The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP022341	Enterococcus faecium strain KUHS13	2802719	43043	69804	2802719	integrase	Streptococcus_phage(80.95%)	29	30562:30575	70322:70335
30562:30575	attL	CAAGAAATCGATCA	NA	NA	NA	NA
WP_000181735.1|43043_44837_+	ATP-dependent helicase	NA	E3T5J8	Cafeteria_roenbergensis_virus	23.8	6.9e-26
WP_000421279.1|45036_45351_+	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	77.7	1.2e-42
WP_001234191.1|45371_45749_+	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	76.4	9.6e-47
WP_000185761.1|45758_46532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001130244.1|46553_47957_+	DUF87 domain-containing protein	NA	A0A1S5SFB5	Streptococcus_phage	66.5	2.2e-176
WP_000426689.1|48137_49322_+	replication initiation factor domain-containing protein	NA	A0A1S5SEX3	Streptococcus_phage	68.1	6.3e-161
WP_000055376.1|49318_49609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001009054.1|49605_49827_+	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	93.2	3.1e-29
WP_000675717.1|49868_50648_+	abortive infection family protein	NA	NA	NA	NA	NA
WP_000870467.1|50714_51209_+	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	63.4	2.8e-54
WP_000248477.1|51264_51903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000723887.1|51974_52370_+	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	72.6	5.9e-47
WP_000331165.1|52353_54807_+	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	78.9	0.0e+00
WP_000192393.1|54803_56831_+	membrane protein	NA	A0A1S5SF30	Streptococcus_phage	65.3	5.1e-195
WP_000768373.1|56827_57850_+	lysozyme family protein	NA	A0A1S5SEZ8	Streptococcus_phage	75.5	2.4e-132
WP_000584387.1|57866_58796_+	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	56.6	1.1e-83
WP_001791010.1|59040_59157_+	tetracycline resistance determinant leader peptide	NA	NA	NA	NA	NA
WP_002345019.1|59172_59976_+	GTP-binding protein	NA	A0A1S5SF82	Streptococcus_phage	98.9	6.0e-147
WP_001159903.1|60210_60447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000163792.1|60453_62406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000868795.1|62477_62975_-	trimethoprim-resistant dihydrofolate reductase DfrG	NA	G3MBI7	Bacillus_virus	49.1	4.0e-40
WP_001817446.1|63336_64377_+	hypothetical protein	NA	A0A1S5SF82	Streptococcus_phage	95.7	3.6e-192
WP_032506803.1|64474_64663_+	cysteine-rich KTR domain-containing protein	NA	D0R0F6	Streptococcus_phage	61.4	7.4e-16
WP_001227350.1|64720_65074_-	helix-turn-helix domain-containing protein	NA	A0A1S5SFA6	Streptococcus_phage	89.7	2.2e-53
WP_000804879.1|65604_66027_+	sigma-70 family RNA polymerase sigma factor	NA	A0A1S5SEW0	Streptococcus_phage	68.6	7.5e-48
WP_000845143.1|66023_66254_+	helix-turn-helix domain-containing protein	NA	A0A1S5SEX1	Streptococcus_phage	78.9	1.0e-27
WP_000633907.1|66751_66952_+	DUF3173 domain-containing protein	NA	NA	NA	NA	NA
WP_000237797.1|66978_68172_+|integrase	site-specific integrase	integrase	A0A0S2MV79	Bacillus_phage	34.2	8.3e-44
WP_002298578.1|68238_69804_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	30.6	3.5e-18
70322:70335	attR	CAAGAAATCGATCA	NA	NA	NA	NA
>prophage 2
NZ_AP022341	Enterococcus faecium strain KUHS13	2802719	201235	265747	2802719	transposase,tRNA	Bacillus_phage(14.29%)	58	NA	NA
WP_138556887.1|201235_202574_-|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
WP_002294220.1|202672_203275_+	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	30.6	3.6e-19
WP_002296548.1|203296_203785_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002296549.1|204106_205480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296550.1|205463_205901_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_002296551.1|206180_207926_-	AarF/ABC1/UbiB kinase family protein	NA	M4R0M8	Ostreococcus_lucimarinus_virus	28.1	6.3e-40
WP_002293424.1|208121_209198_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_002304063.1|209350_210703_+	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_002296553.1|211024_212536_+	DEAD/DEAH box helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	37.4	1.1e-61
WP_002296554.1|212665_213016_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_002296555.1|213031_214153_+	alanine racemase	NA	NA	NA	NA	NA
WP_002289874.1|214163_214526_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A291I9M9	Lactobacillus_phage	37.8	7.6e-09
WP_002293413.1|214701_214971_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_002294206.1|215160_216108_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002296556.1|216413_219119_+	YhgE/Pip domain-containing protein	NA	NA	NA	NA	NA
WP_002294202.1|219716_221540_+	APC family permease	NA	NA	NA	NA	NA
WP_002296558.1|221681_221867_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_002296559.1|222342_222606_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_002296560.1|222605_222872_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_002296561.1|223072_223561_+	mannosyl-glycoprotein endo-beta-N-acetylglucosamidase	NA	NA	NA	NA	NA
WP_002302663.1|224101_224773_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002296564.1|224769_225687_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002293405.1|225683_226325_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002287522.1|227067_227472_+|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
WP_002287525.1|227488_228637_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	93.4	1.2e-204
WP_002296565.1|229587_230619_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_002289743.1|231237_233877_+	cation-translocating P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	31.2	1.6e-84
WP_002296566.1|234044_234743_-	DUF975 family protein	NA	NA	NA	NA	NA
WP_002294183.1|234960_236106_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	40.9	2.5e-82
WP_002294182.1|236202_236583_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_002296567.1|236887_239485_+	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_002288261.1|239713_240820_+	glycosyl hydrolase	NA	NA	NA	NA	NA
WP_002300788.1|241866_242346_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_086953915.1|242971_244310_+|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
WP_126145175.1|244354_244561_+	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_002300046.1|244542_244848_+	5-dehydro-4-deoxy-D-glucuronate isomerase	NA	NA	NA	NA	NA
WP_033582433.1|244867_245671_+	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_161987064.1|245894_246983_-	type 2 isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_002288233.1|246979_248065_-	phosphomevalonate kinase	NA	NA	NA	NA	NA
WP_002300050.1|248077_249055_-	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_002288231.1|249047_249992_-	mevalonate kinase	NA	NA	NA	NA	NA
WP_002352356.1|250307_250967_+	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	51.8	5.6e-58
WP_002300052.1|251051_251957_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_002300053.1|251958_252591_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_002293357.1|252910_253435_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.3	1.4e-14
WP_002289309.1|253506_253707_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_002289310.1|253759_254119_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_002341586.1|254554_254896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296840.1|255002_256190_-|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_080388548.1|256286_257183_+	citrate transporter	NA	NA	NA	NA	NA
WP_002341584.1|257230_259360_+	hydantoinase/oxoprolinase	NA	NA	NA	NA	NA
WP_002302159.1|259334_260024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289316.1|260431_261118_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002315615.1|261253_261448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002301667.1|261497_261938_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_002299303.1|261941_262787_-	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_002294157.1|262935_264354_+	dipeptidase PepV	NA	NA	NA	NA	NA
WP_002297218.1|264451_265747_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
>prophage 3
NZ_AP022341	Enterococcus faecium strain KUHS13	2802719	282359	289291	2802719		Streptococcus_phage(100.0%)	6	NA	NA
WP_032509114.1|282359_282584_+	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	97.1	8.5e-27
WP_002345010.1|282700_283198_+	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	97.6	1.3e-88
WP_002345009.1|283284_283677_+	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	99.2	4.6e-68
WP_000331148.1|283660_286108_+	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	98.4	0.0e+00
WP_161987065.1|286220_288293_+	YtxH domain-containing protein	NA	A0A1S5SF30	Streptococcus_phage	81.4	2.2e-286
WP_002345007.1|288289_289291_+	lysozyme family protein	NA	A0A1S5SEZ8	Streptococcus_phage	95.5	1.3e-183
>prophage 4
NZ_AP022341	Enterococcus faecium strain KUHS13	2802719	296964	341305	2802719	transposase,tRNA	Streptococcus_phage(42.86%)	38	NA	NA
