282_1531678_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001358372.1|1531685_1532426_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	1.4e-129
WP_000479127.1|1532441_1532864_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	87.1	1.2e-61
WP_000459457.1|1532845_1533280_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840305.1|1533272_1535834_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	91.8	0.0e+00
WP_000847379.1|1535830_1536160_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001152612.1|1536159_1536858_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000194781.1|1536863_1537607_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.3e-148
WP_000090917.1|1537543_1538176_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_000515658.1|1538236_1541635_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	86.1	0.0e+00
WP_001230388.1|1541701_1542301_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.5	1.5e-110
WP_000279098.1|1542365_1545764_+	hypothetical protein	NA	X2KTY7	Enterobacteria_phage	36.4	8.2e-12
WP_001366102.1|1545763_1546348_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.8	1.1e-102
WP_000239888.1|1546402_1547071_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937500.1|1547127_1547433_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_001226376.1|1547616_1549101_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201825.1|1549287_1550241_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_000958660.1|1550613_1551771_-|integrase	prophage integrase IntS	integrase	K7P7E1	Enterobacteria_phage	98.7	4.1e-221
WP_000368131.1|1552082_1553015_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_000776768.1|1553308_1554064_+	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000937840.1|1554245_1555304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001296861.1|1555669_1557010_-	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_001296869.1|1557381_1557666_+	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_000531954.1|1557845_1559156_+	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_000426164.1|1559155_1561300_+	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_001195819.1|1561502_1561988_+	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000033328.1|1562671_1563235_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001112828.1|1563316_1565959_+	fimbrial usher protein YfcU	NA	NA	NA	NA	NA
WP_001281615.1|1565978_1566731_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000842082.1|1566705_1567254_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000822649.1|1567250_1567721_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000730291.1|1567717_1568242_+	fimbrial protein	NA	NA	NA	NA	NA
WP_001442176.1|1568228_1569101_+	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000730806.1|1569223_1569775_-	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001309606.1|1569940_1570873_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_001297933.1|1570907_1571993_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
WP_001043821.1|1571996_1572821_+	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_000447356.1|1572820_1573630_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_001089235.1|1573629_1574178_+	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000559764.1|1574211_1574490_+	YfcL family protein	NA	NA	NA	NA	NA
WP_000683799.1|1574610_1576617_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000817178.1|1576775_1577996_+	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
1578030:1578053	attL	GATAAGACGCGCCAGCGTCGCATC	NA	NA	NA	NA
WP_000127750.1|1578279_1579458_+	MFS transporter	NA	NA	NA	NA	NA
WP_000615813.1|1579454_1580450_-	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_161620286.1|1580769_1581510_+	DUF4875 domain-containing protein	NA	NA	NA	NA	NA
WP_000078916.1|1581702_1581843_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_074500808.1|1582671_1584369_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	40.8	1.6e-109
WP_000192894.1|1584365_1584941_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	44.0	8.7e-31
WP_161620651.1|1585201_1585477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161620410.1|1585622_1586195_-	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	76.1	2.7e-77
WP_161620288.1|1587496_1588051_-|tail	tail fiber assembly protein	tail	Q8W612	Enterobacteria_phage	89.4	3.9e-89
WP_161620289.1|1588053_1589709_-|tail	phage tail protein	tail	Q8W613	Enterobacteria_phage	84.7	1.3e-116
WP_000775221.1|1589705_1590341_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	54.8	1.1e-50
WP_161620290.1|1590337_1591522_-	hypothetical protein	NA	F1BUK6	Cronobacter_phage	61.3	5.8e-138
WP_097486554.1|1591514_1591865_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	68.4	4.6e-27
WP_000082775.1|1591854_1593951_-|tail	phage tail tape measure protein	tail	A0A2I7RNI7	Vibrio_phage	37.7	5.5e-107
WP_000998379.1|1594138_1594426_-	hypothetical protein	NA	A5X9I7	Aeromonas_virus	47.6	7.4e-15
WP_000777017.1|1594496_1594838_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	78.2	1.9e-41
WP_001155241.1|1594947_1595244_-|holin	holin	holin	C7BGD7	Burkholderia_phage	44.7	2.6e-15
WP_000213187.1|1595247_1595703_-	DUF2597 family protein	NA	A5X9I1	Aeromonas_virus	54.3	9.5e-41
WP_041329690.1|1595699_1596848_-	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	55.8	5.8e-111
WP_041329691.1|1596867_1597581_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	41.2	3.3e-32
WP_059340225.1|1597577_1598051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059340224.1|1598060_1598555_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	41.2	2.5e-26
WP_059340223.1|1598654_1599365_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	47.0	1.3e-55
WP_059340222.1|1599382_1600396_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	58.8	6.1e-104
WP_000166126.1|1600410_1601307_-|capsid	phage capsid protein	capsid	U3PDG3	Vibrio_phage	41.3	1.5e-37
WP_097486555.1|1601501_1603289_+|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	55.5	6.8e-191
WP_097486556.1|1603281_1604316_+|portal	phage portal protein	portal	Q94MZ7	Haemophilus_virus	54.1	1.8e-90
WP_001300959.1|1604324_1604639_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	45.1	7.3e-16
WP_000974052.1|1604707_1605067_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_000104418.1|1605078_1605366_-	hypothetical protein	NA	A5LH60	Enterobacteria_phage	69.5	1.8e-16
WP_000211287.1|1605380_1605695_-	peptide transporter	NA	A0A0A7NPT5	Enterobacteria_phage	51.4	2.3e-17
WP_074132253.1|1605699_1606659_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.7	7.6e-181
WP_161620292.1|1606735_1609558_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	96.9	0.0e+00
WP_000599402.1|1609564_1609930_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	95.9	1.9e-60
WP_161620293.1|1609926_1610544_-	hypothetical protein	NA	S5MQL6	Escherichia_phage	38.6	9.0e-10
WP_161620411.1|1610553_1611090_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_161620294.1|1611299_1611599_-	ead/Ea22-like family protein	NA	A0A0A7NRX6	Enterobacteria_phage	90.9	5.6e-42
WP_021580170.1|1611595_1611841_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	92.6	3.1e-38