WP_001015311.1|296964_297645_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_002331203.1|298815_299094_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002336646.1|299112_299571_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002336645.1|299582_300203_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_002336644.1|300213_302256_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_001015311.1|302456_303137_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_002331205.1|303509_304655_+	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	33.4	1.2e-52
WP_002331206.1|304681_305173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002345001.1|305615_306815_+	MFS transporter	NA	NA	NA	NA	NA
WP_002331208.1|307309_308068_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002331209.1|308235_309171_+	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_002336649.1|309167_310613_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002336650.1|310640_311096_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002336651.1|311114_312089_+	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_002336652.1|312904_313519_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002331215.1|313759_314143_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002301781.1|314505_315015_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	34.8	2.8e-17
WP_002298023.1|315114_315765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002291914.1|316215_317154_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_002291912.1|317166_318219_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002289255.1|320996_321227_-	resolvase	NA	NA	NA	NA	NA
WP_002289253.1|322434_323124_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_002289252.1|323137_324640_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002301399.1|324664_325624_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_002300328.1|325717_326194_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002341883.1|326352_327312_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_000997695.1|327548_328727_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002300909.1|328805_329141_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_002300907.1|329426_331307_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	33.9	1.9e-98
WP_002300905.1|331385_331613_+	cation transporter	NA	NA	NA	NA	NA
WP_002300904.1|331617_332160_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_025477866.1|332410_333088_+	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_002300900.1|333408_334650_+	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_002294730.1|334796_335432_+	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_002300898.1|335622_336366_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_002300896.1|336599_337433_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_002300890.1|338795_339494_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_098381422.1|340179_341305_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	54.1	5.0e-75
>prophage 5
NZ_AP022341	Enterococcus faecium strain KUHS13	2802719	355255	429948	2802719	transposase,tRNA	Acanthocystis_turfacea_Chlorella_virus(16.67%)	60	NA	NA
WP_002293280.1|355255_356215_-|transposase	IS30-like element IS6770 family transposase	transposase	NA	NA	NA	NA
WP_002302155.1|356441_358277_+	tyrosine decarboxylase	NA	NA	NA	NA	NA
WP_002307870.1|358581_360060_+	amino acid permease	NA	NA	NA	NA	NA
WP_002298914.1|360025_361357_+	amino acid permease	NA	NA	NA	NA	NA
WP_002302152.1|361470_362781_+	HAD-IC family P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	28.2	8.6e-26
WP_002341875.1|362919_364092_+	HAD-IC family P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	47.0	7.9e-31
WP_002341874.1|364237_364966_+	TIM44-like domain-containing protein	NA	NA	NA	NA	NA
WP_002300729.1|365454_367548_+	BglG family transcription antiterminator	NA	NA	NA	NA	NA
WP_002287534.1|367572_367875_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002300730.1|367901_369191_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002298926.1|369638_370508_+	class II fructose-bisphosphate aldolase family protein	NA	NA	NA	NA	NA
WP_002294697.1|370509_371130_+	zeta toxin family protein	NA	NA	NA	NA	NA
WP_002294695.1|371579_372185_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_002294693.1|372319_372772_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002298929.1|373322_374033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161987066.1|374248_374596_+	glyoxalase	NA	NA	NA	NA	NA
WP_002294687.1|374615_374840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002301172.1|375084_376398_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	32.1	2.6e-46
WP_002294685.1|376847_378470_+	alpha-glucosidase	NA	NA	NA	NA	NA
WP_002301175.1|378663_380160_+	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	22.2	4.4e-26
WP_002351198.1|380209_381985_+	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_002317516.1|382042_383938_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002300024.1|383934_385392_+	glycoside hydrolase family 1 protein	NA	NA	NA	NA	NA
WP_002302440.1|385462_386764_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
WP_002294674.1|387476_387911_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002294672.1|388011_389103_+	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
WP_002294671.1|389132_389810_+	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_002301179.1|390145_391441_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002296783.1|391430_392891_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002294668.1|393026_394523_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_002294666.1|394536_396360_+	type 1 glycerol-3-phosphate oxidase	NA	NA	NA	NA	NA
WP_002292560.1|396360_397077_+	aquaporin family protein	NA	M1HVL5	Acanthocystis_turfacea_Chlorella_virus	36.9	1.6e-29
WP_002294659.1|397382_399311_+	mannonate oxidoreductase	NA	F2Y0V3	Organic_Lake_phycodnavirus	27.3	7.2e-21
WP_002294657.1|399436_399991_+	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_002321527.1|400475_400790_-	DsrE family protein	NA	NA	NA	NA	NA
WP_002294653.1|400803_401064_-	metal-sensitive transcriptional regulator	NA	NA	NA	NA	NA
WP_002294651.1|401233_401548_+	rhodanese-like domain-containing protein	NA	E4WM79	Ostreococcus_tauri_virus	39.1	3.4e-05
WP_002294648.1|401549_403205_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002296832.1|403287_405423_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_002344948.1|405597_405963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002325884.1|406028_406982_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002352435.1|407012_407174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002344949.1|407170_408475_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_002294641.1|408570_409440_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_002289297.1|409551_409872_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002305939.1|410041_411001_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002289295.1|411039_411486_+	PTS-dependent dihydroxyacetone kinase phosphotransferase subunit DhaM	NA	NA	NA	NA	NA
WP_002289294.1|411460_412471_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_002289293.1|412498_413104_+	dihydroxyacetone kinase subunit L	NA	NA	NA	NA	NA
WP_002297185.1|413198_414494_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002289292.1|414772_415438_+	G6PD family protein	NA	NA	NA	NA	NA
WP_002289290.1|415720_416380_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_002289289.1|416456_418067_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002289288.1|418079_418961_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.6	1.5e-21
WP_002296829.1|419879_421181_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_002286405.1|421760_423017_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A1L2CUL7	Pectobacterium_phage	42.5	9.0e-81
WP_002286400.1|423307_425185_+	tyrosine decarboxylase	NA	NA	NA	NA	NA
WP_161987067.1|425427_426858_+	amino acid permease	NA	NA	NA	NA	NA
WP_002286385.1|426958_428326_+	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
WP_126145177.1|428652_429948_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.7	2.9e-10
>prophage 6
NZ_AP022341	Enterococcus faecium strain KUHS13	2802719	772111	780583	2802719		Streptococcus_phage(66.67%)	9	NA	NA
WP_002294039.1|772111_772756_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	52.6	4.2e-58
WP_002292340.1|772770_773100_+	cyclic-di-AMP receptor	NA	NA	NA	NA	NA
WP_002288071.1|773113_774052_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	34.4	3.3e-35
WP_002288073.1|774087_774912_+	stage 0 sporulation family protein	NA	NA	NA	NA	NA
WP_002288076.1|774904_775252_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	41.1	5.1e-18
WP_002288078.1|775320_776193_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	60.4	3.1e-88
WP_002294035.1|776301_777423_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_002288081.1|777476_778079_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	58.6	1.7e-53
WP_002288083.1|778393_780583_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	66.6	1.8e-286
>prophage 7
NZ_AP022341	Enterococcus faecium strain KUHS13	2802719	836179	936886	2802719	tail,capsid,head,tRNA,integrase,holin,transposase,terminase,protease,portal	Enterococcus_phage(22.73%)	114	891760:891775	895111:895126