WP_000985718.1|1611837_1612041_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	97.0	1.5e-30
WP_161620295.1|1612064_1612475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161620296.1|1612568_1612682_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	83.8	1.5e-08
WP_021580167.1|1612678_1612921_-	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	83.8	9.5e-32
WP_021580166.1|1612931_1613219_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	76.8	1.3e-32
WP_021580165.1|1613229_1613571_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	76.7	2.0e-43
WP_000004248.1|1613582_1613870_-	hypothetical protein	NA	A0A0M4RCW1	Salmonella_phage	53.7	6.7e-24
WP_021580164.1|1613985_1614306_+	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	43.6	1.0e-12
WP_001560988.1|1614402_1615407_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	55.7	3.4e-99
WP_000004833.1|1615565_1616723_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	7.9e-23
WP_001289162.1|1616788_1617802_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001283590.1|1617801_1618614_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
1622430:1622453	attR	GATGCGACGCTGGCGCGTCTTATC	NA	NA	NA	NA
>prophage 5
NZ_CP041411	Escherichia coli strain STEC719 chromosome, complete genome	4987940	1818204	1827646	4987940		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569325.1|1818204_1819131_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
WP_000783120.1|1819135_1819867_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216961.1|1819847_1819955_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1820014_1820746_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1820967_1822653_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1822649_1823369_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1823415_1823886_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1823926_1824388_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_161622391.1|1824512_1826513_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001292774.1|1826509_1827646_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
>prophage 6
NZ_CP041411	Escherichia coli strain STEC719 chromosome, complete genome	4987940	2344733	2409389	4987940	lysis,holin,integrase,transposase,terminase,tail,portal,protease	Enterobacteria_phage(42.22%)	70	2356914:2356929	2395749:2395764
WP_001260849.1|2344733_2345555_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2345654_2345738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743951.1|2345830_2346166_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091849.1|2346562_2347816_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2347922_2348816_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2348950_2350171_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919226.1|2350295_2350991_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_001315626.1|2350943_2352236_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2352394_2353009_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526492.1|2353051_2353906_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_001676570.1|2353907_2354525_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.1	2.8e-75
WP_161622478.1|2354535_2356959_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.5	2.8e-208
2356914:2356929	attL	GGCTGATTTCAGCCTT	NA	NA	NA	NA
WP_161622397.1|2357019_2359446_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.3	4.5e-214
WP_001295396.1|2359644_2359950_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|2360057_2360768_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2360770_2361331_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705214.1|2361365_2361707_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|2361841_2362168_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|2362373_2363588_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836079.1|2363599_2364619_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
WP_072133799.1|2364676_2364787_+	transporter	NA	NA	NA	NA	NA
WP_000877001.1|2364806_2366087_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	6.6e-156
WP_001296941.1|2366121_2366358_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000048357.1|2366445_2368917_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_001083280.1|2369010_2369202_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000783095.1|2369198_2369387_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000344950.1|2369873_2370449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|2370450_2370606_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001003381.1|2370798_2371206_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
WP_000476993.1|2371283_2371511_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705360.1|2371494_2372016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054496.1|2371996_2372962_+	hypothetical protein	NA	U5P0A0	Shigella_phage	60.8	3.4e-56
WP_001151185.1|2373002_2373428_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.5	5.4e-62
WP_001402181.1|2374517_2374784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000096969.1|2376016_2377366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000878218.1|2377876_2378743_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_000169527.1|2378739_2379039_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000813254.1|2379260_2379416_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000981001.1|2379632_2379884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032151735.1|2379950_2380229_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	7.4e-12
WP_001265024.1|2380230_2381286_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.3	3.2e-87
WP_000140005.1|2381286_2381667_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.8	1.7e-35
WP_000762931.1|2381663_2382485_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.4	1.7e-80
WP_000839572.1|2382920_2383136_+|holin	holin	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_000193284.1|2383140_2383485_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.1e-36
WP_000369848.1|2383450_2383723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992051.1|2383828_2384371_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	92.2	9.5e-96
WP_000700650.1|2384367_2384904_+	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	83.5	4.2e-72
WP_000085745.1|2385072_2385765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000421825.1|2386334_2386874_+	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
WP_161622398.1|2386882_2388982_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	96.7	0.0e+00
WP_001072975.1|2388978_2389191_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000985944.1|2389190_2390699_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	100.0	1.6e-289
WP_001136591.1|2390643_2392671_+|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	99.8	0.0e+00
WP_001097050.1|2392757_2393081_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283144.1|2393073_2393349_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	8.6e-45
WP_000677108.1|2393358_2393937_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	7.2e-102