WP_002296621.1|836179_838978_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2H4UVG0	Bodo_saltans_virus	26.4	2.1e-74
WP_002286618.1|839026_840553_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	35.3	8.9e-75
WP_002286616.1|840567_841215_-	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_002286678.1|841398_841728_-	DUF4828 domain-containing protein	NA	NA	NA	NA	NA
WP_002286614.1|841904_842633_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_002286612.1|842648_843662_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_002286608.1|843661_844939_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	28.8	5.8e-35
WP_002286607.1|845001_847704_+	sigma-54-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_002286606.1|847855_848173_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002286604.1|848202_848523_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002286601.1|848630_850091_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002286598.1|850158_850380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286596.1|850410_850593_+	DUF3188 domain-containing protein	NA	NA	NA	NA	NA
WP_002286592.1|850592_851006_+	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
WP_002286589.1|851128_852310_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002286676.1|852380_852545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049143545.1|854276_854912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049143544.1|855024_855660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303013.1|855693_856155_-	SHOCT domain-containing protein	NA	A0A0F6N4L7	Staphylococcus_phage	34.8	4.5e-06
WP_002296613.1|856284_856716_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_002296612.1|856733_857054_-	helix-turn-helix transcriptional regulator	NA	A0A1S5SDR1	Streptococcus_phage	40.2	2.0e-13
WP_002290310.1|857352_858129_+	phage antirepressor KilAC domain-containing protein	NA	A0A1Q1PVU2	Staphylococcus_phage	53.8	1.1e-73
WP_002296611.1|858143_858347_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002286573.1|858362_858701_+	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_002296610.1|858687_858867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286568.1|858909_859380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286562.1|859466_860165_+	phage regulatory protein	NA	D2IYT0	Enterococcus_phage	34.6	1.7e-25
WP_002286559.1|860342_860684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286557.1|860676_861348_+	DUF1071 domain-containing protein	NA	A0A1B1P7F0	Bacillus_phage	47.4	4.2e-29
WP_002286553.1|861353_862040_+	hypothetical protein	NA	C9E2N1	Enterococcus_phage	69.1	3.2e-88
WP_002286552.1|862042_862792_+	helix-turn-helix domain-containing protein	NA	A0A1L2BY83	Clostridium_phage	54.0	1.7e-31
WP_002286696.1|862803_863073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296607.1|863077_863242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286695.1|863234_863537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296606.1|863533_863695_+	antitoxin	NA	NA	NA	NA	NA
WP_002286694.1|863691_863997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286550.1|863996_864353_+	DUF1140 family protein	NA	A0A2H4JAZ4	uncultured_Caudovirales_phage	37.4	3.1e-10
WP_002322165.1|864339_864558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286547.1|864554_864974_+	hypothetical protein	NA	D2IZL0	Enterococcus_phage	54.3	4.1e-30
WP_002286545.1|864970_865528_+	DUF1642 domain-containing protein	NA	A0A0C5KKV2	Enterococcus_phage	36.2	2.8e-10
WP_002286693.1|865524_865821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286542.1|865897_866311_+	autolysin	NA	C9E2P5	Enterococcus_phage	81.0	1.5e-56
WP_002296602.1|866619_866772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002300143.1|866768_867044_-	hypothetical protein	NA	A0A2H4JEH2	uncultured_Caudovirales_phage	45.7	9.9e-17
WP_002311723.1|867497_867704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296600.1|867899_868067_+	thymidylate synthase	NA	NA	NA	NA	NA
WP_002286540.1|868092_868437_+	HNH endonuclease	NA	A0A1B1P757	Bacillus_phage	57.1	3.8e-26
WP_002296599.1|868441_868723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286538.1|868825_869140_+|terminase	terminase	terminase	A0A1S7FYW6	Listeria_phage	37.9	3.3e-08
WP_002286533.1|869117_870812_+|terminase	terminase large subunit	terminase	A0A1B1P766	Bacillus_phage	49.6	3.0e-148
WP_002286530.1|870831_872010_+|portal	phage portal protein	portal	A0A1B1P754	Bacillus_phage	40.4	5.4e-80
WP_002286527.1|871972_872659_+|protease	Clp protease ClpP	protease	A0A2I6PDD0	Staphylococcus_phage	39.7	1.0e-30
WP_002286525.1|872658_873819_+|capsid	phage major capsid protein	capsid	A0A1B1P752	Bacillus_phage	50.1	1.8e-99
WP_002286524.1|873828_874704_+	hypothetical protein	NA	D2IYX3	Enterococcus_phage	74.2	5.6e-130
WP_002286523.1|874700_875012_+	hypothetical protein	NA	A0A1B1P751	Bacillus_phage	42.1	6.3e-12
WP_002286522.1|875001_875355_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_002296598.1|875344_875746_+	hypothetical protein	NA	A0A1B1P759	Bacillus_phage	33.3	1.1e-13
WP_002286516.1|875738_876143_+	hypothetical protein	NA	R4IBU7	Listeria_phage	29.5	6.1e-07
WP_002286512.1|876154_876763_+	hypothetical protein	NA	Q8W5Z9	Listeria_phage	41.1	3.0e-34
WP_002286510.1|876782_877145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286502.1|877346_880778_+|tail	phage tail tape measure protein	tail	A0A1D3SNL5	Enterococcus_phage	44.4	3.1e-67
WP_002286500.1|880828_881566_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_002296595.1|881575_883867_+|tail	phage tail protein	tail	A0A1D3SNL1	Enterococcus_phage	30.0	1.6e-88
WP_002286495.1|883890_886017_+	hypothetical protein	NA	A0A060AI60	Enterococcus_phage	40.1	1.4e-62
WP_002290627.1|886033_886183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286491.1|886179_886626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296594.1|886627_886765_+	XkdX family protein	NA	NA	NA	NA	NA
WP_002286686.1|886802_887096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286683.1|887092_887317_+|holin	phage holin	holin	NA	NA	NA	NA
WP_002286484.1|887313_888339_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A139ZVY1	Enterococcus_phage	61.3	2.1e-64
WP_087046766.1|889277_890439_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.2	4.1e-80
WP_002286474.1|891362_891770_+	hypothetical protein	NA	NA	NA	NA	NA
891760:891775	attL	AAAAAAATTAAGGAGA	NA	NA	NA	NA
WP_002296902.1|891783_892185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286473.1|892186_892558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286680.1|892593_892896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286470.1|893144_893345_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9AZR0	Lactococcus_phage	75.7	4.6e-08
WP_002286469.1|893649_894882_-	aminopeptidase	NA	NA	NA	NA	NA
WP_002286467.1|895135_895705_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
895111:895126	attR	AAAAAAATTAAGGAGA	NA	NA	NA	NA
WP_002286465.1|895882_896323_-	flavodoxin	NA	NA	NA	NA	NA
WP_002294533.1|896480_897245_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_002286461.1|897276_898200_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_002286457.1|898275_899415_+	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_002286455.1|899407_900208_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_002286453.1|900207_901035_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_002321540.1|901012_901747_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_002286449.1|901846_902713_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	62.5	3.7e-102
WP_002286442.1|902726_903299_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	49.2	8.3e-42
WP_002296544.1|903320_904349_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	43.2	2.2e-69
WP_002294531.1|904446_905298_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	39.0	1.3e-38
WP_002296543.1|905332_907366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296542.1|907409_908690_+	EpaQ family protein	NA	NA	NA	NA	NA
WP_002289081.1|908899_909706_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002296541.1|909717_910938_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.4	3.3e-11
WP_002296539.1|910927_912514_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_002317454.1|912552_914691_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_002297271.1|914758_915718_-|transposase	IS30-like element IS6770 family transposase	transposase	NA	NA	NA	NA
WP_044383074.1|916051_917443_+	sugar transferase	NA	NA	NA	NA	NA
WP_002315330.1|917480_918311_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_002315328.1|919383_920379_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_002335549.1|920382_921525_+	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_002335550.1|921521_922949_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_044383080.1|923589_924330_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	49.4	1.1e-59
WP_049143580.1|924319_925558_-|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	52.2	1.8e-110
WP_025479701.1|925644_925902_-|transposase	transposase	transposase	A0A1S5SBP9	Streptococcus_phage	38.6	3.5e-08