WP_161622399.1|2393933_2394335_+|tail	phage tail protein	tail	A0A291AWY2	Escherichia_phage	99.2	2.4e-72
WP_000211099.1|2394346_2395090_+	hypothetical protein	NA	A0A291AWU6	Escherichia_phage	99.6	3.0e-132
WP_001440689.1|2395150_2395537_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	99.2	6.1e-65
WP_072685754.1|2395545_2395875_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	98.2	4.9e-55
2395749:2395764	attR	GGCTGATTTCAGCCTT	NA	NA	NA	NA
WP_161622400.1|2395846_2398912_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.5	0.0e+00
WP_000447247.1|2398911_2399241_+|tail	phage tail protein	tail	A0A291AWW9	Escherichia_phage	99.1	1.7e-60
WP_001152385.1|2399250_2399949_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	100.0	6.0e-135
WP_032288703.1|2399954_2400698_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.6e-146
WP_000090943.1|2400634_2401237_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	84.7	4.0e-87
WP_161622401.1|2401297_2404795_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	98.3	0.0e+00
WP_001233090.1|2404865_2405465_+	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	97.5	8.2e-109
WP_148119492.1|2405529_2408808_+|tail	phage tail protein	tail	X2KTY7	Enterobacteria_phage	58.8	6.5e-06
WP_000885571.1|2408807_2409389_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.9e-103
>prophage 7
NZ_CP041411	Escherichia coli strain STEC719 chromosome, complete genome	4987940	2618519	2688761	4987940	holin,integrase,plate,terminase,tRNA,tail	Escherichia_phage(90.54%)	85	2620439:2620455	2669924:2669940
WP_000837924.1|2618519_2619653_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
WP_001082294.1|2619793_2620228_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.0e-28
2620439:2620455	attL	ATACAACCTGAACAAAT	NA	NA	NA	NA
WP_161622480.1|2620766_2621330_-	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	98.9	4.1e-102
WP_161622403.1|2621329_2623333_-|tail	phage tail protein	tail	A0A0U2SH60	Escherichia_phage	62.1	5.0e-251
WP_161622404.1|2623356_2623887_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	99.4	1.9e-96
WP_161622405.1|2623901_2625284_-|tail	phage tail protein	tail	A0A0U2SAV1	Escherichia_phage	99.6	1.0e-266
WP_161622406.1|2625280_2625907_-	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	99.5	5.8e-121
WP_161622407.1|2625890_2627117_-	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	98.5	4.9e-225
WP_097446557.1|2627372_2627678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000203816.1|2627942_2628500_+	phage antirepressor Ant	NA	A0A0U2QL80	Escherichia_phage	84.3	1.0e-84
WP_064226511.1|2628475_2628823_-	hypothetical protein	NA	A0A0U2I1S2	Escherichia_phage	97.4	2.8e-61
WP_042966856.1|2629661_2630375_-|plate	phage baseplate protein	plate	A0A0U2JTX5	Escherichia_phage	97.9	1.6e-127
WP_097449789.1|2630374_2631382_-	hypothetical protein	NA	A0A0U2QL72	Escherichia_phage	87.5	1.9e-174
WP_097449788.1|2631381_2631648_-	hypothetical protein	NA	A0A0U2JGJ3	Escherichia_phage	95.5	4.1e-44
WP_086590380.1|2631644_2632313_-	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	98.2	9.5e-122
WP_161622408.1|2632316_2634410_-	lytic transglycosylase domain-containing protein	NA	A0A0U2QV45	Escherichia_phage	48.2	8.6e-161
WP_001774838.1|2634474_2635092_-	hypothetical protein	NA	A0A0U2S634	Escherichia_phage	76.6	6.8e-82
WP_097449786.1|2635088_2635520_-	hypothetical protein	NA	A0A0U2S616	Escherichia_phage	99.3	4.3e-75
WP_161622409.1|2635543_2636881_-	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	97.1	4.2e-246
WP_001139505.1|2636880_2637825_-	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	99.7	1.3e-172
WP_161622410.1|2637811_2638252_-	hypothetical protein	NA	A0A0U2RTA8	Escherichia_phage	97.9	2.4e-81
WP_000175376.1|2638248_2638689_-	hypothetical protein	NA	A0A0U2S646	Escherichia_phage	99.3	1.2e-77
WP_000780861.1|2638688_2639159_-	hypothetical protein	NA	A0A0U2SAX6	Escherichia_phage	100.0	2.5e-84
WP_001272367.1|2639215_2640244_-	hypothetical protein	NA	A0A0U2QQI2	Escherichia_phage	99.7	1.9e-190
WP_001383990.1|2640258_2640876_-	hypothetical protein	NA	A0A0U2S600	Escherichia_phage	99.5	5.9e-118
WP_000059661.1|2640868_2642161_-	DUF2213 domain-containing protein	NA	A0A0U2QW61	Escherichia_phage	100.0	4.6e-197
WP_096934536.1|2642141_2642861_-	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	99.6	1.1e-136
WP_001774832.1|2642919_2644356_-	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	99.8	2.3e-274
WP_000021154.1|2644374_2645703_-|terminase	terminase	terminase	A0A0U2JTW9	Escherichia_phage	99.8	3.4e-264
WP_097446556.1|2645692_2646640_-|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	100.0	7.0e-163
WP_000095643.1|2646805_2647177_-	enterotoxin	NA	A0A0U2SHA2	Escherichia_phage	100.0	4.5e-65
WP_161622411.1|2647166_2647946_-	Heat-labile enterotoxin IIA, A chain	NA	A0A0U2QV53	Escherichia_phage	100.0	3.0e-151
WP_161622412.1|2648035_2648581_-	glycoside hydrolase family 108 protein	NA	A0A0U2I1S0	Escherichia_phage	100.0	6.6e-105
WP_161622413.1|2648582_2648861_-|holin	phage holin family protein	holin	A0A0U2JTZ0	Escherichia_phage	100.0	1.3e-45
WP_161622414.1|2648850_2649243_-|holin	holin	holin	A0A0U2QL90	Escherichia_phage	100.0	2.7e-52
WP_161622415.1|2649736_2650480_-	pertussis toxin-like subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	100.0	9.8e-136
WP_161622416.1|2650497_2650968_-	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	100.0	3.6e-75
WP_161622417.1|2651422_2651959_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	100.0	1.3e-100
WP_161622418.1|2651955_2652246_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	100.0	2.6e-52
WP_161622419.1|2652245_2652845_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	100.0	9.1e-116
WP_161622420.1|2653405_2653618_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	100.0	3.5e-30
WP_000156214.1|2654118_2655216_+	hypothetical protein	NA	A0A0U2S621	Escherichia_phage	100.0	7.3e-212
WP_001204666.1|2655175_2655754_-	sce7726 family protein	NA	A0A0U2RXY7	Escherichia_phage	100.0	2.6e-104
WP_001351477.1|2656060_2656372_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	100.0	3.3e-61
WP_161622421.1|2656615_2657320_-	ead/Ea22-like family protein	NA	A0A0U2QW67	Escherichia_phage	99.6	1.1e-123
WP_161622422.1|2657279_2657585_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	100.0	1.2e-52
WP_161622423.1|2657581_2658004_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	100.0	4.8e-71
WP_161622424.1|2658020_2658782_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	100.0	4.5e-128
WP_123009430.1|2658816_2659239_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	100.0	1.1e-78
WP_161622425.1|2659270_2660341_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	100.0	9.9e-206
WP_096124037.1|2660353_2660776_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	100.0	2.1e-74
WP_063102143.1|2660786_2661035_-	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	100.0	8.0e-42
WP_000753628.1|2661142_2661604_+	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	100.0	3.4e-78
WP_161622426.1|2661855_2662161_+	hypothetical protein	NA	A0A0U2S618	Escherichia_phage	100.0	3.0e-46
WP_097446403.1|2662122_2662356_-	hypothetical protein	NA	A0A0U2S658	Escherichia_phage	100.0	3.1e-35
WP_000560220.1|2662753_2662975_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	100.0	6.2e-38
WP_023568504.1|2662968_2663145_+	bacteriophage protein	NA	A0A0U2SHB5	Escherichia_phage	100.0	3.9e-27
WP_000632298.1|2663219_2663495_+	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	100.0	5.0e-45
WP_161622427.1|2663596_2666743_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	99.9	0.0e+00
WP_021529594.1|2666757_2667846_+	hypothetical protein	NA	A0A0U2S5Y9	Escherichia_phage	100.0	7.7e-206
WP_021500490.1|2667909_2668104_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	100.0	9.0e-33
WP_001383994.1|2668096_2668285_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	100.0	1.9e-27
WP_000079604.1|2668384_2668600_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_161622428.1|2668601_2669837_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	99.8	4.5e-242
WP_001157377.1|2669888_2670824_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	100.0	2.8e-148
2669924:2669940	attR	ATACAACCTGAACAAAT	NA	NA	NA	NA
WP_000123738.1|2670952_2672326_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|2672803_2673787_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628065.1|2674041_2675274_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_001046821.1|2675294_2675858_-	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_001421979.1|2676525_2676705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161620896.1|2677011_2677536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161620897.1|2677587_2679627_-	lytic transglycosylase domain-containing protein	NA	A0A0U2QV45	Escherichia_phage	52.1	1.1e-107
WP_161620898.1|2679691_2680309_-	hypothetical protein	NA	A0A0U2S634	Escherichia_phage	80.0	3.7e-88
WP_161620899.1|2680316_2680988_-	DUF2213 domain-containing protein	NA	A0A0U2QW61	Escherichia_phage	53.9	4.1e-64
WP_032082823.1|2681052_2681631_-	hypothetical protein	NA	A0A0U2QW61	Escherichia_phage	63.2	6.4e-34
WP_069722811.1|2682044_2682332_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_161620900.1|2682328_2682859_-	proQ/FINO family protein	NA	Q2A0A1	Sodalis_phage	34.0	6.2e-07
WP_047085456.1|2682851_2683202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161620901.1|2683606_2685745_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	50.5	1.5e-157
WP_021534226.1|2685741_2686032_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001421990.1|2686036_2686237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089539772.1|2686229_2686595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089539794.1|2686587_2686953_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_052326232.1|2687728_2688460_-	Rha family transcriptional regulator	NA	A0A2D1GLJ3	Escherichia_phage	51.0	4.2e-22
WP_000953275.1|2688572_2688761_-	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.7	4.1e-14
>prophage 8
NZ_CP041411	Escherichia coli strain STEC719 chromosome, complete genome	4987940	2766348	2856885	4987940	holin,transposase,capsid,plate,terminase,tail,portal,protease,head	Escherichia_phage(27.47%)	122	NA	NA
WP_000422045.1|2766348_2767398_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559278.1|2767617_2768376_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	24.5	4.4e-06
WP_001278906.1|2768372_2768963_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|2769002_2769875_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001295575.1|2769975_2770596_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285661.1|2770592_2771474_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2771611_2771656_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194590.1|2771747_2773310_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763511.1|2773309_2774905_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001297118.1|2774908_2776267_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
WP_000209520.1|2776278_2777472_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443056.1|2777471_2778278_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|2778658_2778838_+	general stress protein	NA	NA	NA	NA	NA
WP_001056490.1|2778923_2779424_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079505.1|2779469_2779976_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_096836020.1|2780619_2781177_+	Rha family transcriptional regulator	NA	Q8H9L9	Vibrio_phage	62.9	3.5e-29
WP_136769085.1|2781213_2781792_-	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	91.2	2.0e-91
WP_161620904.1|2781791_2784074_-|tail	phage tail protein	tail	A0A0U2SH60	Escherichia_phage	86.1	3.1e-249
WP_161622429.1|2784098_2785175_-	late control protein	NA	R9TNM7	Vibrio_phage	29.8	1.7e-32
WP_001107807.1|2785165_2785384_-|tail	phage tail protein	tail	R9TR63	Vibrio_phage	52.1	4.9e-11
WP_000228000.1|2785358_2785847_-|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	34.1	4.0e-13
WP_161620906.1|2785849_2787502_-	hypothetical protein	NA	R9TRP8	Vibrio_phage	33.6	6.5e-47
WP_033813285.1|2787619_2787922_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_161622430.1|2788211_2788907_-	protein mom	NA	A0A0C4UQZ7	Shigella_phage	96.5	1.3e-129
WP_001372435.1|2788857_2789043_-	Com family DNA-binding transcriptional regulator	NA	A0A0C4UQS3	Shigella_phage	72.6	7.5e-21
WP_161622481.1|2789167_2789317_-	DUF4376 domain-containing protein	NA	Q8W610	Enterobacteria_phage	62.8	2.7e-05
WP_161622431.1|2789316_2790687_-	SGNH/GDSL hydrolase family protein	NA	A0A223LJ40	Erwinia_phage	53.6	6.7e-138
WP_161622432.1|2790689_2790992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161622433.1|2791880_2792411_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	68.2	5.3e-67
WP_161622434.1|2792425_2793235_-|tail	phage tail protein	tail	A0A0U2SAV1	Escherichia_phage	78.1	9.7e-28
WP_161622435.1|2793238_2793823_-	DUF2313 domain-containing protein	NA	M1NVS6	Vibrio_phage	49.2	7.2e-49
WP_161622436.1|2793807_2794884_-|plate	baseplate J/gp47 family protein	plate	A0A2I7S9E5	Vibrio_phage	51.3	8.7e-93
WP_095628565.1|2794873_2795326_-	hypothetical protein	NA	A0A2I7S9F0	Vibrio_phage	41.8	6.4e-21
WP_161622437.1|2795322_2795859_-|plate	phage baseplate assembly protein V	plate	A0A2I7S9F6	Vibrio_phage	39.2	1.3e-25
WP_000446555.1|2795849_2796920_-|tail	phage tail protein	tail	M4M9L5	Vibrio_phage	47.2	1.5e-89
WP_161622438.1|2796919_2798194_-	multidrug DMT transporter	NA	A0A2I7S9E8	Vibrio_phage	39.0	2.5e-78
WP_161622439.1|2798193_2800041_-|tail	phage tail protein	tail	M4MHE6	Vibrio_phage	51.0	3.4e-121
WP_000829450.1|2800127_2800523_-	hypothetical protein	NA	M4MB64	Vibrio_phage	47.9	1.8e-19
WP_001062748.1|2800524_2800881_-|tail	phage tail protein	tail	A0A2P1A4D6	Alteromonadaceae_phage	35.5	2.9e-13
WP_161622440.1|2800890_2802366_-|tail	phage tail protein	tail	M1Q565	Vibrio_phage	55.9	5.5e-154
WP_000435844.1|2802365_2802551_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_047084872.1|2802531_2803143_-	hypothetical protein	NA	M1PJ94	Vibrio_phage	44.9	4.3e-36
WP_000513058.1|2803139_2803682_-	phage morphogeneis protein	NA	A0A2I7S9D7	Vibrio_phage	63.1	1.6e-58
WP_000540583.1|2803681_2804119_-	DUF1320 domain-containing protein	NA	A0A2I7S9E9	Vibrio_phage	49.7	3.7e-34
WP_063103529.1|2804118_2804430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161622441.1|2804508_2805411_-|head	phage head protein	head	M4MB71	Vibrio_phage	57.2	2.1e-100