WP_002335552.1|926058_926472_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_002315323.1|926647_927058_-	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	40.7	4.1e-19
WP_002325481.1|927183_928575_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_002335553.1|928708_929653_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SKV4	Klosneuvirus	37.8	7.3e-51
WP_002285758.1|929878_930073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287659.1|930062_930416_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_002303202.1|930517_932065_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_000997695.1|932245_933424_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002335555.1|933659_935384_+	C40 family peptidase	NA	B5LJD6	Mycobacterium_phage	41.1	4.8e-16
WP_002296840.1|935698_936886_-|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
>prophage 8
NZ_AP022341	Enterococcus faecium strain KUHS13	2802719	1220167	1229323	2802719	transposase	Lysinibacillus_phage(16.67%)	9	NA	NA
WP_002297185.1|1220167_1221463_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002297115.1|1221737_1222115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288021.1|1222370_1223099_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	E3SPA9	Prochlorococcus_phage	41.4	4.6e-45
WP_002295474.1|1223098_1223353_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_002288017.1|1223354_1224026_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_002288015.1|1224026_1226249_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.3	1.9e-150
WP_002288013.1|1226233_1227673_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.1	5.3e-53
WP_002288011.1|1227695_1228748_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.7	2.7e-62
WP_002288010.1|1228744_1229323_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.4	1.3e-26
>prophage 9
NZ_AP022341	Enterococcus faecium strain KUHS13	2802719	1292014	1345273	2802719	transposase,tRNA	Lysinibacillus_phage(14.29%)	44	NA	NA
WP_002297218.1|1292014_1293310_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002296887.1|1293580_1297108_+	PD-(D/E)XK nuclease family protein	NA	NA	NA	NA	NA
WP_002296885.1|1297104_1300827_+	helicase-exonuclease AddAB subunit AddA	NA	S5MMD7	Bacillus_phage	23.3	2.7e-24
WP_002303789.1|1300895_1301237_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002295783.1|1301545_1302589_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	33.6	1.9e-31
WP_002296881.1|1302593_1305014_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_002288045.1|1306693_1307704_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_161987088.1|1307957_1308695_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	39.0	3.5e-32
WP_002288041.1|1308708_1309524_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002288038.1|1309536_1310184_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002296876.1|1310199_1310856_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002317207.1|1311017_1311839_+	glutamate racemase	NA	NA	NA	NA	NA
WP_002296875.1|1311841_1313197_+	ribonuclease PH	NA	A0A0P0A2M4	Ugandan_cassava_brown_streak_virus	30.8	9.2e-15
WP_002288030.1|1313197_1313716_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_002295789.1|1313822_1314323_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_002295791.1|1314602_1315523_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_002296282.1|1315687_1316701_+	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
WP_002295795.1|1316810_1317566_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_002295797.1|1317784_1318225_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_002296283.1|1318339_1319101_-	peptidylprolyl isomerase	NA	A0A1V0S9I2	Catovirus	38.0	6.7e-23
WP_002295800.1|1319289_1320384_+	DUF871 domain-containing protein	NA	NA	NA	NA	NA
WP_002303791.1|1320469_1321429_-|transposase	IS30-like element IS6770 family transposase	transposase	NA	NA	NA	NA
WP_002289735.1|1321614_1322550_+	alpha/beta hydrolase	NA	W5S4D8	Pithovirus	25.4	2.0e-05
WP_002289734.1|1322634_1323645_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_002303792.1|1323947_1325255_+	GTPase ObgE	NA	NA	NA	NA	NA
WP_002295807.1|1325475_1326063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002295809.1|1326239_1327181_+	ribonuclease Z	NA	NA	NA	NA	NA
WP_002296573.1|1327177_1327966_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002303793.1|1327966_1328410_+	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_002296571.1|1328551_1330849_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	33.9	1.3e-80
WP_002295813.1|1330862_1331375_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	43.6	2.4e-32
WP_002297436.1|1331663_1331882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002302440.1|1332170_1333472_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
WP_002296572.1|1333562_1334186_-	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	59.4	2.2e-16
WP_002295816.1|1334332_1334584_+	DUF896 family protein	NA	NA	NA	NA	NA
WP_002295818.1|1334686_1336684_+	transketolase	NA	NA	NA	NA	NA
WP_002326066.1|1336861_1337815_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002295743.1|1337955_1338864_-|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002295819.1|1339045_1339933_+	glucosaminidase domain-containing protein	NA	A0A0K2CP65	Brevibacillus_phage	43.2	4.5e-18
WP_002296093.1|1340072_1340999_+	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	57.2	2.7e-98
WP_002289542.1|1341234_1341681_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_002289543.1|1341953_1343306_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002296094.1|1343476_1343764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297218.1|1343977_1345273_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
>prophage 10
NZ_AP022341	Enterococcus faecium strain KUHS13	2802719	1487566	1544182	2802719	transposase	Trichoplusia_ni_ascovirus(22.22%)	59	NA	NA
WP_002297185.1|1487566_1488862_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_161987102.1|1490482_1492522_-	penicillin-binding transpeptidase domain-containing protein	NA	NA	NA	NA	NA
WP_002301977.1|1492579_1493335_-	LCP family protein	NA	NA	NA	NA	NA
WP_002295934.1|1493426_1494590_-	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_002287763.1|1495105_1495312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002287766.1|1495327_1495942_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_002300882.1|1496088_1496772_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_002297467.1|1496880_1497339_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_002324056.1|1497422_1499186_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_002324055.1|1499406_1500867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002324054.1|1501074_1502001_-	glutaminase A	NA	NA	NA	NA	NA
WP_002333570.1|1502023_1503451_-	amino acid permease	NA	NA	NA	NA	NA
WP_161987103.1|1503481_1504444_-	ammonium transporter	NA	NA	NA	NA	NA
WP_086968564.1|1504531_1505672_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	57.7	3.8e-78
WP_000202380.1|1506520_1507840_-|transposase	IS1380-like element IS1678 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	82.7	4.8e-210
WP_002290686.1|1509630_1509873_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_002295944.1|1509904_1510462_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002290682.1|1510474_1510663_-	DUF2273 domain-containing protein	NA	NA	NA	NA	NA
WP_002297459.1|1510675_1511242_-	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_000997695.1|1511642_1512821_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002291299.1|1512987_1513161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002295138.1|1513800_1514274_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_002295139.1|1514282_1514510_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002295142.1|1515145_1515517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002291278.1|1515772_1516015_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_002296679.1|1516046_1516949_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002291274.1|1516961_1517150_-	DUF2273 domain-containing protein	NA	NA	NA	NA	NA
WP_002296677.1|1517163_1517727_-	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_002296675.1|1517764_1518658_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	46.0	8.9e-59
WP_002303839.1|1518735_1519659_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_002296672.1|1519707_1520058_-	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_002296671.1|1520090_1520993_-	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_002296670.1|1520985_1521843_-	glycosyltransferase family 8 protein	NA	A0ZYL4	Archaeal_BJ1_virus	27.1	1.3e-19
WP_002296669.1|1522176_1522986_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002296667.1|1523025_1523523_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_002321681.1|1524167_1524491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296665.1|1524654_1524909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296663.1|1524978_1525224_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002296662.1|1525299_1525665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303842.1|1525725_1526289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002293303.1|1526856_1527057_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	77.3	3.9e-23