WP_161622442.1|2805410_2806373_-	peptidase	NA	M1Q578	Vibrio_phage	46.0	7.8e-77
WP_161622443.1|2806586_2807351_-	hypothetical protein	NA	M4M9M5	Vibrio_phage	61.3	5.6e-94
WP_161622444.1|2807343_2808915_-	DUF935 domain-containing protein	NA	A0A2I7S9K0	Vibrio_phage	57.9	1.1e-157
WP_161622482.1|2808911_2810438_-	hypothetical protein	NA	M1NVQ0	Vibrio_phage	67.9	6.0e-196
WP_095628576.1|2810443_2811025_-	DUF3486 family protein	NA	M1PJ86	Vibrio_phage	56.5	2.2e-50
WP_161622445.1|2811162_2811462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024168521.1|2811464_2811752_-	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	60.6	1.6e-25
WP_106844697.1|2811757_2812063_-	DUF2730 family protein	NA	M1Q558	Vibrio_phage	39.6	2.1e-12
WP_063502213.1|2812047_2812275_-	conjugal transfer protein TraR	NA	NA	NA	NA	NA
WP_063502214.1|2812271_2812880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113897679.1|2812867_2813278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040088621.1|2813261_2813489_-	hypothetical protein	NA	A0A0C4UQR6	Shigella_phage	69.9	1.1e-24
WP_161622446.1|2813490_2814087_-	peptidoglycan-binding protein	NA	A0A2I7S9B9	Vibrio_phage	42.8	3.2e-36
WP_074657295.1|2814188_2814686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063502217.1|2814682_2815093_-	transcriptional regulator	NA	A0A0C4UR27	Shigella_phage	58.7	1.2e-34
WP_109955404.1|2815089_2815641_-	regulatory protein GemA	NA	A0A0C4UQU3	Shigella_phage	81.3	3.8e-84
WP_074657301.1|2815618_2816008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161622447.1|2816000_2816183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063502220.1|2816175_2816718_-	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	83.6	2.7e-82
WP_001107934.1|2816816_2817341_-	host-nuclease inhibitor protein Gam	NA	A0A0C4UQY5	Shigella_phage	96.0	9.2e-88
WP_063081998.1|2817361_2817649_-	hypothetical protein	NA	C9DGL7	Escherichia_phage	89.0	4.7e-38
WP_000644790.1|2817666_2818086_-	hypothetical protein	NA	A0A0C4UR25	Shigella_phage	88.5	1.6e-63
WP_001151278.1|2818106_2818376_-	hypothetical protein	NA	C9DGL5	Escherichia_phage	60.7	1.5e-22
WP_085949013.1|2818408_2818633_-	hypothetical protein	NA	C9DGL3	Escherichia_phage	85.1	2.6e-31
WP_001026713.1|2818649_2819588_-	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	88.1	1.3e-153
WP_161622448.1|2819626_2821615_-|transposase	transposase	transposase	C9DGL1	Escherichia_phage	98.5	0.0e+00
WP_000551058.1|2821622_2821844_-	transcriptional regulator	NA	A0A0C4UQU0	Shigella_phage	98.6	1.4e-34
WP_000986830.1|2822029_2822554_+	hypothetical protein	NA	A0A0C4UQZ2	Shigella_phage	90.2	2.3e-83
WP_096095867.1|2825381_2825912_-|tail	phage tail protein	tail	A0A0U2QV64	Escherichia_phage	76.3	4.0e-75
WP_161620907.1|2825926_2827183_-|tail	phage tail protein	tail	A0A0U2SAV1	Escherichia_phage	96.5	1.1e-126
WP_096836038.1|2827179_2827770_-|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	39.9	2.8e-24
WP_000235847.1|2827762_2828677_-|plate	baseplate assembly protein	plate	D5LGZ3	Escherichia_phage	43.6	7.5e-61
WP_000579232.1|2828651_2829008_-	hypothetical protein	NA	V5YTB2	Pseudomonas_phage	46.8	1.6e-19
WP_000049992.1|2829041_2829665_-|plate	phage baseplate assembly protein V	plate	F1BUP5	Erwinia_phage	29.8	2.4e-10
WP_097450120.1|2829648_2830200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096095872.1|2830211_2830934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032083604.1|2830914_2831316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001372342.1|2831318_2831684_-	DNA breaking-rejoining protein	NA	NA	NA	NA	NA
WP_096934545.1|2831734_2832763_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	58.9	1.3e-109
WP_032083606.1|2832831_2833167_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	54.2	3.3e-22
WP_161620836.1|2833206_2834931_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	53.6	6.9e-100
WP_097450122.1|2834950_2836474_-|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	63.4	5.8e-183
WP_000263126.1|2836518_2836728_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	49.2	1.4e-10
WP_136769138.1|2836731_2838648_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.4	4.3e-252
WP_136769139.1|2838619_2839168_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	87.1	1.1e-59
WP_136769141.1|2839752_2840049_-	hypothetical protein	NA	Q8W634	Enterobacteria_phage	98.0	4.3e-50
WP_064484544.1|2840137_2840320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014554.1|2840686_2841064_-	M15 family metallopeptidase	NA	Q9MBZ3	Enterobacteria_phage	98.4	7.8e-65
WP_161620908.1|2841066_2841342_-|holin	phage holin family protein	holin	Q9MBZ4	Enterobacteria_phage	95.6	4.2e-44
WP_001294582.1|2841331_2841724_-|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	90.0	1.5e-50
WP_097450101.1|2841812_2841965_-	DUF3927 domain-containing protein	NA	A0A0A0YRI9	Escherichia_phage	57.8	1.9e-06
WP_097450102.1|2841961_2842387_-	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	85.8	4.2e-59
WP_097450103.1|2843273_2844317_-	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	92.1	4.1e-188
WP_000917767.1|2844467_2844665_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_161620909.1|2844834_2845548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097450105.1|2845802_2846369_-	ORF6N domain-containing protein	NA	A0A2R2Z302	Escherichia_phage	78.4	1.7e-47
WP_161620970.1|2846647_2847031_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	1.3e-59
WP_097450106.1|2847023_2847395_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.2e-36
WP_161622449.1|2847407_2848457_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	6.1e-107
WP_097450153.1|2848458_2848737_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	4.8e-11
WP_096095931.1|2848803_2849055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|2849272_2849428_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_097450141.1|2849718_2850114_-	hypothetical protein	NA	A0A193GYM6	Enterobacter_phage	60.5	7.2e-37
WP_096095942.1|2850113_2850365_-	DUF551 domain-containing protein	NA	Q76H45	Enterobacteria_phage	43.2	7.6e-08
WP_097446831.1|2850913_2851549_-	ead/Ea22-like family protein	NA	A0A2R2Z315	Escherichia_phage	99.5	2.8e-115
WP_001224672.1|2851714_2851897_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	96.7	2.0e-26
WP_033812990.1|2852025_2852337_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	82.5	9.0e-51
WP_033812989.1|2852329_2852584_-	hypothetical protein	NA	A0A0U2RK51	Escherichia_phage	89.3	7.7e-40
WP_087907238.1|2852580_2853003_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	95.0	2.1e-66
WP_161622450.1|2853019_2853790_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	76.6	3.8e-98
WP_161620331.1|2853824_2854367_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	2.2e-84
WP_123007303.1|2854278_2855319_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	88.3	1.9e-92
WP_097450109.1|2855290_2855842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000476986.1|2855825_2856053_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001003379.1|2856130_2856538_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	7.2e-24
WP_000379577.1|2856729_2856885_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
>prophage 9
NZ_CP041411	Escherichia coli strain STEC719 chromosome, complete genome	4987940	3121471	3172702	4987940	holin,integrase,plate,terminase,tail,portal,protease,head	Escherichia_phage(38.3%)	72	3126145:3126204	3172844:3172908
WP_000003663.1|3121471_3122059_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|3122055_3122763_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107384.1|3122781_3124575_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001058323.1|3124571_3125690_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
3126145:3126204	attL	CGGTCTTGAAAACCGGCGACCCGAAAGGGTTCCAGAGTTCGAATCTCTGCGCTTCCGCCA	NA	NA	NA	NA
WP_161620427.1|3126345_3126921_-	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	96.2	3.3e-99
WP_161620419.1|3126920_3128924_-|tail	phage tail protein	tail	A0A0U2SH60	Escherichia_phage	59.3	9.2e-237
WP_136769135.1|3128948_3130025_-	late control protein	NA	R9TNM7	Vibrio_phage	28.9	1.9e-31
WP_001107807.1|3130015_3130234_-|tail	phage tail protein	tail	R9TR63	Vibrio_phage	52.1	4.9e-11
WP_097450115.1|3130208_3130697_-|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	35.0	2.1e-14
WP_097450116.1|3130699_3132361_-	hypothetical protein	NA	R9TRP8	Vibrio_phage	34.2	2.7e-48
WP_097450117.1|3132478_3132781_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_033813286.1|3132842_3133361_-|tail	tail protein	tail	NA	NA	NA	NA
WP_096095866.1|3134889_3135420_-|tail	tail assembly chaperone	tail	A0A1S6KZY8	Salmonella_phage	44.2	5.7e-37
WP_096095867.1|3135437_3135968_-|tail	phage tail protein	tail	A0A0U2QV64	Escherichia_phage	76.3	4.0e-75
WP_161620338.1|3135982_3137236_-|tail	phage tail protein	tail	A0A0U2SAV1	Escherichia_phage	94.4	2.7e-122
WP_161622455.1|3137232_3137823_-|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	38.5	2.8e-24
WP_097450119.1|3137815_3138730_-|plate	baseplate assembly protein	plate	D5LGZ3	Escherichia_phage	44.6	1.6e-63
WP_040091455.1|3138704_3139061_-|plate	baseplate assembly protein	plate	V5YTB2	Pseudomonas_phage	46.8	2.8e-19
WP_096934541.1|3139094_3139718_-|plate	phage baseplate assembly protein V	plate	F1BUP5	Erwinia_phage	30.2	1.1e-10
WP_096934551.1|3139701_3140253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097446582.1|3140264_3140987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096968565.1|3140967_3141369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000159745.1|3141371_3141737_-	DNA breaking-rejoining protein	NA	NA	NA	NA	NA
WP_161620339.1|3142885_3143221_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	51.4	4.7e-21
WP_161620340.1|3143259_3144876_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	2.6e-101
WP_161620415.1|3144865_3146389_-|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	63.2	7.6e-183
WP_000263126.1|3146433_3146643_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	49.2	1.4e-10
WP_161620341.1|3146646_3148563_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	64.2	3.7e-251
WP_136769147.1|3148534_3149044_-|terminase	terminase	terminase	NA	NA	NA	NA
WP_136769154.1|3149517_3149793_-	hypothetical protein	NA	Q8W634	Enterobacteria_phage	91.2	8.9e-42
WP_001233884.1|3150307_3150490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161620342.1|3150562_3150844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161619109.1|3150914_3151292_-	M15 family metallopeptidase	NA	Q9MBZ3	Enterobacteria_phage	96.0	3.3e-63
WP_161620546.1|3151294_3151570_-|holin	phage holin family protein	holin	Q9MBZ4	Enterobacteria_phage	91.2	8.3e-40
WP_097449971.1|3151559_3151952_-|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	86.9	5.5e-53
WP_097449972.1|3152130_3152403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097449973.1|3152368_3152713_-	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	83.0	2.0e-46
WP_097449974.1|3152717_3152933_-|holin	holin	holin	G9L6J5	Escherichia_phage	97.2	2.2e-32
WP_096129430.1|3153198_3153522_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	99.1	1.7e-60
WP_000738076.1|3153709_3153979_-	Shiga toxin Stx2d subunit B	NA	Q5TJL5	Enterobacteria_phage	97.8	3.0e-42
WP_097449975.1|3153990_3154950_-	Shiga toxin Stx2 subunit A	NA	Q6DWN9	Enterobacteria_phage	96.6	1.8e-169
WP_097449976.1|3155319_3156033_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917767.1|3156169_3156367_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_057108854.1|3156540_3157254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_136769106.1|3157508_3158174_-	antiterminator	NA	I6PDF8	Cronobacter_phage	52.9	1.9e-61
WP_001217445.1|3158170_3158530_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	68.4	3.7e-40
WP_161620343.1|3158542_3159589_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	57.6	2.3e-114
WP_161620416.1|3159590_3159863_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	47.5	1.0e-10
WP_001260977.1|3159998_3160256_+	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	86.7	1.5e-30
WP_000220600.1|3160261_3160561_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2R2Z2Y1	Escherichia_phage	99.0	3.9e-51
WP_053272730.1|3160765_3161110_-	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	98.2	1.1e-57
WP_001229294.1|3161106_3161472_-	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	99.2	3.3e-68
WP_161620344.1|3161473_3161692_-	DUF4014 domain-containing protein	NA	A0A1I9LJM2	Stx_converting_phage	90.3	2.6e-28
WP_161620345.1|3161724_3161937_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	92.9	1.5e-33
WP_161620346.1|3161987_3162488_-	ead/Ea22-like family protein	NA	A0A2R2Z315	Escherichia_phage	84.3	1.3e-54
WP_161620347.1|3162474_3162741_-	hypothetical protein	NA	A0A0U2RK51	Escherichia_phage	87.5	1.1e-36
WP_161620348.1|3162737_3163133_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	55.0	4.4e-34
WP_161622456.1|3163162_3163705_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	8.3e-84
WP_161620350.1|3163616_3164657_-	phage replisome organizer	NA	A0A0U2RT81	Escherichia_phage	93.9	5.6e-105
WP_161620351.1|3164728_3165154_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000172735.1|3165150_3165453_-	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	1.1e-05
WP_122985828.1|3165550_3165922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302048.1|3165942_3166134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|3166135_3166414_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000379589.1|3166705_3166861_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_086590109.1|3167020_3167239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000920491.1|3167645_3167879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033560808.1|3168446_3168635_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090193.1|3168631_3168835_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_161620352.1|3168915_3171396_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	64.1	2.2e-62
WP_000273158.1|3171462_3171714_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_161620353.1|3171682_3172702_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	50.0	4.4e-86
3172844:3172908	attR	CGGTCTTGAAAACCGGCGACCCGAAAGGGTTCCAGAGTTCGAATCTCTGCGCTTCCGCCAAATAA	NA	NA	NA	NA
>prophage 10