WP_002296658.1|1527452_1527602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296656.1|1527808_1528522_-	HAD family phosphatase	NA	A0A1D8KPI1	Synechococcus_phage	23.0	5.4e-06
WP_002296654.1|1528514_1529600_-	mannonate dehydratase	NA	NA	NA	NA	NA
WP_002296653.1|1529616_1530060_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002321678.1|1530093_1530447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296650.1|1530558_1530960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296648.1|1530996_1531506_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002296647.1|1531527_1532385_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_002289425.1|1534185_1535181_-	PTS glucitol/sorbitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_002289423.1|1535198_1535753_-	PTS glucitol/sorbitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_002289422.1|1535740_1536232_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002289421.1|1536224_1538093_-	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_002289420.1|1538111_1538912_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	26.2	2.6e-09
WP_002289418.1|1539135_1539351_+	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_002303864.1|1539489_1539975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289415.1|1540430_1540844_+	Hsp20/alpha crystallin family protein	NA	A0A1B2LRT2	Wolbachia_phage	31.5	2.1e-07
WP_000997695.1|1541894_1543073_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_000222572.1|1543228_1544182_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_AP022341	Enterococcus faecium strain KUHS13	2802719	1749383	1759199	2802719	tRNA	Streptococcus_phage(50.0%)	9	NA	NA
WP_002288576.1|1749383_1750637_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	55.3	7.7e-24
WP_002347404.1|1750707_1751193_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_002326253.1|1751215_1751974_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	36.9	6.5e-26
WP_002322842.1|1751989_1753168_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	48.9	5.1e-102
WP_002326254.1|1753397_1755518_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	58.3	6.3e-220
WP_002326255.1|1755740_1756466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288586.1|1756455_1756965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288588.1|1757034_1758483_-	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	29.3	1.7e-19
WP_002293942.1|1758482_1759199_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.7	1.0e-33
>prophage 12
NZ_AP022341	Enterococcus faecium strain KUHS13	2802719	1794560	1855384	2802719	integrase,transposase,tRNA	Streptococcus_phage(38.89%)	48	1779460:1779476	1842894:1842910
1779460:1779476	attL	AAAATCATCTGCATAAT	NA	NA	NA	NA
WP_002294833.1|1794560_1794827_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0P0I3D2	Lactobacillus_phage	58.7	2.8e-08
WP_002294835.1|1795002_1795572_-	prevent-host-death protein	NA	NA	NA	NA	NA
WP_049143547.1|1795645_1796935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304700.1|1797288_1798137_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_002374090.1|1798281_1799223_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_049143548.1|1801495_1803571_-	copper/silver-translocating P-type ATPase CopB	NA	A0A218MNH6	uncultured_virus	32.3	4.8e-71
WP_002312937.1|1803590_1805777_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	38.6	5.3e-121
WP_002289040.1|1805776_1805986_-	copper chaperone CopZ	NA	NA	NA	NA	NA
WP_002294855.1|1805998_1806439_-	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
WP_002304690.1|1806512_1807052_-	topology modulation protein	NA	A0A097BYE2	Leuconostoc_phage	34.5	3.8e-20
WP_002288779.1|1807666_1809133_-	amino acid permease	NA	NA	NA	NA	NA
WP_002304688.1|1809443_1811525_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	35.6	2.4e-115
WP_002288776.1|1812048_1812408_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_002326717.1|1812437_1812779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304684.1|1812775_1813450_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_002288767.1|1814502_1815801_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.3	1.2e-59
WP_002304682.1|1815840_1817031_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_002348809.1|1817051_1817579_-	DUF5590 domain-containg protein	NA	NA	NA	NA	NA
WP_002304681.1|1817625_1820415_-	DEAD/DEAH box helicase family protein	NA	A0A1X9I5C8	Streptococcus_phage	30.9	1.1e-89
WP_002288762.1|1820561_1820762_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	74.2	2.5e-22
WP_002323868.1|1821213_1821534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297185.1|1821811_1823107_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002288760.1|1823558_1824677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304680.1|1825147_1826455_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_002296623.1|1826559_1827855_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
WP_002340453.1|1828084_1829284_+	YdcF family protein	NA	NA	NA	NA	NA
WP_002289547.1|1829310_1830579_-	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	31.1	2.2e-42
WP_002289559.1|1831795_1832299_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_002318140.1|1832421_1833186_-	RNA methyltransferase	NA	A0A2D1A6G0	Rhodococcus_phage	26.1	1.7e-05
WP_002289551.1|1833292_1833568_+	acylphosphatase	NA	NA	NA	NA	NA
WP_010723400.1|1834283_1835234_+	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_010723402.1|1836874_1837096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002318149.1|1838539_1838734_-	hypothetical protein	NA	M1PSF2	Streptococcus_phage	74.0	5.0e-15
WP_002337646.1|1839640_1841188_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_161987109.1|1841259_1841640_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_002285758.1|1841629_1841824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305669.1|1842027_1842381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025477502.1|1842508_1843048_-	hypothetical protein	NA	NA	NA	NA	NA
1842894:1842910	attR	AAAATCATCTGCATAAT	NA	NA	NA	NA
WP_010723404.1|1843077_1843269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305667.1|1843310_1844177_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010723405.1|1844200_1845853_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	40.4	2.0e-104
WP_002318153.1|1845857_1846760_-	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_010723406.1|1846843_1848157_-	cupin domain-containing protein	NA	A0A1V0SH58	Hokovirus	26.9	1.5e-38
WP_002318154.1|1848224_1849169_-	GDP-L-fucose synthase	NA	A0A1D8KU05	Synechococcus_phage	53.4	1.5e-93
WP_002323224.1|1849205_1850219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305661.1|1850298_1851345_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	63.1	1.8e-122
WP_002288571.1|1851982_1853428_-|transposase	IS1182-like element ISEfa7 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	48.2	5.2e-125
WP_111996092.1|1854535_1855384_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_AP022341	Enterococcus faecium strain KUHS13	2802719	2033060	2038733	2802719	tail,capsid,terminase,head,portal	uncultured_Caudovirales_phage(50.0%)	7	NA	NA
WP_002296483.1|2033060_2033396_-|head	phage head closure protein	head	V5UQC7	Enterococcus_phage	35.6	4.7e-13
WP_002296484.1|2033382_2033667_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_002296485.1|2033722_2035246_-|capsid	phage major capsid protein	capsid	A0A1W6JPR8	Staphylococcus_phage	37.4	1.4e-48
WP_002296486.1|2035238_2036414_-|portal	phage portal protein	portal	A0A2H4J5A4	uncultured_Caudovirales_phage	35.6	3.2e-64
WP_002317249.1|2036417_2036603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296487.1|2036568_2038263_-|terminase	terminase large subunit	terminase	A0A2H4JBN3	uncultured_Caudovirales_phage	43.8	9.1e-129
WP_002296488.1|2038259_2038733_-|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
>prophage 14
NZ_AP022341	Enterococcus faecium strain KUHS13	2802719	2261400	2295893	2802719	transposase,bacteriocin,protease	uncultured_virus(16.67%)	30	NA	NA
WP_002296840.1|2261400_2262588_-|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_002288864.1|2262999_2264625_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	56.8	2.2e-156
WP_002288862.1|2264675_2264960_-	co-chaperone GroES	NA	A0A221S4M3	uncultured_virus	40.2	2.0e-12
WP_002288860.1|2265184_2265847_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002288858.1|2265922_2267215_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002288856.1|2267384_2268014_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_002288854.1|2268116_2268926_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	33.6	3.1e-34
WP_002288853.1|2268980_2269850_-	two-component system regulatory protein YycI	NA	NA	NA	NA	NA
WP_002288852.1|2269850_2271167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288851.1|2271163_2272999_-	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	37.7	4.0e-37
WP_002288850.1|2273003_2273708_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	41.6	5.8e-45
WP_002322652.1|2274743_2275313_-	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_002321654.1|2276887_2277034_-|bacteriocin	EntF family bacteriocin induction factor	bacteriocin	NA	NA	NA	NA
WP_161987145.1|2277137_2277449_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_002295743.1|2277430_2278339_-|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002304799.1|2278498_2278696_-	enterocin	NA	NA	NA	NA	NA
WP_002287807.1|2279089_2280817_-	ABC transporter permease/substrate binding protein	NA	NA	NA	NA	NA
WP_002287805.1|2280809_2282003_-	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.0	1.2e-29
WP_002287801.1|2282189_2282834_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002290587.1|2282927_2283062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002287799.1|2283063_2285196_-	ferrous iron transport protein B	NA	NA	NA	NA	NA
WP_002287797.1|2285192_2285666_-	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_002287795.1|2286066_2286291_+	glutaredoxin-like protein NrdH	NA	A0A0M7REK7	Lactobacillus_phage	42.7	1.7e-11
WP_002287793.1|2286449_2288609_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	63.2	3.8e-265
WP_002287792.1|2288658_2289624_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	70.4	3.4e-128
WP_002287791.1|2289712_2290852_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_002287788.1|2291160_2291874_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	43.7	6.5e-20
WP_002287787.1|2292127_2292829_-	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_002290558.1|2293062_2294595_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.0	3.3e-45
WP_002295743.1|2294984_2295893_-|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_AP022341	Enterococcus faecium strain KUHS13	2802719	2447031	2480329	2802719	holin,transposase,tRNA	Bacillus_phage(36.36%)	22	NA	NA
WP_002285932.1|2447031_2447211_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_104674935.1|2447404_2447575_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_161987137.1|2447998_2449027_-	collagen binding domain-containing protein	NA	NA	NA	NA	NA
WP_002285924.1|2449164_2452236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303189.1|2454141_2454903_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002344993.1|2455002_2456724_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.0	1.3e-37
WP_002304835.1|2456738_2458523_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.2	2.1e-46
WP_002285917.1|2458903_2460457_-	glycosyl hydrolase	NA	NA	NA	NA	NA
WP_002285916.1|2460804_2463219_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	72.8	0.0e+00
WP_002301403.1|2463645_2465664_-	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXE4	Bacillus_phage	39.6	5.8e-13
WP_002285911.1|2466033_2466690_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_002285909.1|2466689_2467646_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	57.4	3.3e-43
WP_002285906.1|2467645_2468212_+	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	42.8	2.2e-34
WP_002299614.1|2468647_2468878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025479400.1|2470353_2470656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303477.1|2472951_2473971_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1G5SA77	Enterococcus_phage	66.1	2.4e-60
WP_002301818.1|2473981_2474188_-|holin	phage holin	holin	NA	NA	NA	NA
WP_002301399.1|2474320_2475280_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_002304713.1|2475482_2476415_+	DUF4041 domain-containing protein	NA	M1NRY5	Streptococcus_phage	53.8	1.8e-57
WP_002341521.1|2476486_2476843_+	hypothetical protein	NA	U4KJ82	Streptococcus_phage	42.2	9.2e-15
WP_010729461.1|2476940_2478119_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_086953915.1|2478989_2480329_-|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
>prophage 16
NZ_AP022341	Enterococcus faecium strain KUHS13	2802719	2663697	2717297	2802719	integrase,transposase	Bacillus_phage(25.0%)	44	2669796:2669811	2684443:2684458
WP_094029191.1|2663697_2663865_-|transposase	transposase	transposase	A0A288TXV8	Enterococcus_phage	75.0	4.4e-12
WP_002303678.1|2666197_2666869_-	hypothetical protein	NA	A0A0C5K996	Enterococcus_phage	33.9	4.1e-08
WP_010727027.1|2667217_2668669_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A075BS18	Microcystis_phage	46.1	1.9e-18
2669796:2669811	attL	CTAGTATAAGTTTGTC	NA	NA	NA	NA
WP_002303671.1|2670256_2675959_-	YSIRK-type signal peptide-containing protein	NA	NA	NA	NA	NA
WP_002303670.1|2676575_2676881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303669.1|2677025_2678231_-	YSIRK-targeted surface antigen transcriptional regulator	NA	NA	NA	NA	NA
WP_002302419.1|2678924_2679311_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_002302418.1|2679408_2679600_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002305515.1|2680113_2680446_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002348988.1|2680741_2680897_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_033612055.1|2682753_2683161_-	NusG domain II-containing protein	NA	NA	NA	NA	NA
WP_161987062.1|2683349_2684138_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_002330794.1|2684485_2684704_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
2684443:2684458	attR	CTAGTATAAGTTTGTC	NA	NA	NA	NA
WP_106914383.1|2684724_2685360_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.1	1.2e-17
WP_002303663.1|2685552_2685792_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002303662.1|2685815_2687339_-	zinc ABC transporter substrate-binding protein AdcA	NA	NA	NA	NA	NA
WP_002302412.1|2687356_2687479_-	putative metal homeostasis protein	NA	NA	NA	NA	NA
WP_002303661.1|2687508_2688492_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_002297320.1|2688515_2688665_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_002297319.1|2688685_2689063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297318.1|2689094_2689274_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_002297316.1|2689288_2689558_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_002349036.1|2690080_2691847_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	4.5e-30
WP_049219897.1|2691806_2693561_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.8	5.7e-25
WP_161987143.1|2693663_2694239_-	MptD family putative ECF transporter S component	NA	NA	NA	NA	NA
WP_002303655.1|2694256_2695672_-	energy-coupling factor ABC transporter ATP-binding protein	NA	A0A1V0SGN0	Hokovirus	26.4	5.8e-20
WP_002297304.1|2695682_2696351_-	cobalt transporter	NA	NA	NA	NA	NA
WP_071875988.1|2696481_2697066_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_073120143.1|2697643_2698591_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002297294.1|2698590_2699433_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_002297293.1|2699891_2701079_+|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	28.7	4.6e-26
WP_002297292.1|2701170_2701911_-	metal ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	33.2	5.7e-19
WP_002302388.1|2702371_2702686_-	PTS cellobiose transporter subunit IIC	NA	NA	NA	NA	NA
WP_161987144.1|2702701_2704297_-	solute:sodium symporter family transporter	NA	NA	NA	NA	NA
WP_002302386.1|2704319_2705210_-	myo-inosose-2 dehydratase	NA	NA	NA	NA	NA
WP_002302385.1|2705226_2706252_-	inositol 2-dehydrogenase	NA	NA	NA	NA	NA
WP_002302384.1|2706275_2707283_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_002330790.1|2707395_2708556_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_002302381.1|2708631_2710086_-	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_002297404.1|2710494_2711745_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002305507.1|2711932_2712757_-	5-deoxy-glucuronate isomerase	NA	NA	NA	NA	NA
WP_002305506.1|2712795_2714712_-	3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing)	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	24.4	6.2e-25
WP_002305505.1|2714722_2715757_-	5-dehydro-2-deoxygluconokinase	NA	NA	NA	NA	NA
WP_126145177.1|2716001_2717297_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.7	2.9e-10
>prophage 1
NZ_AP022343	Enterococcus faecium strain KUHS13 plasmid pELF2	108102	4955	45078	108102	transposase,protease	Streptococcus_phage(37.5%)	39	NA	NA
WP_010729835.1|4955_5222_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5S8E8	Streptococcus_phage	48.8	8.6e-18
WP_152630965.1|5334_5910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001015311.1|5937_6618_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_001226076.1|6844_7420_+	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	34.8	9.0e-20
WP_002323245.1|7641_8814_-|transposase	IS256-like element IS1542 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	88.8	1.3e-121
WP_001280781.1|8965_9661_+	VanA-type vancomycin resistance DNA-binding response regulator VanR	NA	W8CYM9	Bacillus_phage	37.7	4.9e-36
WP_002305818.1|9638_10793_+	VanA-type vancomycin resistance histidine kinase VanS	NA	W8CYF6	Bacillus_phage	23.3	1.5e-13
WP_001059542.1|11007_11976_+	D-lactate dehydrogenase VanH-A	NA	M1HUW8	Acanthocystis_turfacea_Chlorella_virus	33.1	3.5e-40
WP_001079845.1|11968_13000_+	D-alanine--(R)-lactate ligase VanA	NA	NA	NA	NA	NA