NZ_CP041411	Escherichia coli strain STEC719 chromosome, complete genome	4987940	3860135	3949516	4987940	lysis,holin,integrase,capsid,plate,terminase,tail,portal,protease,head	Enterobacteria_phage(40.91%)	98	3885057:3885073	3946962:3946978
WP_000131044.1|3860135_3862169_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001295527.1|3862297_3862885_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_161622459.1|3862898_3864371_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159102.1|3864384_3866055_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_001295805.1|3867129_3867693_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	53.3	6.0e-53
WP_001315275.1|3868022_3868817_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001406334.1|3868970_3869732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071593451.1|3870877_3872071_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_001209098.1|3872254_3872920_+	membrane protein	NA	NA	NA	NA	NA
WP_000370308.1|3873165_3873861_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023910.1|3873853_3875281_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102115.1|3875291_3876011_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339587.1|3876540_3877395_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001046314.1|3877620_3878946_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	2.5e-113
WP_000474084.1|3879054_3879291_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001299021.1|3879302_3879896_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000621009.1|3880486_3881338_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_047676078.1|3881477_3885731_-	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
3885057:3885073	attL	CGGCGATTTTTTCCAGC	NA	NA	NA	NA
WP_000662258.1|3886846_3886948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803990.1|3887310_3887574_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|3887573_3887714_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147277.1|3887748_3887976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001296902.1|3888798_3889341_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|3889415_3890003_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716398.1|3890060_3890729_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131094.1|3890754_3893280_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_024179212.1|3893269_3894913_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001305432.1|3894881_3895592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303809.1|3895904_3896234_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|3896481_3897096_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070698.1|3897513_3898203_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643331.1|3898199_3899156_+	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
WP_001111349.1|3902297_3902708_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_134236683.1|3903369_3904113_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000355484.1|3904939_3905713_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.5	2.4e-36
WP_068868356.1|3906355_3906853_+|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	68.3	2.0e-55
WP_001716846.1|3906852_3907455_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	91.0	3.2e-100
WP_000554682.1|3907870_3908494_-	hypothetical protein	NA	U5P0I1	Shigella_phage	70.1	1.3e-64
WP_000383572.1|3908497_3909082_-	YmfQ family protein	NA	O22003	Shigella_phage	99.5	2.4e-113
WP_000424732.1|3910118_3910544_-	hypothetical protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_015364403.1|3910543_3911092_-|plate	phage baseplate assembly protein	plate	Q8SBG6	Shigella_phage	98.9	5.6e-96
WP_000999510.1|3911091_3912171_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	100.0	5.3e-207
WP_096314331.1|3913564_3915472_-|tail	phage tail tape measure protein	tail	U5P420	Shigella_phage	99.5	0.0e+00
WP_000571713.1|3915556_3915880_-|tail	phage tail assembly protein	tail	U5P0R5	Shigella_phage	99.1	1.1e-51
WP_000090998.1|3915876_3916233_-	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_161622460.1|3916232_3917729_-|tail	phage tail protein	tail	M1FN90	Enterobacteria_phage	98.8	2.9e-272
WP_000497751.1|3917712_3917883_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000779294.1|3917891_3918452_-	hypothetical protein	NA	Q8SBH4	Shigella_phage	99.5	1.8e-105
WP_000224835.1|3918448_3918955_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	92.9	1.3e-83
WP_000702401.1|3918929_3919340_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	94.9	8.0e-71
WP_000927719.1|3919336_3919660_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_000601360.1|3919662_3919863_-	hypothetical protein	NA	S5FNU1	Shigella_phage	97.0	3.8e-26
WP_000257505.1|3919912_3921118_-|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	99.3	3.5e-223
WP_001193631.1|3921132_3921783_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_000466255.1|3921760_3923002_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
WP_000605606.1|3923001_3923184_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_122057049.1|3923195_3924692_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.4	2.2e-299
WP_161622461.1|3924925_3925420_-|terminase	phage terminase small subunit P27 family	terminase	Q8SBI1	Shigella_phage	99.4	3.0e-88
WP_001532225.1|3925545_3925896_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	96.6	3.1e-63
WP_000738423.1|3926421_3926715_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001228695.1|3926805_3926988_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_024186729.1|3927204_3927702_-	lysozyme	NA	I6R0P2	Salmonella_phage	98.8	4.9e-91
WP_000286100.1|3927679_3927883_-	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_000512806.1|3928374_3928863_-	late gene antiterminator protein	NA	M1FPN0	Enterobacteria_phage	100.0	5.3e-90
WP_001028864.1|3928853_3929525_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	96.9	1.6e-129
WP_024174867.1|3929521_3930133_-	recombination protein NinG	NA	K7PHM2	Enterobacterial_phage	99.5	1.8e-98
WP_000567007.1|3930125_3930296_-	protein ninF	NA	M1FPE8	Enterobacteria_phage	100.0	1.4e-26
WP_057698421.1|3930292_3930475_-	NinE family protein	NA	Q716C5	Shigella_phage	98.3	3.7e-28
WP_161622462.1|3930471_3930999_-	phage N-6-adenine-methyltransferase	NA	K7PMG2	Enterobacteria_phage	99.4	3.6e-100
WP_000736925.1|3930995_3931436_-	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	98.6	2.2e-79
WP_000145931.1|3931509_3931800_-	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
WP_000788877.1|3931796_3932498_-	Replication protein 14	NA	K7P6G2	Enterobacteria_phage	100.0	9.9e-130
WP_000185505.1|3932494_3933394_-	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	100.0	3.8e-174
WP_000251069.1|3933426_3933720_-	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000437875.1|3933838_3934039_-	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_000104863.1|3934139_3934853_+	LexA family transcriptional regulator	NA	M1FN96	Enterobacteria_phage	100.0	1.6e-127
WP_000788349.1|3934965_3935805_+	protein rexA	NA	M1FPD4	Enterobacteria_phage	100.0	3.7e-155
WP_001245922.1|3935820_3936255_+	protein rexB	NA	M1FPN8	Enterobacteria_phage	100.0	1.9e-70
WP_001564525.1|3936720_3937044_+	antitermination protein	NA	A0A0K2FII1	Escherichia_phage	100.0	4.5e-53
WP_000281856.1|3937044_3937527_-	superinfection exclusion protein B	NA	A4KWR7	Enterobacteria_phage	100.0	1.1e-87
WP_001542700.1|3937793_3937994_+	restriction inhibitor protein ral	NA	A0A088CQ62	Enterobacteria_phage	98.5	1.2e-32
WP_001542699.1|3938176_3938545_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	97.5	2.9e-64
WP_001198860.1|3938617_3938782_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	100.0	1.4e-26
WP_000372923.1|3938750_3938894_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	97.9	2.7e-18
WP_000995439.1|3938969_3939266_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100845.1|3939271_3940057_+	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	1.1e-148
WP_102290897.1|3940053_3940734_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCQ7	Stx2-converting_phage	99.1	5.1e-131
WP_161622463.1|3940730_3940889_+	DUF1317 family protein	NA	M1FJ61	Enterobacteria_phage	92.3	2.2e-21
WP_001001031.1|3940885_3942130_+	phosphoadenosine phosphosulfate reductase family protein	NA	Q8W6P3	Burkholderia_virus	34.0	7.1e-46
WP_000205067.1|3942141_3942744_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_047675690.1|3942740_3943325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000763364.1|3943693_3943912_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	95.8	1.8e-34
WP_000488419.1|3943959_3944238_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	98.9	1.7e-48
WP_000446903.1|3944209_3944560_+	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	99.1	1.6e-59
WP_000051905.1|3944436_3945600_+|integrase	site-specific integrase	integrase	S5FNS2	Shigella_phage	100.0	4.1e-229
WP_000893255.1|3945804_3947058_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
3946962:3946978	attR	CGGCGATTTTTTCCAGC	NA	NA	NA	NA
WP_001285288.1|3947069_3948173_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749863.1|3948460_3949516_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
>prophage 11
NZ_CP041411	Escherichia coli strain STEC719 chromosome, complete genome	4987940	3981104	4043300	4987940	plate,tRNA,protease,transposase	Cronobacter_phage(12.5%)	52	NA	NA
WP_000611742.1|3981104_3981518_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393845.1|3981521_3983372_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348806.1|3983335_3984418_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113725.1|3984442_3985723_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|3985719_3986244_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246437.1|3986246_3987578_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000343298.1|3987582_3988344_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_161622464.1|3988352_3991112_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.5	6.1e-82
WP_000088873.1|3991108_3991852_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_001240543.1|3991856_3993272_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_122985538.1|3993380_3996815_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001087745.1|3996825_3998178_+	membrane protein	NA	NA	NA	NA	NA
WP_001284199.1|3998201_3998684_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000908052.1|3998727_3999642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001236649.1|3999651_4000131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086142.1|4000267_4001053_-	aminopeptidase	NA	NA	NA	NA	NA
WP_001297205.1|4001592_4002324_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_000917883.1|4002388_4002856_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001295200.1|4002852_4003575_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052707.1|4003608_4004364_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|4004435_4005794_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000211729.1|4005841_4006612_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|4006689_4007490_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648570.1|4007730_4008645_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997049.1|4008641_4009445_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.1	1.2e-38
WP_001140175.1|4015206_4015782_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000593994.1|4015969_4017001_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001294600.1|4016993_4017647_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874224.1|4017686_4018502_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202330.1|4018619_4019024_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094011.1|4019020_4019728_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260716.1|4019838_4021557_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001346133.1|4021609_4022434_+	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_053897843.1|4022636_4023617_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000239192.1|4023866_4024577_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000635545.1|4024590_4025013_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001185293.1|4025009_4025555_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_000417058.1|4025720_4025921_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062312.1|4025907_4026168_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000176573.1|4026216_4027515_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000901098.1|4027579_4027969_-	VOC family protein	NA	NA	NA	NA	NA
WP_001021030.1|4028025_4030167_-	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000055741.1|4030265_4031225_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001294757.1|4031237_4034720_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000569430.1|4034756_4035353_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_000139667.1|4035349_4036498_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000565966.1|4036497_4037286_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|4037289_4037745_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_001139279.1|4037849_4038875_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000758956.1|4038878_4039364_-	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001240896.1|4039485_4041918_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_001295561.1|4041947_4043300_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
>prophage 1
NZ_CP041414	Escherichia coli strain STEC719 plasmid pSTEC719_3, complete sequence	84140	55165	63495	84140	transposase	Stx2-converting_phage(42.86%)	9	NA	NA
WP_052993163.1|55165_56395_+	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	33.9	4.8e-63
WP_052993162.1|56379_57024_+	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.1	3.1e-53
WP_052993161.1|57093_57369_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_161622497.1|57574_58129_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_161622498.1|58789_59044_-	hypothetical protein	NA	Q6H9S3	Enterobacteria_phage	94.7	3.1e-25
WP_001339397.1|59005_59683_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|59682_60030_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|60049_61621_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_033800815.1|62769_63495_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	47.8	1.7e-52