WP_000402347.1|13005_13614_+	D-Ala-D-Ala dipeptidase VanX-A	NA	NA	NA	NA	NA
WP_001812592.1|14032_14944_+	D-Ala-D-Ala carboxypeptidase VanY-A	NA	NA	NA	NA	NA
WP_060475447.1|15300_15975_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.0	1.6e-116
WP_002297218.1|16000_17296_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	29.1	1.0e-42
WP_002347537.1|17735_17918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347536.1|18022_18307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347535.1|18322_18559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347534.1|18580_18835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002320785.1|18916_19102_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0A7RWW9	Clostridium_phage	40.4	7.6e-05
WP_002320784.1|19168_19564_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0C5AN56	Paenibacillus_phage	39.7	4.1e-16
WP_002350538.1|19553_19931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347532.1|19952_20327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002320781.1|22525_22924_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_010729833.1|23114_23882_-	replication initiation protein	NA	NA	NA	NA	NA
WP_025480441.1|23916_25140_-	RepB family plasmid replication initiator protein	NA	NA	NA	NA	NA
WP_002323589.1|26246_27395_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	93.7	9.0e-205
WP_002287522.1|27411_27816_-|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
WP_002320777.1|28013_28817_+	replication initiation protein	NA	NA	NA	NA	NA
WP_002320776.1|29400_29856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002321771.1|29974_31033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010730985.1|31074_33024_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A2I7REQ1	Vibrio_phage	24.7	2.9e-30
WP_002347432.1|33026_36668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347431.1|37067_37406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033624104.1|37515_37737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347429.1|37756_39913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002320768.1|39924_40158_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_002320767.1|40147_41014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002320766.1|41028_42999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287522.1|43508_43913_+|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
WP_002323589.1|43929_45078_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	93.7	9.0e-205
>prophage 1
NZ_AP022342	Enterococcus faecium strain KUHS13 plasmid pKO1, complete sequence	253148	3207	139487	253148	integrase,holin,bacteriocin,transposase	Streptococcus_phage(25.0%)	117	86776:86835	147784:147934
WP_002287522.1|3207_3612_+|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
WP_002330559.1|3628_4777_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	91.0	1.0e-200
WP_063526637.1|6949_7189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010727931.1|7255_7495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305218.1|7621_8311_+	sortase	NA	NA	NA	NA	NA
WP_161987146.1|8316_9483_+	EpaQ family protein	NA	NA	NA	NA	NA
WP_161987147.1|9564_10236_+	sortase	NA	NA	NA	NA	NA
WP_161987148.1|10288_12265_+	isopeptide-forming domain-containing fimbrial protein	NA	NA	NA	NA	NA
WP_002302871.1|12277_13030_+	class C sortase	NA	NA	NA	NA	NA
WP_002351354.1|13045_13807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002293489.1|13819_14080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002319825.1|14076_16167_+	isopeptide-forming domain-containing fimbrial protein	NA	NA	NA	NA	NA
WP_002300034.1|16202_18260_-	FIVAR domain-containing protein	NA	NA	NA	NA	NA
WP_002300033.1|18404_18596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002300032.1|18783_19239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305782.1|19235_19478_+	DUF5415 family protein	NA	NA	NA	NA	NA
WP_002296358.1|19495_19798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161987149.1|19869_21924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005874920.1|21923_24536_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_161987150.1|24532_27058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002295656.1|27107_27440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296362.1|27440_28034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002307536.1|28196_30221_+	ATPase	NA	NA	NA	NA	NA
WP_023043274.1|30220_31426_+	glucosaminidase domain-containing protein	NA	Q6SEC2	Lactobacillus_prophage	42.4	1.9e-32
WP_002390087.1|31441_32086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002343431.1|32096_32903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002304981.1|32925_33156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161987161.1|33419_33989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002325546.1|34847_35123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002330592.1|35164_35587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002330591.1|35605_37198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002330590.1|37209_37545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002330589.1|37691_37886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161987151.1|37917_40290_+	hypothetical protein	NA	B5SP25	Lactococcus_phage	29.1	4.9e-11
WP_002313123.1|40350_41820_+	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_161987152.1|41830_43804_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	52.6	1.5e-111
WP_002295632.1|43919_44069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002299811.1|44149_44746_+	type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein	NA	NA	NA	NA	NA
WP_002301800.1|44758_45658_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_002301801.1|45660_45792_+	single-stranded DNA-binding protein	NA	A8ATZ7	Listeria_phage	83.3	1.3e-11
WP_002305808.1|45813_46146_+	single-stranded DNA-binding protein	NA	W6LM61	Streptococcus_phage	53.2	6.1e-21
WP_002295625.1|46167_46425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002295624.1|46583_46706_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_002305809.1|46895_47120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305810.1|47562_47769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002300797.1|47768_48020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002300799.1|48035_48191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002300801.1|48200_48473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002300804.1|48917_49097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002311569.1|49155_49512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002300807.1|50487_50751_+|bacteriocin	circular bacteriocin, circularin A/uberolysin family	bacteriocin	NA	NA	NA	NA
WP_000997695.1|51122_52301_+|transposase	IS256-like element ISEf1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	25.6	3.0e-30
WP_002300833.1|52689_54636_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002300835.1|54638_55094_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002300836.1|55107_56436_+	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_002300838.1|56469_56754_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002300840.1|56755_57271_+	YjbQ family protein	NA	NA	NA	NA	NA
WP_002300841.1|57286_57949_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_002300842.1|57955_58528_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002300843.1|58714_60235_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	31.6	1.1e-48
WP_002305884.1|60477_60663_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_161987153.1|60646_60829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002301839.1|61782_62382_+|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	36.1	1.3e-29
WP_002322465.1|62445_63045_+	bacteriophage abortive infection AbiH family protein	NA	NA	NA	NA	NA
WP_002292418.1|64060_64933_-	ROK family protein	NA	NA	NA	NA	NA
WP_002293868.1|65196_67143_-	PTS beta-glucoside transporter subunit IIBCA	NA	NA	NA	NA	NA
WP_002302078.1|67327_68767_+	sucrose-6-phosphate hydrolase	NA	S6ATV4	Bacillus_phage	25.1	1.4e-16
WP_002302077.1|68768_69731_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	25.8	2.3e-20
WP_161987154.1|69900_71327_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.8	2.5e-47
WP_002301718.1|71569_72025_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.6	1.3e-13
WP_002300328.1|77328_77805_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_158514236.1|77900_78077_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_002287870.1|80579_81098_+	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_002296623.1|82505_83801_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
WP_002301591.1|84684_85770_+	tyrosine recombinase XerS	NA	NA	NA	NA	NA
86776:86835	attL	GAAAATATGCTTCTATCATTACAAGCTCGTTTGGTGTAAGATGGGTATAAGTCATTTATG	NA	NA	NA	NA
WP_002301126.1|86960_88211_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002298736.1|88229_89156_-	PEP phosphonomutase	NA	NA	NA	NA	NA
WP_002301128.1|89234_90230_-	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_002301130.1|90245_91415_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002301131.1|91430_92165_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002301811.1|94668_95961_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	41.0	6.1e-32
WP_000997695.1|96744_97923_+|transposase	IS256-like element ISEf1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	25.6	3.0e-30
WP_025481469.1|98274_98571_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0C5AEB1	Paenibacillus_phage	59.2	5.1e-19
WP_002287876.1|99575_99971_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_002287874.1|100841_101669_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
WP_002349114.1|101680_102541_-	Rossmann-like and DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_002300493.1|102778_103948_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_002285815.1|105584_106238_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.2	4.0e-24
WP_002348630.1|107366_108083_-	aminotransferase class V-fold PLP-dependent enzyme	NA	Q2XUY6	environmental_halophage	50.0	4.5e-45
WP_002302256.1|108132_108342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002302261.1|109998_111030_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.6	1.8e-26
WP_002313180.1|111036_111867_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002330693.1|111863_112679_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002302267.1|112675_113500_-	alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_002302268.1|113489_114590_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_002302270.1|114767_115553_+	histidinol phosphate phosphatase	NA	NA	NA	NA	NA
WP_002330694.1|115585_115969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077828694.1|116044_116176_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_002322470.1|116144_116381_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_002302275.1|116458_117430_-	radical SAM protein	NA	NA	NA	NA	NA
WP_002340465.1|118081_119704_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	47.5	2.7e-122
WP_002297218.1|120065_121361_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	29.1	1.0e-42
WP_002301195.1|121511_122888_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002298083.1|122887_123544_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	1.3e-22
WP_102829665.1|125079_126241_+|transposase	IS3-like element ISEfa8 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.2	1.8e-80
WP_002330699.1|126271_126721_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_002298088.1|126876_127419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102829664.1|127646_128808_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.2	9.2e-80
WP_002295743.1|129967_130875_-|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002301108.1|131550_132105_-|integrase	tyrosine-type recombinase/integrase	integrase	W8CYP1	Bacillus_phage	46.1	8.6e-36
WP_161987155.1|133430_134048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002311006.1|135111_135333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008271463.1|135430_135676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002344895.1|136899_137901_-	DUF4062 domain-containing protein	NA	NA	NA	NA	NA
WP_002344896.1|138059_138326_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002344897.1|138315_138672_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_161987156.1|138806_139487_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	5.8e-127
147784:147934	attR	GAAAATATGCTTCTATCATTACAAGCTCGTTTGGTGTAAGATGGGTATAAGTCATTTATGTTCACTCTCCTTGTATGCTTTAGCGGGTATTACAATTTGAGTGTAACATAAATGGCTTTTTTATTTGTCTCGCTTAATTATACAAACGGCG	NA	NA	NA	NA
>prophage 2
NZ_AP022342	Enterococcus faecium strain KUHS13 plasmid pKO1, complete sequence	253148	146532	197711	253148	integrase,transposase	Streptococcus_phage(70.97%)	55	176712:176737	208744:208769
WP_000222577.1|146532_147492_+|transposase	IS30-like element IS1252 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.1	2.4e-33
WP_002324480.1|147536_147779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161987158.1|147903_148599_-	response regulator	NA	W8CYM9	Bacillus_phage	32.4	9.2e-27
WP_002350432.1|149054_150041_-	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_002350433.1|150053_150980_-	tagatose-6-phosphate kinase	NA	NA	NA	NA	NA
WP_010731482.1|150992_151508_-	galactose-6-phosphate isomerase subunit LacB	NA	A0A222YX14	Synechococcus_phage	29.0	9.5e-05
WP_049142584.1|151526_151955_-	galactose-6-phosphate isomerase subunit LacA	NA	NA	NA	NA	NA
WP_001015311.1|152279_152960_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_000301765.1|153083_153356_-	antitoxin	NA	A0A1X9I6E5	Streptococcus_phage	100.0	5.0e-05
WP_000527317.1|153372_153582_-	peptide-binding protein	NA	A0A1X9I6D5	Streptococcus_phage	100.0	6.3e-32
WP_174236401.1|153686_154583_-	ParA family protein	NA	A0A1X9I765	Streptococcus_phage	99.6	1.1e-154
WP_073459356.1|154685_154970_-	topoisomerase DNA-binding C4 zinc finger domain-containing protein	NA	A0A1X9I6W8	Streptococcus_phage	93.0	2.3e-40
WP_002321849.1|155115_155853_-	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(B)	NA	E4ZFQ0	Streptococcus_phage	100.0	3.7e-135
WP_045135950.1|155977_156073_-	23S rRNA methyltransferase attenuation leader peptide	NA	NA	NA	NA	NA
WP_000635249.1|156121_156361_-	peptide-binding protein	NA	A0A1X9I6D5	Streptococcus_phage	81.5	6.8e-22
WP_010726733.1|156494_157982_-	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	98.8	1.7e-272
WP_002338419.1|158172_159492_-|transposase	IS1380-like element ISSsu5 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	100.0	1.3e-252
WP_002294507.1|159719_160247_-	adenine phosphoribosyltransferase	NA	A0A1X9I6E2	Streptococcus_phage	100.0	1.9e-93
WP_002294505.1|160290_161154_-	aminoglycoside nucleotidyltransferase ANT(6)-Ia	NA	A0A1X9I6F2	Streptococcus_phage	100.0	8.7e-168
WP_000662263.1|161186_161921_-	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	100.0	1.5e-141
WP_000233000.1|161901_162771_-	nucleotidyltransferase domain-containing protein	NA	A0A1X9I6C9	Streptococcus_phage	90.7	6.7e-152
WP_000205227.1|162785_163010_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_161987159.1|164711_167699_-|transposase	Tn3 family transposase	transposase	A0A125RQ78	Bacillus_phage	38.3	5.6e-206
WP_002321606.1|167823_168429_+	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	33.2	1.2e-19
WP_000824191.1|168473_168641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000366408.1|168674_168974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001224538.1|169014_169632_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	33.1	5.1e-13
WP_002304891.1|169956_170352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000344083.1|170430_172782_-	DUF1906 domain-containing protein	NA	NA	NA	NA	NA
WP_000718009.1|172906_173596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000751236.1|173609_174062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002325565.1|174192_174873_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	1.3e-126
WP_002332580.1|174994_175612_-	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	36.1	4.5e-17
WP_002415115.1|175625_175796_-	hypothetical protein	NA	NA	NA	NA	NA
176712:176737	attL	TTTGGTTCTGTTGCAAAGTTTTAAAT	NA	NA	NA	NA
WP_001015311.1|176788_177469_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_044383156.1|178319_179000_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	83.6	3.2e-109
WP_002292681.1|179629_180178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002292680.1|180178_181036_-	ParA family protein	NA	F0PIG8	Enterococcus_phage	30.7	8.1e-33
WP_002300557.1|181321_181609_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002292678.1|181598_181928_-	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_002322961.1|182939_183107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002298077.1|183139_184540_-	putative basic amino acid antiporter YfcC	NA	NA	NA	NA	NA
WP_002288620.1|186318_187560_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_002288618.1|187595_188306_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002288615.1|188373_189189_-	fructoselysine 6-kinase	NA	NA	NA	NA	NA
WP_002336724.1|189199_190168_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_001291561.1|191031_192249_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5SEW7	Streptococcus_phage	100.0	3.7e-233
WP_000814511.1|192330_192534_-	excisionase	NA	A0A1S5SF07	Streptococcus_phage	100.0	4.0e-31
WP_000857133.1|192994_193225_-	helix-turn-helix domain-containing protein	NA	A0A1S5SEX1	Streptococcus_phage	100.0	2.7e-36
WP_000804885.1|193221_193644_-	sigma-70 family RNA polymerase sigma factor	NA	A0A1S5SEW0	Streptococcus_phage	100.0	2.5e-72
WP_001227347.1|194148_194502_+	helix-turn-helix domain-containing protein	NA	A0A1S5SFA6	Streptococcus_phage	100.0	1.3e-58
WP_002389879.1|196052_196322_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5SCV8	Streptococcus_phage	48.8	8.7e-18
WP_014748823.1|196311_196578_-	antitoxin	NA	NA	NA	NA	NA
WP_077974475.1|196646_196874_-	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_010729807.1|197078_197711_-	HAD family phosphatase	NA	A0A1D8KNV9	Synechococcus_phage	27.9	3.0e-08
208744:208769	attR	ATTTAAAACTTTGCAACAGAACCAAA	NA	NA	NA	NA
